10,000 Matching Annotations
  1. May 2026
    1. On 2024-05-08 16:54:50, user Jorge Soberon wrote:

      Many people have used ellipsoids (Mahalanobis distance) for niche modelling in the past. I think you need to consult, at least:

      Farber, O. and Kadmon, R., 2003. Assessment of alternative approaches for bioclimatic modeling with special emphasis on the Mahalanobis distance. Ecological modelling, 160(1-2), pp.115-130.

      Jiménez, L., Soberón, J., Christen, J.A. and Soto, D., 2019. On the problem of modeling a fundamental niche from occurrence data. Ecological Modelling, 397, pp.74-83.

      Drake, J.M., 2015. Range bagging: a new method for ecological niche modelling from presence-only data. Journal of the Royal Society Interface, 12(107), p.20150086.

      Hirzel, A.H., Hausser, J., Chessel, D. and Perrin, N., 2002. Ecological‐niche factor analysis: how to compute habitat‐suitability maps without absence data?. Ecology, 83(7), pp.2027-2036.

    1. On 2024-05-08 12:59:32, user Yuri Pavlov wrote:

      "The artifacts of the dataset were removed by the authors while publishing the dataset" statement is false. The data you downloaded are raw EEG data (as stated in the dataset description. All analyses are therefore performed on data containing a lot of eye movement and muscle artifacts making your classification algorithm useless.

    1. On 2024-05-07 17:37:12, user Julian C wrote:

      (From the author) To appear as a book chapter in: Ruiz Romero C, Calamia V and Lourido L (Eds), Protein Arrays: Methods and Applications, Electronic ISSN 1940-6029, Print ISSN 1064-3745, Springer Nature.

    1. On 2024-05-06 08:20:36, user Liheng Luo wrote:

      Your work, CRISPR-GPT is groundbreaking, bridging the gap between complex gene-editing technology and researchers from various fields. The potential for accelerating biological discovery is immense, and I’m excited to see its impact on future research. <br /> I am eager to see this technology in action and would greatly appreciate the opportunity to explore a demo of the author’s website. Such hands-on experience would provide invaluable insight into the practical applications of CRISPR-GPT.

    1. On 2024-05-06 08:02:44, user Daniel Guzman Llorens wrote:

      Congratulations to the team, it is a great article. I found the results very insightful.<br /> While reading, I seem to have found an error in the insulin intensity histogram in Figure 3, as both A and C seem to be the same histogram.

    1. On 2024-05-04 01:52:43, user priyanka.bajaj3193@gmail.com wrote:

      In this study the authors comprehensively examined the mutational effects on PLpro proteolytic activity and stability. The authors have designed a FRET-based assay composed of N-terminal mClover3 donor and C-terminal m-Ruby3 acceptor fluorophores separated by a linker containing the Nsp2/3 PLpro cleavage motif to measure the proteolytic activity of PLpro. From DMS data the authors infer PLpro active site mutations ablates activity. Their study also revealed residues required for cleavage of the Nsp2/3 site, identified features of substrate binding pocket and the sequence requirements of the blocking loop. The authors have given explanations for their observations in the Discussion section. Overall, the paper is supported with follow-up enzymology and crystallography experiments of key residues. The major limitation of this study is leaky expression of mutations can mask clinically relevant mutations that can arise due to viral evolution and might have the potential to evade inhibitor treatment. Study of such mutations can provide more information about the potential escape routes open to the virus to evade developing therapeutics. Moreover, incorporation of statistical analysis could strengthen the confidence in inferences drawn from the deep sequencing data and improve the quality of the manuscript. <br /> The following points can improve the quality of the manuscript:<br /> Major points<br /> 1. In Figure 1f, it is unclear that why is the PLpro activity increasing with increase in inhibitor concentration? Perhaps the Y axis is mislabeled as while inhibitor concentration is increasing, PLpro activity should decrease. However, FRET signal would increase (and maybe should be the axis label), since there will be no cleavage. <br /> 2. Line 175 – 178 - What does 0 represent in the normalized dataset? What is the rationale used for selecting minimum 10 reads in the unselected library as the read cut-off. 10 reads is pretty low cut-off. From the data, it seems the distribution tails off before cut-off chosen for the s.d.- by eye. 0.3 s.d and 20 as read cut-off might be a better option to eliminate sequencing artifacts.<br /> 3. Line 187-190 – What is the number of reads for the mutants that showed lower activity scores? There is a possibility that due to low read cutoff, these mutants might be lying in the range with low reads in the unselected library.<br /> 4. Line 223-224 – Authors mention they find a good correlation between activity and abundance score. Although this is noticeable from the scatter plot but supporting high-throughput data with statistical parameters like pearson correlation coefficient, a metric that provides comparison between 2 datasets will make this data reporting more quantitative and informative.<br /> 5. Line 1340- Figure 3b- What do authors mean by variants with small enough error? Please be precise.<br /> 6. Line 315-319/ Line 1550-1556- Extended data Fig 15c – It is difficult to interpret the inference reported that is based on the data in Extended Fig 15. There is no data reported for Normalized AMC cleavage for Y268W. Interpretation can be more comprehensible by plotting a scatter plot between the Normalized Activity Fitness Scores obtained from DMS data and Normalized AMC cleavage (%). Through this plot, the reader can easily make out the outlier.<br /> 7. Line 364-367 – Authors mention “M208W strikingly increases the protein melting temperature by over 5C, indicating a substantial improvement in thermal stability. Increased stability, and thus reduced turnover in cells, may provide a mechanism to explain leaky expression in our cellular assay and increased yield of recombinant protein for E.coli expression.” Since, leaky expression is a different issue, it is confusing why will leaky expression be a plausible reason for increased stability but less activity? <br /> 8. Since Extended data Fig 11a shows that variants display substantial amount of leaky expression, how have the authors taken this information into account while inferring results from DMS activity scores, especially since they are quantifying at the RNA level and not at the DNA level? Can the activity scores obtained for the mutants be normalized to leaky expression scores in some way, for example by subtracting the scores obtained from the leaky expression dataset in order to measure the true activity of each mutant?<br /> 9. Solvents are known to affect an enzyme’s activity, selectivity and stability. In Figure 5, authors should consider and comment about the role of solvent in understanding the mechanism of Michelis-Menten kinetics of M208 variants using substrates Z-RLRGG-AMC, Ubiquitin-Rhodamine and ISG15-Rhodamine.<br /> Minor points<br /> 1. Figure numbers need to be reformatted. Figure 3 onwards they are incorrectly labelled. For eg. ‘Fig 3’ is labelled as ‘Fig 1’.<br /> 2. Line 426-429 – In Figure 3b, L and R domains of papain should be labelled or highlighted in separate colors for the ease of understanding for the reader.<br /> 3. Overall, different DMS datasets obtained from different assays in the paper have different read cut-offs such as 10, 13 and 18. A consistent statistical logic for obtaining different read cut-offs across different DMS datasets will be helpful. Also, increasing the read cut-off might improve the data quality and minimize sequencing artefacts.

      • Reviewed by Priyanka Bajaj and James Fraser (UCSF)
    1. On 2024-05-03 10:36:51, user Samvid Kurlekar wrote:

      Really great and useful work and an astounding tour de force - enjoyed reading it!<br /> I was wondering if the authors might please comment on whether the iPT cells expressed significantly higher levels of lncRNAs such as Neat1 or Malat1 when compared to 'normal' PT cells. We have seen these Neat1/Malat1-rich PT cells in our own scRNA-seq dataset (from mice) but were unable to detect HAVCR1 or VCAMI. However, genes associated with VCAM1-positivity were detected and these PT cells (which we called PT Class A) were present in Control kidneys and were seen in situ by RNAScope too. <br /> I would be quite interested to know if the iPT-VCAM1+ population you have comprehensively described matches the PT Class A cells we saw.

    1. On 2024-05-02 21:22:33, user Alex Crits-Christoph wrote:

      Nanomotif looks like a fine tool, especially for metagenomics, and I have no doubt it will push the prokaryotic methylation nanopore field further!

      I was curious if you would be able to benchmark it more, as the benchmark presented in Fig 1C is quite limited in scope, and could be expanded. We have shared R10.4.1 data for a variety of microbes that you might be interested in benchmarking on, include some with paired PacBio data in REBASE (which is not ground truth, but a good comparision):

      aws s3 cp --recursive s3://cultivarium-sequencing/MICROBEMOD-DATA-NOV2023/mapped_bams/ . aws s3 cp --recursive s3://cultivarium-sequencing/MICROBEMOD-DATA-NOV2023/reference_genomes/ . aws s3 cp --recursive s3://cultivarium-sequencing/MICROBEMOD-DATA-NOV2023/pod5/ .

      It is also worth noting that the comparison to MicrobeMod is a bit limited due to the reason that you note here: "The low motif recall of MicrobeMod, at high coverage and high motif occurrence settings, primarily stems from identification of similar motifs that are not identical to the benchmarking motif, e.g. SNGAm6TC instead of GAm6T".

      Despite this, overall my sense is very that nanomotif's motif calling will be likely superior in many circumstances to STREME in the context of prokaryotic methylation. Probably the best way to evaluate methylation motifs would be with some manual inspection after running multiple tools (and parameters).

    1. On 2024-05-01 23:26:21, user Guei-Sheung Liu wrote:

      The article has published in Hum Gene Ther.<br /> Utility of Self-Destructing CRISPR/Cas Constructs for Targeted Gene Editing in the Retina.<br /> Li F, Hung SSC, Mohd Khalid MKN, Wang JH, Chrysostomou V, Wong VHY, Singh V, Wing K, Tu L, Bender JA, Pébay A, King AE, Cook AL, Wong RCB, Bui BV, Hewitt AW, Liu GS.<br /> Hum Gene Ther. 2019 Nov;30(11):1349-1360. doi: 10.1089/hum.2019.021. Epub 2019 Oct 25. PMID: 31373227

    1. On 2024-05-01 23:23:51, user Guei-Sheung Liu wrote:

      The article has now publshed in Nucleic Acid Ther.<br /> An Integrative Multi-Omics Analysis Reveals MicroRNA-143 as a Potential Therapeutic to Attenuate Retinal Angiogenesis.<br /> Wang JH, Chuang YF, Chen J, Singh V, Lin FL, Wilson R, Tu L, Ma C, Wong RCB, Wang PY, Zhong J, Hewitt AW, van Wijngaarden P, Dusting GJ, Liu GS.<br /> Nucleic Acid Ther. 2022 Aug;32(4):251-266. doi: 10.1089/nat.2021.0111. Epub 2022 Mar 31. PMID: 35363088

    1. On 2024-05-01 23:21:11, user Guei-Sheung Liu wrote:

      The article has now published in Pharmacol Res. 2023 Jan:187:106617. doi: 10.1016/j.phrs.2022.106617. Epub 2022 Dec 16.

    1. On 2024-05-01 17:47:25, user Kevan Shokat wrote:

      Fantastic study of the clamping effects of Rocaglamide analogs across the helicase family. I particularly like the different effects of nucleotide and that ATP rather than AMP-PNP can stabilize different helicases as shown in Figure 5F. I wonder if mixtures of ATP and smaller concentrations of AMP-PNP could let helicases work (ATP) and then trap (AMP-PNP). Great study of so many dimensions of this assay! Congratulations!

    1. On 2024-05-01 16:53:49, user Timothy Tomkins wrote:

      This manuscript explores the mechanisms involved with decreased immunity due to aging. It does this by looking at the microbiome found within mice at different ages, then looking at increased inflammation utilizing immunoassays. The results show increased innate immunity and inflammatory signals, showing that an older mice’s microbiome acts differently on the TLR signaling system. The manuscript excels on the immunological side; however, the microbiome side of the study lacks quality control and explanation. I would recommend contacting a microbiome expert to get more insight into the field, as there is much missing from this report.

      This review focuses on the microbiome side of the report, which has quite a few problems to work on.

      1. Polymerase Chain Reaction (PCR) details are missing, such as the primers used, the polymerase used, and the procedure used, such as the temperature, timing, number of cycles. The PCR is not repeatable based on what is said in the methods. Refer to the paper ‘The Impact of DNA Polymerase and Number of Rounds of Amplification in PCR on 16S rRNA Gene Sequence Data’ at DIO: https:// doi.org/10.1128/mSphere.001....

      2. When sequencing the PCR data, the number of reads per sample is not stated. This is important to know if the coverage of the communities is measured. The authors also do not include the observed number of taxa to compare to the Chao1 numbers to determine coverage. This is shown in Figure 1B, where the chao1 number is very low. The taxa used for this graph is not stated, leaving the reader confused if it is the number of genera, or phyla. The lower number assumes phyla, while genera is the more commonly used in the field and should be in the hundreds. Showing the number of ASVs/OTUs in each sample is a common measure of alpha diversity.

      3. The method to which the sequenced data was sorted is not given. The authors do not state if ASVs or OTU’s were utilized which leads to confusion in the way the dominant taxa were determined. It is also impossible to know if the sequenced data was corrected for 16S copy number, or for variance in genome size. Refer to ‘The Variability of the 16S rRNA Gene in Bacterial Genomes and Its Consequences for Bacterial Community Analyses’ at DIO: https://doi.org/10.1371/jou...

      Next are some more minor issues that can be addressed.

      1. At line 340, the instrument and settings for the zirconia beads are not explained.

      2. No reference is given for the CLR method at line 385.

      3. In the statistical analysis, it states that data was rarefied to the minimum library size, but that size is not mentioned.

      4. Figure 1A states P=0.002, however no statistical test is given to get that P.

      5. Figure 1C utilizes the words upregulated and downregulated which are used with expression data. I believe this is abundance of taxonomic groups, so different word choices would be more accurate, such as more or less represented. Further, you don’t know that age caused that, as implied by the phrase “by age.”

      6. Timothy Tomkins, SHSU biomedical student.

    1. On 2024-04-30 20:15:37, user Austin McIlhany wrote:

      Fascinating paper both on the topics of cutting edge field of microbiomes and still-ongoing issues of human-caused environmental crises, specifically oil spillages. Here are a few ideas and questions I have that I think could possibly improve this paper:<br /> 1. Since this study focuses on N and P levels and hydrocarbon degradation, then the levels of N and P in the collected seawater need to be quantified.<br /> 2. I understand that it must not be under lab-ready circumstances to extract AND analyze the samples of the artic waters at the same exact location for a more accurate sampling of the microbiome<br /> 3. The levels in the three growth conditions of high, low, and ambient. It would be helpful to list all ingredients and their final concentrations for the three conditions as well.<br /> 4. Perhaps in the future, the use of transposons could also be used to track the genes that correlate with biodegradation of crude oil, and which strains/taxa of bacteria they originate. Making a isolated, pairwise and community could also help narrow it down.<br /> 5. PCR conditions for the V4 amplification should be described.<br /> 6. In the “differential abundance analysis,” were there adjustments made for different 16S copy numbers in different taxa? Different genome sizes? If not, this must be mentioned as a limitation.

    1. On 2024-04-29 15:59:37, user Amber Gonzalez wrote:

      Additional comments<br /> Hello! I am a Sam Houston State University graduate student enrolled in a microbiome course, BIOL5394. My overall impression of the manuscript is that it is excellent, and the information presented is helpful for forensic science. <br /> Abstract and Introduction<br /> The introduction is very clear and to the point. Does this study consider where the individual's death occurred, indoors or outdoors? I believe the environment in which a death occurred could alter the microbial community succession and potentially influence your given results. What ethical guidelines were followed when handling the cadavers?<br /> Methods<br /> Quality control <br /> • Need specific PCR protocol, like # cycles, temps, polymerase, etc. https://journals.asm.org/do... <br /> • There is no mention of the correction of the 16S copy number and variances in genome size for taxa identified ASVs. https://journals.plos.org/p... <br /> • Was coverage of communities measured and representatively sampled equally?<br /> o Include coverage measures such as Good’s coverage or Chao1.<br /> • Line 115 explicitly states the protocol for USA samples. What about the samples from Finland and Italy?<br /> • Lines 113-114 mention sections of the dissected internal organs but fail to mention the specific section. Is there a measured area region that was dissected? This could help with consistency in sampling.<br /> DNA Extraction and Sequencing <br /> • Lines 130-131 state the Greengenes database used to assign taxonomy was last updated in May 2013. More accurate identification results would come from a more recently updated 16S gene database.<br /> Statistical analyses<br /> • Good practice to include the complete list of packages and codes used for the analysis.<br /> Results<br /> Figure 3<br /> • PCoA assumes normal distribution of data. Need to show normality test or use NMDS.<br /> Figure 4<br /> • The taxa in this figure show excessive “unknowns.” I believe updating the database could improve this.<br /> Figure 5<br /> • Lines 256-259 mention the findings of ASV family are in class Bacteroidia, however after reviewing I believe the correct class is Betaproteobacteria.<br /> o Bacteroidia, Betaproteobacteria, and Clostidia are color-coded with very similar colors. Consider making the jump to the next class a bit more distinctive.<br /> Additional comments<br /> • The article mentions the sample size was 265, but when I add up the four category sample sizes, I get a sum of 262. Is this intentional, or a typo?<br /> • Of the 20 Finnish cadavers, why was the liver the only organ supplied?<br /> • Overall, it was a very interesting study!

    1. On 2024-04-29 13:34:46, user Oyinoluwa wrote:

      Abstract & Introduction

      The abstract is good overall and structured well. It gives a clear insight into the concern at hand and summarizes the key findings to show its significance. However, the research question is not clearly stated. This is something that can be elaborated on in the introductions, but it should also be stated briefly in the abstract. I understand that there is not a lot of research done on the effects of pregnancy to the female microbiota, but it is unclear as to what the research question is. This introduction gives a good background on the issue of pregnancy altering the microbiome. Below are my comments on what could be added or further explained.<br /> 1. Are you trying to determine which organisms are lost/recovered?<br /> 2. Is this study for a general understanding of the effects of pregnancy on women (pre/post birth)?<br /> 3. Are you looking at a specific family of bacteria, fungi or archea that has a meaningful change during both phases (pre- and post-maturation) to see their effects? <br /> 4. Are the women from diverse backgrounds (race)?<br /> 5. Was this study conducted in the same location?<br /> 6. Include more previous studies, if any, stating what others have claimed to be the reasons behind “side effects” of pregnancy <br /> 7. Include your own claims on what you would expect and not expect to see.

