Hypothesis

24,814 Matching Annotations

Jan 2022
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.04.22268652

1
1. sciscore 08 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.04.22268652: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Ethics statement: Written informed consent was obtained from all participants; ethics approval was obtained from the regional review board for biomedical research in April 2020 (Comité de Protection des Personnes Sud Méditerranée I, Marseille, France; ID RCB 2020-A00932-37), and the study was registered on ClinicalTrials.gov (NCT04341142) (10).<br>IRB: Ethics statement: Written informed consent was obtained from all participants; ethics approval was obtained from the regional review board for biomedical research in April 2020 (Comité de Protection des Personnes Sud Méditerranée I, Marseille, France; ID RCB 2020-A00932-37), and the study was registered on ClinicalTrials.gov (NCT04341142) (10).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After gentle shaking and a contact of 30 min at room temperature in plastic microplates, 150 mL of the mix was transferred into 96-well microplates covered with Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were conducted using GraphPad Prism® software (version 8; GraphPad software, La Jolla, CA, USA) and R software, version 3.6.1 (R Foundation for Statistical Computing, Vienna, Austria).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism®</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04341142</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Assessment of Serological Techniques for Screening Patients …</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.04.22268652
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.04.22268776

1
1. sciscore 08 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.04.22268776: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics declaration: This study was approved by the MHS (Maccabi Healthcare Services) Institutional Review Board.<br>Consent: Due to the retrospective design of the study, informed consent was waived by the IRB, and all identifying details of the participants were removed before computational analysis.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This study has several limitations. The estimates of vaccine-induced protection against symptomatic infection should be interpreted with caution, since a protective effect of the vaccine was already evident a few days after the receipt of the first dose (52% effectiveness at 0-6 days). We did not expect to find a significant effect of vaccination in the first week after receipt of the first dose, since it presumably takes time for the vaccine to induce an immune response. We observed a small but significant reduction in the odds of infection in the six days following the first dose and a larger reduction in the odds of symptomatic infection, which could indicate a potential bias. It is possible that individuals are less likely to be tested immediately after vaccination (e.g. because they attribute symptoms to temporary side effects), and are therefore less likely to be detected (rather than less likely to be infected) compared to unvaccinated individuals, especially symptomatic ones. However, this bias would most likely be short-lived, so the estimates of vaccine effectiveness against COVID-19 could be more reliable a couple of weeks after receipt of the first dose.9,16 A second limitation is with regards the generalizability of our findings in light of the emergence of novel SARS-CoV-2 variants. Our study only estimates the short- and long-term vaccine effectiveness against the Delta variant, which was the dominant strain in Israel at the time of our study. The protection co...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.04.22268776
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.04.22268758

1
1. sciscore 08 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.04.22268758: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Human Subjects Approval: Sequencing of samples was approved by the University of Michigan Institutional Review Board (IRB Protocol ID: HUM185966) or performed as part of a public health investigation prompted by state and local health officials (IRB Protocol ID:</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenetic methods: To generate a phylogenetic tree, we aligned consensus genomes with MUSCLE 3.8.31 and masked positions that are known to commonly exhibit homoplasies or sequencing errors(8).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MUSCLE</div><div>suggested: (MUSCLE, RRID:SCR_011812)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We generated a maximum likelihood phylogeny with IQ-TREE, using a GTR model and 1000 ultrafast bootstrap replicates(9,10).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IQ-TREE</div><div>suggested: (IQ-TREE, RRID:SCR_017254)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For saliva specimens, RNA was extracted with the Thermo Fisher MagMAX Viral RNA Isolation Kit (200 µL of input sample eluted in 50 µL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo Fisher MagMAX</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reads were aligned to the Wuhan-Hu-1 reference genome (GenBank MN908947.3) with BWA-MEM version 0.7.15.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA-MEM</div><div>suggested: (Sniffles, RRID:SCR_017619)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Oxford Nanopore library preparation and sequencing: After multiplex PCR amplification, libraries were prepared for sequencing with the Oxford Nanopore Technologies MinION using the ARTIC Network version 3 protocol (6,7).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Oxford Nanopore</div><div>suggested: (Oxford Nanopore Technologies, RRID:SCR_003756)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Each library (15-20 ng) was loaded onto a flow cell (FLO-MIN106) and sequenced with the MinION.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MinION</div><div>suggested: (MinION, RRID:SCR_017985)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.04.22268758
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.04.21268586

1
1. sciscore 08 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.04.21268586: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: KEY RESOURCES TABLE: PBMC Isolation: Blood was collected in heparin tubes and processed within 4 hours of collection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-CD3 (Clone OKT3, Biolegend, 1ug/mL) and anti-CD28 Ab (Clone CD28.2, Biolegend, 1ug/mL) were used as positive controls.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-CD3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, pseudovirus neutralization titer 50 (pNT50) was calculated by taking the inverse of the serum concentration that achieved 50% neutralization of SARS-CoV-2 pseudotyped lentivirus particles entry into ACE2 expressing 293T cells (a gift from Michael Farzan).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: KCB Cat# KCB 200744YJ, RRID:CVCL_0063)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/content/10.1101/2022.01.04.21268586v1
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.05.21268323

1
1. sciscore 08 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.05.21268323: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A small number of samples (36) in our study were sequenced using Oxford Nanopore GridION or MINION.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MINION</div><div>suggested: (MinION, RRID:SCR_017985)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenetics: The alignment of consensus sequences with at least 95% coverage was used for phylogenetic reconstruction using RAxML-NG version 0.9.0 [47].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RAxML-NG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Ancestral sequence reconstruction was performed on the TreeTime divergence tree using IQ-TREE version 1.6.12 [48].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IQ-TREE</div><div>suggested: (IQ-TREE, RRID:SCR_017254)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.05.21268323
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.04.22268773

1
1. sciscore 08 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.04.22268773: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: The study was conducted in accordance with the STROBE guidelines for observational research (26), and received ethics approval from the Research Ethics Board at the University of Toronto.<br>IRB: The study was conducted in accordance with the STROBE guidelines for observational research (26), and received ethics approval from the Research Ethics Board at the University of Toronto.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">We included all reported cases of infection meeting these criteria, as well as a 2% random sample of vaccinated individuals with no record of infection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.04.22268773
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.04.22268754

1
1. sciscore 08 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.04.22268754: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was reviewed and approved by the Institutional Review Board at Qatar University (QU-IRB 1537-FBA/21).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analysis was performed using GraphPad Prism software (Version 8.2.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.04.22268754
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.04.22268742

1
1. sciscore 08 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.04.22268742: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was deemed exempt from Institutional Review Board (IRB) review pursuant to the terms of the US Department of Health and Human Service’s Policy for Protection of Human Research Subjects at 45 C.F.R. 46.104(d); category 4 exemption (Sterling IRB, Atlanta, GA, waived ethical approval for this work).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were carried out in SAS 9.4 (SAS Institute, Cary, NC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.04.22268742
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.04.21267659

1
1. sciscore 08 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.04.21267659: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Power calculation: The sample size of 38 patients (32 Vaccinated, 5 Unvaccinated, 1 Unknown) accrued as of August 2021 yields 80% power at an alpha of 0.05 to detect a hazard ratio of 0.01 for severe COVID-19, assuming two unequally matched groups.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Although this study was able to identify critical biomarkers for severe COVID 19 patients, it also has some limitations. This being a retrospective analysis, the findings are primarily used in generating hypotheses, not necessarily in clinical practice. Furthermore, as a registry analysis, there is an inherent bias in the patient selection determined by registry entrant decided based on pre-defined criteria such as outcome in our case. Consequently, the study population likely has a higher COVID 19 severity than the general population of cancer patients with COVID 19. Additionally, as discussed above, this study included a more significant proportion of unvaccinated patients than other analyses, and this may have led to improved generalizability reflecting the impact of COVID 19 in remote settings. However, to maximize sample size, a small number of vaccinated patients were added to the cohort, limiting the generalizability of the findings. Additionally, there are significant differences between the timing of COVID 19 diagnosis in this study and the epidemiology of the pandemic in the general population, with an overrepresentation of diagnoses in the early part of the pandemic period. In all likelihood, this study does not include patients with delta-variant since it includes data up until the third trimester of 2021. In light of the ordinal outcome of COVID 19 severity, including metrics such as hospitalization and ICU admission, patients without vaccination may have an adva...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.04.21267659
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.04.22268772

1
1. sciscore 08 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.04.22268772: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.04.22268772
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.04.22268766

1
1. sciscore 08 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.04.22268766: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the Institutional Review Board as non-human subjects research.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SPSS version 27</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(IBM Corporation, Armonk, NY) was used for database construction activities and SAS version 9.4 (SAS Institute, Inc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  There are several limitations to this study. First, although we focused on a period of the pandemic with the least within state heterogeneity in policy responses, there was still county-level variation within some U.S. states in reopening policies during the study period which may lead to heterogeneity within the comparison groups. This limitation, however, would underestimate rather than overestimate the effects of adherence and lessen our ability to detect significant differences between the study groups. Despite this limitation, our study findings detected substantial disparities in outcomes by adherence category on the state level. Another study limitation is that the adherent group included some states that were stricter than the CDC guidance in the phased framework for social distancing and therefore the documented effects may be partly driven by restrictions stricter than the tested CDC guidelines. Further, the study period is limited to the first wave of the pandemic in the U.S. and the magnitude of the effects of reopening strategies on epidemiological trends with the presence of vaccination and differences in the transmissibility of COVID-19 may vary.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.04.22268766
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.05.22268779

