[Paper-level Aggregated] PMCID: PMC5615879

Evidence Type(s): Functional

Summary: Mutation: p.K558delinsBP | Summary: The mutation p.K558delinsBP (c.1673_1674insTCC) indicates an alteration in molecular or biochemical function due to the insertion of nucleotides.

Evidence Type: Functional Mutation: Ala-Tyr | Summary: The duplication of Ala-Tyr at codons 502-503 suggests an alteration in molecular function due to the mutation.

Evidence Type: Functional Mutation: p.Y503_F504insTY | Summary: The insertion of p.Y503_F504insTY indicates a change in the molecular or biochemical function associated with the mutation.

Gene→Variant (gene-first): KIT(3815):p.K558delinsBP KIT(3815):Ala-Tyr KIT(3815):p.Y503_F504insTY

Genes: KIT(3815)

Variants: p.K558delinsBP Ala-Tyr p.Y503_F504insTY

[Paper-level Aggregated] PMCID: PMC5615879

Evidence Type(s): Oncogenic

Summary: Mutation: K558 del | Summary: The K558 del mutation is part of a common in-frame deletion associated with tumor development. Additionally, an in-frame deletion in exon 11 is linked to oncogenesis in a GIST.

Evidence Type: Oncogenic Mutation: V555del | Summary: The V555del mutation is identified as a somatic variant contributing to tumor progression.

Evidence Type: Oncogenic Mutation: c.1669_1674delTGGAAG | Summary: The c.1669_1674delTGGAAG mutation is a common in-frame deletion that plays a role in tumor development.

Evidence Type: Oncogenic Mutation: c.1676T>A | Summary: The c.1676T>A mutation is associated with oncogenic activity as a somatic variant.

Evidence Type: Oncogenic Mutation: c.1679T>A | Summary: The c.1679T>A mutation is recognized as a somatic variant that contributes to tumor progression.

Evidence Type: Oncogenic Mutation: p.V559D | Summary: The p.V559D mutation is identified as a somatic variant that plays a role in tumor development.

Evidence Type: Oncogenic Mutation: p.V560D | Summary: The p.V560D mutation is associated with oncogenic behavior as a somatic variant.

Evidence Type: Oncogenic Mutation: c.1666C>G | Summary: The mutation c.1666C>G, resulting in the p.Q556E protein change, is identified as a novel mutation in a classic hot-spot region, suggesting its contribution to tumor development. It is also associated with tumor progression as part of the KIT mutations observed in the study.

Evidence Type: Oncogenic Mutation: c.1666_1668dupCAG | Summary: The mutation c.1666_1668dupCAG, leading to the p.Q556dup protein change, is noted as a novel mutation associated with double mutations, indicating its potential role in tumor progression. It contributes to tumor development or progression, being one of the common KIT mutations identified.

Evidence Type: Oncogenic Mutation: c.1672_1677delAAGGTTinsAGT | Summary: The mutation c.1672_1677delAAGGTTinsAGT, resulting in the p.K558_V559delinsS protein change, is described as a partner mutation in double mutations, suggesting its involvement in oncogenic processes. It is implicated in tumor development or progression, being part of the KIT mutations found in the cases.

Evidence Type: Oncogenic Mutation: p.K642R | Summary: The novel substitution mutation p.K642R (c.1925A>G) is implicated in tumor progression in a GIST, supporting its oncogenic potential. It is linked to tumor development or progression, as it is part of the KIT mutations observed in the study.

Evidence Type: Oncogenic Mutation: c.1504_1509 dup GCCTAT | Summary: The mutation c.1504_1509 dup GCCTAT is associated with tumor development in cases of small intestine tumors, indicating its role in oncogenesis.

Evidence Type: Oncogenic Mutation: c.1509_1510insACCTAT | Summary: The insertion mutation c.1509_1510insACCTAT is noted in a case of duodenal GIST, contributing to tumor progression. It is associated with tumor development or progression, as it is one of the identified KIT mutations.