      Figures and Tables

      The table heading and description are good and easy to read. However, make sure to explain all abbreviations.<br /> Table 1. <br /> 1. What is the difference between an t-test and a Fishers exact t-test?<br /> 2. What does SS-days mean? <br /> 3. Also explain why each test was used for the p-value result.<br /> Figure 3. <br /> 1. I am not sure what these diagrams represent.<br /> 2. 3B- What is a vaginal community state type? How were they classified? It is stated that software clusters them, but what are the criteria?<br /> 3. 3A- What do the colors represent? Explain the unknown portion? <br /> General comments for figures<br /> Figures captions need to be clear, like in 1C ii) the title is “Rchress.” Is that observed ASVs? Include clear titles for your figures as well as axis labels. References to the figures from the results section show that the figures support the findings. You can include the reasoning behind choosing these graphical analyses. <br /> Methods, Materials & Analysis

      1. In your sample and collection section, it is mentioned that the participants collected their own samples. Is there a reason for this? Why did a professional, specifically a doctor, not collect the samples? Was there a way to determine that the samples were collected and stored properly?
      2. Does the study look at women across different races? Consider this please!
      3. How was Lctobacillus classified to species level using only the V4 region? That is not possible, the full 16S sequence is required. https://www.nature.com/arti...
      4. How did your account for chimeras and PCR errors before going onto further filtering steps?
      5. Further explain your controls. It was mentioned that positive and negative controls were removed, but there is no mention of their identity.
      6. What analysis was used to determine dominant and rare taxa? This was mentioned in the paper but was not included in the methods section.
      7. This study used 16S rRNA analysis to determine species present as different body sites, when the sequencing step is conducted to determine the species what the sequencing coverage is. Is it complete? In addition, how many reads per sample? <br /> a. This was not stated at all in the paper, and it would be good to include it in the analysis portion.

      Results, Discussion, Conclusion

      In the limitations section, it is mentioned that the samples were not collected from the same women before and after pregnancy. Wouldn’t this affect the results you have presented? It is hard to say whether your results and conclusion support the claims which were made due to this aspect of sample collection. Although your results and conclusions are significant to the study, the validity is questionable.

    1. On 2024-04-25 23:14:15, user Michelle Wille wrote:

      This is an important study rapidly presenting key findings of sampling for HPAI in the Antarctic region. We have some concerns around the interpretation of the results - we beleive the diagnostic used is excellent at detecting a broad diversity of H5 viruses and is not specific to HPAI H5 and therefore it is unclear whether the authors detected HPAI H5N1 or LPAI H5Nx. A summary of our concerns has been presented here: https://www.preprints.org/m...

    1. On 2024-04-25 14:29:24, user Heather Etchevers wrote:

      New address for Dr. Patrice Quintana: Université Clermont Auvergne, INSERM, U1107, NEURO-DOL, Clermont-Ferrand, France.

    1. On 2024-04-25 07:12:08, user Rafal Mostowy wrote:

      Hi, it’s very interesting work! I was wondering if you could make your supplementary material available? I don’t see it posted with the preprint. Thank you

    1. On 2024-04-23 17:09:36, user Moira C wrote:

      Hello, the Yadav lab has shown data on a protein structurally similar to SLK in humans called TAOK1, I have linked their paper here https://www.science.org/doi.... Do you have any comment on the similarity between these two proteins especially since this other kinase seems to have an I-bar domain as well.

    1. On 2024-04-23 12:36:47, user Alessandro Popoli wrote:

      This paper highlights some valuable genetic elements and offers precise quantifications of subtle effects on fruit shape, which are attributed to a single STM autoregulatory element. While it is commendable that such effects have been observed and quantified with apparent robustness, this aspect alone does not compensate for the overall weaknesses of the study.

      The significance of this autoactivation in fruit metamorphosis, as discussed, is exaggerated. Techniques such as imaging quantification and single-cell analysis are utilized, yet they seem to function more as ornamental enhancements rather than providing substantial contributions to the core narrative. For instance, the imaging quantification primarily shows proliferation within the stomatal lineages but fails to delve deeper into the overall growth mechanisms influencing fruit shape. Additionally, the single-cell analysis appears to be inadequately executed in several aspects.

      A thorough reporting and discussion on the robustness of observations involving transgenic lines, such as GUS reporters, inducible lines, and mutants, is sorely missing. This is crucial, especially considering the minimal phenotypical effects of the cis-regulatory element under investigation. A detailed analysis is needed to ascertain whether the observed effects are indeed significant or simply artifacts stemming from genetic background noise.

      Lastly, the selection analysis presented in Supplementary Figure 26 is conceptually flawed and should be reconsidered. The approach of segregating sequences with and without the binding site (BS) before analysis is fundamentally problematic. Selecting species that carry the BS and then asserting high conservation within this group compared to others is tautological and compromises the scientific integrity of the findings.

    1. On 2024-04-23 10:07:33, user AngelPerezDiz wrote:

      The final version of this manuscript has been published in Molecular Ecology journal:

      Diz, A.P., & Skibinski, D.O.F. (2024). Patterns of admixture and introgression in a mosaic Mytilus galloprovincialis and Mytilus edulis hybrid zone in SW England. Molecular Ecology, 33, e17233. https://doi.org/10.1111/mec...

    1. On 2024-04-23 07:19:50, user Rashidul Islam wrote:

      This manuscript has been officially published in the British Journal of Cancer. We therefore kindly request to review the final published version of the manuscript.

      Here is the paper:<br /> Islam, R., Heyer, J., Figura, M. et al. T cells in testicular germ cell tumors: new evidence of fundamental contributions by rare subsets. Br J Cancer (2024). https://doi.org/10.1038/s41...

    1. On 2024-04-19 10:09:16, user RG wrote:

      Fascinating analysis & great dataset.

      The question of PIE aside, which is a complex social and linguistic matter, there is in fact clear evidence of movement from the Balkan route into Anatolia in in fact clear and unequivocal, despite the claims expressed in this study.

      The presence of I2a-L699 in Yassitepe (Lazaridis 2023), and its persistence into the Iron Age is clear testament to this. Contra to the analysis offered in L. et al (2023), that lineage is not a Balkan lineage - missing in all pre Bronze Age samples (Mathieson 2015, Penske 2023, Lazaridis 2023)- but from further north, esp the Dnipro valley, and more proximately Cernavoda C.

      This establishes links between southeastern Europe and Anatolia, and exposes the limitations of inferences limited to one particular qpAdm set up.

      It also supports the view supported by most linguists- that proto-anatolians arrived via the Balkans (without excluding more complex scenarios entailing convergence).

    1. On 2024-04-18 19:38:40, user Rishav Mitra wrote:

      Summary:<br /> Transglutaminase 2 (TG2) is a GTP binding/ protein-crosslinking enzyme with therapeutic potential in various conditions such as cancers, Celiac disease, and neurological disorders. TG2 is thought to have two major conformational states, an inactive GTP-bound closed state and a crosslinking-active Ca2+-bound open state. Other groups have previously reported X-ray structures of TG2 that reveal the structural basis for the regulation of transamidation activity by GTP/GDP and Ca2+. Although these studies have suggested that guanine nucleotides and Ca2+ allosterically regulate TG2 activity by inducing global conformational changes, direct evidence for conformational transitions has been lacking so far. The authors of this paper have previously shown that a small-molecule inhibitor, TTGM 5826, inhibits the protein crosslinking activity of TG2 by stabilizing the open conformation. Interestingly, TTGM 5826 prevented the growth of cancer cells which led the authors to conclude that the open conformation is cytotoxic. Therefore, locking TG2 in the open state by small molecules could lead to new therapeutic strategies. <br /> In this study, the authors have investigated how the binding of guanine nucleotides, calcium, and small-molecule inhibitors affects the open and closed conformational states of TG2 using small- angle X-ray scattering (SAXS) and single-particle cryoelectron microscopy (cryo-EM). Additionally, they focused on the discovery of improved small molecule inhibitors compared to TTGM 5826. The major success of this paper is the finding that TG2 can undergo a reversible conformational transition in solution between closed and open states under physiological GTP and Ca2+ concentrations. In addition, the authors have found a new conformational state inhibitor, LM11, that is more potent than TTGM 5826, although the evidence to support the connection between drug potency and TG2 conformational specificity in cells is weak. The authors show that the LM11-bound state has a different conformation from the Ca2+-bound open state. The major weakness of this paper is the lack of mechanistic information to explain the potency of LM11. Hopefully further structural studies will provide further details on the conformational changes induced by LM11 and other inhibitors. <br /> Major points:

      In Figure 3D, the authors explained the different conformations between WT and the R580K mutant under GTP conditions by Kratky plots and fitting using CRYSOL. A Kratky plot normalized by Rg may be a better way to discuss the conformations since normalized Kratky plots emphasize conformational differences. In such a plot the weak shoulder in around q = 0.15Å-1 of “open dimer”, which likely comes from the dimer conformation's symmetry, can then be emphasized and discussed.<br /> In the text regarding Figure 4, the authors mentioned 3DFSC but it is not provided in the figures. 3DFSC is one of most important plots in cryo-EM analysis to verify directional resolution and density isotropy. <br /> In Figure 4A, the authors said that the homology model generated from TG3 was an excellent fit for the map under Ca2+ conditions. Considering Figure S2, the fit looks excellent certainly. But it was just a visual evaluation, and quantitative scores to validate the degree of fitness like the Q score should be provided.<br /> In the text mentioning Figure 4B, the authors said “a homology model of TG2 bound to Ca2+ at the three conserved binding sites and found that it was in good agreement with the cryo-EM map”. However, this sentence does not seem to match the figure because Figure 4B shows the calcium-binding sites and the related residues in the model, not including the cryo-EM map. Therefore, we suggest that Figure S2 which shows how the calcium-binding sites fit the map is included in Figure 4 instead of Figure 4B.<br /> In Figure 4, SAXS and Cryo-EM under Ca2+ conditions showed different conformations based on each protein concentration. Do you have information about the concentration of TG2 in human cells and how this relates to regulation? <br /> The authors explained that TG2 R580K mutant forms higher-order oligomers at lower Ca2+ concentrations compared to WT TG2 from Figure 4. However, at this stage, proof that WT TG2 forms higher-order oligomers seems to be only the I(0) value of the red SAXS profile in Figure 4C. In addition, since the profile is well-fitted to the calculated open-dimer profile, readers might not notice the increased I(0) value. Figure S7B looks like a more direct proof of WT TG2 higher-order oligomers under Ca2+ conditions. Therefore, we suggest that Figure S7B is included in Figure 4 or is mentioned in the text related to Figure 4.<br /> In general, SAXS has technical limitations in confirming the presence of oligomeric species due to the possibility of non-specific aggregates, precipitates, and buffer components scattering at low q values. Addressing these sources of low q scattering either through explicit mention in the text or furnishing more direct evidence of the TG2 oligomers may enhance the strength of the claims.<br /> The authors mention that using 3 μM TG2 in cryo-EM made it possible to capture monomeric TG2. The SAXS experiments required higher concentrations (25 μM) for sufficient signal. Given the importance of TG2 dimers in this study, the authors might consider measuring the affinity constant for self-association to confirm that the stoichiometry (homodimer/monomer) in the different experiments is indeed what they expect based on the solution behavior of TG2.<br /> Can the authors explain the significance of the differences in fluorescence emission at each arrow point for no drug vs. LM11 treatment in the BODIPY-GTP binding assays in Figure 5A?<br /> Some discussion regarding the limitations in using two cell lines that possibly differ in expression levels of genes other than TG2, membrane permeability, metabolic activities etc. to assess LM11 potency, can align the conclusions more closely with the data.

      Minor points:

      Table S2 is not mentioned in the text. <br /> In Figure 3D, it is better to describe what concentration of GTP the experimental curves have clearly. Certainly, we can read those based on the values of Rg in Figures 2 and 3B but that’s a bit unfriendly.<br /> There seems to be a typo in the text of Figure 4C. “yellow, see Figure S3C” looks like the correct text because Figure 3C does not include SAXS profiles.<br /> Figures 2 and 3 can be combined to make it easier for the reader to compare between TG2 WT and R580K.<br /> The term “saturated conformational state” in the legend for Figure 3B is not meaningful.<br /> Are the % cell viability data for LM11 and TTGM 5826 normalized to vehicle control?

      Reviewed by Hiroki Yamamura, Rishav Mitra, and James Fraser (UCSF)

    1. On 2024-04-18 19:30:24, user KL wrote:

      Very interesting paper, however I have a concern about Fig 2B. Specifically, your Male/Female assignments are inconsistent between the two plots - see the line of 4 people above the alpha/beta main cluster? In the left panel they are F, M, F, M, while in the right panel they are all female. This is true of other date points between the two panels, just providing one example. The left plot also does not appear to contain any white males or females, despite them being included in the legend, though I think I see the X-with-box symbol in the right panel in a few places (pink, purple, orange).

    1. On 2024-04-18 11:32:12, user Karyn Esser wrote:

      I want to note that due to some computer problems in the lab we have lost a significant amount of the real time bioiluminescence recordings for the PER2:LUC tissue clock results reported. As such, we are not confident moving forward with peer review. Thus, we will be repeating and expanding this study moving forward. Karyn Esser

    1. On 2024-04-18 00:42:18, user CommunityScientist wrote:

      Work would benefit greatly from a mutation of other zinc fingers and data to suggest there is no DNA binding occurring. Furthermore, I am alarmed by figure 3 as this is not the correct way to report replicates in SMT experiments, arising doubt surrounding the analysis and significance. Figure 4E needs explanation as to why the values overlap yet are shown to be statistically significant. I do not believe the correct statistical tests were used.

    1. On 2024-04-17 20:01:01, user Christopher Hart wrote:

      It's great that the authors have put together a manuscript that aims to generate data on an important but often ignored question in cell biology on a neglected clade. I have a few questions regarding their methods listed below, where I could not replicate or understand their choices.

      If I'm reading the methods correctly the authors have used two sets of primers to amplify two transcripts from cDNA: PAPYR_7259 (P7) and PAPYR_8006 (P8). They then clone these into an expression vector to generate antibodies that they've used for some IF and a pulldown. <br /> Importantly PAPYR_7259 has several strong interpro domains corresponding to subunits of ubiquitin activating E1 domains that each hit 4-5 different genes, so the antibody specificity will be dependent on which epitopes were available in the expression vector and their antigenicity. In an effort to understand whether the authors have used a truncated protein with just the SFA domains or the whole protein including the ubiquitin interacting domains I looked for primer binding sites within each gene. I BLASTed the primers against the genome, and found binding sites for the PAPYR_7259 Fwd/Rev primers that would amplify a region from 232645 - 233620 within the genome that is near the start/stop codons of 232642 - 240693. This suggests that they are taking nearly the whole protein including the N-term Ubiquitin activating E1 domains, could the authors confirm this is the case? As for PAPYR_8006 the Fwd primer bind in the region of 147480, however I was entirely unable to find a hit by BLASTn for the listed reverse primer (GCTAGCGGCCGCATGGGTGATGACGTGGAGGCCGTCCTG) against any Paratrimastix genome in Genbank. It’s possible that the authors are using their own genome sequence, however this should be included as data within the paper and should be acknowledged in their methods. It may also be that the authors are using this primer to do a Gibson assembly so we would expect it to be less homologous to the paratrimastix pyriformis genome, however this is not explained in the methods either, and the 6-8bp 5’ non-homologous regions of the other primers suggests to me that this is simple enzyme cloning, and can all be located by BLAST. Could the authors please double check that the sequence in the text is correct and double check where it binds, and which genome version they’re using?<br /> The authors also mention that they validated their antibodies by Western Blot, however the data is not present in the paper, it would be excellent to include that data, even if it’s just as a supplemental figure. <br /> The authors then conduct expansion and Immunofluorescent microscopy to localize the SFAs within this unique organism. While expansion produces very pretty images, the authors do not include non-expanded cells, and given the difficulties of working with expanded cells and how little is known about Paratrimastix sp. it is important that the authors also show any data that they might have to show the same binding pattern is similar in non-expanded cells. I know too in our lab we've had difficulties getting DAPI/hoescht to work well with expansion but no issues with regular IF, so that inclusion would be great. Notably too the authors do not show P7 IF staining, it would be good to look at the localization of both SFAs, not just one, and this may be simpler to do in non-expanded cells.

    1. On 2024-04-16 19:58:42, user Marie-Alda Gilles-Gonzalez wrote:

      The much higher affinities you report do not agree with the Wayne model of Mtb. How did you purify your DosT and DosS proteins? Since you are impugning our work, and it does matter very much how the proteins are purified, you should provide information on this. Were your DosT and DosS fusion proteins? Were they tagged? If so, how and where?

    1. On 2024-04-15 08:03:17, user Kazuhito Tabata wrote:

      Your reports have been very interesting. The improved efficiency of PURE synthesis is an important finding for the future of synthetic biology and would be an interesting topic for the field of materials production. In this paper you discuss the effect of molecular crowders, but we also tested the effect of TMAO and betaine.

      https://pubs.acs.org/doi/fu...

      We also tested the effect of TMAO and betaine and found that 100mM or 1M was not as effective, but 0.4M improved protein synthesis by about 2 times. I am very happy to see that the results are the same as what you tested. I am also very interested to see if the conditions we found will further improve your result.