1
1. sciscore 08 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.05.22268779: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The systematic search was carried out in May 2021 utilizing PubMed (Medline), Scopus, and Embase.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div><div style="margin-bottom:8px"><div>Embase</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations: One of the limitations of our systematic review was the restricted number of studies and size of the sample population. We have only included studies published until May 2021. Future reports of heart block in COVID-19 patients might reveal new relations between the severity of the infection and the prognosis of patients who develop heart block. The resolution of ECGs changes after discontinuation of HCQ in a case suggests a causal relationship between hydroxychloroquine and ECG abnormalities. Thus the role of certain medications, like hydroxychloroquine, on the development of arrhythmias in the presence of COVID-19 infection must also be further investigated 26. Also, the presence of COVID-19 induced myocarditis was not confirmed via biopsy or MRI in any of the patients who developed heart block in our included studies. Conclusion: The exact pathogenesis of heart block in COVID-19 patients must be further explored. More research is required to determine whether myocarditis due to COVID-19 is associated with the development of heart blocks. It is also needed to be studied further whether heart block is an independent risk factor for a worse prognosis in COVID-19 cases. Patients hospitalized for COVID-19 must be continuously monitored for arrhythmias including heart blocks, especially in the presence of comorbidities. Physicians must be made aware of these cardiac manifestations of the infection, as early detection can shorten the hospital stay and improve the prog...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.05.22268779
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.04.22268749

1
1. sciscore 08 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.04.22268749: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: [17] Protocols were approved by institutional review boards at the University of California San Diego and Xochicalco University in Tijuana.<br>Consent: Informed consent was obtained from all human participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum samples were batched and tested weekly by Genalyte® (San Diego, CA), using their Maverick™ Multi-Antigen Serology Panel [33] that detects IgG and IgM antibodies to five SARS-CoV-2 antigens.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">[34] HIV and HCV Serology: Rapid HIV and HCV tests were conducted using the Miriad® HIV/HCV Antibody InTec Rapid Anti-HCV Test (Avantor</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-HCV</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were conducted using SAS, version 9.4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS</div><div>suggested: (SASqPCR, RRID:SCR_003056)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  [43] Limitations: This study was limited by the cross-sectional nature of the analysis, which precludes causal inferences. Although this was a binational study, sampling was non-random and results may not generalize to other samples of PWID. Our survey relied on self-report and may have been subject to socially desirable responding or recall challenges. We could not differentiate between circumstances in which COVID-19 testing was mandatory (e.g., in prison, jails, detention centers, and some homeless shelters) versus situations in which testing was voluntary and sought out by participants. These contextual factors are important to explore in future studies. Similarly, we did not ask participants if they were required to pay for COVID-19 testing. Noting that the availability and cost of COVID-19 testing may have changed over time, we controlled for time in our analysis. Statistical power may have limited our ability to detect some associations. For example, we did not find that attending SSPs was independently associated with COVID testing, which could be related to the low number of participants who had recently accessed SSPs. During the COVID-19 epidemic, many U.S. SSPs reduced their services or hours of operation, [25] or reduced provision of other health services. [44] In California, free rapid COVID-19 testing only became available through mobile SSPs after data collection for this study ended.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.04.22268749
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.01.05.475037

1
1. sciscore 08 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.05.475037: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Written informed consent was obtained from all study subjects.<br>IRB: This study was approved by the Institutional Review Board of The University of Hong Kong/Hospital Authority Hong Kong West Cluster (Ref No. UW 21-120 452).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Briefly, 6-10-week-old male and female hamsters were obtained from the Chinese University of Hong Kong Laboratory Animal Service Centre through the HKU Centre for Comparative Medicine Research.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The hamsters were randomized from different litters into experimental groups.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serially diluted plasma from healthy individuals or previously published monoclonal antibodies against SARS-CoV-2 (B8) were used as negative controls.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Two consecutive staining steps were conducted: the first one used an antibody and spike cocktail incubation of 30 min at 4 °C; the second staining involved staining with anti-His-APC and anti-His-FITC antibodies (Abcam) at 4 °C for 30 min to detect the His tag of the RBD.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His-APC</div><div>suggested: (Miltenyi Biotec Cat# 130-101-322, RRID:AB_2800415)</div></div><div style="margin-bottom:8px"><div>anti-His-FITC</div><div>suggested: (Miltenyi Biotec Cat# 130-092-675, RRID:AB_1103226)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were further permeabilized with 0.2% Triton X-100 and incubated with cross-reactive rabbit sera anti-SARS-CoV-2-N for 1 hour at RT before adding an Alexa Fluor 488 goat anti-rabbit IgG (H+L) cross-adsorbed secondary antibody (Life Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2-N</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: HEK293T cells, HEK293T-hACE2 cells and Vero-E6-TMPRSS2 cells were maintained in DMEM containing 10% FBS, 2 mM L-glutamine, 100 U/mL/mL penicillin and incubated at 37 □in a 5% CO2 setting 51</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HEK293T-hACE2</div><div>suggested: RRID:CVCL_A7UK)</div></div><div style="margin-bottom:8px"><div>Vero-E6-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, The pseudovirus was generated by co-transfection of 293T cells with pVax-1-S-COVID19 and pNL4-3Luc_Env_Vpr, carrying the optimized spike (S) gene (QHR63250) and a human immunodeficiency virus type 1 backbone, respectively 54</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibody-virus mixtures were subsequently added to pre-seeded HEK 293T-ACE2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T-ACE2</div><div>suggested: RRID:CVCL_A7UK)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mixtures were then transferred to 96-well plates pre-seeded with 1×104/well Vero E6 cells and incubated at 37°C for 24 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, The pseudovirus was generated by co-transfection of 293T cells with pVax-1-S-COVID19 and pNL4-3Luc_Env_Vpr, carrying the optimized spike (S) gene (QHR63250) and a human immunodeficiency virus type 1 backbone, respectively 54</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pVax-1-S-COVID19</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pNL4-3Luc_Env_Vpr</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">https://www.ncbi.nlm.nih.gov/igblast/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.ncbi.nlm.nih.gov/igblast/</div><div>suggested: (IgBLAST, RRID:SCR_002873)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequences were aligned using Clustal W in the BioEdit sequence analysis package (Version 7.2)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioEdit</div><div>suggested: (BioEdit, RRID:SCR_007361)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Half-maximal (IC50) or 90% (IC90) inhibitory concentrations of the evaluated antibody were determined by inhibitor vs. normalized response --4 Variable slope using GraphPad Prism 8 or later (GraphPad Software Inc.)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The fluorescence density of SARS-CoV-2 infected cells were scanned using a Sapphire Biomolecular Imager (Azure Biosystems) and the neutralization effects were then quantified using Fiji software (NIH)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The structure alignment, cartoon representations, labeling of amino acids in RBD (from PDB 7K45) were generated by PyMOL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantification and statistical analysis: Statistical analysis was performed using PRISM 8.0 or later.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PRISM</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations of the study: ZCB11 probably represents the broadest breadth among bNAbs reported thus far with comparable potency against all current SARS-CoV-2 VOCs including Omicron and OmicronR346K. We are still in the process in determining its mode of action by solving structures of the RBD-ZCB11 Fab complex. Such information will be useful to guide vaccine design as mentioned because the frequency of elite vaccine remains low (2/34 in this study). To understand the frequency of ZCB11-like bNAb among BNT162b2-vaccinees, we need to investigate other elite responders who show equally potent bNAb responses. More ZCB11-like bNAbs should be also discovered to improve current antibody-based cocktail immunotherapy. For animal challenge experiments, we have done a single dose efficacy experiment. Different doses and routes of administration or antibody combination will be tested in future experiments to provide useful information to support clinical development of ZCB11 and ZCB11-like bNAb.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.01.05.475037
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.01.05.475107

1
1. sciscore 07 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.05.475107: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">52 The lipid and the protein have been represented by the Amber ff1453,54 force field while water has been modeled via TIP3P.55 MD simulations have been performed using the NAMD code,56,57 using periodic boundary condition (PBC) and the constant number of particle, pressure, and temperature (NPT) ensemble, using a Langevin thermostat and barostat.58,59 A time step of 4fs has been used to integrate the Newton equation of motion thanks to the use of Hydrogen Mass Repartition (HMR)60 in combination with RATTLE and SHAKE.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Amber</div><div>suggested: (AMBER, RRID:SCR_016151)</div></div><div style="margin-bottom:8px"><div>NAMD</div><div>suggested: (NAMD, RRID:SCR_014894)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 11. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.01.05.475107
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.01.04.474979