Evidence Type: Oncogenic Mutation: c.2466T>A; p.N822K | Summary: The mutation p.N822K (c.2466T>A) is associated with tumor development in a case of jejunal cancer, indicating its potential role in oncogenesis.

Gene→Variant (gene-first): KIT(3815):K558 del KIT(3815):V555del KIT(3815):c.1669_1674delTGGAAG KIT(3815):c.1676T>A KIT(3815):c.1679T>A KIT(3815):p.V559D KIT(3815):p.V560D POTEF(728378):c.1666C>G KIT(3815):c.1666_1668dupCAG KIT(3815):c.1672_1677delAAGGTTinsAGT POTEF(728378):p.K642R KIT(3815):c.1504_1509 dup GCCTAT KIT(3815):c.1509_1510insACCTAT KIT(3815):c.2466T>A KIT(3815):p.N822K

Genes: KIT(3815) POTEF(728378)

Variants: K558 del V555del c.1669_1674delTGGAAG c.1676T>A c.1679T>A p.V559D p.V560D c.1666C>G c.1666_1668dupCAG c.1672_1677delAAGGTTinsAGT p.K642R c.1504_1509 dup GCCTAT c.1509_1510insACCTAT c.2466T>A p.N822K

[Paragraph-level] PMCID: PMC5615879 Section: ABSTRACT PassageIndex: 6

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: c.1666C>G | Summary: The mutation p.Q556E (c.1666C>G) is associated with tumor development or progression as part of the KIT mutations observed in the study. Evidence Type: Oncogenic | Mutation: c.1666_1668dupCAG | Summary: The mutation p.Q556dup (c.1666_1668dupCAG) contributes to tumor development or progression, as it is one of the common KIT mutations identified. Evidence Type: Oncogenic | Mutation: c.1672_1677delAAGGTTinsAGT | Summary: The mutation p.K558_V559delinsS (c.1672_1677delAAGGTTinsAGT) is implicated in tumor development or progression, being part of the KIT mutations found in the cases. Evidence Type: Oncogenic | Mutation: c.1509_1510insACCTAT | Summary: The mutation p.Y503_F504insTY (c.1509_1510insACCTAT) is associated with tumor development or progression, as it is one of the identified KIT mutations. Evidence Type: Oncogenic | Mutation: c.1925A>G | Summary: The mutation p.K642R (c.1925A>G) is linked to tumor development or progression, as it is part of the KIT mutations observed in the study.

Gene→Variant (gene-first): 3815:Ala-Tyr 3815:c.1509_1510insACCTAT 728378:c.1666C>G 3815:c.1666_1668dupCAG 3815:c.1672_1677delAAGGTTinsAGT 5156:c.1925A>G 3815:p.K558_V559delinsS 728378:p.K642R 728378:p.Q556E 3815:p.Q556dup 3815:p.Y503_F504insTY

Genes: 3815 728378 5156

Variants: Ala-Tyr c.1509_1510insACCTAT c.1666C>G c.1666_1668dupCAG c.1672_1677delAAGGTTinsAGT c.1925A>G p.K558_V559delinsS p.K642R p.Q556E p.Q556dup p.Y503_F504insTY

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 20

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: c.2466T>A; p.N822K | Summary: The mutation p.N822K (c.2466T>A) is associated with tumor development in a case of jejunal cancer, indicating its potential role in oncogenesis.

Gene→Variant (gene-first): 3815:c.2466T>A 3815:p.N822K

Genes: 3815

Variants: c.2466T>A p.N822K

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 18

Evidence Type(s): None

Summary: Not enough information in this passage.

Gene→Variant (gene-first): 3815:c.1924A>G 3815:p.K642E

Genes: 3815

Variants: c.1924A>G p.K642E

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 16

Evidence Type(s): Oncogenic, Functional

Summary: Evidence Type: Oncogenic | Mutation: c.1504_1509 dup GCCTAT | Summary: The mutation c.1504_1509 dup GCCTAT is associated with tumor development in cases of small intestine tumors, indicating its role in oncogenesis. Evidence Type: Functional | Mutation: Ala-Tyr | Summary: The duplication of Ala-Tyr at codons 502-503 suggests an alteration in molecular function due to the mutation. Evidence Type: Oncogenic | Mutation: c.1509_1510insACCTAT | Summary: The insertion mutation c.1509_1510insACCTAT is noted in a case of duodenal GIST, contributing to tumor progression. Evidence Type: Functional | Mutation: p.Y503_F504insTY | Summary: The insertion of p.Y503_F504insTY indicates a change in the molecular or biochemical function associated with the mutation.