    1. On 2024-04-12 18:10:47, user Luis E. Gimenez wrote:

      Regarding Figure 1B, it is incorrect to calculate arithmetic averages for EC50 values, even more so to show scatter measures on an arithmetic scale, given that EC50 values do not typically follow a Gaussian distribution. Instead, The authors should show pEC50 values and apply one-way ANOVA to the transformed data.

    1. On 2024-04-12 16:25:56, user Lori Passmore wrote:

      COMMENTS FROM PASSMORE LAB JOURNAL CLUB:

      In this manuscript the authors show how LEA proteins can improve protein behaviour in cryoEM. This has an advantage over using detergents such as CHAPSO, because the target protein concentration can remain lower. It seems like this would be a straightforward method to implement for challenging specimens and therefore should be of broad interest.

      We would find it helpful if the authors could provide more methodological detail in the manuscript, especially given it is a methods-based paper. For example, when was LEA added to the samples? What concentration was the stock solution of LEA? Is glycerol necessary for LEA protein stability?

      The manuscript would be strengthened by investigation into the mechanistic basis of how LEA proteins improve particle quality. The authors hypothesize that LEA coats the air-water interface and could further investigate this. The orientation bias of the samples in this study suggests that the sample proteins are still interacting with an interface. Tomography could help explain these.

      It would also be interesting to know if the authors attempted to reconstruct crosslinked PRC2 in the absence of LEA (as a control, instead of comparing to other laboratories' work).

    1. On 2024-04-12 15:15:07, user Alaina wrote:

      I really enjoyed reading this paper. Very exciting results! I am wondering how the results differed between the cultured genomes and the MAGs? MAGs only represent a population average of a genome, lacking that individual-level genome variability which defenses tend to exhibit. Were the results different between MAGs and cultured genomes? Also if available, I'd recommend including SAGs as well to recover that variability / microdiversity.

    1. On 2024-04-10 13:58:54, user Shelly Peyton wrote:

      I teach a professional development course for graduate<br /> students, and we reviewed your paper last week. We loved it! As part of the class, we are providing comments as reviewers, which I've compiled here, and we hope you find them useful!

      Introduction and Abstract:<br /> Strengths:<br /> - good summary of current work in the field, well motivated

      Potential improvement:<br /> -Could be more clear to introduce cell migration first then explain the impact of the ECM on these processes which is a smoother lead in to the research question. Right now it jumps from ECM to migration back to ECM and reads as choppy and disjointed.

      Methodology:<br /> Strengths:<br /> -Thorough throughout, providing replicable description of the work , culturing, and data analysis

      Potential Improvement: <br /> -We wanted the same level of detail in the experimental methods as was given in<br /> the cell culture.

      Results:<br /> Strengths:<br /> -Easy to follow. Great figures, well organized.

      Potential Improvements:<br /> -We suggest moving figure 1a-b to a separate figure.

      -It would be more useful to consider cell averages across more replicates. Some experiments only had N=1 biological replicates, which we only found in the legends - these would be appreciated on the figures themselves in cases where we were comparing between groups (figure 3a control and b2-KO, e.g.).<br /> -Sufficient replicates were not always performed to make robust statistical comparisons.

      Conclusions:<br /> Strengths:<br /> -explained why they did what they did

      -compared their work to previous work

      -nice summary flow (first sentence is what was their goal, followed by some<br /> background, etc,)

      Potential Improvement: <br /> -would help clarity to refer to their own figures in the conclusions. So it wasn’t always clear if statements were being made to prior work or the work done in this paper.

      -Conclusions could use some clarity in writing - Some sentences are confusing (line 377-379).

    1. On 2024-04-09 07:36:42, user Gabriel Munar-Delgado wrote:

      We want to congratulate the authors for this manuscript addressing what we think is a very interesting and relevant topic. The dataset is impressive, the methods are outstanding, and the results are robust and relevant.

      However, in our opinion, the manuscript does not fully clarify whether environmental similarity between relatives affects phenotypic heritability versus phenotypic heritability estimates of the animal model. This clarification is crucial for interpretation of the results obtained by anyone fitting similar models.

      In other words, are the estimates after accounting for environmental similarity the 'correct' values for the trait’s heritability (implying that otherwise, they would be overestimated, and environmental similarity only affects heritability estimates but not heritability per se)? Or, when accounting for environmental similarity, do heritability estimates reflect the heritability after controlling for environmental inheritance (i.e., environmental similarity does affect heritability and its effects are statically removed when fitted in the model, resulting in an underestimation of total heritability)?

      We believe that this topic could be better addressed, by referring to recent theoretical work presented in Munar-Delgado et al. 2023 (https://doi.org/10.1111/204.... Here we showed how heritability is affected by environmental similarity only when the environment itself is somehow inherited and affects the phenotypic trait via phenotypic plasticity. In such a scenario, the total heritability of the trait is the sum of the direct heritability (the inherited basis for the phenotypic trait) plus the indirect heritability (the direct inherited basis for the focal environment, proportional to the square of the strength of phenotypic plasticity). Thus, accounting for environmental similarity in the animal model statically removes those indirect effects. Both heritability estimates (when not accounting for environmental similarity and when doing so) are statistically 'correct' (unbiased) estimates. However, they do reflect different things biologically, and not considering this can bias their interpretation.

      As a side note, we think that the effect of environmental inheritance on the heritability of the phenotypic trait has the same outcome when the environment is genetically inherited (in the ms mentioned as "If it results from a genetically mediated breeding environment choice, then this could actually be considered part of the 'genetic' heritability of the trait") and when it is non-genetically inherited (in the ms mentioned as "by assuming similarity in the environments used by individuals is driven purely by non-genetic"). Animal models estimate the proportion of the variation in the phenotype transmitted across generations. This variation can be both genetically and non-genetically transmitted. In this context, it might be helpful to talk about 'inclusive heritability' (Danchin and Wagner, 2010 - https://doi.org/10.1111/j.1... when referring to the heritability potentially affected by environmental similarity, which can be both genetically and non-genetically inherited (this includes environmental inheritance via limited dispersal).

      Overall, we would state that environmental similarity does increase heritability of the phenotypic trait if it is affected by a heritable environment (unlike the title of the ms that states that it decreases heritability).

      Once again, congratulations on your work, and we are happy to discuss this further if you wish.

      Gabriel Munar-Delgado & Pim Edelaar

    1. On 2024-04-09 07:23:04, user Julien Roux wrote:

      Thanks for this useful benchmark!

      In the introduction you wrote "In the supervised category, gene set enrichment methods like xCell, MCP-counter, and SaVant can be included. However, these methods use an enrichment-based approach and output enrichment scores that can only be compared within samples, which limits their application for inter-sample comparisons". <br /> Regarding xCell this seems to be contradictory to what the authors claim, see notably their Github page https://github.com/dviraran... (section "Notes for correct usage": "xCell produces enrichment scores, not percentages. It is not a deconvolution method, but an enrichment method. That means that the main usage is for comparing across samples, not across cell types.")

    1. On 2024-04-09 01:06:43, user Shelly Peyton wrote:

      I teach a professional development course for graduate students, and we reviewed your paper last week. We loved it! As part of the class, we are providing comments as reviewers, which I've compiled here, and we hope you find them useful!

      Introduction and Abstract:<br /> Strengths:<br /> - great illustrations of the two possibilities of how leader and follower cells could be mechanically organized. <br /> - simple, concise and clear language in the abstract + intro<br /> - minimal jargon in abstract<br /> - good summary of current work in the field

      Potential improvement:<br /> -Should define Rac1 in the intro

      Methodology:<br /> Strengths:<br /> Very clear what they were doing and why.

      Potential Improvement: <br /> Too descriptive in explaining simulation functions. This information could be moved to the supplement.

      Results:<br /> Strengths:

      Straight forward system to explain the results, easy to follow. Great figures, well organized.

      Potential Improvements:

      A lot of the equations being put in the results, when it’s already in the methodologies. Can remove these to simplify the paper.

      Conclusions:<br /> Strengths:<br /> Conclusions correctly respond to the hypothesis of whether leader cells actually direct migration and answers that asymmetric forces generated leads to migration.

      Potential Improvement: <br /> Maybe highlight the results again and connect it to some speculation.

      additional comments:

      Loved the figures! Figure 1 in particular was helpful. Liked that you stayed away from red and green. Figure 5 was a little busy but the rest were nicely organized and clear. Great experimental design!

    1. On 2024-04-08 08:07:16, user Max Shinn wrote:

      Let's take time to thank the developers of Scanpy and Seurat. These packages are both incredible endeavours that took lots of time, energy, and passion to pull off. Open source scientific software is hard to fund and even harder to maintain over the course of years. It's not just the code that makes it hard - even more difficult than the initial code release is writing clear documentation, tracking down bugs, interacting with the community, designing ergonomic APIs (and maintaining the old non-ergonomic ones), and fixing regressions as the Python/R ecosystem changes. Scientific progress depends on the people willing to do ALL of these things, despite the fact that few (if any) are paper-worthy, and are not valued in career progression decisions, funding, etc. The authors of Scanpy and Seurat have really gone the extra mile to make sure we researchers have great tools to use, and I hope people will join me in thanking them for their efforts that our work depends on!

    1. On 2024-04-05 20:31:38, user Samir Khleif wrote:

      Congrats! i am very happy to see this wonderful manuscript which confirms the findings we published in Verma et al, Nat Imm, 2019. These are very important findings in identifying a resistance mechanism for anti-PD1. Similar to what we reported, this manuscript confirms the following:

      1. CD8 T cells expressing CD38hi are dysfunctional T cells and are associated with PD1 blockade resistance.
      2. ICB (PD1 blockade) induces these dysfunctional CD8 CD38hi T cells. In verma et at, we also demonstrated that the induction of CD38hi by anti-PD1 actually occurs in unprimed or sub-optimally primed conditions.
      3. CD38hi CD8 T cells are predictive of ICB resistance using the same cohort of patients
      4. Depleting CD38hi enhances immune response

      In addition to what the authors showed in this manuscript, we also demonstrated that Priming of CD8 T cells with vaccines prevent the induction of these CD38hi cells

      Accordingly, we believe that such findings presented in both papers would further strengthen the design of clinical trials to overcome anti-PD1 resistance

    2. On 2024-03-11 04:02:22, user Passionate Scientist wrote:

      Yup, nice validation of previous study by verma et al. Nat Immunology 2019. Seems like these cells phenotype is very important determinant of checkpoint inhibitors efficacy.

    3. On 2024-03-04 18:23:27, user Bilikere Dwarakanath wrote:

      It is increasingly becoming clear that resistance to Immune Checkpoint Blockade (ICB) can compromise the efficacy of cancer therapy at large. This has compelled the need to understand mechanisms underlying ICB resistance so that effective therapy can be designed to overcome ICB resistance. In this direction, the pioneering work of Dr. Khleif’s lab showing the role of CD38+PD1+CD8 T cells in ICB resistance was a landmark contribution (Ref #17 of this communication). Using elegantly designed pre-clinical studies (with mouse TC-1 and melanoma tumor models) as well as clinical samples (melanoma patients; pre- and post-therapy) they convincingly established the role of CD38 (high)PD1+CD8 T cells in ICB. This submission by Or-Yam Revach et al., (Dr. Jenkin’s Lab at Harvard Medical School) reinforces the importance of CD38+PD1+CD8 T cells in ICB resistance with CD38 as a marker of exhaustion. These two findings are expected to stimulate further efforts on developing approaches to overcome ICB resistance.

    4. On 2024-02-25 15:12:20, user Vivek Verma wrote:

      It is a pleasure to see this publication being submitted where the authors report the role of CD38 in promoting T cell exhaustion. It is so heartwarming to see that the authors were able to recapitulate all our findings reported at (https://pubmed.ncbi.nlm.nih.... In this research, we showed that CD38 expression on PD1+CD8 T cells is a marker of T cell dysfunction, and these CD38+PD1+CD8 T cells are directly associated with ICB resistance. Using various genetic and cell depletion experiments, we demonstrated the causality of these cells in the failure of anti-PD1 therapy in mouse melanoma models. In addition to mouse models, using melanoma patient cohorts treated with anti-PD1 ICB, we have shown that therapy-resistant patients had higher numbers of these cells in their tumors pre- and post-treatment compared to sensitive patients. <br /> This study is also in line with several other reported observations where the role of the CD38-NAD+ axis in T cell exhaustion has been extensively reported (https://pubmed.ncbi.nlm.nih..., https://pubmed.ncbi.nlm.nih.... This study, in conjunction with the prior reports, adds to the growing body of literature highlighting the importance of CD38 as a marker of exhaustion rather than activation.

    5. On 2024-02-24 04:04:41, user Michael B. Atkins wrote:

      Great to see this important work building on my colleague Samir Khleif's discoveries published in Nature Immunology (Ref 17).

    1. On 2024-04-05 17:40:42, user Adrianna San Roman wrote:

      The graduate students of the Duke University Human Genetics course reviewed this pre-print as an assignment. A group of student editors synthesized the individual reviews into this PreReview. We hope that the authors and readers of this paper will find our comments useful!

      Introduction <br /> The paper, “Complete chromosome 21 centromere sequences from a Down syndrome family reveal size asymmetry and differences in kinetochore attachment,” delves into the role of centromere structure and epigenetic features of chromosome 21 (chr21) in contributing to Trisomy 21 (T21). Trisomy 21, clinically known as Down syndrome, is the most common autosomal chromosomal aneuploidy in humans, which is caused by the presence of an entire extra chromosome 21 in the affected individual. While there are multiple ways this syndrome can be inherited, the most common path is a nondisjunction of chromosomes during maternal meiosis I (MI) due to an error in segregation of chromosomes. Centromeres are crucial for the correct segregation of chromosomes during meiosis; thus, understanding their role and how their characteristics might contribute to nondisjunction of chromosome 21 is a current gap in knowledge.

      The authors hypothesized that genetic and epigenetic variation at the centromere of chromosome 21 can act as risk factors for chromosome 21 nondisjunction. Previously, centromeres sequences were inaccessible using short-read sequencing technologies. To overcome this limitation, the authors employed a variety of sequencing methods including Pacific Biosciences (PacBio) high-fidelity (HiFi) long read sequencing and ultra-long Oxford Nanopore Technologies (UL-ONT) along with ChIP-seq. Utilizing these technologies, the team sequenced and assembled centromeres from a parent-child trio, where the child, diagnosed with Down syndrome, exhibits three distinct chromosome 21 centromere haplotypes with significant size differences. Finally, the centromere variations in the T21 family were compared to a population sampling of 35 completely sequenced chromosome 21 centromeres from diverse ancestry, which revealed unique features of T21 centromeres, especially size asymmetry and epigenetic differences. The authors concluded that these findings suggest an impairment in the kinetochore formation that can lead to nondisjunction and T21; therefore, providing insights into Down syndrome’s molecular mechanism and emphasizing the importance of centromeric structure in chromosomal stability.

      Main Limitations<br /> The authors acknowledged several major limitations of the study, including the sampling of only one proband-parent trio and the exclusive use of transformed lymphoblastoid cell lines. Here, we elaborate on the significance of these limitations and introduce additional limitations for consideration by the authors.

      1) The sequencing of only one parent-proband trio is a major limitation of the study, given the heterogeneity in higher order repeat (HOR) array length and centromere dip region (CDR) methylation pattern found among the 35 previously assembled chromosome 21 centromeres. Although the results did show that the HOR array of one of the proband's maternally inherited chromosomes was significantly shorter than any HOR array from the control human population, it still cannot be assumed from one parent-child trio that this unusually short length or asymmetry in the mother increases the risk of nondisjunction and trisomy 21. The paternal sequencing data also showed centromere asymmetry, to a lesser extent than that of the mother, and without data from more trios, we are still left with the question of whether paternal asymmetry can also contribute to nondisjunction risk. Furthermore, some individuals, such as HG03710 in Figure 3C, also exhibit centromere HOR asymmetry and differential CDR methylation patterns across chromosome 21 centromere haplotypes. Thus, with the current data, it is difficult to distinguish between normal variation and variation associated with trisomy 21.

      Sampling only one trio is accompanied by yet another limitation specific to trisomy 21 – the mother’s age at conception was 29, which is not representative of the increased risk of trisomy 21 at maternal ages greater than 35.

      Finally, the of sampling only one trio, while very informative of the most common type of meiotic error leading to trisomy 21 (meiosis I, maternal), does not necessarily explain the mechanism by which other meiotic errors lead to trisomy 21. To make a well-supported conclusion about what genetic factors confer risk for trisomy 21, more parent-child trios would need to be analyzed. While we acknowledge the costs of long-read sequencing and the resources needed to carry it out, obtaining the sequencing data of just one or two additional trios could potentially provide more confidence that these epigenetic differences and asymmetry are conserved across cases of trisomy 21 and contribute to nondisjunction.

      2) The authors of the study extracted DNA from transformed lymphoblastoid cell lines rather than primary tissue material collected from the individuals. There is currently limited evidence on the genomic and epigenomic stability of these cells at the centromere. Repeating the analysis on DNA taken from primary culture, if possible, could bring certainty to the fact that the observed genetic and epigenetic features are associated with nondisjunction/trisomy 21, and not with the EBV transformation of these cells, for example. A broader analysis across cell types in the future could also remove epigenetic differences between cell lines as confounding variables.

      3) While the authors extensively characterized the centromeres of chromosome 21 in one case of trisomy 21 and identified variations in size, methylation patterns, and CENP-A enrichment, they did not directly demonstrate the functional significance of these differences in promoting chromosome 21 nondisjunction.

      To address this limitation, the authors could perform functional assays using cell lines or animal models to assess the impact of altered centromere structure and epigenetics on chromosome segregation and the occurrence of trisomy 21. These additional experiments would strengthen the study's conclusions and provide deeper insights into the mechanisms underlying trisomy 21. However, we understand that these kinds of functional experiments may not be the focus of the research group that carried out the study, and other research groups or collaborators may choose to complement their findings with functional experiments.