1
1. sciscore 07 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.04.474979: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Cells were frequently tested for mycoplasma contamination and consistently tested negative.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 15 additional minutes, cells were incubated in blocking buffer (permeabilization buffer supplemented with 1 % BSA), and further incubated in blocking buffer containing anti-Strep mouse antibody (1:1000 dilution), and anti-Sirt5 rabbit antibody (1:1000 dilution).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Strep</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Sirt5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The next day, the cells were washed with PBS three times and incubated in the blocking buffer containing anti-mouse IgG donkey antibody conjugated with Alexa 488 (1:500 dilution, Thermo Fisher)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">anti-rabbit IgG donkey antibody conjugated with Alexa 555 (1:500 dilution, Thermo Fisher), and for counter-staining, DAPI (1 μg/ml</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit IgG donkey antibody</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549 cells stably expressing ACE2 (A549-ACE2) were a gift from O. Schwartz (Pasteur Institute, Paris).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Early passage HEK293T cells were transfected with 1.5 μg of dCas9-KRAB-MeCP2 repressor plasmid (Addgene #110824) and 0.5 μg of Piggyback Transposase (gift from Maxim Greenberg), using PEI 25K transfection reagent (Polysciences Inc, Cat. 23966-1), according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We combined 10 pmol of Streptococcus pyogenes NLS-Sp.Cas9-NLS (SpCas9) nuclease (Aldevron, USA, Cat. 9212) with 30 pmol of total synthetic sgRNA (10 pmol each sgRNA) to form ribonucleoproteins (RNPs) in 20 μL of total volume with SE Buffer for A549-ACE2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transfection, Strep affinity purification, and Flag immunoprecipitation in HEK-293T cells: HEK-293T cells were plated in six-well plates or 10-cm dishes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sample Preparation for Proteomic Analysis: HEK-293T Sirt5-KD cells were transfected with plasmids expressing Nsp14-strep in the presence or absence of SIRT5 with 3 biological replicates for each condition.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sirt5-KD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 stocks were propagated in Vero-E6 cells, and their sequences were verified by next-generation sequencing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For infection experiments, A549-ACE2 or Calu3 cells were seeded into 12- or 24-well plates and rested for at least 24 hours prior to infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu3</div><div>suggested: RRID:CVCL_EQ19)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infections of HCT-8 cells with HCoV-OC43 were performed similarly.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCT-8</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids expressing GFP and Nsp14 proteins (from SARS-CoV-2, SARS-CoV and HCoV-OC43) with a C-terminus strep tag were a gift from Nevan Krogan (1, 2), and are also available on Addgene (pLVX-EF1alpha-SARS-CoV-2-nsp14-2xStrep-IRES-Puro, Addgene #141380).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLVX-EF1alpha-SARS-CoV-2-nsp14-2xStrep-IRES-Puro</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mammalian expression plasmids for SIRT5 and SIRT5-H158Y with a myc-his tag in a pCDNA 3.1 vector were available in the Verdin lab (26).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA 3.1</div><div>suggested: RRID:Addgene_20407)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Early passage HEK293T cells were transfected with 1.5 μg of dCas9-KRAB-MeCP2 repressor plasmid (Addgene #110824) and 0.5 μg of Piggyback Transposase (gift from Maxim Greenberg), using PEI 25K transfection reagent (Polysciences Inc, Cat. 23966-1), according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>dCas9-KRAB-MeCP2</div><div>suggested: RRID:Addgene_110821)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nsp14 is cytotoxic, and we used 0.5 μg of Nsp14-strep plasmid for a six-well plate and 4 μg for a 10-cm dish.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Nsp14-strep</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Other co-transfecting plasmids, such as pcDNA-SIRT5, were used at the same concentration except when specifically mentioned.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA-SIRT5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein purification and enzymatic assays: Nsp10 and Nsp14 proteins from the Wuhan strain of SARS-CoV-2 (NC_045512.2) were codon-optimized, ordered as Gblocks (IDT), and cloned into a pVFT1S expression vector using a HiFi DNA Assembly kit (NEB)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pVFT1S</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Methyltransferase assays were performed in reaction buffer (50 mM Hepes, pH 7.0, 6 mM KCl, 2 mM DTT, 1 mM MgCl2, and 0.1 mg/ml BSA) in presence of 0.1 mM NAD+ and 10 μM SAM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAM</div><div>suggested: (SAM, RRID:SCR_010951)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were run using GraphPad Prism version 9.1.2 for macOS (GraphPad Software, USA, www.graphpad.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A genome index was constructed using GRCh38 genome build with Gencode v38 annotation of the transcriptome, and Genbank MT246667.1 for the sequence of SARS-CoV-2, USA/WA-1/2020 isolate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gencode</div><div>suggested: (GENCODE, RRID:SCR_014966)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differential gene expression analysis was done with DEseq2, which was also used to generate normalized gene counts (71).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DEseq2</div><div>suggested: (DESeq2, RRID:SCR_015687)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Over-representation of biological gene sets in the gene clusters was investigated using the R clusterProfiler package and enricher function (72).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>clusterProfiler</div><div>suggested: (clusterProfiler, RRID:SCR_016884)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.01.04.474979
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.01.04.475015

1
1. sciscore 07 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.04.475015: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All protocols were approved by the Institutional Animal Care and Use Committee (Protocol ID 8A-M6, IACUC ID 2021-8A-02-01 & 2021-8A-03-03).<br>Euthanasia Agents: Mock or SARS-CoV-2 infected mice were anesthetised by isoflurane, followed by perfusion with 10 or 20 ml of cold 1× DPBS (Gibco) into the left ventricle to remove blood from the tissues.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mice: Eight-week-old male B6.Cg-Tg(K18-hACE2)2Prlmn/J mice were purchased from the Jackson Laboratory and maintained in a biosafety level 2 (BSL-2) animal facility in the Korea Research Institute of Chemical Technology (KRICT).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the virus neutralization, the inoculum was further incubated with CR3022 neutralizing antibody (ab273073, Abcam, Cambridge, UK) for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">anti-mouse CD45 Antibody (103114, BioLegend)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD45</div><div>suggested: (BioLegend Cat# 103114, RRID:AB_312979)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, APC anti-mouse TNF-α Antibody (506307, BioLegend)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse TNF-α Antibody ( 506307</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FITC anti-mouse IL-6 Monoclonal Antibody (MP5-20F3) (11-7061-82, eBioscience, San Diego, CA, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IL-6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FITC anti-human ACE2 Antibody (NBP2-7211F</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, Novus Biologicals, Centennial, CO, USA), and Alexa 647 anti-Iba1 Antibody (78060S, Cell signalling Technology, Danvers, MA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Iba1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were stained with the anti-SARS-CoV-2 NP antibody (40143-R001, Sino biological, Beijing, China) and a secondary horseradish peroxidase-conjugated goat anti-rabbit IgG (Bio-Rad, Hercules, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 NP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The brain sections (30 μm thickness) were permeabilized with 0.2 % Triton X-100 in 1 % BSA/PBS for 30 min, washed in PBS, and blocked with 0.5 % BSA in PBS for 15 min, followed by incubation overnight at 4 °C with primary antibodies, namely, anti-SARS-CoV-2 S (40150-T62-COV2, Sino Biological), and anti-Iba1/AIF1 (MABN92, Merck Millipore, Burlington, MA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Iba1/AIF1</div><div>suggested: (Millipore Cat# MABN92, RRID:AB_10917271)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing twice, further incubation was carried out with Alexa Fluor 488-conjugated anti-rabbit antibody (A32731, Thermo Fisher Scientific, Waltham, MA, USA) and Alexa Fluor 594-conjugated anti-mouse antibody (A32744, Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A32731</div><div>suggested: (Thermo Fisher Scientific Cat# A32731, RRID:AB_2633280)</div></div><div style="margin-bottom:8px"><div>A32744</div><div>suggested: (Thermo Fisher Scientific Cat# A32744, RRID:AB_2762826)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were immunostained overnight at room temperature with primary antibodies, namely, anti-dsRNA J2 (MABE1134, Sigma-Aldrich), anti-SARS-CoV-2 NP (40143-R019, Sino Biological), anti-SARS-CoV-2 S (40150-T62-COV2, Sino Biological), and anti-CD68 (sc-17832, Santa Cruz Biotechnology, Dallas, TX, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-dsRNA J2 ( MABE1134</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 NP ( 40143-R019 , Sino Biological)</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD68 ( sc-17832 , Santa Cruz Biotechnology , Dallas , TX , USA)</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>sc-17832</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing thrice, further incubation was carried out with Alexa Fluor 488-conjugated anti-rabbit antibody (A32731, Thermo Fisher Scientific) and Alexa Fluor 594-conjugated anti-mouse antibody (A32744, Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (Thermo Fisher Scientific Cat# A32731, RRID:AB_2633280)</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Thermo Fisher Scientific Cat# A32744, RRID:AB_2762826)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The membrane was incubated with 5 % skim milk (BD Biosciences) in Tris-buffered saline with 0.1 % Tween 20 (TBST) buffer and the primary antibodies, namely, anti-SARS-CoV-2 NP (40143-R001, Sino biological), anti-CD68 (sc-17832, Santa Cruz Biotechnology) anti-GSDMDC1 (sc-81868, Santa Cruz Biotechnology), anti-Actin (sc-47778, Santa Cruz Biotechnology), anti-Hsp70 (sc-24, Santa Cruz Biotechnology), anti-CX3CL1 (ab25088, Abcam), anti-CX3CR1 (ab8021, Abcam), anti-CD16 (80006S, Cell signalling Technology), anti-phospho-Stat1 (9167S, Cell signalling Technology), anti-Stat1 (14994S, Cell signalling Technology), anti-Fas (4233T</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD68</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-17832, RRID:AB_627157)</div></div><div style="margin-bottom:8px"><div>anti-GSDMDC1</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-81868, RRID:AB_2263768)</div></div><div style="margin-bottom:8px"><div>sc-81868 , Santa Cruz Biotechnology</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Actin ( sc-47778 , Santa Cruz Biotechnology)</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Hsp70</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>sc-24</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-24, RRID:AB_627760)</div></div><div style="margin-bottom:8px"><div>anti-CX3CL1</div><div>suggested: (Abcam Cat# ab25088, RRID:AB_448600)</div></div><div style="margin-bottom:8px"><div>anti-CX3CR1</div><div>suggested: (Abcam Cat# ab8021, RRID:AB_306203)</div></div><div style="margin-bottom:8px"><div>anti-CD16</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-phospho-Stat1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Stat1</div><div>suggested: (Cell Signaling Technology Cat# 14994, RRID:AB_2737027)</div></div><div style="margin-bottom:8px"><div>anti-Fas</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CRL-3304), Caco-2 (HTB-37), and Vero E6 (CRL-1586) cell lines were purchased from ATCC (Manassas, VA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV-2 Korean strain (GISAID Accession ID: EPI_ISL_407193), isolated from a patient in South Korea, was obtained from Korea Centres for Disease Control and Prevention (KCDC) and propagated in Vero cells (CCL-81, ATCC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice: Eight-week-old male B6.Cg-Tg(K18-hACE2)2Prlmn/J mice were purchased from the Jackson Laboratory and maintained in a biosafety level 2 (BSL-2) animal facility in the Korea Research Institute of Chemical Technology (KRICT).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B6.Cg-Tg(K18-hACE2)2Prlmn/J</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunofluorescence assay: After transcardial perfusion with cold 4 % paraformaldehyde in PBS, brain tissues of SARS-CoV-2 infected K18-hACE2 mice were dissected and fixed by immersion in 4 % paraformaldehyde in PBS overnight at 4 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then analysed by FACSAria III sorter (BD Biosciences, San Jose, CA, USA), and data was analysed by the FlowJo software (BD Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">From the sequenced reads, adaptor sequences were removed using Cutadapt (version 3.1) (65) and aligned to the hybrid reference genomes of human (GRCh38.p13_ENS100) and SARS-CoV-2 (ASM985889_v3) with STAR aligner (version 2.7.6a) (66)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cutadapt</div><div>suggested: (cutadapt, RRID:SCR_011841)</div></div><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_004463)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Aligned reads were quantified in gene level by HTSeq (version 0.13.5) (67) with “intersection-nonempty” mode.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HTSeq</div><div>suggested: (HTSeq, RRID:SCR_005514)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differentially expressed gene analysis were processed with DESeq2 (version 1.30.1) (68) using abs (log2 fold change) > 1 and adjusted P-value (Benjamini-Hochberg) < 0.01 as cut-off</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Multidimensional scaling analysis were performed with clustermap function in python seaborn package (version 0.11.1) using genes with mean FPKM > 1 among the samples and transformed to log2(FPKM+1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Over-representation analysis of the DEGs enriched to GO Biological Process 2018 with EnrichR (69) with adjusted P-value (Benjamini-Hochberg) < 0.05 cut-off.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EnrichR</div><div>suggested: (Enrichr, RRID:SCR_001575)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Network analysis were presented by Metascape (70) using the GO Biological Process gene sets.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Metascape</div><div>suggested: (Metascape, RRID:SCR_016620)</div></div><div style="margin-bottom:8px"><div>GO Biological</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All data were analysed using the GraphPad Prism 8.0 software (GraphPad Software, San Diego, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.01.04.475015
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.01.04.474958