Gene→Variant (gene-first): 3815:Ala-Tyr 3815:c.1504_1509 dup GCCTAT 3815:c.1509_1510insACCTAT 3815:p.Y503_F504insTY

Genes: 3815

Variants: Ala-Tyr c.1504_1509 dup GCCTAT c.1509_1510insACCTAT p.Y503_F504insTY

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 13

Evidence Type(s): Functional

Summary: Evidence Type: Functional | Mutation: p.K558delinsBP | Summary: The mutation p.K558delinsBP (c.1673_1674insTCC) indicates an alteration in molecular or biochemical function due to the insertion of nucleotides.

Gene→Variant (gene-first): 3815:K580dup 3815:c.1673_1674insTCC 3815:c.1731_1742dupTTATGATCACAA 3815:p.K558delinsBP

Genes: 3815

Variants: K580dup c.1673_1674insTCC c.1731_1742dupTTATGATCACAA p.K558delinsBP

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 12

Evidence Type(s): None

Summary: Not enough information in this passage.

Gene→Variant (gene-first): 3815:p.L576P 3815:p.T574I 3815:p.V559A 3815:p.V559D 3815:p.V560D 3815:p.V560G

Genes: 3815

Variants: p.L576P p.T574I p.V559A p.V559D p.V560D p.V560G

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 11

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: K558del; c.1654_1674delATGTATGAAGTACAGTGGAAG | Summary: The in-frame deletion in exon 11 is associated with tumor development in a GIST, indicating its role in oncogenesis. Evidence Type: Oncogenic | Mutation: p.K642R; c.1925A>G | Summary: The novel substitution mutation in exon 13 is implicated in tumor progression in a GIST, supporting its oncogenic potential.

Gene→Variant (gene-first): 3815:K558del 3815:c.1654_1674delATGTATGAAGTACAGTGGAAG 5156:c.1925A>G 728378:p.K642R

Genes: 3815 5156 728378

Variants: K558del c.1654_1674delATGTATGAAGTACAGTGGAAG c.1925A>G p.K642R

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 10

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: c.1666C>G | Summary: The mutation c.1666C>G, resulting in the p.Q556E protein change, is identified as a novel mutation in a classic hot-spot region, suggesting its contribution to tumor development. Evidence Type: Oncogenic | Mutation: c.1666_1668dupCAG | Summary: The mutation c.1666_1668dupCAG, leading to the p.Q556dup protein change, is noted as a novel mutation associated with double mutations, indicating its potential role in tumor progression. Evidence Type: Oncogenic | Mutation: c.1672_1677delAAGGTTinsAGT | Summary: The mutation c.1672_1677delAAGGTTinsAGT, resulting in the p.K558_V559delinsS protein change, is described as a partner mutation in double mutations, suggesting its involvement in oncogenic processes.

Gene→Variant (gene-first): 728378:c.1666C>G 3815:c.1666_1668dupCAG 3815:c.1672_1677delAAGGTTinsAGT 728378:p.Q556E 3815:p.Q556dup

Genes: 728378 3815

Variants: c.1666C>G c.1666_1668dupCAG c.1672_1677delAAGGTTinsAGT p.Q556E p.Q556dup