      4) Although the title of the paper claims that the sequencing of the chromosome 21 centromeres revealed “differences in kinetochore attachment”, there is no functional evidence of differences in kinetochore attachment provided in the paper. At several points throughout the manuscript the authors use more speculative language to refer to what can be gleaned about the kinetochore from their epigenetic results. For example, in the abstract: “these epigenetic signatures suggest less competent kinetochore attachment” and when referring to the CDR on p. 5, “the likely site of kinetochore attachment”, or on p. 7 “thought to define the site of kinetochore attachment”. We recommend that the authors either remove this from the title, incorporate uncertainty into the title, or add additional experiments to the paper that would provide evidence for differences in kinetochore attachment. For example, ChIP-seq for other kinetochore proteins could bolster this claim.

      Minor Limitations<br /> While the paper mentioned several major limitations, there are also some minor limitations that we found relevant to the paper. Minor limitations include recommendations for improved clarity and figure presentation.

      1) A brief statement elucidating the significance of the AluY retrotransposon insertion highlighted in the text would add clarity to its relevance.

      2) Furnishing more details about the controls, such as their geographic origin and diversity, would strengthen the study. We infer that the abbreviations in parenthesis next to the sample names in figure 4 refers to ancestry information, but it would be helpful to add these abbreviations in the figure legend.

      3) The large size of the pedigree in Figure 1 made it challenging to discern the epigenetic profiles and heatmaps due to their small size; enlarging these elements or providing clearer delineation could address this issue.

      4) Integrating portions of supplemental figures 2 and 5, which compare the proband to the parents, as additional panels in the main figures, would emphasize differences in methylation patterns and CDR more effectively.

      5) Figures featuring numerous colors or intricate details, such as figures 2 and 3, could benefit from additional textual labeling or zooming in on key regions of interest to enhance comprehension. It would have been beneficial to strengthen the evolutionary significance portion of their article. Centromeres are complex genomic regions subject to unique evolutionary forces, including concerted evolution, which can lead to rapid turnover and homogenization of repetitive sequences. The evolutionary history of α-satellite HORs may involve intricate processes that are not fully captured by sequence divergence analyses alone. Without additional comparative genomic analyses or experimental validation, it is challenging to accurately infer the evolutionary age of specific α-satellite HORs. While sequence divergence can provide insights into the evolutionary history of genomic regions, it may not always accurately reflect the age of a particular sequence due to factors such as selective pressures, genetic drift, and genomic rearrangements. Therefore, relying solely on sequence identity plots to infer evolutionary age may oversimplify the evolutionary dynamics of α-satellite HORs.

      6) In the methods, the authors state that the proband had a mosaic karyotype, and provide the same karyotype information that is given on the Coriell repository website for the cell line. Did the authors perform their own validation of the karyotypes of the trio in their cell line aliquots at a passage close to what they used for their experiments? It would be useful for the authors to comment on how the 58% of cells with the translocated chromosome 21 and 22 in the proband might impact their results, if at all.

      Significance<br /> The paper reports significant technical advancements in the study of centromere structure and epigenetics, particularly within the context of trisomy 21 (Down syndrome). Utilizing long-read sequencing technology PacBio HiFi and UL-ONT, combined with ChIP-Seq, the researchers comprehensively examined centromere size and epigenetic differences, overcoming previous limitations associated with conventional methods. This approach not only facilitated the resolution of complex repetitive regions like centromeres but also enabled the integration of genetic sequencing with epigenetic profiling, providing a holistic understanding of centromere biology.

      In the broader context of human genetic disorders, the findings of this study offer novel insights into the role of centromere structure and function in the prevalence of Down syndrome. By highlighting the potential contribution of centromere size variability and epigenetic differences to the risk of chromosome nondisjunction, the paper opens new avenues for understanding molecular mechanisms of nondisjunction events, with implications for other aneuploidies beyond Down syndrome. Moreover, further exploration of centromere size variability and epigenetic differences could lead to advancements in diagnostic and therapeutic strategies for genetic disorders, ultimately improving patient outcomes and healthcare practices.

    1. On 2024-04-05 07:43:17, user Giorgio Cattoretti wrote:

      Efforts at improving data meaningful data extraction from spatial hyperplexed proteomics are sorely needed and meritorious and this work fall just into this effort.<br /> The results however are not satisfactory to this observer’s eye.<br /> Taking into account that heat maps can be deceiving (doi.org/10.1038/s41590-021-...:hd0LiwxhxpZXJPGM2sSoP5ETPSQ "doi.org/10.1038/s41590-021-01006-z)"), looking at your Fig. 5C it seems to me that the evidence that the problem is only marginally solved is:<br /> - SMA in lane 15 (Endo): endothelium CD31+ CD14- VIM+ should be SMA-, while you do not have SMA in the stromal clusters, where it should be.<br /> - Macrophages (lane 14) are generally CD20-, except for signal bleeding from adjacent C B cells. And, for what is worth a heat map, CD4 signs should be stronger than CD3.<br /> - CD8 vanished<br /> Your “PD1+ B cells” are probably TCF1+ CD3+ CD4+ T follicular helper cells.<br /> As per the smart strategy to use of a plausibility score from a priori knowledge, the only example I do know of usable markers are PAX5 for B cells, CD3 and CD8 for T cells and CD163 for macrophages.<br /> Maybe one can add CD14, although it has been described on cDC2 and B1 cells.<br /> Everything else is shared by more than one cell type (experience on ~80 markers). <br /> CD68 is Macs + pDC, your CD68 clone, KP1, labels also neutrophils, CD20 is on some T cells, CD31 abundantly labels Macs, etc. etc.<br /> As per your table S1, CD31 labels T cells (doi: 10.3389/fimmu.2019.02434 ), CD20 and CD68 mutual exclusivity is emptied by your cluster 14 data.<br /> Plausibility score should therefore be based on maybe 3-4 hypothetical mutual exclusion.<br /> But dimensionality reduction algorithms are much better at that.<br /> I believe that the problem is somewhere else in the analytical pipeline: data processing.<br /> We developed a pipeline, BRAQUE (Dall’Olio, L.; Bolognesi, M.; Borghesi, S.; Cattoretti, G.; Castellani, G. BRAQUE: Bayesian Reduction for Amplified Quantization in UMAP Embedding. Entropy 2023, 25, 354. https://doi.org/10.3390/e25... in which data pre-processing has a major effect in separating clusters, to be further classified. We found (ms in preparation) that endothelial cells can effortlessly be separated from SMA+ fibroblasts. The “doublets” of CD4 and CD8 are minimized (see Table 2). All this without any of the processing you developed with STARLING. Imagine by combining BRAQUE with STARLING! <br /> Our data are available in the public domain and can be shared for a focused collaboration.<br /> While I do congratulate for the effort and long-standing work in the field, I hope that my observations will further improve the experience in the field. Best

    1. On 2024-04-04 17:09:33, user Steve Gwynne wrote:

      Pretty much sums up the Human Overshoot Conundrum with the added need of a cultural revolution.

      I've been working on the cultural dimension for some time now and I have reached the conclusion that what is needed is a transition from the growth imperative to the balance imperative.

      This accords with the panarchy cycle in terms of shifting from the growth stage to the conservation phase.

      https://passel2.unl.edu/vie....

      It accords with the necessary transition from a r-selected strategy to a k-selected strategy. It accords with the maximum power principle in that the goal of evolutionary system design is to optimise the balance between the rate of energy transfer with efficiency of energy transfer which means optimising the balance between force functions, resilience functions, adaptability functions and reproductive functions. In other words, maximising survival potential.

      https://www.ecologycenter.u...

      Finally the transition from the growth imperative to the balance imperative accords with the need for the human species to balance with Earth systems and in particular balance human activity with the natural carbon, oxygen, nitrogen, phosphorus and water cycles to ensure healthy and resilient functioning of these cycles.

      It is of course, natural cycle disequilibrium that typifies human ecological overshoot with the exponential growth of high entropy waste associated with an exponentially growing human abiotic environment which cannot be assimilated naturally by nonhuman biotic and abiotic systems.

      Therefore I propose that the Post Growth cultural revolution be predicated on the balance imperative with the understanding that nonhuman associated ecological growth needs to be balanced with the human biotic and abiotic enterprise. And that this is a zero sum game between the k-selected strategy and the current r-selected strategy.

      I think the meme of 'Post Growth' is more relevant than the meme of Degrowth although degrowth can be seen as sub category of Post Growth. I think Post Growth is more relevant because it better describes what is actually occurring within the panarchy cycle and is therefore more relatable in terms of public education and public discourse in terms of explaining actually existing dynamics regarding human societies hitting per capita limits to economic abiotic growth and human societies hitting per capita ecological carrying capacity limits.

      I would suggest limits to economic growth is indelibly linked to breaching carrying capacity limits but further research is needed to qualify that. This hypothesis suggests that capitalism is responsive to both ecological scarcity and ecological carrying capacity breaches through the price mechanism and should be considered as part of the suite of educational tools to inform the public exactly what is going on beyond the false growth narrative being disseminated by politicians, think tanks, the media and business leaders.

      Similarly, the capitalist state system does have resilience mechanisms by which economic contraction can be absorbed to some degree. I feel we need to utilise these systems rather than throw the baby out with the bath water.

      By educating the public at the same time as leaning on the resilience functions embedded within the state capitalist system, we can help coordinate temporary and long lasting solutions to permanent per capita economic contraction by rerouting energy and material throughput as necessary. Therefore rather than a solely bottom up approach, I think we also need to utilise current top down systems to facilitate bottom up participatory approaches in order to try and create a win win mutualist strategy. This would include allowing maladaptive state capitalist functions to perish.

      Thus rather than using post growth dynamics to reject the state capitalist system which I think will make our shared future even more daunting, I suggest we use the state capitalist system to provide ourselves with buffers to deliberate on the next steps.

      This would include devising remedial solutions as different parts of the state capitalist system collapses. This means a more gradualist contraction strategy whereby we rationally respond to the changes that are being indicated by the state capitalist system which as I argued above is probably in sync with ecological scarcity and carrying capacity limits via the invisible hand of the market.

      This isn't to say that part of the cultural revolution from the growth imperative to the balance imperative is to try and make capitalism more sustainable. It is to recognise that capitalism itself emerged as a bottom up strategy from its mercantile roots and that we can now activate the emergence of another bottom up system from the roots of the capitalist system.

      BalancenotGrowth

      OnePlanetLiving

    1. On 2024-03-29 20:49:08, user Scott Saunders wrote:

      Nice preprint! You may want to cite this paper. "Sean A. Higgins, Sorel V. Y. Ouonkap, and David F. Savage. Rapid and Programmable Protein Mutagenesis Using Plasmid Recombineering."

    1. On 2024-03-26 10:05:44, user Davidski wrote:

      Hello authors,

      Your preprint claims that present-day Hungarians are genetically similar to Scythians, and that this is consistent with the arrival of Magyars, Avars and other eastern groups in this part of Europe.

      However, present-day Hungarians are overwhelmingly derived from Slavic and German peasants from nearby Hungary. This is not a controversial claim on my part; it's backed up by historical sources and a wide range of genetic analyses.

      Hungarians still show some minor ancestry from Hungarian Conquerors (early Magyars), but this signal only reliably shows up in large surveys of Y-chromosome samples.

      The Scythians that you used to model the ancestry of present-day Hungarians are of local, Pannonian origin, and they don't show any eastern nomad ancestry. So they're either acculturated Scythians, or, more likely, wrongly classified as Scythians by archeologists.

      And since these so-called Scythians lack eastern nomad ancestry, the similarity between them and present-day Hungarians is not a sign of the impact from Avars, Hungarian Conquerors and the like, but rather a lack of significant input from such groups in present-day Hungarians.

      I've done a rather long blog post about your analysis of Medieval Poles and present-day Hungarians at the link below. Hopefully you'll find it useful.

      https://eurogenes.blogspot....

    1. On 2024-03-26 03:38:19, user James Mallet wrote:

      Congratulations on an interesting theoretical paper which sounds very plausible!

      Some comments:

      1) Your abstract ends:<br /> "Here, we show that these empirical patterns all emerge from a single theory incorporating the evolution of cis and trans-acting regulators of gene expression. This theory offers a level of parsimony and generality rarely seen in biology."

      But you don't say what "THIS THEORY" is! A vague mention of "cis and trans-acting regulators of gene expression" does not well encapsulate your hypothesis, if I understand it correctly. Your problem is to explain chromosome-wide effects, the effect of overall ancestry. You don't mention a key part of your theory, which is DOSAGE COMPENSATION!!! I think you should do this in the abstract.

      2) You don't cite our papers, and why should you have done so? -- they came out very recently, probably after you'd done most of this work.

      However, I think our recent genomic mapping papers on Haldane's Rule in female heterogametic butterflies are highly relevant and provide circumstantial evidence for the chromosome-wide, polygenic effects required in your dosage-compensation hypothesis, especially on the Z chromosome. The two relevant papers are:

      Rosser, N., Edelman, N.B., Queste, L.M., Nelson, M., Seixas, F., Dasmahapatra, K.K., & Mallet, J. 2022. Complex basis of hybrid female sterility and Haldane's rule in Heliconius butterflies: Z-linkage and epistasis. Molecular Ecology 31:959-977. https://doi.org/10.1111/mec...

      Xiong, T., Tarikere, S., Rosser, N., Li, X., Yago, M., & Mallet, J. 2023. A polygenic explanation for Haldane’s rule in butterflies. Proceedings of the National Academy of Sciences of the United States of America 120:e2300959120. https://doi.org/10.1073/pna...

      The latter paper especially, which re-analyzes inferences made about the weird epistatic sterility effects inferred via QTL analysis in the former paper. A quantitative proportion of ancestry effect is a better fit, according to Xiong et al., than the single locus + (left and right end of the chromosome pairwise epistasis) proposed by Rosser et al.

      Of course, it was well known since Dobzhansky 1936 that hybrid sterility in Drosophila was multi-locus. See: Dobzhansky, T. 1936. Studies on hybrid sterility. II. Localization of sterility factors in Drosophila pseudoobscura hybrids. Genetics 21:113-135. https://doi.org/10.1093/gen...

      I think our papers suggest, or at least comport with the idea that in two distantly related pairs of butterfly species, female hybrid sterility is also mediated by multilocus effects, at least along the Z chromosome. The fraction of ancestry matters.

      As we wrote "The molecular nature of polygenicity is unresolved. In our case, it is tempting to consider epigenetic mechanisms between autosomes and the Z chromosome. For instance, genetic variance of pupal weight in backcross males is much smaller than that in females (SI Appendix, Table S2). This is consistent, for instance, with dosage compensation in Lepidoptera in which both Z chromosomes in<br /> males are partially suppressed (37), which will dampen the effects of introgressed factors."

      Anyway, congratulations on a very stimulating idea that certainly seems plausible!

    1. On 2024-03-25 12:29:58, user Pedro H. Oliveira wrote:

      This is an interesting study, but the authors fail to mention recent work linking defensome and ecological contexts such as: https://www.nature.com/arti...

      Also, the link between lack of DSs and intracellular/parasitic lifestyle is known for several years. Some refs are lacking.

    1. On 2024-03-25 11:20:00, user Vincent Viala wrote:

      Great work. Essential for the new era of ab initio transcriptomics. Congratulations. Have you considered basecalling with Dorado and generating Duplex reads with the kit 14 chemistry? Best regards

    1. On 2024-03-22 13:47:09, user Georg wrote:

      As for the identification of the so-called East Scandinavian cluster associated with the I1 Y haplogroup, conclusions about the Baltic source are premature - the isolated autosomal complex is characteristic of groups of hunter-gatherers found from the Mesolithic Iron Gates, Neolithic Northern Germany ostorf003 and possibly EastBaltic

    2. On 2024-03-18 17:57:45, user Martin Rundkvist wrote:

      I have a few suggestions for making this fascinating paper more comprehensible to archaeologists and historians. I have edited about 120 issues of two journals. Feel free to get in touch.

    1. On 2024-03-20 11:33:13, user Chris Baumann wrote:

      Upon reading the recent preprint titled “Dietary reconstructions of Magdalenian canids from SW-Germany do not indicate that the area was a centre of early European wolf domestication” by Bons et al. on BioRxiv, it has come to our attention that certain aspects require clarification to ensure accurate information is conveyed. First and foremost, it is essential to mention that the referenced paper has undergone a rigorous peer-review process and did not meet the acceptance criteria, resulting in its rejection. Maintaining transparency and accuracy in discussions related to the scholarly review process is imperative. In responding to the preprint, our intention is to focus on rectifying any potential misinterpretations within the content of our work. While constructive criticism and scientific discourse are vital components of academic discussion, our emphasis remains on addressing the scientific aspects rather than engaging in personal disputes. Below we address the seven main scientific criticisms of our study.

      1. Why were the canids from Gnirshöhle called dogs?

      In our paper, we did not definitely classify the remains as dogs or wolves on purpose. We hypothesize that all Gnirshöhle canids had restricted diet and where at the beginning of the domestication process of wolves leading to dogs, which is why we have chosen the title as "A refined proposal for the origin of dogs". All scientific evidence points out that wolves are the wild ancestors of dogs, so addressing the origin of dogs requires that we investigate some ancient wolves. During the early steps of wolf domestication, it is expected that the first changes will take place in the behavior of some individuals within a larger wolf population and therefore, changes in the isotopic composition of canid bones will occur among individuals with similar genetic background. This is exactly what is documented in our article, as the canids were genetically like wolves at the mitochondrial level, while their diet was very specific and not comparable to the diet of other wolves from the Magdalenian. To us and the reviewers of our study, this was convincing evidence of a restrictive diet, most likely influenced by prehistoric humans, which can be interpreted as pet-keeping. This would be the first step of wolf domestication - hence the title of the article, consistent with recent scientific literature.