1
1. sciscore 07 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.04.474958: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To study the molecular mechanisms in SARS-CoV-2 S protein binding with several Abs, Verkhivker and Di Paola (Verkhivker and Di Paola, 2021) performed all-atom and CG simulations with mutational sensitivity mapping using the BeAtMuSiC approach and perturbation response scanning (PRS) profiling of SARS-CoV-2 receptor-binding domain complexed with CR3022 and CB6 antibodies, complementing it with a network modeling analysis of the residue interactions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CB6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">They have included the complexes between the RBD of SARS-CoV-2 spike (S) glycoprotein and CR3022 or S309 antibodies and the ACE2 receptor.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S309</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Each outer cycle consists of randomly choosing CDRs (L1, L2, L3, H1, H2, H3) from clusters in the RAbD database and then grafting that CDR’s structure onto the antibody framework in place of the existing CDRs (GraftDesign).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>L3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Considering that any antibody has 6 CDR’s (i.e. L1, L2, L3 on the light chain and H1, H2, H3 on the heavy chain) one has to decide which of these CDR’s should be modified with respect to the original structure (CR3022 as given by PDB id 6w41).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>L1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>L2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>H1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>H2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">L1 in the original CR3022 antibody is an extended loop that makes a large surface area contact with the RBD antigen (wildtype/Wuhan sequence) which stabilizes the Ab-Ag interaction.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Different studies have highlighted the importance of these interactions for the host-pathogen and antigen-specific antibody interfaces (Bai and Warshel, 2020; Corrêa Giron et al., 2020; Nguyen et al., 2021, 2020; Poveda-Cuevas et al., 2020, 2018; Xie et al., 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific</div><div>suggested: (Miltenyi Biotec Cat# 130-092-104, RRID:AB_615063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The GROMACS 2019.3 suite (Abraham et al., 2015) has been used for all atomistic MD simulations.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GROMACS</div><div>suggested: (GROMACS, RRID:SCR_014565)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Considering that any computational method has its limitations and accuracy, evaluating the Ab-Ag complexes with complementary computational approaches, and selecting the ones that are consistent in all evaluations, strongly increase the reliability of predictions. Thus, the observed improved affinity of the models could be considered to result from the real physics/chemistry of the complex interactions in the systems and not from any particular algorithm-related issues. RBD-Ab free energy of interactions explored with umbrella sampling CG simulations: Free energy calculations using US MD calculations revealed that from the list of the top 10 best RAbD candidates only P01, P05, P06, P09, and P10 showed better binding affinities compared with the native CR3022 (see Figure 5 for their PMF profiles). Although all these candidates show statistically significant improved affinities compared with CR3022, the errors in estimating the binding free energies for P05, P06, P09, and P10 did not allow us to distinguish between them in terms of affinity. Among the candidates P01 seems the best, giving statistically significant better affinity of binding compared with both the native CR3022 and the P05, P06, P09, and P10 set. However, caution must be taken when considering absolute values obtained by US-CG SIRAH to compare with more rigorous atomistic or experimental data. As the results of Patel et al. (2017) showed, only the ΔΔG = ΔGmutant -ΔGwild-type should be regarded quantitatively, as...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.01.04.474958
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.04.22268717

1
1. sciscore 07 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.04.22268717: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The project was approved by the Institutional Review Boards at Qatar University (QU-IRB 1492-E/21 and QU-IRB 1469-E/21).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study had some limitations; most of our RT-PCR samples were collected from asymptomatic individuals (Table S1), which might have underestimated the assay’s sensitivity. In addition, the control group did not include samples for other coronaviruses or influenza that might cross-react with SARS-CoV-2, which could have led to an overestimated specificity. In conclusion, our data showed that FineCare™ 2019-RBD antibody test demonstrated excellent performance in terms of sensitivity, specificity, and overall agreement with RT-PCR as a reference test. In addition, correlation with the FDA-approved sVNT from Genscript and the automated analyzer VIDAS®3 from bioMérieux, FineCare™ immunoassay showed an outstanding performance in detecting total antibodies in serum samples against SARS-CoV-2. Thus, this assay could be reliable for the quantitative detection of antibodies in the vaccinated population and recovered patients.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.04.22268717
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.01.21268576

1
1. sciscore 07 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.01.21268576: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.4 Questionnaire: The online questionnaire was created in German and distributed with Research Electronic Data Capture (REDCap).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  4.6 Strengths and limitations: The main strength of this study is its transnational prospective study design. It allows observing the impact of the situation at the time (e.g. differences in severity of implemented safety measures and number of new infections) between the respective countries on the aforementioned associations. Together with the results of survey round 2 and 3, the influence of different time points (i.e. August & December 2021, August 2022) on these associations can likewise be observed. Another strength is the application of innovative statistical methods (i.e. two-step procedure26-28) in the area of sports medicine. Several potential limitations should be discussed. Due to the design of the study, the group sizes were not balanced. This may be a reason for not reaching statistical significance in some of the post-hoc analyses. Moreover, the study cohort may likely not be representative of the German-speaking general population, especially because of the high percentage of female participants and individuals with a university degree. Nonetheless, the results are adaptable to a population of well-educated individuals.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.01.21268576
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.03.22268704

1
1. sciscore 07 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.03.22268704: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Study design and participants: One hundred and seventeen recovered COVID-19 patients who were healthy adults aged ≥18 years and previously infected with SARS-CoV-2 (defined as anti-nucleocapsid positivity (IgG) or a history of positive SARS-CoV-2 detection) were enrolled with written consent.<br>IRB: Approvals were received from the Research Ethics Committee of the Faculty of Medicine, Chulalongkorn University (IRB numbers 192/64 and 281/64).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serological testing: In all sera samples, anti-SARS-CoV-2 IgG and IgA immunoglobulin, including anti-nucleocapsid (N) protein IgG, anti-spike1-specific IgA, and anti-spike/receptor-binding domain (RBD)-specific IgG antibodies, were determined.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA immunoglobulin, including anti-nucleocapsid (N) protein IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-spike1-specific IgA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The IgG antibodies against SARS-CoV-2 S1/RBD were quantitatively measured using CE marked SARS-CoV-2 Quant IgG II (Abbott Diagnostics), and antibody level is expressed as BAU/mL, with values ≥7.1 BAU/mL defined as positive.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were conducted using GraphPad Prism v9.0 (GraphPad, San Diego, CA) and SPSS v23.0 (IBM Corp, Armonk, NY).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  There were some limitations to the study. First, neutralizing titers were not examined. Laboratory testing was limited, because titers of anti-S1 IgA, neutralizing activity, and total interferon-gamma responses exceeded upper detection limits. Thus, exact levels of immune response after boosting could not be summarized. Moreover, other SARS-CoV-2-particular proteins, such as matrix and nucleocapsid proteins, which induce total interferon-gamma release52, did not stimulate SARS-CoV-2-specific T cells. Last, small sample size was a limitation. Participants were not randomly assigned to receive different types of vaccine, and vaccine groups were assigned on the basis of convenience. Further investigation is warranted to assess the durability of antibody and T-cell responses after vaccination of people with previous SARS-CoV-2 infection, as well as the interplay between natural and vaccine-induced immunity. Notably, some vaccinated participants in this study failed to produce a booster response, particularly a T-cell response; thus, further studies in this population are needed. Longitudinal studies are required to determine persistence of humoral and T-cell responses after vaccination in previously infected individuals. Additionally, whether immunization of those with prior infection affects the level of mucosal IgA should be further investigated. In conclusion, previously infected SARS-CoV-2 individuals developed a more robust immune response after AZD1222 or CoronaVac vaccinat...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.03.22268704
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.04.22268738

