[Paper-level Aggregated] PMCID: PMC5615879

Evidence Type(s): Oncogenic, Predictive, Functional

Justification: Oncogenic: The text describes various mutations in the KIT gene, particularly in exon 11, which are associated with gastrointestinal stromal tumors (GISTs). The presence of these mutations, including in-frame deletions and substitutions, indicates their role in tumorigenesis. Predictive: The identification of specific mutations, such as p.K558delinsBP and p.Y503_F504insTY, suggests potential predictive value for treatment responses in GISTs, particularly in relation to targeted therapies. Functional: The mutations described, including duplications and insertions, are likely to affect the function of the KIT protein, as indicated by their association with specific tumor characteristics and morphologies.

Gene→Variant (gene-first): KIT(3815):Ala-Tyr KIT(3815):c.1504_1509 dup GCCTAT KIT(3815):c.1509_1510insACCTAT KIT(3815):p.Y503_F504insTY POTEF(728378):c.1666C>G KIT(3815):c.1666_1668dupCAG KIT(3815):c.1672_1677delAAGGTTinsAGT PDGFRA(5156):c.1925A>G KIT(3815):p.K558_V559delinsS POTEF(728378):p.K642R POTEF(728378):p.Q556E KIT(3815):p.Q556dup KIT(3815):K558 del KIT(3815):V555del KIT(3815):c.1669_1674delTGGAAG KIT(3815):c.1676T>A KIT(3815):c.1679T>A KIT(3815):p.V559D KIT(3815):p.V560D KIT(3815):K580dup KIT(3815):c.1673_1674insTCC KIT(3815):c.1731_1742dupTTATGATCACAA KIT(3815):p.K558delinsBP KIT(3815):c.2466T>A KIT(3815):p.N822K KIT(3815):p.L576P KIT(3815):p.T574I KIT(3815):p.V559A KIT(3815):p.V560G

Genes: KIT(3815) POTEF(728378) PDGFRA(5156)

Variants: Ala-Tyr c.1504_1509 dup GCCTAT c.1509_1510insACCTAT p.Y503_F504insTY c.1666C>G c.1666_1668dupCAG c.1672_1677delAAGGTTinsAGT c.1925A>G p.K558_V559delinsS p.K642R p.Q556E p.Q556dup K558 del V555del c.1669_1674delTGGAAG c.1676T>A c.1679T>A p.V559D p.V560D K580dup c.1673_1674insTCC c.1731_1742dupTTATGATCACAA p.K558delinsBP c.2466T>A p.N822K p.L576P p.T574I p.V559A p.V560G

[Paragraph-level] PMCID: PMC5615879 Section: ABSTRACT PassageIndex: 6

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the presence of KIT mutations in cases and specifies the types of mutations found in different exons, indicating their association with the disease. Oncogenic: The mention of KIT mutations contributing to tumor development is implied by their prevalence in cases, suggesting a role in cancer progression.

Gene→Variant (gene-first): 3815:Ala-Tyr 3815:c.1509_1510insACCTAT 728378:c.1666C>G 3815:c.1666_1668dupCAG 3815:c.1672_1677delAAGGTTinsAGT 5156:c.1925A>G 3815:p.K558_V559delinsS 728378:p.K642R 728378:p.Q556E 3815:p.Q556dup 3815:p.Y503_F504insTY

Genes: 3815 728378 5156

Variants: Ala-Tyr c.1509_1510insACCTAT c.1666C>G c.1666_1668dupCAG c.1672_1677delAAGGTTinsAGT c.1925A>G p.K558_V559delinsS p.K642R p.Q556E p.Q556dup p.Y503_F504insTY

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 20

Evidence Type(s): Oncogenic

Justification: Oncogenic: The passage describes a somatic variant (p.N822K) identified in a tumor, indicating its potential role in tumor development or progression.

Gene→Variant (gene-first): 3815:c.2466T>A 3815:p.N822K

Genes: 3815

Variants: c.2466T>A p.N822K

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 18

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 3815:c.1924A>G 3815:p.K642E

Genes: 3815

Variants: c.1924A>G p.K642E

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 16

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses mutations identified in tumors located in the small intestine, indicating a significant association with the disease, which supports the use of these variants in defining or classifying the disease. Oncogenic: The passage describes mutations that contribute to tumor development, specifically mentioning internal tandem duplications and insertions in the context of tumors, indicating their role in oncogenesis.

Gene→Variant (gene-first): 3815:Ala-Tyr 3815:c.1504_1509 dup GCCTAT 3815:c.1509_1510insACCTAT 3815:p.Y503_F504insTY

Genes: 3815

Variants: Ala-Tyr c.1504_1509 dup GCCTAT c.1509_1510insACCTAT p.Y503_F504insTY

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 13

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage mentions specific variants and their occurrence in a case, indicating their association with a particular disease or condition. Oncogenic: The variants discussed are likely somatic mutations contributing to tumor development, as they are described in the context of a case study.

Gene→Variant (gene-first): 3815:K580dup 3815:c.1673_1674insTCC 3815:c.1731_1742dupTTATGATCACAA 3815:p.K558delinsBP

Genes: 3815

Variants: K580dup c.1673_1674insTCC c.1731_1742dupTTATGATCACAA p.K558delinsBP

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 12

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage provides mutation frequencies for specific variants, indicating their association with a disease or subtype. Oncogenic: The mention of substitution mutations suggests that these variants may contribute to tumor development or progression, as they are likely somatic mutations.