      1. Why did we include foxes and did two large canid clusters?

      As Bons et al. correctly pointed out, the number of clusters can be reduced or increased. To test if the chosen number of clusters leads to a bias in the distinction between the two clusters of large canids, we made another analysis by first excluding the foxes and reducing the number of clusters to two. The result is that the large canids are divided in the same way, as in our three clusters, into two groups of large canids. Only the one wolf from Schussenquelle (SCH-11), formerly in the fox niche, joins the canids from Gnirshöhle, because of its low δ15N value. Nevertheless, the same clear difference can be seen between the large canids with high δ15N values (δ15N = 7.9 ± 0.9 ‰) and the large canids with low δ15N values (δ15N = 5.8 ± 0.3 ‰, which we have called diet-restricted canids). To separate the foxes and use them as a ‘trophic outgroup’, we decided to construct three clusters instead of two in our original article.

      1. Why is comparing the isotopic variation of modern wolf hair with the isotopic variation in ancient wolf collagen invalid and misleading?

      Bons et al. compared our measured isotopic values in bone collagen with those of modern wolf hair from the USA. This argument is intended to show that our niche reconstruction is not valid because the intraspecific variability of the isotopes is too large to allow it. However, hair records a snapshot of individual life and therefore are subject to short-term and seasonal dietary fluctuations, leading to potentially high isotopic variability. In contrast, bone collagen records average isotope values over several years of the animal's life. Therefore, the ranges of isotopic variations of bone collagen are not comparable to those from hair. A high variability in hair isotope data comes from seasonal, regional, and other short-term and local variations, while in contrast, high variability in bone collagen can only come from different dietary preferences over a long period of time spanning over a year. Thus, isotopic variations in bone collagen were adequate to show different feeding strategies and are related to trophic behavior and niches.

      1. Did the inclusion of one data point possibly from the Late Pleistocene to Holocene transition influence the interpretation?

      We used only isotopic data from the Magdalenian (c. 16 to 14 k yrs calBP) to calculate diet and niches, therefore prior to this environmental transition. Only one single wolf from Hohle Fels (c. 13.2 kyrs calBP) could fall into the Late Pleistocene to Holocene transition, which dated from c. 12.4 - 10.8 kyrs BP. However, this potential chronological outlier was not the subject of discussion. All the other 13 canid individuals, as well as the food resources, come from secured archaeological layers of the Magdalenian or have even been directly dated (all dates were published in our article).

      1. Why did we use the TEF of foxes instead of wolves?

      Bons et al. questioned our decision to use the TEF values of foxes from Krajcarz et al. (2018) and not using the published wolf’s TEF values. The values calculated by Krajcarz et al. (2018) correspond to a “natural” case study, where canids have to actively forage, catch, and consume their own food, in contrast to the published wolf TEF values, calculated more indirectly. They are thus the most recently published and the closest to the reality of canid’s metabolism. The metabolism of foxes and wolves is very similar because they belong to the same taxonomic family and could feed on the same kind of prey.

      1. Was essential information about our dietary reconstructions not provided, and why are the results apparently not the same as in Bons et al.?

      We have included all the necessary raw data in our article to allow scientists to replicate our calculations. The most important control factors for good and usable models are the Geweke and Gelman-Rubin tests. Both tests independently indicate the convergence of the model and are essential information that must be given for the models used. The chain length of the Markov chain Monte Carlo (MCMC) must also be reported, as well as the number of chains and the burn-in. The reason that Bons et al. got different results from the model than we did may be that their model did not run convergently, which cannot be verified due to the lack of Geweke and Gelman-Rubin test results.

      1. Did the individual age of GNI-999 as a subadult change the interpretation?

      According to Bons et al.’s interpretation of the CT scans of one individual, GNI-999, this is a subadult individual, which would have significantly changed our interpretation if we had included it. This is incorrect. As Bons et al. also acknowledge, this was not a young puppy, which means that the bone collagen examined was not influenced by consumption of mother’s milk. In fact, the isotopic values of subadult canids should be considered equivalent to those of an adult animal because they do not have a 15N-enriched milk signal after weaning and thus, the δ15N values of their bone collagen are not elevated. According to Geiger et al. (2016), the CT scan of GN-999 shows an age of at least four months, whereas wolves are weaned after three months (Packard 2019). Therefore, this statement does not affect our interpretation of its isotopic values. Moreover, it has also no consequences on the interpretation of the 13 other specimens of large canids considered in the paleogenetic and isotopic investigation presented in our article.

      Written on behalf of all co-authors of the Baumann et al. (2021) study,<br /> Dr. Chris Baumann

    1. On 2024-03-19 14:38:24, user Tien Anh Vu wrote:

      I am Tien Anh Vu, the co-first author of this manuscript. I would like to provide the following corrections for this preprint as follows:

      • Correspondence Contact: hai.dang@vnu.edu.vn
      • Lead Author: Dr. Thanh Hai Dang
      • Funding: This research was supported by the Vietnam National - Foundation for Science and Technology Development (NAFOSTED) under grant number 102.05-2016.14.
      • Manuscript Repository: https://github.com/aidantee...
    1. On 2024-03-18 15:25:25, user McClelland wrote:

      Are there any informative sequences that overlap between Paranthropus and Homo antecessor that would allow this additional species to be placed on the tree? It would be expected to clade closer to the other Homo. Or is the data for both so sparse that they can only be mapped relative to complete or near complete genomes?

    1. On 2024-03-18 13:29:40, user Luca Jovine wrote:

      Published on 14 March 2024 as:

      Nishio S., Emori C., Wiseman B., Fahrenkamp D., Dioguardi E., Zamora-Caballero S., Bokhove M., Han L., Stsiapanava A., Algarra B., Lu Y., Kodani M., Bainbridge R. E., Komondor K. M., Carlson A. E., Landreh M., de Sanctis D., Yasumasu S., Ikawa M. & Jovine L.<br /> ZP2 cleavage blocks polyspermy by modulating the architecture of the egg coat<br /> Cell 187:1440-1459.e24 (2024)<br /> DOI: https://doi.org/10.1016/j.c...<br /> PubMed: https://pubmed.ncbi.nlm.nih...

    1. On 2024-03-18 08:51:51, user Björn Brembs wrote:

      I only skimmed the figures for a trace of a model fly flying without visual input. Does the model generate the kind of spontaneous behavior observed in real flies if the input is omitted?<br /> I'd assume it's a bit early, but has learning been implemented in the model, yet? Is it planned? For instance, does the model learn to adapt to inverted coupling between the fly's behavior and, e.g., visual feedback?

    1. On 2024-03-17 18:53:29, user Tibor Rohacs wrote:

      Cool new structures. It is interesting that DiC8 PIP2 can bind to the same site as the endogenous PI (and capsaicin), and results in a partially open state, potentially explaining the positive effects of DiC8 PIP2 in excised patches.

      What the paper does not mention is that long-acyl-chain natural PIP2 (PMID: 17596456, 24158445) and diplmitoyl PIP2 (PMID: 17074976) also potentiate TRPV1 in excised patches. This happens in the presence of capsaicin, which is hard to reconcile capsaicin and PIP2 acting on the same binding site.

      DiC8 PIP2 binding to the vanilloid (capsaicin) site also does not explain the finding that capsaicin induces a left-shift in the dose-response of DiC8 PIP2 activation of TRPV1 in excised patch experiments (PMID: 17596456: Fig 9), begging the question, where PIP2 bind to the channel in the presence of Capsaicin.

    1. On 2024-03-17 07:37:14, user Hiroshi Mori wrote:

      In order to properly use this tool, users must purchase a KEGG FTP license. In the config.yml file of this tool, the following description exist. "KEGG_FTP_DATA_DIR: '/scratch/shared_data_new/KEGG_FTP/2023-10-11/kegg' # Replace with your KEGG FTP data directory".<br /> Authors should mention this restriction (i.e. KEGG FTP license required) in the manuscript.

    1. On 2024-03-10 22:43:57, user Alex Crits-Christoph wrote:

      This is very interesting work!

      1 minor comment upon reading:

      "Both MAGs also encoded the restriction enzyme Mrr of the type IV system but not the corresponding modification enzyme"

      There is no corresponding modification enzyme for Mrr - because it targets methylated DNA.

    1. On 2024-03-10 08:35:38, user Dmitrii Kriukov wrote:

      Thank you for the interesting reading! I have following comments/questions:

      Major:<br /> - Definitely the current state of the research suffers from insufficient validation. Please, reproduce your analysis on (Thompson, 2018); (Meer, 2018) datasets as well as other single-cell hepatocytes datasets like (Gravina, 2016.)<br /> - It is not theoretically clear how the exponent in PC-1 component is related to the one in Gompertz law. Provide more theoretical explanation as one, for example, was proposed in (Vural, 2014, Phys. Rev.)<br /> - The exponential fit to PC1 scores seems to be unreliable because I expect a large confidence interval for this parameter due to the small number of data points. Please, add confidence interval for the parameter. <br /> - I also recommend to compare exponential fit with other model families like parabolic or sin or others. AIC criterion could be used here for model comparison.<br /> - "Such a pattern of exponential growth in both mean and variance is indicative of stochastic instability of the organism state..." - this is the key phrase I saw in multiple papers from your group. I assume using this statement you implicitly refer readers to the Wiener process property of increase variance linearly with time. But I do not know which well-known process has exponential increase in variance. Could you please elaborate this explanation more in the text by adding the necessary literature references?<br /> - In your previous paper (Aging clocks, entropy and limits of age reversal) you obtained linear relation for human blood PC1 scores, no relation for PC2 scores and hyperbolic relation for PC3. My question is why PC2 in humans shows no relation with respect to some function?<br /> - I also interested why you changed methodology of CpG-sites pre-selection by comparing with the previous work in humans?<br /> - "The distribution of the loading vector components for the exponential feature, DNAm-PC1, displays heavy tails, indicating the presence of sites significantly associated with this process" - is the order of PCA loadings stable? Did you test the CpG sites with boostrap procedure, by subsampling the dataset and checking the stability of PC-loadings? <br /> - In figure 4b you demonstrate that CR mice demonstrate higher PC2/tBA values than Control. But what if this observations is due to the covariate shift between two datasets which was caught by PC2 and not caught by PC1 axis? This could explain the differences by a pure data distortions without attracting more complex theory.<br /> - No code<br /> - No supplementary info

      Minor:<br /> - "...as heavy regularization tends to select a number of features approximately equal to the sample size, based on their correlation to the target phenotype." - could you please add a reference to this theoretical result. My experiences with complexity penalization says other.<br /> - In the regards of problems with clocks, adding remarks on biomarkers paradox, multicollinearity and uncertainty problem would be beneficial.

    1. On 2024-03-10 08:03:03, user ummon wrote:

      The Huna invasions only traveled as far as Central India and it's simply implausible to suggest, as this preprint does, that the Huna could have contributed East Asian ancestry to East and North-East regions of India when such ancestry doesn't show up in regions that the Huna actually invaded.

      It is unclear from the described ALDER results whether the admixture came from a single event. More plausible is that the East Asian admixture in Bengalis diffused over time from east of Bengal.

    2. On 2024-03-05 05:02:39, user vkfromIndia wrote:

      I just want to say, coming from India, that there is not caste as Scheduled Caste or Other backward caste genetically. "Scheduled" caste comes from affirmative action by government of india which is based on British list. On the other hand, Other backward caste gained positive affirmation as a political alternative to Ram temple agitation. Both are collection of several castes. There are "most" backward caste MBC and so forth.

      I think "Jati" is the better way to go for genetic analysis. Several years ago, jati was involved with a specific profession and marriages took place inside those jati only.

      In my opinion it would be better if comparison was made between various Jati in different regions. Also, inside the same region among various jati.

      Also, It would be worthwhile to mention here that the regions marked north/central/east etc are based on political boundaries which came into existence in the 20th century, the main purpose of which was to exercise strict control over the population. It would not be appropriate to club entire 21st century political unit as a homogeneous one for genetic analysis.

      So, in summary, i think comparison could be more on the basis of traditional occupation based on jati, like yadav for milkmen, yet at the same time most important beneficiary of positive affirmation or kurmi/patel for vegetable grower etc.

    3. On 2024-02-22 21:54:05, user Davidski wrote:

      Hello authors,

      It's extremely unlikely that there are any significant genetic differences between Sarazm_EN_1 (I4290) and Sarazm_EN_2 (I4210), and also unlikely that the former has significant South Asian ancestry while lacking Anatolian farmer ancestry.

      The only significant difference between them is that I4290 is lower coverage. I suspect that this, coupled with your use of the very low quality Iran_Mesolithic_BeltCave in the outgroups, might be the problem in your qpAdm analysis.

      I4290 and I4210 appear to be very similar in all of the PCA, qpAdm and ADMIXTURE analyses that I've done. Indeed, they're close to each other in all of my PCA, including across many different dimensions, except of course the PCA that reflect different levels of coverage in the samples being run.

      For instance, here's a PCA that looks specifically at differences in South Asian and Anatolian genetic affinities. As you can see, there's practically no difference between I4290 and I4210.

      https://blogger.googleuserc...

      It is possible that I4290 and I4210 both have some sort of minor South Asian-related ancestry, but if so, then this type of low level South Asian-related admixture was ubiquitous in Eneolithic/Chalcolithic Central Asia.

      For more details please refer to this blog post and comments in which I show that both I4290 and I4210 can be modeled in qpAdm as mixtures between Botai Eneolithic and a subset of Geoksyur Chalcolithic samples.

      https://eurogenes.blogspot....

    1. On 2024-03-08 14:21:12, user Michael Jeltsch wrote:

      Anal fin blood vascular network regeneration in zebrafish has been shown to occur indirectly via transdifferentiation of lymphatics into blood vessels (Das et al. 2022). Does this hold true for the caudal fin? If yes, you might consider analyzing also VEGF-C expression!

    1. On 2024-03-08 13:17:33, user Tainara Duarte wrote:

      Dear authors,

      My name is Tainara, I am an undergraduate student in Biological Sciences at the Federal University of Minas Gerais and affiliated with the Plant Interaction Laboratory (LIVe). My research is focused on studying the interaction between plants and bacteria. Our laboratory has activities that include reading articles related to the areas of knowledge we study, called “Preprint Club”.<br /> For this activity, I selected your preprint called “Culturable approach to rice-root associated bacteria in Burkina Faso: diversity, plant growth-<br /> promoting rhizobacteria properties and cross-comparison with metabarcoding data” for reading and evaluation.<br /> In your manuscript you carried out tests with isolated bacteria and this was very interesting, studies like yours are very important to clarify the processes involved in the plant microbiome.<br /> However, I would like to make some observations about your manuscript:

      In the introduction I thought you covered several topics, which are important to the topic, but are not specific to your research so they are not that relevant.<br /> On the other hand, how do you make a direct comparison of your results with the study referring to your bibliographic reference (60) (Barro, et al 2022) I thought I could address aspects of this study in its introduction.

      Regarding the captions, in general I would suggest that the authors write more details when describing the figures so that it would be better to understand the results. This is important for the reader.<br /> Specifically in the caption of figure 4, we note that there is no caption for some images (specifically figure 4d)

      Regarding the figures in general, I would also like to suggest that the authors increase the size of the details in the figures. Specifically in figure 8, where the species included in the heat map are so close together and because they are very small, it is not possible to read them and this hinders the understanding of their results.<br /> And finally, I would like to suggest more photos and data on the results of the in vivo tests of the two rice cultivars.

      These are some notes that I thought were important to write, I hope they are useful for the authors. It was a pleasure to read the preprint of your research.<br /> All the best,

      Tainara Duarte.

    1. On 2024-03-06 22:24:50, user Jimmy Weagley wrote:

      Hi, great paper overall – very nice insight into the mechanistic and structural basis of PARIS defense.

      I am curious about your discrepancy with Rousset et al. (2022) regarding whether PARIS is a toxin-antitoxin system. They state, “We then focused on the system from E. coli B185 for subsequent experiments. Deletion of either ariA or ariB was non-toxic and abolished defense, excluding the hypothesis of a toxin-antitoxin system and showing that both components are required for activity (Figures S4C–S4E).” If ariB encodes a toxin, I expect they would have observed growth inhibition when deleting ariA. They don’t show the growth curves of these two mutants, only lawns with plaques in Figure S4.

      Additionally, Burman et al. (2024) state “As opposed to prototypical toxin-antitoxin systems, AriB isn’t toxic when expressed alone. This suggests that AriA activates AriB through a structural modification that enables dimerization or an unidentified posttranslational modification. More work will be necessary to determine the mechanism of AriB release and activation.” And “Expression of AriB alone is not toxic to the cells, nor does it provide phage defense [Rousset et al. (2022)]”.

      In your experiments, you only observe toxicity when overexpressing AriB, and not from the native promoter. Do you think this is an accurate representation of the natural/normal toxicity of AriB? Do you think these genes are transcriptionally regulated and only expressed at levels sufficient for toxicity during phage infection? Do you think the basal level of AriB expression from the native promoter is low enough to avoid the toxicity you observe during overexpression? Your results suggest that AriB toxicity doesn’t necessarily depend on “a structural modification that enables dimerization or an unidentified posttranslational modification” as posited by Burman et al. (2024).

      Do you think that when overexpressed at a high enough level a fraction of AriB can homodimerize without release from AriA by Ocr? You stated that “while we were initially unable to express and purify soluble AriB, we found that incubating AriA-AriB with Ocr released soluble AriB for further analysis (Figure 4c).” This made me wonder about the necessity of AriA+Ocr for AriB solubility and dimerization/activation. If you were to quantify the cellular/chromosomal abnormalities in the microscopy images presented in Figure 6 and Figure S15, do you think AriB overexpression would exhibit an intermediate phenotype to AriA and AriA+AriB+Ocr? It is hard to tell from the (single) images, but it looks like there is a higher proportion of dead (yellow) and abnormal cells in Figure S15C compared to S15A, perhaps suggesting increased AriB activity/toxicity when released from AriA by Ocr then when expressed on its own.