1
1. sciscore 07 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.04.22268738: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  There are some limitations, and this is a single-centre audit so results may not be generalisable. By necessity we audited time periods when the NHS was under considerable pressure, and therefore rates of appropriate follow-up may improve when services are not under such strain. These data suggest BTS guideline adherence regarding radiological follow-up may be suboptimal, with room for improvement and consequently improved patient outcomes. This audit should be undertaken at additional hospitals, and potentially nationally, to ensure appropriate BTS guidelines adherence thereby avoiding delay in diagnosing underlying malignancy or chronic lung disease.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.04.22268738
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.01.22268614

1
1. sciscore 07 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.01.22268614: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Strengths and Limitations: There are several strengths of the current study. One strength is the use of a large population-representative sample, consisting of infected individuals of a wide range of disease symptom severities—ranging from asymptomatic to hospitalized—as well as non-infected controls. Another strength is the use of a validated measure of subjective symptomology assessing everyday function rather than more sensitive but less ecologically valid performance-based measures. However, by virtue of the survey format, it was not possible to validate the infection status of individuals by testing. This may lead to under- or over-estimation of effect size and statistical significance of tests, vis-a-vis misreporting of infection status. This is a limitation of all survey studies of COVID-19 and cognitive dysfunction however. Finally, the cross-sectional design limits our ability to draw causal inference. Future studies should examine the longevity of cognitive dysfunction symptoms over time, as well as the extent to which the dose-response and age gradients observed here are replicable across samples. Finally, additional studies examining neurological impacts at the level of the brain itself will be required, using functional brain imaging paradigms. Conclusions: In summary, the current study used a population-representative sample consisting of a balanced proportion of infected and uninfected individuals to estimate the association between SARS-CoV-2 infection and sym...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.01.22268614
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.04.22268750

1
1. sciscore 07 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.04.22268750: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics Statement: This study was approved by the Stanford University Institutional Review Board (IRB-60171 and IRB-57519).<br>Consent: Informed consent was obtained from volunteer healthcare workers before blood collection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We also recorded available anti-S1 IgG antibody results.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S1 IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analyses and graphing were performed in Python version 3.8.5 using the packages pandas, matplotlib, seaborn, numpy, scipy, and statsmodels.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div><div style="margin-bottom:8px"><div>matplotlib</div><div>suggested: (MatPlotLib, RRID:SCR_008624)</div></div><div style="margin-bottom:8px"><div>numpy</div><div>suggested: (NumPy, RRID:SCR_008633)</div></div><div style="margin-bottom:8px"><div>scipy</div><div>suggested: (SciPy, RRID:SCR_008058)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Although this study was strengthened by evaluating vaccine responses in a large heterogeneous cohort of immunosuppressed patients, limitations include the small sample size of certain patient disease and ISMT categories, and a lack of information on drug dosages and history of prior therapy. Additionally, there were no pediatric patients included in NISP cohort. As the COVID-19 pandemic ensues and new SARS-CoV-2 variants arise, our findings provide an evidence-based framework for clinicians to determine optimal vaccination strategy in immunosuppressed patients. While numerous studies have examined humoral response to SARS-CoV-2 vaccination in particular immunosuppressed subgroups, relatively few have examined concurrent cellular response. This study shows that immunosuppressive conditions differentially impact humoral and cellular responses to SARS-CoV-2 vaccines, with 20% of patients only developing a cellular response following initial vaccination. The importance of cellular response in anti-SARS-CoV-2 immunity is supported by several reports8,31–35 and a recent study showed that emerging SARS-CoV-2 variants that escape humoral immunity in vaccinees may not escape cellular immunity36. Humoral and cellular responses, therefore, provide complementary protection against SARS-CoV-2 in immunosuppressed patients. This emphasizes the importance of monitoring both humoral and cellular responses to vaccination, especially in immunosuppressed patients, and the utility of performing c...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.04.22268750
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.01.05.474231

1
1. sciscore 07 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.05.474231: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Identification of epitope regions on the Spike Protein: We downloaded the structures of 182 protein complexes of antibodies that bound to the SARS-CoV-2 Spike or its receptor-binding domain (RBD) or N-terminal domain (NTD) from the Protein Data Bank (all structures available before August 8, 2021, www.rcsb.org).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>N-terminal domain (NTD</div><div>suggested: (Leinco Technologies Cat# LT2000, RRID:AB_2893936)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data collection: The sequencing data were retrieved from SRA database in NCBI (BioProject: PRJNA784038), which was generated by the Network for Genomic Surveillance in South Africa (NGS-SA) [2,6].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioProject</div><div>suggested: (NCBI BioProject, RRID:SCR_004801)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quality control and mutation detection: Quality control and adaptor trimming were performed by FASTP [30].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FASTP</div><div>suggested: (fastp, RRID:SCR_016962)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mpileup file and the read count file were generated by SAMtools [32] and Varscan2 [33].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAMtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenetic construction was performed by IQ-TREE (1.6.12) [35].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IQ-TREE</div><div>suggested: (IQ-TREE, RRID:SCR_017254)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">TMRCA estimation: The estimation of the time to the most recent common ancestor (TMRCA) and mutation rate was performed by BEAST (2.6.4) [36] using 108 sequences collected between November 13, 2021, and November 23, 2021.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BEAST</div><div>suggested: (BEAST, RRID:SCR_010228)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.01.05.474231
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.01.05.475095

1
1. sciscore 07 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.05.475095: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.01.05.475095
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.01.04.474974

1
1. sciscore 07 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.04.474974: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For each of the half-map pairs local resolution maps were calculated using Resmap version 1.1.4 (Kucukelbir et al., 2014) with default parameters.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Resmap</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">It was developed in Python 3 with an extensive use of pytorch (Paszke et al., 2019), numpy (Oliphant, 2006), scipy (Virtanen et al., 2020), CCTBX (Grosse-Kunstleve et al., 2002) and CCP4 (Winn et al., 2011) libraries and utility programs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div><div style="margin-bottom:8px"><div>scipy</div><div>suggested: (SciPy, RRID:SCR_008058)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For making sequence database queries we use HMMER suite version 3.3.2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HMMER</div><div>suggested: (Hmmer, RRID:SCR_005305)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  Thank you for including a protocol registration statement.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.01.04.474974
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.03.22268681

1
1. sciscore 07 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.03.22268681: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">While anti-nucleocapsid antibody is indicative of prior or current SARS-CoV-2 infection, anti-spike protein antibody may be induced either by SARS-CoV-2 infection or by COVID-19 vaccination (including the three vaccines authorized in the United States).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-nucleocapsid</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-spike protein</div><div>suggested: (GeneTex Cat# GTX632604, RRID:AB_2864418)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Persons who met these criteria and tested positive for anti-spike antibody were also considered to have no laboratory evidence of SARS-CoV-2 infection as anti-spike antibody was presumed to be vaccine-derived.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-spike</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  In addition, given the limitations of laboratory assays and detection sensitivities of each test, some of the six cases may have been infected with SARS-CoV-2 in the recent past, and vaccination may be coincidental to the subsequent MIS-C illness. Children often have unrecognized SARS-CoV-2 infection associated with mild or absent symptoms.3, 5 Persons with mild or asymptomatic illness may be less likely to generate anti-nucleocapsid antibody, and anti-nucleocapsid antibody from prior infection wanes over time, particularly in those with mild infection.8, 24, 25 These limitations could lead to misclassification of SARS-CoV-2 infection status. In addition to the six persons without evidence of SARS-CoV-2 infection, we identified three others who met clinical and inflammatory criteria and did not have evidence of SARS-CoV-2 infection but did not meet MIS-C case definition because anti-spike antibody was not obtained. Neither MIS-C nor multisystem inflammatory syndrome in adults (MIS-A) was reported in the clinical trials of COVID-19 vaccines used in the United States.14, 26 Globally, MIS-C following COVID-19 vaccination has been reported in the literature for six persons <21 years of age.23, 27-30 Two of these persons are from the United States and are included in our case series; both had evidence of SARS-CoV-2 infection.23 A third reported person from the United States had received dose two of the Pfizer-BioNTech vaccine two months prior to presentation and had evidence of in...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.03.22268681
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.01.21268271