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 9

Evidence Type(s): Oncogenic

Summary: Evidence Type: Oncogenic | Mutation: K558 del | Summary: The K558 del mutation is part of a common in-frame deletion associated with tumor development. Evidence Type: Oncogenic | Mutation: V555del | Summary: The V555del mutation is identified as a somatic variant contributing to tumor progression. Evidence Type: Oncogenic | Mutation: c.1669_1674delTGGAAG | Summary: The c.1669_1674delTGGAAG mutation is a common in-frame deletion that plays a role in tumor development. Evidence Type: Oncogenic | Mutation: c.1676T>A | Summary: The c.1676T>A mutation is associated with oncogenic activity as a somatic variant. Evidence Type: Oncogenic | Mutation: c.1679T>A | Summary: The c.1679T>A mutation is recognized as a somatic variant that contributes to tumor progression. Evidence Type: Oncogenic | Mutation: p.V559D | Summary: The p.V559D mutation is identified as a somatic variant that plays a role in tumor development. Evidence Type: Oncogenic | Mutation: p.V560D | Summary: The p.V560D mutation is associated with oncogenic behavior as a somatic variant.

Gene→Variant (gene-first): 3815:K558 del 3815:V555del 3815:c.1669_1674delTGGAAG 3815:c.1676T>A 3815:c.1679T>A 3815:p.V559D 3815:p.V560D

Genes: 3815

Variants: K558 del V555del c.1669_1674delTGGAAG c.1676T>A c.1679T>A p.V559D p.V560D

[Paper-level Aggregated] PMCID: PMC5615879

Evidence Type(s): Oncogenic, Predictive, Functional

Justification: Oncogenic: The text describes various mutations in the KIT gene, particularly in exon 11, which are associated with gastrointestinal stromal tumors (GISTs). The presence of these mutations, including in-frame deletions and substitutions, indicates their role in tumorigenesis. Predictive: The identification of specific mutations, such as p.K558delinsBP and p.Y503_F504insTY, suggests potential predictive value for treatment responses in GISTs, particularly in relation to targeted therapies. Functional: The mutations described, including duplications and insertions, are likely to affect the function of the KIT protein, as indicated by their association with specific tumor characteristics and morphologies.

Gene→Variant (gene-first): KIT(3815):Ala-Tyr KIT(3815):c.1504_1509 dup GCCTAT KIT(3815):c.1509_1510insACCTAT KIT(3815):p.Y503_F504insTY POTEF(728378):c.1666C>G KIT(3815):c.1666_1668dupCAG KIT(3815):c.1672_1677delAAGGTTinsAGT PDGFRA(5156):c.1925A>G KIT(3815):p.K558_V559delinsS POTEF(728378):p.K642R POTEF(728378):p.Q556E KIT(3815):p.Q556dup KIT(3815):K558 del KIT(3815):V555del KIT(3815):c.1669_1674delTGGAAG KIT(3815):c.1676T>A KIT(3815):c.1679T>A KIT(3815):p.V559D KIT(3815):p.V560D KIT(3815):K580dup KIT(3815):c.1673_1674insTCC KIT(3815):c.1731_1742dupTTATGATCACAA KIT(3815):p.K558delinsBP KIT(3815):c.2466T>A KIT(3815):p.N822K KIT(3815):p.L576P KIT(3815):p.T574I KIT(3815):p.V559A KIT(3815):p.V560G

Genes: KIT(3815) POTEF(728378) PDGFRA(5156)

Variants: Ala-Tyr c.1504_1509 dup GCCTAT c.1509_1510insACCTAT p.Y503_F504insTY c.1666C>G c.1666_1668dupCAG c.1672_1677delAAGGTTinsAGT c.1925A>G p.K558_V559delinsS p.K642R p.Q556E p.Q556dup K558 del V555del c.1669_1674delTGGAAG c.1676T>A c.1679T>A p.V559D p.V560D K580dup c.1673_1674insTCC c.1731_1742dupTTATGATCACAA p.K558delinsBP c.2466T>A p.N822K p.L576P p.T574I p.V559A p.V560G

[Paragraph-level] PMCID: PMC5615879 Section: ABSTRACT PassageIndex: 6

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the presence of KIT mutations in cases and specifies the types of mutations found in different exons, indicating their association with the disease. Oncogenic: The mention of KIT mutations contributing to tumor development is implied by their prevalence in cases, suggesting a role in cancer progression.