      It's nice that you have similar conclusions regarding the structure of the PARIS-Ocr complex as Burman et al. (2024). Additionally, their work supports your hypothesis of AriB blocking protein synthesis “potentially through cleavage of as-yet unidentified essential cellular tRNAs.”

      In short, what do you think underlies the discrepancy in AriB toxicity between your study, Rousset et al. (2022) and Burman et al. (2024)?

      Rousset, F., Depardieu, F., Miele, S., Dowding, J., Laval, A.L., Lieberman, E., Garry, D., Rocha, E.P., Bernheim, A. and Bikard, D. (2022). Phages and their satellites encode hotspots of antiviral systems. Cell host & microbe, 30(5), 740-753.

      Burman, N., Belukhina, S., Depardieu, F., Wilkinson, R.A., Skutel, M., Santiago-Frangos, A., Graham, A.B., Livenskyi, A., Chechenina, A., Morozova, N. and Zahl, T. (2024). Viral proteins activate PARIS-mediated tRNA degradation and viral tRNAs rescue infection. bioRxiv, 2024-01

    1. On 2024-03-04 20:57:10, user Jeffrey Ruberti wrote:

      This is a nice piece of work showing collagen dynamics including the fate of endogenous collagen added to the a cell culture system. See the following paper that already demonstrated exogenous collagen incorporation into cell synthesized matrix and for methods to produce an exogeneous labelled collagen that is minimally disruptive to fibril assembly. Siadat, S.M., Silverman, A.A., Susilo, M.E., Paten, J.A., Dimarzio, C.A., Ruberti, J.W., 2022. Development of Fluorescently Labeled, Functional Type I Collagen Molecules. Macromolecular Bioscience 22, 2100144.. https://doi.org/10.1002/mab...

    1. On 2024-03-04 17:13:18, user alexander_zlobin wrote:

      Hi!<br /> Please correct Fig.1. These proteases have HID, not HIE. This is a very serious and meaningful distinction. The incorrect tautomer on the scheme undermines the soundness of the study, since it questions the understanding of the enzymology of these enzymes.

    1. On 2024-03-03 18:08:21, user Lenzen Sigurd wrote:

      Dear authors and readers of this bioRxiv preprint,

      The approval of the anti-CD3 antibody by the FDA in November 2022 now enables a “disease modifying” therapy for the first time, which can delay the manifestation of T1DM by two to three years [1].

      And in combination with an anti-TNFα antibody, such a therapy even opens up the prospect of a long-term therapeutic effect with curative potential in the foreseeable future. The successful implementation of such a therapy is based on numerous studies over the last decades, which have shown (not cited in this manuscript) that the proinflammatory cytokine TNFα plays a central role in the destruction of pancreatic beta cells in the pathogenesis of Type 1 Diabetes Mellitus (T1DM) [2, 3].

      The authors Alexandra Coomans de Brachène et al. of the current MS now present results that lead them to hypothesize that the interferons IFNα and especially IFNγ play a prominent role in the destruction of beta cells in T1DM. This is in contrast to the situation in the endocrine pancreas in vivo, both in patients with T1DM and in reliable spontaneous animal models of human T1DM [4]. The gene expression and protein expression of IFNγ is only low in infiltrated pancreatic islets of the human T1DM pancreas [4] and in the infiltrated pancreas of the IDDM rat model of T1DM, which is closest to the human situation [5], while the highly expressed TNFalpha is the pro-inflammatory cytokine that is centrally responsible for the destruction of pancreatic beta cells in the infiltrated T1DM pancreas [2].

      Combination therapy with anti-TCR in rats (ie, anti-CD3 in mice and humans) and anti-TNFα eliminates the infiltration with proinflammatory cytokines [3, 6], which cannot be achieved with a combination therapy with anti-IFNγ [3]. An exclusive reference to an antidiabetic effect in the NOD mouse model of T1DM is inadequate, as the authors do in the current manuscript. A large number of studies in the NOD mouse showed therapeutic success in this mouse model using a wide variety of preventive therapies, but none of these therapies could be successfully transferred to the situation in patients with T1DM [7]. A successful transfer of such a therapeutic concept into an effective translational therapy for patients with T1DM, which enables a return to a normal metabolic state, is therefore not recognizable based on the facts presented, at least not in the foreseeable future. Therefore, IFNγ does not play a central role in the T1DM pathogenesis. Such a concept lacks the necessary experimental basis.

      REFERENCES

      [1]          Herold KC, Gitelman SE, Gottlieb PA, Knecht LA, Raymond R, Ramos EL (2023) Teplizumab: a disease-modifying therapy for type 1 diabetes that preserves beta-cell function. Diabetes Care

      [2]          Jörns A, Arndt T, Meyer zu Vilsendorf A, et al. (2014) Islet infiltration, cytokine expression and beta cell death in the NOD mouse, BB rat, Komeda rat, LEW.1AR1-iddm rat and humans with type 1 diabetes. Diabetologia 57: 512-521

      [3]          Jörns A, Arndt T, Yamada S, et al. (2020) Translation of curative therapy concepts with T cell and cytokine antibody combinations for type 1 diabetes reversal in the IDDM rat. J Mol Med (Berl) 98: 1125-1137

      [4]          Jörns A, Wedekind D, Jähne J, Lenzen S (2020) Pancreas pathology of latent autoimmune diabetes in adults (LADA) in patients and in a LADA rat model compared with type 1 diabetes. Diabetes 69: 624-633

      [5]          Lenzen S, Arndt T, Elsner M, Wedekind D, Jörns A (2020) Rat models of human type 1 diabetes. Methods Mol Biol 2128: 69-85

      [6]          Jörns A, Akin M, Arndt T, et al. (2014) Anti-TCR therapy combined with fingolimod for reversal of diabetic hyperglycemia by beta cell regeneration in the LEW.1AR1-iddm rat model of type 1 diabetes. J Mol Med (Berl) 92: 743-755

      [7]          Lenzen S (2017) Animal models of human type 1 diabetes for evaluating combination therapies and successful translation to the patient with type 1 diabetes. Diabetes Metab Res Rev 33

      Sigurd Lenzen, MD<br /> Professor of Experimental Diabetes Resarch <br /> Institute of Experimental Diabetes Research<br /> Hannover Medical School

    1. On 2024-03-01 15:08:07, user Tianyu Liu wrote:

      Hi, it seems that I cannot reply the problem in the community part, so I will write my response here:

      Hi, thanks for your checking. scGPT v1 should be trained based on 10M cells rather than the 33 M cells (scGPT). We did observe a better performance of scGPT v1, thus we are doubting the contribution of increasing the number of cells for pre-training. In the discussion part, we share our ideas about doing data ablation via online learning for further improvement.

    1. On 2024-03-01 10:20:33, user Carla Perpiñá-Clérigues wrote:

      Published:

      Perpiñá-Clérigues, C., Mellado, S., Galiana-Roselló, C. et al. <br /> Novel insight into the lipid network of plasma extracellular vesicles reveal sex-based differences in the lipidomic profile of alcohol use disorder patients.<br /> Biol Sex Differ 15, 10 (2024). https://doi.org/10.1186/s13...

    1. On 2024-03-01 02:07:13, user Jeff Ellis wrote:

      I think there are several problems with section 1of the results and the legend of Fig 1.In the results section there are two experiments being described. <br /> In the first differentially tagged Pwl2 and Bas1( presumably an effector known from previous work to localise to the BIC) expressed in the same strain is inoculated onto rice rice and Pwl2 and Bas1 are shown to co-localise, which demonstrates Pwl2 is secreted into the BIC.

      In the second experiment two different strains, one carrying Pwl2 marked with GFP and the other carrying Pwl2 marked with RFP are used to co-infect rice.The claim that a BIC contains either RFP or GFP and not both only becomes meaningful if you were to state here that you specifically scanned for individual cells at the infection site that were simultaneously infected by both strains.How many such cells were observed?

      In the legend of Fig 1the statement “ confirming that the BIC does not contain Pwl2 transferred from rice cells” occurs. This is very cryptic and no mention of this is idea made in the results section. Presumably the unstated hypothesis is that transfer between BICs in the same rice cell could occur. Although the data support this the hypothesis should be included in an expanded results section. Perhaps this experiment is not necessary in this paper?

      In Fig 1 legend line 689 I think the verb should be was not were. The dashed lines in Fig1 A and B are not explained..Line 692. This should be B and D and not C and D?

    1. On 2024-02-27 08:48:43, user Herman van Eck wrote:

      This is an interesting manuscript! However, the manuscript typically describes parallelism. It is not about convergent evolution.

    1. On 2024-02-26 20:40:13, user marcinkortylewski wrote:

      The final version of this manuscript is published after peer-review at Molecular Therapy Nucleic Acids - doi: 10.1016/j.omtn.2024.102137.

    1. On 2024-02-26 19:29:08, user Chris Estes wrote:

      Am I going crazy, or have they misread Nemecek & Poore (2018)? Nemecek & Poore use a 100g of meat/kg CO2 equivalent, but in this paper they cite it as a kg/kg CO2.

    1. On 2024-02-26 16:34:20, user Claudiu Bandea wrote:

      The origin of viruses: from hypothesis to fact<br /> Claudiu Bandea (February 26, 2024)

      The origin of viruses is one of the greatest mysteries remaining in biology. In previous comments regarding the recent discovery and characterization of Borgs [1, 2], I proposed that Borgs are incipient viral lineages that originated from symbiotic or parasitic archaeal lineages, as predicted by the fusion model of the origin of viruses, by reductive evolution from cellular ancestors [3-6] .

      The reduction hypothesis regarding the origin of viruses was proposed in the mid-1930’s [7], during a period when knowledge of the structural and biochemical composition of viruses and of the diversity of cellular organisms was still emerging. However, by the middle of the last century, this growing body of knowledge led to the formalization of the modern concept of viruses [8].

      In 1957, Andre Lwoff, one of the founders of modern virology, defined viruses in his famous article “The Concept of Virus” as biological entities that: (i) have only one type of nucleic acid, DNA or RNA, (ii) multiply in the form of their genetic material, (iii) are unable to grow and to undergo binary fission, and (iv) lack energy metabolism [8]. The conceptual identification of viruses with virus particles, or virions - the transmissible, infectious forms in the viral life cycle - and the definition of viruses based on the physical, biochemical, and biological properties of these particles have both endured until recently in virtually all scientific literature and textbooks (discussed in [4, 9-16]).

      Not surprisingly, within the conceptual framework of viruses as virus particles, the historical hypotheses for the evolutionary origin of viruses focused on the structure and biochemical composition of virus particles: (i) the Pre-cellular or Virus-first Theory suggesting that viruses originated from precellular, self-replicating nucleic acids, or replicons, encoding for capsid proteins; (ii) the Endogenous or Escape Hypothesis proposing that viruses originated from cellular genomic sequences, or replicons, encoding for capsid proteins; (iii) and the historical Regression or Reduction Hypothesis proposing the reductive transition of parasitic cellular lineages, such as bacteria, into nucleocapsid-like structures.

      In context of the view of viruses as particles, the reduction hypothesis was questioned by Salvador Luria and James Darnell, the authors of one of the first textbooks of Virology [17], who wrote: “The strongest argument against the regressive origin of viruses from cellular parasites is the non-cellular organization of viruses. The viral capsids are morphogenetically analogous to cellular organelles made up of protein subunits, such as bacterial flagella, actin filaments, and the like, and not to cellular membranes.” (all quotes in italics) [17].

      Two decades later, in concert with a new perspective on the nature of viruses and a new definition based on their properties during the intracellular stage of the viral life cycle, I proposed a fusion hypothesis for the origin of viruses [3-5]. Briefly, according to the fusion hypothesis, viral lineages originated from cellular organisms that fused with their host cells through a process in which their cell membrane fused with the host membrane. By discarding their cell membranes, these novel organisms increased their access to resources present in their special environmental niche, the host cell, including the ribosomes and translation machinery. After synthesizing their specific molecules and replicating their genome using the resources found in the host cell, the parasites produced spore-like, transmissible forms, which started a new life cycle by fusing with other host cells. These incipient viral lineages diversified by reductive evolution into a myriad of viruses with smaller genomes and diverse life cycles. The origin and evolution of viruses ‘molecular organisms,’ overcomes the problems presented by the historical reduction theory.

      Nonetheless, unlike the new perspective on the nature of viruses, which, after decades in obscurity, is increasingly used to explain the biology of viruses and their role in shaping the metabolism and the evolution of their hosts [9, 11, 13, 14, 16, 18-27], the fusion model for the origin of incipient viral lineages has received little attention. Possibly, the main reason is the reminiscent scientific argument put forward by Luria and Darnell against the reduction theory, which has been recently re-articulated by Mart Krupovic, Valerian Dolja, and Eugene Koonin in their article “Origin of viruses: primordial replicators recruiting capsids from hosts” [28].

      They write: “Thus, the evolution of giant viruses, irrespective of the numerous interesting and puzzling aspects of their genome layout and biology, can be accommodated in the evolutionary scenario proposed here. Also, no evidence exists for the possible origin of viruses from intracellular parasitic bacteria. As intracellular parasitic or symbiotic bacteria have evolved numerous times and have independently given rise to extremely reduced forms, including organelles (119,120), the absence of bacteria-derived viruses suggests that the evolutionary path from a cell to a virus is impracticable.

      Patrick Forterre and Mart Krupovic emphasized the same problem with the historical reduction hypothesis: “virions were so different from any kind of cell (even the most reduced parasitic cells) that the regression hypothesis (the idea that parasitism triggered the reductive evolution from cells to viruses) was discarded as senseless by most biologists (for an exception, see Bandea 1983).” [16].

      Indeed, many symbiotic intracellular bacterial lineages evolved by regressive evolution into organelles, and several parasitic bacteria have reduced the number of their genes and proteins to a fraction of those found in their ancestors, or for that matter to a fraction of those found in some viruses. Yet, these organelles do not resemble virus particles. Nevertheless, like in the case of Luria and Darnell’s argument, the rationale used by these authors for questioning the historical reduction theory does not apply to the fusion hypothesis.

      Another scientifically sound rationale for dismissing the historical reduction hypothesis emerged from phylogenetic studies refuting the hypothesis that giant viruses originated from a fourth domain of cellular life by reductive evolution [29-31]. These studies support an evolutionary relationship of giant viruses with smaller viruses, which is consistent with the theory that they are polyphyletic and did not originate from a fourth domain. These results, however, are also consistent with the fusion hypothesis, which supports the evolutionary relationship of giant viruses with smaller viruses and contradicts the fourth domain hypothesis.

      Indeed, one of the fundamental predictions of the fusion hypothesis is that new giant virus lineages originated from diverse parasitic pre-cellular and cellular lineages throughout the history of life. Another prediction of the fusion hypothesis is that only cellular lineages that parasitize evolutionarily related hosts from the same cellular domain can transition to a viral type of biological organization. This explains the apparent homology of some of their genes with those of their hosts, which has been usually interpreted as evidence for the accretion model for the evolution of viruses towards complexity.

      As mentioned above, the current phylogenetic analyses do not exclude the reductive evolutionary diversification of the giant viruses into smaller viruses. Indeed, as recently noted by Natalya Yutin, Yuri Wolf, and Eugene Koonin: “The only alternative, however non-parsimonious, to the massive gene gain scenario appears to be independent early emergence of multiple ancestral giant viruses followed by massive losses in the branches leading to the smaller extant viruses.” [29]. This alternative is exactly what the fusion hypothesis predicts, with the realization that this process has occurred throughout the history of life, which explains the extraordinary diversity of the extant viruses, including thousands of relatively small viruses. It is difficult to envision how these small viruses have evolutionary survived for several billions years since their presumed origin, as postulated in the accretion model [28].

      Interestingly, at the other end of the accretion model, we could envision the possibility that some complex viral lineages transition into cellular lineages. That would be, indeed, an extraordinary event, but I’m not aware of any evidence suggesting such a transition. However, as discussed in the following, given the general evolutionary trend of symbiotic and parasitic organisms, the accretion model is questionable.

      I find the logic of viral evolution, as recently articulate by Koonin, Dolja and Krupovic, to be the cornerstone for our thinking about the origin and evolution of viruses: “Overall, the logic of virus evolution is defined by the key biological feature of viruses, namely their obligate intracellular parasitism.” [32]. I also find this logic of evolution to be applicable to thousands of parasitic cellular lineages from all cellular domains. In this context, unlike the virus-first hypothesis and the escape hypothesis, or their hybrid formulations, which are based on the principle of viral evolution towards complexity, and which dominate the current scientific literature, the fusion hypothesis is consistent with the well-documented reductive evolution of thousands of intracellular parasitic microorganisms. This prompts the critical question: Why would viruses evolve in the opposite way?

      Nevertheless, the holy grail of the fusion model is that it can be addressed experimentally. Even better, because this model predicts that new incipient viruses originated from parasitic cellular lineages throughout the history of life, it is possible that this natural evolutionary process can be observed in real time. Hypothetically, Borgs are incipient viral lineages that originated relatively recently, through a fusion mechanism, from archaeal ancestors evolutionarily related to their hosts [1, 2]. More extraordinary though, as I previously discussed [2, 4] some extant parasitic cellular lineages, such as parasitic red algae, are currently at various stages in their evolutionary transition into viral lineages.

      Do the current data and observations regarding the biology and life cycle of parasitic red algae support a scientific transition of the fusion hypothesis into an established fact? The fusion of these parasites with their hosts cells is surely a fact. The use of host cell resources, including, in my assessment, the host cell translation machinery and ribosomes, to synthesize their specific proteins and other components is also a fact. Another fact is that after replicating their genome using host-cell resources, these parasites direct the morphogenesis of their reproductive, spore-like, transmissible forms, which initiate a new life cycle. So, are some parasitic red algae viruses, and has the fusion hypothesis transitioned into a fact?