1
1. sciscore 07 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.01.21268271: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical considerations: The phase II clinical trial protocol was reviewed and approved by an ad hoc centralized Research Ethics Committee from the Medical Sciences University, Faculty of Medicine “Manuel Fajardo”, Havana, designed by the Health Innovation Committee from the Cuban Ministry of Health (MINSAP).<br>Consent: Written informed consent was obtained from all participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Healthy adults aged 19-80 years, of both sexes were recruited through public advertisement at community or professional environment close to the clinical site.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Participants and study design: Phase IIb was designed as a multicenter, adaptive, parallel, double blind, randomized, placebo controlled trial for evaluating the immunogenicity, safety and reactogenicity of two doses of SOBERANA 02 and the heterologous scheme with a third dose with SOBERANA Plus.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Participants and study design: Phase IIb was designed as a multicenter, adaptive, parallel, double blind, randomized, placebo controlled trial for evaluating the immunogenicity, safety and reactogenicity of two doses of SOBERANA 02 and the heterologous scheme with a third dose with SOBERANA Plus.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We calculated seroconversion rate for anti-RBD IgG antibodies (≥4-fold increase in antibody concentration over baseline) for each subject.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) Products under evaluation: SOBERANA 02 (FINLAY-FR-2) and SOBERANA Plus (FINLAY-FR-1A) are vaccine candidates based on the recombinant receptor binding domain (RBD) of SARS-CoV-2 virus produced in CHO cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO</div><div>suggested: CLS Cat# 603479/p746_CHO, RRID:CVCL_0213)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Platform: https://rpcec.sld.cu/trials/RPCEC00000347</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Platform</div><div>suggested: (TRIO Platform, RRID:SCR_021596)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The trial was conducted following the Declaration of Helsinki, Good Clinical Practice and the rules of the Cuban National Immunization Program.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>National Immunization Program</div><div>suggested: (Centers for Disease Control and Prevention, RRID:SCR_012976)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were done using SPSS version 25.0; EPIDAT version 12.0 and Prism GraphPad version 6·0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.01.21268271
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.01.21268131

1
1. sciscore 07 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.01.21268131: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: Thank you for sharing your code.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our approach for estimating the growth rate is a purely statistical method and therefore has limitations. First, the model is non-mechanistic and does not incorporate any epidemiological assumptions. Therefore, it is not suitable for predicting future changes in infections or making long term forecasts, particularly as it cannot account for the depletion of susceptible through infection or vaccination. Second, we assume that the spatial regions investigated are independent and homogeneous, we do not account for the movement of infection between regions (Kraemer et al., 2021) nor the spatial and social structure within a region. A lack of internal structure could be important for public-health concerns; for example, an outbreak that is primarily increasing in the young has very different health implications compared to one that is increasing in the elderly. There is no reason why richer data structures cannot be incorporated within our methodology (for example looking at the growth rate in a set of age-groups), but such an analysis requires large amounts of data and is increasing complex to interpret. Third, the data analysed in this study comes from PCR testing (or individuals that have performed a lateral flow test followed by PCR). Therefore, there are limitations due to specificity and sensitivity of the test and the ability of individuals to swab reliably. Associated with this, and discussed above, changes to test-seeking behaviour beyond a simple increase in testing coul...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.01.21268131
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.04.22268721

1
1. sciscore 07 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.04.22268721: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Modeling of mitigation policies: We quantify the time varying variation in contacts due to mitigation policies by using Google mobility reports [29].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Google</div><div>suggested: (Google, RRID:SCR_017097)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  It is important to acknowledge the limitations of our approach. The compartmental structure adopted is relatively simple and does not account explicitly for asymptomatic transmission, and different degrees of severity (i.e., hospitalizations and ICUs). While our model accounts for the COVID-19 vaccine rollout, we have access to limited information about the exact number of different vaccines (i.e., AstraZeneca, J&J, Pfizer, Moderna) administered. For simplicity we assume a two doses regiment across the board. We set several parameters driving the natural history of the disease using estimates from previous SARS-CoV-2 variants. The large number of mutations and divergence of Omicron could affect some of these values. We model immune escape from previous infections and vaccines with a single parameter. Finally, our model does not consider geographical heterogeneity. Our results confirm that more data is necessary to estimate the key characteristics of the Omicron VOC. Nevertheless, region of values (capturing its relative transmissibility with respect to Delta and its potential for immune escape) compatible with current observations confirms the likelihood for the Omicron variant of igniting new pandemic waves in regions with high attack rates from previous strains and/or vaccination rates. Data about the severity of Omicron with respect to Delta and the ancestral SARS-CoV-2 viruses are going to be crucial in assessing the impact of on the health-care system of countries affect...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.04.22268721
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.04.21268275

1
1. sciscore 07 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.04.21268275: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: This research was conducted under Food and Drug Administration Investigational New Drug Application 24777; the research protocol was approved by the Duke University Institutional Review Board, registered on ClinicalTrials.gov (NCT04399252), and was previously published.<br>IRB: This research was conducted under Food and Drug Administration Investigational New Drug Application 24777; the research protocol was approved by the Duke University Institutional Review Board, registered on ClinicalTrials.gov (NCT04399252), and was previously published.<br>Consent: 18 All participants provided documented informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Trial design: Participants were randomized using a permuted block randomization technique to receive LGG or placebo in a 1:1 ratio.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Both subjects and study coordinators are blinded to the intervention; the randomization key was generated by the study statistician and only the pharmacist dispensing the study product had access to the key.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Pre-study sample size was calculated assuming an attack rate of 10.5% in household contacts based on CDC reports.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data Collection: Data on demographics, medical history, household risks, and infection details of index patient were collected remotely upon enrollment via REDCap, an electronic platform that supports secure data capture for research.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">23 After demultiplexing, DADA2 was used for quality control and to generate a count table,24 and taxonomy was assigned using the Silva v138.1 database.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Silva</div><div>suggested: (SILVA, RRID:SCR_006423)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis was performed using the R programming suite packages phyloseq and ggplot2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were performed in SAS 9.4 (SAS Institute, Cary, NC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study has several limitations. First, we were limited by a smaller-than-expected sample size due to difficulty with recruitment during concurrent vaccine rollout, which increasingly limited the eligible population and our statistical power. Given the high transmissibility of newer viral strains and potential for waning vaccine efficacy, future studies may consider including vaccinated individuals, especially as data suggest that probiotic administration improves vaccination efficacy against other viral pathogens, such as influenza.30 Further, while allocation was blinded and randomized in a 1:1 fashion, participants in the placebo group had a small increased incidence of current smoking and hypertension at baseline, which are potential risk factors for development of COVID-19 disease; however, smoking was not associated with development of symptoms in our study. Additionally, LGG and other probiotics may be associated with gastrointestinal side effects, potentially confounding our measurement of symptoms, although fewer GI side effects were noted in the probiotic group. Another limitation was the remote format, wherein the primary endpoint was self-reported symptoms rather than laboratory-confirmed infection; participants had inconsistent access to laboratory testing, with only 61% of symptomatic participants ultimately undergoing testing. In conclusion, COVID-19 continues to pose a unique and novel challenge to global health.5 We conducted the first double-blinded, rando...
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04399252</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Effect of Lactobacillus on the Microbiome of Household Conta…</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.04.21268275
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.03.21268549

1
1. sciscore 07 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.03.21268549: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As previously described, beginning in January 2021, DCI physicians had the option of activating a SARS-CoV-2 vaccine protocol, in which anti-spike immunoglobulin G (anti-spike IgG) antibodies were drawn monthly with routine labwork.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-spike immunoglobulin G (anti-spike IgG</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This study has limitations, including lack of data on cellular immunity and possible selection bias, both in the enrollment for antibody monitoring and for the administration of additional vaccine dose. We did not correlate antibody levels to breakthrough infections. Importantly, a major strength is that this study includes real-world results on seroresponse to additional doses of SARS-CoV-2 vaccination. In conclusion, additional SARS-CoV-2 vaccine doses elicit robust seroresponse among patients receiving maintenance dialysis, including among patients whose seroresponse has lapsed, suggesting that additional vaccine doses are critical to maximize and sustain protection of maintenance dialysis patients. In combination with omicron-variant dominance,14 we recommend that a third vaccine dose be standard for all maintenance dialysis.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.03.21268549
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.03.22268669

1
1. sciscore 07 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.03.22268669: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The Institutional Review Board of CMABC approved this study (Protocol approval ABC-20-93).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">All of them with an age >18 years, not pregnant, with an oxygen saturation measurement ≥90% when evaluated at hospital, and in those patients at home that referred dyspnea an evaluation of oxygen saturation measurement ≥90% was necessary.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Sample size calculation: The sample size calculation was based on the requirements for a multivariable model (events per variable, EPV); considering that 6.2% was estimated to present the outcome of clinical progression (13), and following the assumption of 10-20 events per variable (14), and that the study has 8 parameters (symptoms), we calculated a minimum required sample size of 1324 patients, expecting 80 patients with progressive illness; and a maximum of 2648.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical significance was set at p<0.05 and performed with SPSS version 27.0</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This study has limitations. Clinical interview was realized by many doctors with different training (general practitioners, internists, and otorhinolaryngologists), although, all of them received a standardized training to participate in the program. C-19PAIS Index may help discern those with low from high risk of progression, identifying those who require more intensive monitoring and extension tests, anticipate, and prevent adverse outcomes.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.03.22268669
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.04.21268372