Gene→Variant (gene-first): 3815:Ala-Tyr 3815:c.1509_1510insACCTAT 728378:c.1666C>G 3815:c.1666_1668dupCAG 3815:c.1672_1677delAAGGTTinsAGT 5156:c.1925A>G 3815:p.K558_V559delinsS 728378:p.K642R 728378:p.Q556E 3815:p.Q556dup 3815:p.Y503_F504insTY

Genes: 3815 728378 5156

Variants: Ala-Tyr c.1509_1510insACCTAT c.1666C>G c.1666_1668dupCAG c.1672_1677delAAGGTTinsAGT c.1925A>G p.K558_V559delinsS p.K642R p.Q556E p.Q556dup p.Y503_F504insTY

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 20

Evidence Type(s): Oncogenic

Justification: Oncogenic: The passage describes a somatic variant (p.N822K) identified in a tumor, indicating its potential role in tumor development or progression.

Gene→Variant (gene-first): 3815:c.2466T>A 3815:p.N822K

Genes: 3815

Variants: c.2466T>A p.N822K

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 18

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 3815:c.1924A>G 3815:p.K642E

Genes: 3815

Variants: c.1924A>G p.K642E

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 16

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses mutations identified in tumors located in the small intestine, indicating a significant association with the disease, which supports the use of these variants in defining or classifying the disease. Oncogenic: The passage describes mutations that contribute to tumor development, specifically mentioning internal tandem duplications and insertions in the context of tumors, indicating their role in oncogenesis.

Gene→Variant (gene-first): 3815:Ala-Tyr 3815:c.1504_1509 dup GCCTAT 3815:c.1509_1510insACCTAT 3815:p.Y503_F504insTY

Genes: 3815

Variants: Ala-Tyr c.1504_1509 dup GCCTAT c.1509_1510insACCTAT p.Y503_F504insTY

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 13

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage mentions specific variants and their occurrence in a case, indicating their association with a particular disease or condition. Oncogenic: The variants discussed are likely somatic mutations contributing to tumor development, as they are described in the context of a case study.

Gene→Variant (gene-first): 3815:K580dup 3815:c.1673_1674insTCC 3815:c.1731_1742dupTTATGATCACAA 3815:p.K558delinsBP

Genes: 3815

Variants: K580dup c.1673_1674insTCC c.1731_1742dupTTATGATCACAA p.K558delinsBP

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 12

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage provides mutation frequencies for specific variants, indicating their association with a disease or subtype. Oncogenic: The mention of substitution mutations suggests that these variants may contribute to tumor development or progression, as they are likely somatic mutations.

Gene→Variant (gene-first): 3815:p.L576P 3815:p.T574I 3815:p.V559A 3815:p.V559D 3815:p.V560D 3815:p.V560G

Genes: 3815

Variants: p.L576P p.T574I p.V559A p.V559D p.V560D p.V560G

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 11

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 3815:K558del 3815:c.1654_1674delATGTATGAAGTACAGTGGAAG 5156:c.1925A>G 728378:p.K642R

Genes: 3815 5156 728378

Variants: K558del c.1654_1674delATGTATGAAGTACAGTGGAAG c.1925A>G p.K642R

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 10

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses mutations in exon 11 and their association with specific cases, indicating that these mutations can be used to classify or define a disease subtype. Oncogenic: The mention of double mutations and their role in the context of tumor development suggests that these somatic variants contribute to tumor progression.

Gene→Variant (gene-first): 728378:c.1666C>G 3815:c.1666_1668dupCAG 3815:c.1672_1677delAAGGTTinsAGT 728378:p.Q556E 3815:p.Q556dup

Genes: 728378 3815

Variants: c.1666C>G c.1666_1668dupCAG c.1672_1677delAAGGTTinsAGT p.Q556E p.Q556dup

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 9

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the frequency of specific mutations, including in-frame deletions and substitutions, which are associated with the classification of cases, indicating their role in defining or confirming a disease subtype. Oncogenic: The mention of mutations in exon 11, including specific variants, suggests their contribution to tumor development or progression, as they are described in the context of cancer cases.