      References:

      1. Bandea, C., Will Borgs Illuminate the Evolutionary Origin of Ancestral Viral Lineages? bioRxiv, 2021: p. https://www.biorxiv.org/con....

      2. Bandea, C., New evidence supports the hypothesis that Borgs are incipient viral lineages. bioRxiv, 2023: p. https://www.biorxiv.org/content/10.1101/2023.08.01.549754v1#comments.

      3. Bandea, C.I., A new theory on the origin and the nature of viruses. J Theor Biol, 1983. 105(4): p. 591-602.

      4. Bandea, C., The Origin and Evolution of Viruses as Molecular Organisms. Nature Precedings, 2009: p. https://www.nature.com/articles/npre.2009.3886.1.

      5. Bandea, C.I., A unifying scenario on the origin and evolution of cellular and viral domains. Nature Precedings, 2009: p. https://doi.org/10.1038/npre.2009.3888.1.

      6. Bandea, C.I., Are Antarctic Nanohaloarchaeota emerging viral lineages? Preprints, 2019: p. https://doi.org/10.20944/preprints201911.0308.v1.

      7. Green, R.G., ON THE NATURE OF FILTERABLE VIRUSES. Science, 1935. 82(2132): p. 443-5.

      8. Lwoff, A., The concept of virus. J Gen Microbiol, 1957. 17(2): p. 239-53.

      9. Forterre, P., Giant viruses: conflicts in revisiting the virus concept. Intervirology, 2010. 53(5): p. 362-78.

      10. Racaniello, V., The virus and the virion. Virology Blog. About Viruses and Viral Diseases, 2010: p. https://www.virology.ws/2010/07/22/the-virus-and-the-virion/.

      11. Forterre, P., Manipulation of cellular syntheses and the nature of viruses: The virocell concept. Comptes rendus. Chimie, 2011. 14(4): p. 392-399.

      12. Claverie, J.M. and C. Abergel, Giant viruses: The difficult breaking of multiple epistemological barriers. Stud Hist Philos Biol Biomed Sci, 2016. 59: p. 89-99.

      13. Nasir, A., E. Romero-Severson, and J.M. Claverie, Investigating the Concept and Origin of Viruses. Trends Microbiol, 2020. 28(12): p. 959-967.

      14. Enquist, L.W. and V. Racaniello, Virology: From Contagium Fluidum to Virome. In: Fields Virology, Vol. 4. Fundamentals, 7th Edition edited by P. M. Howley and D. M. Knipe, Wolters Kluwer. 2024.

      15. Kostyrka, G., La place des virus dans le monde vivant. PhD Thesis, Université Panthéon-Sorbonne-Paris I, 2018: p. https://tel.archives-ouvertes.fr/tel-02359424/document.

      16. Forterre, P. and M. Krupovic, The origin of virions and virocells: the escape hypothesis revisited, in Viruses: essential agents of life. 2012, Springer. p. 43-60.

      17. Luria, S. and J. Darnell, General Virology 1965, New-York: Wiley.

      18. Moniruzzaman, M., et al., Dynamic genome evolution and complex virocell metabolism of globally-distributed giant viruses. Nat Commun, 2020. 11(1): p. 1710.

      19. Correa, A.M.S., et al., Revisiting the rules of life for viruses of microorganisms. Nat Rev Microbiol, 2021. 19(8): p. 501-513.

      20. Rosenwasser, S., et al., Virocell Metabolism: Metabolic Innovations During Host-Virus Interactions in the Ocean. Trends Microbiol, 2016. 24(10): p. 821-832.

      21. Howard-Varona, C., et al., Phage-specific metabolic reprogramming of virocells. Isme j, 2020. 14(4): p. 881-895.

      22. Braga, L.P.P., et al., Novel virocell metabolic potential revealed in agricultural soils by virus-enriched soil metagenome analysis. Environ Microbiol Rep, 2021. 13(3): p. 348-354.

      23. DeLong, J.P., et al., Towards an integrative view of virus phenotypes. Nat Rev Microbiol, 2022. 20(2): p. 83-94.

      24. Depuydt, C.E., et al., Human Papillomavirus (HPV) virion induced cancer and subfertility, two sides of the same coin. Facts Views Vis Obgyn, 2016. 8(4): p. 211-222.

      25. Bandea, C.I., Endogenous viral etiology of prion diseases. Nature Precedings, 2009: p. https://www.nature.com/articles/npre.2009.3887.1.

      26. Bandea, C.I., The Prion Hypothesis at Forty: Enlightening or Deceptive? J Alzheimers Dis, 2022: p. https://www.j-alz.com/editors-blog/posts/prion-hypothesis-forty-enlightening-or-deceptive.

      27. Caetano-Anollés, G., J.M. Claverie, and A. Nasir, A critical analysis of the current state of virus taxonomy. Front Microbiol, 2023. 14: p. 1240993.

      28. Krupovic, M., V.V. Dolja, and E.V. Koonin, Origin of viruses: primordial replicators recruiting capsids from hosts. Nat Rev Microbiol, 2019. 17(7): p. 449-458.

      29. Yutin, N., Y.I. Wolf, and E.V. Koonin, Origin of giant viruses from smaller DNA viruses not from a fourth domain of cellular life. Virology, 2014. 466-467: p. 38-52.

      30. Williams, T.A., T.M. Embley, and E. Heinz, Informational gene phylogenies do not support a fourth domain of life for nucleocytoplasmic large DNA viruses. PLoS One, 2011. 6(6): p. e21080.

      31. Moreira, D. and P. López-García, Evolution of viruses and cells: do we need a fourth domain of life to explain the origin of eukaryotes? Philos Trans R Soc Lond B Biol Sci, 2015. 370(1678): p. 20140327.

      32. Koonin, E.V., V.V. Dolja, and M. Krupovic, The logic of virus evolution. Cell Host Microbe, 2022. 30(7): p. 917-929.

    1. On 2024-02-26 08:01:28, user rock dong wrote:

      Dear Chenhao zhang, etc, could you share the dataset you used to compare Highfold vs AfCycDesign, with a download link? I hope to self compare your new algorithm vs AfCycDesign on your curated dataset that's 4.1.1/4.1.2/4.1.3. It would be best you can share your data curation methon for 4.1.3. thanks!!

    1. On 2024-02-25 14:44:57, user Ian Myles wrote:

      This is a fascinating study. The senior author presented this at a conference and the work is excellent. It would be interesting to see a follow up study that included 32degC as a condition. 32degC would provide insights into how the cells respond when at skin (surface) temperatures. But as it stands, I hope this paper finds a place in a journal that will afford it the platform it deserves.

    1. On 2024-02-24 05:45:54, user BL Somani wrote:

      In Methods it has not been described how the L-GA was added to cell culture experiments. Was it added first followed by DMEM medium or it was mixed with the medium and added/ Please give your comments. Moreover , you mentioned that it inhibits Hexokinase but you have not described that it specifically inhibits HK-2 which is mitochondrial enzyme and you mentioned no upstream intermediates were increased, in case of HK-2 inhibition which upstream intermediates are expected to increase?

    2. On 2024-02-23 07:38:38, user BL Somani wrote:

      Well I have gone through the article but in, Methods, I dont see any description about addition of L-GA, at what stage this was added and how it was added. Was it added to the cells first and the medium later or it was mixed with the medium and added to the cell culture plate. Please give your comments. Thanks

    1. On 2024-02-23 23:44:15, user Doris Loh wrote:

      The preprint stated that "taurine (TCI Chemicals) was dissolved directly into complete cell culture media at a concentration of 40 mg/mL", which is 319.62 mM. However, throughout the entire study, the only concentration of taurine used in various experiments was either 160 mM or 100 μM. Was 40 mg/mL a typo or did the authors use 320 mM instead of 160 mM?

    1. On 2024-02-22 08:03:02, user Christoph Grunau wrote:

      This is an excellent tool. We have been using it for many years now and it still outperforms the other methods for detecting differentially modified chromatin regions. It allows for the generation of chromatin "colours" and it produces reliable mutagène profiles. A particular advantage is that it relies on observed/expected values for this and not on absolute RPKM or other enrichment values. Works with or without input. I recommend it.

    1. On 2024-02-21 20:04:00, user Daphne wrote:

      Summary:

      Fusidic acid (FA) and its derivative fusidic acid cyclopentane (FA-CP) are antibiotics administered to treat Staphylococcus aureus (SA) infections. Previous studies have established that FA acts by impeding release of elongation factor G (EF-G) from the ribosome, thereby inhibiting translation. However, because previous structures of FA bound to ribosome have been solved from Gram-negative bacteria that are resistant to FA, our understanding of precisely how FA acts on Gram-positive species like Staphylococcus aureus and how resistance arises is incomplete. In this paper, the authors solve cryo-EM structures of FA- and FA-CP bound ribosomes from Staphylococcus aureus to understand their interactions with the ribosome in a native Gram-positive environment and put previously observed resistance mutants in context.The major success of this paper is its development of a structural rationale for previously observed FA-resistant mutants, and development of a structural basis for improved FA derivatives. Additionally, the authors found novel posttranscriptional modifications within the SA ribosome. The major weakness of this paper is in validation of these novel rRNA modifications. In conjunction with FA-bound Gram-negative ribosomes, these structures are important for defining the core interactions that mediate FA resistance, which could also help to enumerate the space of possible future resistant mutants.

      Major points:

      Given the high level of sequence conservation in ribosomes across different bacterial species, it would be informative to explain the benefits of investigating ribosomes specifically from S. aureus. Are the FA binding site and EF-G in S. aureus distinct from the FA binding site and EF-G in bacteria used in previous structural studies of FA-bound ribosomes? Or is there something unique about S. aureus physiology and its development of antibiotic resistance? Providing a specific explanation, perhaps by citing what previous studies in the field have not captured or providing sequence conservation metrics, would emphasize the novelty of these structures and how they contribute to our understanding of FA resistance.

      “The CHI state is the most abundant in our sample, and only a minor population is in POST state. In the FA data, 60% of the ribosomes are bound to EF-G, and 93% of those are in CHI state. In the FA-CP data, 72% of the 70S particles contain EF-G, out of which 88% are in CHI state.” Would an S. aureus ribosome dataset with EF-G bound but no FA in the sample have no detectable POST population? A comparison to EF-G bound with no FA in the sample would also strengthen the claim “In our data, however, we do observe POST state, indicating that FA inhibition allows time for the SSU head to back-swivel in presence of EF-G.” Before making claims about how FA changes the landscape of EF-G bound-ribosome conformations, it would be helpful for readers to understand the initial landscape of EF-G bound-ribosome with no FA – perhaps explaining observations from previous studies would help with this.

      In Figure 4, any differences in hydrogen bonding or other FA interactions between the three different structures should be highlighted (or lack thereof should be mentioned). Although the text describes different rotamers and positions of switch II and residues like R464, it is unclear to us how that impacts FA binding interactions.

      In Figure 5, the explanation of resistance mutations would be clearer if there were a side-by-side diagram of what interactions are present in a FA-susceptible ribosome vs FA-resistant mutant, as opposed to simply highlighting all the affected residues. As is, Figure 5 is unclear about whether multiple mutations are required to confer resistance or if each residue individually confers resistance, and the relative increase in resistance that each mutation confers. Discussion of how these mutations rationalize previously observed resistance on a structural level, and whether this structure can also rationalize the degree to which they confer resistance, would be helpful. Furthermore, we are curious how the FA-CP analog corresponds to these mutations – does the structure rationalize FA-CP resistant mutants as well? An additional figure in the style of Figure 5 but with FA-CP, showing FA-CP resistant mutants from previous studies, would further show how this structure can provide a basis for understanding resistance mutants.

      For the rRNA modifications observed in Figure 6:

      We are curious whether these modifications could be related to EF-G, fusidic acid, fusidic acid cyclopentane interactions and relevant resistance mutations. Speculation in the discussion about possible consequences of these modifications, resistance-related or not, would be helpful for readers to understand why these modifications are important.

      The authors showed the single modifications in Figure 6, but perhaps a few supplemental figures showing how the modifications interact with functionally important parts (i.e. decoding center and peptidyl transferase center) of the ribosome would be helpful for reader comprehension.

      Since FA-CP was tested against S. aureus ATCC 29213 in Garcia Chavez et. al. 2021 (reference #28), but the ribosomes in this paper are from S. aureus NCTC 8325-4, we are also curious if these rRNA modifications are general to all S. aureus ribosomes or if there is some strain-specific modification.

      The authors made their conclusions about novelty based on their map in comparison to E. coli rRNA modifications. These modifications could also be compared to other S. aureus ribosomal structures instead of the E. coli structures. Additionally, for further investigation of the cryoEM density itself, there are programs such as qPTxM or Curiosity (both of which can be found at https://github.com/irisdyoung) that could help validate that the modification is present and clarify any heterogeneity in the density. Validation by mass spectrometry or other experimental techniques would also increase confidence in the model.

      Minor points:

      In Figure S4, it would be helpful to show the hydrogen bonds or other interactions that lock switch II in place.

      Regarding this sentence, “ The other is an intermediate so-called chimeric hybrid state (CHI) of translocation, in which the head of the small ribosomal subunit (SSU) remains swiveled and tRNAs make A- and P-site interactions with the mRNA codon and the SSU head, but P- and E-site interactions with the 30S body and the 50S (12, 18).” It was not clear as to what the authors meant after the word but.

      Reviewed by Mohamad Dandan, Daphne Chen, and James Fraser

    1. On 2024-02-21 19:14:22, user Priyanka Bajaj wrote:

      In a previous paper, the authors expressed fragments of peptides to identify sequences that would act as “dominant negative” inhibitors of the parent protein. However, screening peptides for inhibitory effects in cells by bulk competition and deep sequencing has limitations. Due to their limited size, peptides can potentially have multiple non-specific or off-target consequences such as multiple target binding, cytotoxicity, or non-specific binding to the target protein of interest. Validating that a peptide is a true inhibitor is critical, however, determining the mechanism of inhibition across multiple fragment sequences can be very time consuming. Genetically this could be done testing fragments in overexpressed target protein backgrounds to help confirm that the interaction between a given fragment and the desired target is due to target inhibition but, for libraries of fragments, a more high throughput method would be desirable. While in some cases (such as with GroEL and GroES) the authors inferred that the inhibitory effect of fragments were specific interactions due to the concentration of the target protein (i.e. correlation between higher expression of target and inhibition), the mechanisms of inhibition for several proteins were not definitively proven to occur through native interactions which leaves an open question as to whether these fragments are true inhibitors. Here they develop a computational screen to increase the confidence that inhibitory peptides work via the desired on-target mechanism, the authors have now developed a computational tool that is built upon AlphaFold called FragFold. FragFold structurally predicts the fragment bound to the target protein, with inhibitory fragments identified experimentally having a predicted high number of contacts between fragment and target.

      The major strength of this paper is in developing a method that could be used to identify regions of proteins that are involved in PPI’s based on evolutionarily related sequences that recapitulate the native binding interfaces. The major weakness of this paper is that the underlying method of MSA concatenation is not clearly explained (see Major point 1). Why is the discontinuous unpaired strategy optimal relative to other AlphaFold-multimer-like strategies? Overall, the paper demonstrates the power of AlphaFold to closely recapitulate the structures of experimentally determined fragment binding interfaces by working exclusively in sequence space in a high-throughput manner. Further, in the absence of experimental structures, the authors present plausible AlphaFold predictions of fragment bound structures that are supported by biochemical and genetic data which could further contribute to the utility of this method in studying known PPI’s.

      There are a few points we would like to bring to the attention of the authors to strengthen the manuscript further.

      Major points:

      1) The authors state that they generated multiple sequence alignments for both the fragments and target protein prior to running AlphaFold2 to minimize computation time. Although it is not clearly explained, the authors claim they concatenated these two MSA’s into a single MSA. We interpret this to mean that the input MSA’s were not directly pairing the fragment sequences to the target sequences but leaving either side of the fragment sequence and the target sequence blank to force AlphaFold to co-predict the structure of the fragment with the target protein by treating it as a single discontinuous sequence. While we were surprised by the simplicity of this method and the ability to remain in sequence space based on evolutionary similarity of fragment and target protein sequences, there are several questions we have regarding this implementation.<br /> From the explanation provided with figure 1A, the fragment sequence appears to be directly paired to the target sequence, however in fig 1B the method appears to work by using the evolutionary information of many orthologs and related proteins of both fragment and target to co-predict their structures using a discontinuous input sequence. Is this correct? Could the authors provide a clearer description of how they are concatenating the MSA’s? We were also curious to know how different concatenation strategies affect the accuracy of predictions. For example, could the authors also try concatenating directly paired fragment-target sequences from the same species of origin (or even try this as a single continuous sequence)? If the sequences are continuous, does adding linker regions between the fragment and target alter the results? Does the order of concatenation affect the results (concatenating from the N or C-termini of the target?).

      2) In Figure 2A, the peaks indicating inhibitory activity correlate positively with the observed peaks in calculated weighted N_contacts, which forms the basis for all inferences. However, the data reveals an interesting observation in the initial segment of the protein fragment (0 to 100 aa) that while there is a peak indicating predicted binding by the AlphaFold model, there is no corresponding inhibitory activity observed for the protein in that region. Any comments on this discrepancy?

      3) The authors introduce (f_native,pairwise) and (f_native,binding) to quantify similarities between experimentally solved structures and AlphaFold2 models. We found the explanation of these metrics to be confusing, one refers to the fragment and the target site but the other refers to the native binding site bound by the fragment. Is one referring to the contacts made in the experimental structure and the other the contacts in the AlphaFold model? Further clarification of what these precisely correspond to would be helpful for discerning the similarities and differences between the two.