1
1. sciscore 07 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.04.21268372: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This work has several limitations. We use a viral load model based on pre-Omicron parameters (10) due to a lack of data on the viral kinetics in Omicron infections. Evidence from pseudovirus infectivity assays (15) and early estimates of a shorter incubation period (13) may indicate faster proliferation of Omicron, for which we conduct a sensitivity analysis assuming a 50% shorter proliferation period (Figure S4). In this analysis, the shortened proliferation phase in effect results in faster relative time from exposure to clearance. However, whether the peak to clearance phase is lengthened is yet unknown, as is the potential interaction with vaccination (in particular boosters), which also reduces the duration of clearance (10), or prior infection. Also unknown is whether peak viral loads are higher or lower in Omicron-infected individuals and the sensitivity of different LFTs to Omicron given changes to the Nucleocapsid (N) antigen, though early assessment indicates sensitivity of tests licensed in the UK is similar to previous variants (8). We model infectiousness as equal to the probability of culturing virus for a given viral load (11) though a like-for-like comparison indicates LFTs to be more sensitive than culture (Figure S1), which may be a result of the difficulty and limits of detection when culturing live virus or alternatively a short period of residual LFT positivity after the infectious period (16). If individuals test positive for over 10 days then it may be ...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.04.21268372
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.03.22268676

1
1. sciscore 07 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.03.22268676: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.03.22268676
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.04.22268770

1
1. sciscore 07 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.04.22268770: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/content/10.1101/2022.01.04.22268770v1
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.03.22268684

1
1. sciscore 07 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.03.22268684: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics statement: The study was approved by the Institutional Review Boards of the Nicaraguan Ministry of Health and the University of Michigan.<br>Consent: Written informed consent was obtained from a parent/guardian of all participants, and verbal assent was obtained from children aged ≥6 years.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: Thank you for sharing your code.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This analysis does have several limitations. First, the initial serology samples were collected in February/March 2020—largely before the first wave of SARS-CoV-2 infections in Nicaragua. As such, it is possible that some infections, particularly milder presentations, were missed. It is likely, however, that most of these infections were captured via PCR or by ELISA testing of samples collected in late 2020 and early 2021. Additionally, to assess illness severity of infections detected only by ELISA, we relied on retrospective surveys that may have been subject to recall bias. Fortunately, this is likely to have affected only the mildest of cases as the PCR testing criteria were quite broad—particularly after being expanded in June 2020. Finally, as a community-based, prospective cohort study, we were underpowered to assess the burden of MIS-C and death associated with SARS-CoV-2 infection due to their rarity. Through this prospective cohort of Nicaraguan children, we were able to assess the impact of SARS-CoV-2 infection on children aged 0-14 years at the community level. We observed high rates of infection, with 51.6% of children having been infected with SARS-CoV-2 over the course of the study. While illness was generally mild, severe illness and prolonged sequelae were observed—most often among children <2 years. Finally, symptomatic re-infection was quite common, with lower protection among children aged >10 years, suggesting important age-associated differences in immun...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.03.22268684
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.01.04.474908

1
1. sciscore 07 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.04.474908: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants provided written informed consent per the institutional review board (IRB)-approved study protocol (IRB at the Icahn School of Medicine at Mount Sinai, protocol IRB-20-03352, April 15, 2020).<br>IRB: All participants provided written informed consent per the institutional review board (IRB)-approved study protocol (IRB at the Icahn School of Medicine at Mount Sinai, protocol IRB-20-03352, April 15, 2020).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">All pregnant people receiving obstetrical care at the Mount Sinai Hospital and Mount Sinai West during the study period are eligible for participation.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plasma samples were first screened using a low dilution (1:50) for antibodies to SARS-CoV-2 receptor binding domain (RBD).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 receptor binding domain (RBD).</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A general limitation in SARS-CoV-2 IgG testing is the possibility of false negatives prior to IgG antibody production onset or in cases where IgG antibody levels revert to zero in the months after infection [25].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.5 Statistical analysis: Demographic and clinical characteristics of cases (100 pregnant people with anti-S IgG antibodies) and controls (100 pregnant people with no anti-S IgG antibodies) were compared using either an independent samples t-test or a Mann-Whitney U test for continuous variables and a chi-square test for categorical variables.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To examine the association between cytokine levels and antibody titer levels, cases were divided into three groups based on anti-S IgG antibody titer level for ease of interpretation: mild (1:80-1:400), moderate (1:800-1:1600), and high (>1:1600).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>1:800-1:1600</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The multiplex assay was performed at Eve Technologies using the Bio-Plex™ 200 system (Bio-Rad Laboratories, Inc., Hercules, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bio-Rad Laboratories</div><div>suggested: (Bio-Rad Laboratories, RRID:SCR_008426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Prior to clustering, each cytokine was scaled and centered; clusters were identified using complete-linkage agglomerative hierarchical clustering with Euclidean distances across cases and controls using the pheatmap v1.0.2 package in R [34].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pheatmap</div><div>suggested: (pheatmap, RRID:SCR_016418)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plots were generated in R using the pheatmap, ggplot2 and corrplot packages, and in GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using SPSS software version 27.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  4.4 Strengths and limitations: This study has several strengths. We used a serological assay with a high sensitivity (95%) and specificity (100%) to establish SARS-CoV-2 exposure [20]. This enabled unbiased recruitment of pregnant people with past SARS-CoV-2 infection, both with and without symptoms. Even though we do not know the exact timing of infection, based on time of sample collection and expected duration of antibodies we can infer that infection occurred during pregnancy. This study is the largest of its kind so far. We investigated a broad panel of cytokines, which allowed us to assess not only individual cytokine responses, but also cytokine clusters. The findings of the current study are also subject to some limitations. The difference in sample size between the second trimester samples compared to the third trimester and labor and delivery samples is due to the current study being an interim analysis of an ongoing prospective cohort study. Future studies based on the entire prospective cohort will include a larger sample for each timepoint. Pregnant people with false negative anti-S IgG antibodies may have been misclassified as unexposed since IgG production onset occurs one week after infection and even though studies have shown sustained IgG antibody levels after 30 weeks of infection [38], IgG antibody levels might incidentally revert to zero in the months after infection [25]. In addition, anti-S IgG antibodies were assessed only once in participants, at a me...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.01.04.474908
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.01.01.474713

1
1. sciscore 07 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.01.474713: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The final dataset consisted of 53,050 sequences from NCBI and 386,147 from GISAID (439,197</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NCBI</div><div>suggested: (NCBI, RRID:SCR_006472)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  One limitation in this study is that the Thai sequences available on NCBI and GISAID were from two sources: the state quarantines and domestic hospitals/research institutions. The strains collected in the state quarantine zones are likely imported in Thailand and less likely to cause local transmission. Unfortunately, the available data did not allow to distinguish the variant source. Hence, the number of variants found in Thailand in this study could be an overestimation of the variants that actually caused local transmissions. Nevertheless, it is always important to keep tracking of possible new strains as the mutation rate is very high in single-stranded RNA viruses compared to DNA viruses [44]. The high mutation rate poses a great challenge for developing vaccines [45], highlighting why incorporating conserved residue information into structural analyses could be essential for discovering other alternative measures for COVID-19 diagnosis, treatment, and prevention. Another limitation is that at the time of this study only the 3D coordinates of the spike trimer and the spike-hACE2 interaction were available. Recently, the spike protein was reported to bind to other human proteins, such as CD209 [46], HAVCR1 [47], and NRP1 [48, 49], and other mammal proteins [50]. Therefore, in this study, the number of interface residues could have been underestimated, and it is possible that in the future, additional variants will be classified according to their effect on additional viru...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.01.01.474713
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.30.474592

1
1. sciscore 07 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.30.474592: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence alignment, SNP calling and annotation: We aligned these 1,853,355 genome sequences to the reference sequence (Wuhan-Hu-1(Wu, et al. 2020), GenBank: NC_045512, GISAID: EPI_ISL_402125) using MAFFT (--auto -- keeplength)(Katoh and Standley 2013).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.30.474592
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.01.03.474779

1
1. sciscore 07 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.03.474779: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.01.03.474779
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.01.03.474825

1
1. sciscore 07 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.03.474825: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Informed consent was obtained from all participants as part of ethics approvals (Decisions# 2020-01620, 2020-02881 and 2020-05630) from the National Ethical Review Agency of Sweden.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: HEK293T cells (ATCC CRL-3216) and HEK293T-ACE2 cells (stably expressing human ACE2) were cultured in Dulbecco’s Modified Eagle Medium (high glucose, with sodium pyruvate) supplemented with 10% fetal calf serum, 100 units/ml penicillin, and 100 μg/ml streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HEK293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Therefore, 3D-classification was performed within CryoSparc 3.31 without pose alignment using 20 classes with a mask around the two RBDs in up conformations and their bound Fabs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CryoSparc</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structure figures and EM density-map figures were generated with UCSF ChimeraX40 and COOT, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">l analysis: Neutralizing IC50 values were calculated in Prism v9 (GraphPad Software) by fitting a four-parameter logistic curve, to neutralization by serial 3-fold dilutions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.01.03.474825
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.01.04.474803

1
1. sciscore 07 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.04.474803: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: The cell line has been tested negative for contamination with mycoplasma.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data was analyzed using FlowJo V10.4.2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses of plaque counts were done using GraphPad Prism software, version 8.4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.01.04.474803
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.01.03.474855

1
1. sciscore 07 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.03.474855: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structure determination and refinement: The structure was determined using the molecular replacement method with PHASER in the CCP4 suite[27].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CCP4</div><div>suggested: (CCP4, RRID:SCR_007255)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 14. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.01.03.474855
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.02.22268622