Gene→Variant (gene-first): 3815:p.L576P 3815:p.T574I 3815:p.V559A 3815:p.V559D 3815:p.V560D 3815:p.V560G

Genes: 3815

Variants: p.L576P p.T574I p.V559A p.V559D p.V560D p.V560G

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 11

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 3815:K558del 3815:c.1654_1674delATGTATGAAGTACAGTGGAAG 5156:c.1925A>G 728378:p.K642R

Genes: 3815 5156 728378

Variants: K558del c.1654_1674delATGTATGAAGTACAGTGGAAG c.1925A>G p.K642R

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 10

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses mutations in exon 11 and their association with specific cases, indicating that these mutations can be used to classify or define a disease subtype. Oncogenic: The mention of double mutations and their role in the context of tumor development suggests that these somatic variants contribute to tumor progression.

Gene→Variant (gene-first): 728378:c.1666C>G 3815:c.1666_1668dupCAG 3815:c.1672_1677delAAGGTTinsAGT 728378:p.Q556E 3815:p.Q556dup

Genes: 728378 3815

Variants: c.1666C>G c.1666_1668dupCAG c.1672_1677delAAGGTTinsAGT p.Q556E p.Q556dup

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 9

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the frequency of specific mutations, including in-frame deletions and substitutions, which are associated with the classification of cases, indicating their role in defining or confirming a disease subtype. Oncogenic: The mention of mutations in exon 11, including specific variants, suggests their contribution to tumor development or progression, as they are described in the context of cancer cases.

Gene→Variant (gene-first): 3815:K558 del 3815:V555del 3815:c.1669_1674delTGGAAG 3815:c.1676T>A 3815:c.1679T>A 3815:p.V559D 3815:p.V560D

Genes: 3815

Variants: K558 del V555del c.1669_1674delTGGAAG c.1676T>A c.1679T>A p.V559D p.V560D

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 20

Evidence Type(s): Oncogenic

Justification: Oncogenic: The passage describes a somatic variant (p.N822K) identified in a tumor, indicating its potential role in tumor development or progression.

Gene→Variant (gene-first): 3815:c.2466T>A 3815:p.N822K

Genes: 3815

Variants: c.2466T>A p.N822K

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 18

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 3815:c.1924A>G 3815:p.K642E

Genes: 3815

Variants: c.1924A>G p.K642E

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 16

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses mutations identified in tumors located in the small intestine, indicating a significant association with the disease, which supports the use of these variants in defining or classifying the disease. Oncogenic: The passage describes mutations that contribute to tumor development, specifically mentioning internal tandem duplications and insertions in the context of tumors, indicating their role in oncogenesis.

Gene→Variant (gene-first): 3815:Ala-Tyr 3815:c.1504_1509 dup GCCTAT 3815:c.1509_1510insACCTAT 3815:p.Y503_F504insTY

Genes: 3815

Variants: Ala-Tyr c.1504_1509 dup GCCTAT c.1509_1510insACCTAT p.Y503_F504insTY

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 13

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage mentions specific variants and their occurrence in a case, indicating their association with a particular disease or condition. Oncogenic: The variants discussed are likely somatic mutations contributing to tumor development, as they are described in the context of a case study.

Gene→Variant (gene-first): 3815:K580dup 3815:c.1673_1674insTCC 3815:c.1731_1742dupTTATGATCACAA 3815:p.K558delinsBP

Genes: 3815

Variants: K580dup c.1673_1674insTCC c.1731_1742dupTTATGATCACAA p.K558delinsBP

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 12

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage provides mutation frequencies for specific variants, indicating their association with a disease or subtype. Oncogenic: The mention of substitution mutations suggests that these variants may contribute to tumor development or progression, as they are likely somatic mutations.

Gene→Variant (gene-first): 3815:p.L576P 3815:p.T574I 3815:p.V559A 3815:p.V559D 3815:p.V560D 3815:p.V560G

Genes: 3815

Variants: p.L576P p.T574I p.V559A p.V559D p.V560D p.V560G

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 11

Evidence Type(s): None

Justification: Not enough information in this passage.

Gene→Variant (gene-first): 3815:K558del 3815:c.1654_1674delATGTATGAAGTACAGTGGAAG 5156:c.1925A>G 728378:p.K642R

Genes: 3815 5156 728378

Variants: K558del c.1654_1674delATGTATGAAGTACAGTGGAAG c.1925A>G p.K642R

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 10

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses mutations in exon 11 and their association with specific cases, indicating that these mutations can be used to classify or define a disease subtype. Oncogenic: The mention of double mutations and their role in the context of tumor development suggests that these somatic variants contribute to tumor progression.

Gene→Variant (gene-first): 728378:c.1666C>G 3815:c.1666_1668dupCAG 3815:c.1672_1677delAAGGTTinsAGT 728378:p.Q556E 3815:p.Q556dup

Genes: 728378 3815

Variants: c.1666C>G c.1666_1668dupCAG c.1672_1677delAAGGTTinsAGT p.Q556E p.Q556dup

[Paragraph-level] PMCID: PMC5615879 Section: RESULTS PassageIndex: 9

Evidence Type(s): Diagnostic, Oncogenic

Justification: Diagnostic: The passage discusses the frequency of specific mutations, including in-frame deletions and substitutions, which are associated with the classification of cases, indicating their role in defining or confirming a disease subtype. Oncogenic: The mention of mutations in exon 11, including specific variants, suggests their contribution to tumor development or progression, as they are described in the context of cancer cases.

Gene→Variant (gene-first): 3815:K558 del 3815:V555del 3815:c.1669_1674delTGGAAG 3815:c.1676T>A 3815:c.1679T>A 3815:p.V559D 3815:p.V560D

Genes: 3815

Variants: K558 del V555del c.1669_1674delTGGAAG c.1676T>A c.1679T>A p.V559D p.V560D