      4) In both figures 2 and 3 the authors show structures of the experimentally solved complexes and the predicted AlphaFold models side by side. We were curious to know whether the AlphaFold models were able to recapitulate the sidechain conformations. In addition we were also curious to know whether the AlphaFold model recapitulated any key contacts made between the binding site and the fragment (ex: salt bridges, electrostatic interactions between charged amino acids, pi-pi stacks, hydrogen bonds between sidechains).

      5) The authors explain their use of tiling to generate inhibitory fragments and that overlapping fragments generate greater predicted binding peaks. Have the authors attempted to use smaller fragments in their program (i.e. what is the smallest fragment size that AlphaFold can still predict to be correctly binding?). We are curious to know if effects vary by changing the fragment sizes. Further, can this method be expanded upon to study multiple different fragments that bind to different sites on the target protein simultaneously?

      Minor points:

      1) The orange and yellow lines used to show contacts between the fragment and target are difficult to distinguish from each other. Consider a different set of colors?

      2) Figure 4C+E. The use of black in the model makes it difficult to distinguish the sidechains and interactions with the fragment.

      • Reviewed by CJ San Felipe, Priyanka Bajaj and James Fraser (UCSF)
    1. On 2024-02-21 16:10:16, user Susanne Fuchs wrote:

      I really like your paper and currently working on vocalizations in an evolutionary games where people need to create new vocalisation. I had the feeling that the participants (adults) were less creative than I thought they could have been - and maybe this also links back to what you have done. Would be very curious to see some of your data. How long did you take to record all these babies? And why did you do a catgegorization and did not do a bottom up acoustic analysis? Is there any reason?

    1. On 2024-02-20 16:27:03, user Diego del Alamo wrote:

      (The comments below are my own thoughts and aren’t meant to serve as a substitute for peer review)

      This manuscript presents a much-needed quantitative examination of structures of LeuT fold transporters, which are helical membrane proteins that import and export a wide variety of substrates in and out of cells. In the context of protein dynamics, this superfamily is characterized by a diverse range of conformational changes amongst its members, with some helices staying fixed in some representatives but not others throughout their respective transport cycles. In this analysis, the authors break down these conformational changes between pairs of structures using a rotationally- and translationally-invariant method for tracking helical movements (distance difference matrices, or DDMs). From these movements, the authors conclude that bundle-hash rocking is the foundation defining all conformational changes in proteins in this superfamily.

      The results are compelling, but my enthusiasm is somewhat dampened by the use of a comparatively small dataset and relative absence of mathematical rigor. I think this can easily be addressed with a bit of additional analysis.

      The basis for the main finding, stated above, derives from a principal component analysis (PCA) of these DDMs. If my understanding is correct, the authors use distance differences in 22 pairs of structures across nine proteins and arrive at six distinct motions that can explain most of these changes. While the authors show the reconstruction error when different numbers of principal components (PCs) are used in Fig 3D, I did not see a mathematical justification for selecting six components specifically. It might help to compute a statistical criteria such as the Akaike or Bayesian Information Criterion to verify that six PCs is the appropriate number.

      By the same token, it would be beneficial to run some cross-validation on some intentionally left out structural pairs. A low reconstruction error on proteins left out during parametrization would go some way toward supporting the authors’ conclusion that these movements are shared. For example, can the conformational dynamics of NSSs like SERT and LeuT be explained entirely using PCs derived from structures in other families?

      Finally, I would strongly encourage the authors to expand their analysis to include new structures deposited after mid-2021. I understand that this would add a lot of work, as I suspect that segmentation and assignment of residues to helices is done manually. But given the rapid clip at which these LeuT-fold structures are being deposited in recent years, it could significantly increase the size of the dataset. Off the top of my head, this would add NKCC1, KimA, and SGLT2, and probably others.

      Beyond that, a few things here and there stood out:<br /> • It isn’t clear based on Fig 3F or the text if the PCA itself is segmented by specific steps in the conformational cycle, or if the structural pairs are unlabeled during analysis (I suspect the latter from the text).<br /> • On the use of pymol cealign to align pairs of structures, it is a little strange given that this is a sequence-independent method intended to align proteins with little to no sequence homology. However, given the low RMSD between their pairs of structures, and that the paper’s bulk focuses on alignment-independent analysis, this is unlikely to affect the conclusions much at all (I've also tested it on a few pairs and the results look more or less identical to other sequence- and structure-based alignment methods). With that in mind though, I wouldn't state RMSD values in the text if they were calculated this way, unless they are supplemented by other metrics, such as TM-score<br /> • The name MntH is used throughout the text, except at the very end where the name DraNramp is used. I assume these are the same protein?<br /> • I just want to say that including an analysis where the membrane serves as a reference plane for a structural analysis is a great idea and very much appreciated, and I hope others follow your example and do the same thing

    1. On 2024-02-20 09:47:16, user Nils Schuergers wrote:

      Nice work! Instead of reference 42 you probably wanted to cite "Nils Schuergers, Tchern Lenn, Ronald Kampmann, Markus V Meissner, Tiago Esteves, Maja Temerinac-Ott, Jan G Korvink, Alan R Lowe, Conrad W Mullineaux, Annegret Wilde (2016) Cyanobacteria use micro-optics to sense light direction eLife 5:e12620"

    1. On 2024-02-19 15:17:57, user Mathis Riehle wrote:

      super nice - congratulations conceptional very persuasive paper!

      Q: is there a link to the movies to have a look? Would love to use them in class in the future - nothing like seeing is believing.

      slight critique - the bar graph overlays on top of the data in figs 2B, D & F, 3D, 4C & E, 5C & D & 6C are OK - if you think that you need them - but consider toning their intensity down to allow one to 'see the data' - they are a bit 'in the way'/too strong imho.

      Not quite sure if the n numbers given in the figures for 'cells' are for independent experiments or neighbouring cells? If they are in the same dish it would quite difficult in dens(ish) cultures as shown to be assured of independence; in your methods you talk about 3-8 independent experiments - here exemplary analysis showing the data as visualised via e.g. SuperPlotsofData by J Goedhard (https://huygens.science.uva... & DOI: 10.1083/jcb.202001064) would give assurance that these datasets are good to be assembled/pooled together?

    1. On 2024-02-19 11:12:56, user Andrew Almonte wrote:

      An interesting paper. Regarding the sequences in Table 2, you state that the ompC protein in clade C3 has a 181_182insDPD in strains ST73 and ST12. It's written as N/DPD/F, but position 181 is a G in the reference genome. Is this a clerical mistake or am I misunderstanding the alignment?

    1. On 2024-02-18 12:34:22, user Michael Polymenis wrote:

      The paper has been published. Mol Biol Cell. 2023 Dec 1;34(13):br20. doi: 10.1091/mbc.E23-05-0166. Epub 2023 Oct 4.<br /> PMID: 37792491

    1. On 2024-02-17 21:21:04, user arva43 wrote:

      Hi,<br /> Please note that some of your figures are unreadable, as they were uploaded in mirror mode, and the quality of some of them is quite poor. <br /> Bests

    1. On 2024-02-16 19:24:51, user Joerg Deutzmann wrote:

      Exceptional work and a big step in improving productivity in MES systems! The authors did a great service to the field by highlighting that MES has the potential to compete with gas fermentations! Congratulations!

      In case my quick comment from earlier gets published, I apologize for the partial double post. However, after reading the paper more carefully, I wanted to amend the post and add the following:<br /> 1) One concern regards the presentation and perception of the data, which could provide an unjust hurdle for others in the field when publishing their MES improvements. While nothing is stated wrongly, the abstract already implies a >200-day production of carboxylic acids at an unprecedented rate, efficiency, and current density. However, the stated maximum values are derived from what seems to be single measurements (CP) or a series of two values (CA) in a time series and represent spikes in productivity. Thus, other studies that might achieve improved average KPIs, e.g., stable production rates between the average rate and the peak rate achieved in this study (which seem to differ by a factor of about two; ~20 kg/m3 vs. ~40 kg/m3 butyrate in Fig. S4A, for example), could be regarded as not improving the field, because the production rates presented in the abstract and highlighted in the main text give the impression that higher rates have been achieved already during long-term operation. <br /> This leads me to a quantification question: How confident are the authors regarding the accuracy of the values of individual measurements? The data is significantly scattered, which could be due to a scatter in the sampling and quantification methods or due to biological fluctuations. While it is certainly possible that the microbial system performs exceptionally well for a few days only to subsequently crash and almost halt production for the next few days, a high scatter in the quantification methods (i.e., high measurement or sampling uncertainty) could result in a similar data profile. Unfortunately, the temporal resolution of the data is not high enough to clearly show biological fluctuation (with the potential exception of the 2-4 point peak in Figure 4D). Without clear evidence that the exceptional production rates and increases in product concentration are indeed caused by true biological fluctuations, highlighting these occasional values throughout the manuscript seems misleading. Even if these production rates are the result of biological fluctuations, a more detailed discussion of the highly fluctuating performance and its impact might be warranted. If dense biofilms are prone to cause these enormous fluctuations that would open an exciting and important field of research for biofilm-based MES. Nevertheless, the described system seems unable to continuously produce the exceptional amounts of product frequently highlighted in the manuscript. Therefore, reporting averaged production rates (over at least 3-5 measurements) together with peak values in sections like Abstract, Summaries, Conclusions, and Highlights (which are most likely to be posted most visibly and therefore picked up by data mining and AI nowadays used to gather data) would be a more honest representation of the results and seems more appropriate to me. The rates and other performance indicators are extraordinary enough, even without the focus on a few exceptional values.

      2) Furthermore, a comparison to “state of the art” MES systems and the statement that “biofilm-based MES have so far outperformed MES driven by microorganisms in suspension by several orders of magnitude” should be backed by values cited from the appropriate sources. The rates and other KPIs for studies cited in the paragraph starting line 59 are not mentioned to allow verification of the order of magnitude statement. Further, I would like to add that we recently also achieved integrated electrosynthesis of acetate with suspended cells at 40-95% CE and at rates that approach glucose-fed chemostats at high acetate titers, which is in the order of the “state of the art” KPIs cited later in the paper (https://doi.org/10.1016/j.b... and supplements). A direct comparison to a variety of studies in multiple KPIs instead of hand-picking pair-wise comparisons would help to paint a more holistic picture of the improvements this study adds to the field.

      3) The microbial biomass reported is very high. Even to a degree that almost sounds impossible. Do the authors report wet weight or dry weight? I assumed dry weight because the cited reference states “Consequently, assuming νN,X = 0.2 molN molX−1 as coefficient of nitrogen in the elemental formula of dry biomass, (Popovic, 2019) the total amount of biomass in the reactor was obtained… “.<br /> 390 g/L dry weight would exceed the dry mass density of the cytoplasm of E. coli (https://doi.org/10.1371/jou....<br /> Further, water content is essential within biofilms and has been determined for several pure cultures and mixed biofilms and usually ranges from 70-98% (e.g., https://doi.org/10.1080/104..., whereas the maximum water content at 390 g/L cell mass would be less than 65% and exclude larger flow channels. Further, the cathode volume presumably also includes the carbon felt (assumed density 0.1g/cm3 with a carbon density of 2g/cm3 = ~5% of the cathode volume). Thus, less than 60% of the cathode compartment volume would be water. To push 2 cm/s of fluid through such a dense biofilm seems almost impossible to me! <br /> Could you provide a little more detail into how this incredible biomass density was calculated and whether this density is comparable to other biofilm systems? Further, do you assume EPS is in the biofilm, and would this contain N as well? Could ammonia pass the Cation Exchange membrane and be lost? Could ammonia (or other volatile N-compounds) be stripped in the bubble column and impact the biomass quantification in a long-term experiment?

      4) Why focus the comparison to other non-MES systems on syngas fermentation? H2/CO2 gas fermentation would be more similar to the MES process. For Example, Kantzow and colleagues produced 148g/L/d acetate or (>2.4 gc L-1 h-1) from H2/CO2 in a continuous system with suspended cells (10.1016/j.jbiotec.2015.07.020). Further, Figure 5 B is likely not the best visualization of the comparison to other studies, because the points of all comparison studies cannot be distinguished on the [X] axis. The SI table containing the values would be more informative than this figure in the main MS.

      I’m happy to discuss more and again congrats to a MES system that performs so well!

      P.S. Based on your experience with this system, do you think Clostridium luticellarii and Eubacterium limosum would be good candidates for pure culture MES?

    1. On 2024-02-13 04:16:02, user GN wrote:

      Great paper and fantastic use of iPOND to examine the DNMT1-DNA adduct proximal proteome.

      I would like to get clarification on something on this paper if possible.

      Lines 325-327 state that the data shows SUMO-dependent ubiquitylation (of DNMT1-DNA adducts) is promoted by RNF4 and TOPORS. Perhaps I missed it, but I could not see direct evidence for ubiquitylation in the data figures. I had interpreted that the authors were inferring ubiquitylation from the effects of TOPORS/RNF4 KO on DNMT1-DNA adducts and the known roles of these enzymes.

      Would appreciate if the authors or anyone else could help clarify this.

      Thanks<br /> GN

    1. On 2024-02-12 14:59:12, user Dianne Little wrote:

      Nice set of recommendations that will be useful for the field. Some of the citations in text don't match correct citations in the refence list.

    1. On 2024-02-09 14:44:59, user Christopher Ours wrote:

      The prior comment was written by Leslie Biesecker, Yosuke Mukoyama, Marjorie Lindhurst, Shaima Raji Abdul Rahiman Sirajuddeen, and Christopher Ours

    2. On 2024-02-09 13:32:31, user Christopher Ours wrote:

      It is good to see that an organoid model of the AKT1 c.49G>A p.Glu17Lys variant has been created. It may turn out to be useful for studying Proteus syndrome. Unfortunately, the preprint by He et al includes a number of errors and misconceptions about Proteus syndrome, previously published results, and general concepts about therapeutic research.

      It is odd that they expected to find the Proteus syndrome variant in a lymphoblast cell line (Coriell GM12209) as it has been shown that no living patient with Proteus syndrome has the variant detectable in a peripheral blood sample (PMID 21793738). In that publication, only two of 38 blood samples were positive and both of those were from deceased patients and could not be replicated. As stated in GeneReviews “It is strongly recommended to not use peripheral blood for molecular genetic testing in individuals with suspected PS.”<br /> The authors refer to our work (PMID 31194862) when they state: “Chimera animal models9 with germline transmission of the conditional AKT1 allele recapitulate the clinical manifestations of PS syndrome in the skin, bones, and vasculature…” It makes no sense to refer to chimeras and germline transmission. As well, these animals did not have an abnormal skeletal phenotype, nor did they have significant skin manifestations.<br /> The statement “Animal models are also unsuitable for identifying patient-specific treatment responses due to variations across species.” is perplexing. Animal models are widely used to model therapeutic effects. It is unclear what is meant by “patient-specific”.<br /> They claim their model is “consistent with the vascular malformation systematically seen in Proteus syndrome patients”. Indeed, there are no manifestations of the disorder seen “systematically”. The disorder is mosaic and thus not all patients have any particular manifestation.<br /> It makes no sense to refer to a “50% mosaic mutation”. The correct term to use here would be ‘variant allele fraction’. In a constitutional heterozygous genotype, VAF is 50%. If 50% of cells harbor a heterozygous variant, the VAF is 25%. It is nonsensical to say that a given mutation level is “mirroring clinical observations”. Since every patient has a different level of VAF and that level varies across tissues, it is not clear that this claim has any meaning.<br /> It is not correct that miransertib “…has shown efficacy in reducing facial bone overgrowth and the size of cerebriform connective tissue nevi in PS patients after one year of treatment, although a survey of 41 patients indicated no significant improvement in overall clinical outcomes as per the Clinical Gestalt Assessment (CGA) for PS10” (10 is the citation for PMID 35461279). In fact, that publication included no data on treatment.<br /> The authors seem to have misinterpreted our publication on vascular abnormalities in mouse models of Proteus syndrome (PMID 33030203). While the AKT1 activating variant caused an abnormal honeycomb-shaped capillary network with increased density of endothelial tubes, the key conclusion of that paper is that this variant caused a defect in the vascular remodeling of the capillary network, preventing the formation of the higher ordered vascular branching network. The He et al paper should discuss a technical limitation of their vascular organoid method in analyzing vascular remodeling in vitro.<br /> It is surprising that the methods section of the publication does not include any information on the sourcing of the therapeutics used in the study. It is important to include this in the methods as there are numerous sources of therapeutic compounds that are of dubious quality.

    1. On 2024-02-08 20:50:30, user Lin-xing Chen wrote:

      Dear authors, congrats!

      I found that it is really difficult for me to understand the figure caption of Figure 4a, could you please explain?

      And, could the metagenomes reported in this study be re-analyzed freely by other researchers?

    1. On 2024-02-07 17:53:03, user Thomas Munro wrote:

      This is very interesting. Other possible electron donors could be radicals generated by the crystallization conditions, e.g. HEPES and other buffers, residual nickel from affinity chromatography, and certain N-terminal sequences. I've argued that the ligands in 5c1m and 1jvn have undergone radical reactions for this reason: https://doi.org/kx34

    1. On 2024-02-07 14:06:01, user Antriksh Srivastava wrote:

      This is a great work, it directly relates to my recent publication in PCE (10.1111/pce.14821), we tried to quantify the effects of stomatal conductance reduction both positive and negative from a modelling perspective.

    1. On 2024-02-07 06:53:30, user Zia Mehrabi wrote:

      Note: While the percentage losses produced in this paper seem to check out, an error does exist in the last equation for the monetary impacts. Specifically, the multiplication of gross production value by percentage losses will not represent the total economic costs. To obtain these monetary impacts you need to subtract the observed value from the counterfactual production value. In practice the influence of this error is small in the study context, where the percentage cumulative losses are small (~5%). But any work building on this could correct it for more precise estimates. Fixing it will become important when trying to estimate economic impacts of individual events, where the percentage losses can be considerable. ZM.