Gene→Variant (gene-first): 3815:K558 del 3815:V555del 3815:c.1669_1674delTGGAAG 3815:c.1676T>A 3815:c.1679T>A 3815:p.V559D 3815:p.V560D

Genes: 3815

Variants: K558 del V555del c.1669_1674delTGGAAG c.1676T>A c.1679T>A p.V559D p.V560D

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 20

Evidence Type(s): Oncogenic

Justification: Oncogenic: The passage describes a somatic variant (p.N822K) identified in a tumor, indicating its potential role in tumor development or progression.

Gene→Variant (gene-first): 3815:c.2466T>A 3815:p.N822K

Genes: 3815

Variants: c.2466T>A p.N822K

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 18

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 3815:c.1924A>G 3815:p.K642E

Genes: 3815

Variants: c.1924A>G p.K642E

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 16

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses mutations identified in tumors located in the small intestine, indicating a significant association with the disease, which supports the use of these variants in defining or classifying the disease. Oncogenic: The passage describes mutations that contribute to tumor development, specifically mentioning internal tandem duplications and insertions in the context of tumors, indicating their role in oncogenesis.

Gene→Variant (gene-first): 3815:Ala-Tyr 3815:c.1504_1509 dup GCCTAT 3815:c.1509_1510insACCTAT 3815:p.Y503_F504insTY

Genes: 3815

Variants: Ala-Tyr c.1504_1509 dup GCCTAT c.1509_1510insACCTAT p.Y503_F504insTY

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 13

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage mentions specific variants and their occurrence in a case, indicating their association with a particular disease or condition. Oncogenic: The variants discussed are likely somatic mutations contributing to tumor development, as they are described in the context of a case study.

Gene→Variant (gene-first): 3815:K580dup 3815:c.1673_1674insTCC 3815:c.1731_1742dupTTATGATCACAA 3815:p.K558delinsBP

Genes: 3815

Variants: K580dup c.1673_1674insTCC c.1731_1742dupTTATGATCACAA p.K558delinsBP

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 12

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage provides mutation frequencies for specific variants, indicating their association with a disease or subtype. Oncogenic: The mention of substitution mutations suggests that these variants may contribute to tumor development or progression, as they are likely somatic mutations.

Gene→Variant (gene-first): 3815:p.L576P 3815:p.T574I 3815:p.V559A 3815:p.V559D 3815:p.V560D 3815:p.V560G

Genes: 3815

Variants: p.L576P p.T574I p.V559A p.V559D p.V560D p.V560G

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 11

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 3815:K558del 3815:c.1654_1674delATGTATGAAGTACAGTGGAAG 5156:c.1925A>G 728378:p.K642R

Genes: 3815 5156 728378

Variants: K558del c.1654_1674delATGTATGAAGTACAGTGGAAG c.1925A>G p.K642R

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 10

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses mutations in exon 11 and their association with specific cases, indicating that these mutations can be used to classify or define a disease subtype. Oncogenic: The mention of double mutations and their role in the context of tumor development suggests that these somatic variants contribute to tumor progression.

Gene→Variant (gene-first): 728378:c.1666C>G 3815:c.1666_1668dupCAG 3815:c.1672_1677delAAGGTTinsAGT 728378:p.Q556E 3815:p.Q556dup

Genes: 728378 3815

Variants: c.1666C>G c.1666_1668dupCAG c.1672_1677delAAGGTTinsAGT p.Q556E p.Q556dup

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 9

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the frequency of specific mutations, including in-frame deletions and substitutions, which are associated with the classification of cases, indicating their role in defining or confirming a disease subtype. Oncogenic: The mention of mutations in exon 11, including specific variants, suggests their contribution to tumor development or progression, as they are described in the context of cancer cases.

Gene→Variant (gene-first): 3815:K558 del 3815:V555del 3815:c.1669_1674delTGGAAG 3815:c.1676T>A 3815:c.1679T>A 3815:p.V559D 3815:p.V560D

Genes: 3815

Variants: K558 del V555del c.1669_1674delTGGAAG c.1676T>A c.1679T>A p.V559D p.V560D