1
1. sciscore 06 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.02.22268622: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">10, 13, 29-34 Modeling analyses were conducted in MATLAB R2019a (Boston/MA/USA).37 Effectiveness of prior infection against reinfection and impact of bias: Applying the test-negative, case-control study design, PES was derived as one minus the ratio of the odds of prior infection in subjects testing positive (such as by polymerase chain reaction (PCR) testing), to the odds of prior infection in subjects testing negative for the infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MATLAB</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Matching of cases and controls was done to control for known differences in the risk of exposure to SARS-CoV-2 infection in Qatar.13, 43-46 Further description of Qatar’s databases and methods of analysis can be found in previous publications.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Qatar’s</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">13, 43-46, 48,49 PES and its associated 95% CI were calculated by applying the following equation: PES = 1™ odds ratio of prior infection among cases versus controls Statistical analyses were conducted in STATA/SE version 17.0.50 The study was approved by the Hamad Medical Corporation and Weill Cornell Medicine-Qatar Institutional Review Boards with waiver of informed consent.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA/SE</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  In regard to limitations, specific forms of bias were investigated, but other sources of bias are possible, and these may depend on the database being analyzed.26 There is already a volume of literature investigating other forms of bias for the test-negative design in the context of vaccine effectiveness estimation,16, 17 some of which may apply in the context of PES estimation. While this study demonstrated use of the test-negative design to estimate PES, other factors need to be considered in actual application. For instance, the algorithm for matching needs to be developed with knowledge of the local epidemiology to ensure that matching can effectively control differences in the risk of exposure to the infection. In conclusion, the test-negative design offers a feasible and robust method to estimate protection of prior infection in preventing reinfection. This method should be considered to provide rapid, rigorous estimates of protection offered by prior infection for different variants of SARS-CoV-2, such as the Omicron that emerged recently.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.02.22268622
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.28.21268460

1
1. sciscore 06 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.28.21268460: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Each nasopharyngeal sample was ten-fold serially diluted (dilution range from 1:10 to 1:1000000), added on a monolayer of Vero E6 cells, and fixed and stained at 72 hours post inoculation with 4% Paraformaldehyde and 0.1% of crystal violet respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/content/10.1101/2021.12.28.21268460v1
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.21.21268200

1
1. sciscore 06 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.21.21268200: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations: One of the major limitations of this work is that the model only accounted for the initial COVID-19 (“alpha”) variant, as at the time of the modelling the web-based application had no facility for projecting scenarios based on new variants of the virus. Accordingly, the actual effect on the epidemic and related health outcomes from a vaccination strategy may have different outcomes from that predicted depending on which variant(s) is prevalent in the country. The other limitation is that due to the limited data available for the Kyrgyz context, some of the key parameter values we used for the simulations were based on assumptions and estimates. As mentioned earlier, in such cases we applied either existing global data, proxy national data or we estimated the values in consultation with local experts.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.21.21268200
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.03.22268675

1
1. sciscore 06 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.03.22268675: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: Thank you for sharing your code.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations: There are several limitations to this study. Although we were able to use baseline empirical contact-data, these contact patterns could be further altered if shielding would be implemented and contact dynamics change. We only considered Digaale IDP camp, as to our knowledge it is the only humanitarian setting for which detailed contact and demographic data is available. Social contacts are context specific24, and Digaale is a relatively small-scale peri-urban settlement, which may not be representative of other low-resource or crisis-affected settings. Our model did not include an additional force of infection from outside the camp, beyond the first seeding event. Fewer than 2% of all contacts were reported to be made outside of the camp in the contact data, so the relative impact of additional transmission from outside the camp in the unshielded population is expected to be small once transmission has already been established. We did not estimate the number of cases and deaths that would be expected after infection, though these are proportional to the number of infections. We focussed our analysis on the impact of shielding high-risk individuals, but only assumed individuals aged 60+ years old to be at high-risk. Although the age-risk profile may well be different in low-resource settings compared to stable settings25, empirical estimates are missing, and similar levels of effectiveness could be expected with broader definitions of high-risk groups. We did not ...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.03.22268675
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.02.22268629

1
1. sciscore 06 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.02.22268629: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: All analyses were conducted in SPSS version 27.0.1.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations include the use of self-reported vaccination status and executive function, and abbreviated versions of time perspective measures due to the population survey format. Finally, the sample age range is from 18-55 years, thereby excluding older adults and adolescents. However, this working age population is arguably a key population in which to study mitigation behaviors, as such individuals tend to be highly mobile and more variable in implementation of precautions than older age groups.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.02.22268629
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.30.21268571

1
1. sciscore 06 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.30.21268571: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.30.21268571
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.02.22268634

1
1. sciscore 06 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.02.22268634: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Both studies were approved by the BIDMC institutional review board.<br>Consent: All participants provided informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plates were washed with ELISPOT wash buffer and incubated for 2-4 h with Biotinylated mouse anti-human IFN-γ monoclonal antibody from MabTech (1 µg/mL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IFN-γ</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">106 peripheral blood mononuclear cells well were re-suspended in 100 µL of R10 media supplemented with CD49d monoclonal antibody (1 µg/mL) and CD28 monoclonal antibody (1 µg/mL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD49d</div><div>suggested: (BD Biosciences Cat# 347690, RRID:AB_647457)</div></div><div style="margin-bottom:8px"><div>CD28</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The next day, the cells were washed twice with DPBS, stained with aqua live/dead dye for 10 mins and then stained with predetermined titers of monoclonal antibodies against CD279 (clone EH12.1, BB700), CD4 (clone L200, BV711), CD27 (clone M-T271, BUV563), CD8 (clone SK1, BUV805), CD45RA (clone 5H9, APC H7) for 30 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD279</div><div>suggested: (BD Biosciences Cat# 566460, RRID:AB_2744348)</div></div><div style="margin-bottom:8px"><div>CD4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD27</div><div>suggested: (BD Biosciences Cat# 748705, RRID:AB_2873109)</div></div><div style="margin-bottom:8px"><div>CD8</div><div>suggested: (Abcam Cat# ab34397, RRID:AB_2291359)</div></div><div style="margin-bottom:8px"><div>CD45RA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed twice with 1X Perm Wash buffer (BD Perm/WashTM Buffer 10X in the CytoFix/CytoPerm Fixation/ Permeabilization kit diluted with MilliQ water and passed through 0.22µm filter) and stained with intracellularly with monoclonal antibodies against IFN-γ (clone B27; BUV395), and CD3 (clone SP34.2, Alexa 700), for 30 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IFN-γ</div><div>suggested: (BD Biosciences Cat# 563563, RRID:AB_2738277)</div></div><div style="margin-bottom:8px"><div>CD3</div><div>suggested: (BD Biosciences Cat# 556610, RRID:AB_396483)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, the packaging construct psPAX2 (AIDS Resource and Reagent Program), luciferase reporter plasmid pLenti-CMV Puro-Luc (Addgene) and spike protein expressing pcDNA3.1-SARS-CoV-2 SΔCT were co-transfected into HEK293T cells (ATCC CRL_3216) with lipofectamine 2000 (ThermoFisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: ATCC Cat# CRL-3216, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To determine the neutralization activity of human serum, HEK293T-hACE2 cells were seeded in 96-well tissue culture plates at a density of 1.75 × 104 cells per well overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-hACE2</div><div>suggested: RRID:CVCL_A7UK)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, the packaging construct psPAX2 (AIDS Resource and Reagent Program), luciferase reporter plasmid pLenti-CMV Puro-Luc (Addgene) and spike protein expressing pcDNA3.1-SARS-CoV-2 SΔCT were co-transfected into HEK293T cells (ATCC CRL_3216) with lipofectamine 2000 (ThermoFisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>psPAX2</div><div>suggested: RRID:Addgene_12260)</div></div><div style="margin-bottom:8px"><div>pLenti-CMV Puro-Luc</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pcDNA3.1-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fixed cells were transferred to 96-well round bottom plate and analyzed by BD FACSymphony(tm) system.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD FACSymphony(tm</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed using FlowJo v9.9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Descriptive statistics and logistic regression were performed using GraphPad Prism 8.4.3, (GraphPad Software, San Diego, California).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04436276</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Study of Ad26.COV2.S in Adults (COVID-19)</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/content/10.1101/2022.01.02.22268634v1
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.30.474602

1
1. sciscore 06 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.30.474602: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were then blocked with 5% w/v BSA and incubated with clarified cell lysates containing 200 ng/mL total protein followed by incubation with a rabbit polyclonal anti-GRFT antibody (gift of Barry O’Keefe, National Cancer Institute, Bethesda, MD) at 1:400 dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-GRFT</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound Q-GRFT was detected using an HRP-conjugated goat anti-rabbit polyclonal antibody at 1:5000 dilution and TMB (Cat. #65-6120 and #N301, respectively, Thermo Fisher Scientific, Waltham, MA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (Innovative Research Cat# 65-6120, RRID:AB_88384)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Strains and plasmids: E. coli strains DLF_R003, DLF_R004 [20], and DLF_Z0025 [21], as well as plasmid pHCKan-yibD-QGRFT plasmid (Addgene #158748) [18], were prepared as previously described.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHCKan-yibD-QGRFT</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.30.474602
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.01.03.474721

1
1. sciscore 06 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.03.474721: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.01.03.474721
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.30.474580

1
1. sciscore 06 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.30.474580: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">They were brought to boil at high power (700 W), and then incubated for 5 more minutes at 50% power (350 W).</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies used: ACE2 (rabbit), Abcam ab15348; NRP1 pre-conjugated to Alexa-488; Neurofilament (chicken), Abcam ab4680; TMPSSR2 (rabbit), Novus Biologicals NBP3-00492; MBP pre-conjugated to Alexa-647; fibronectin (rabbit) gift from Dr. Ken Yamada ([6].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Alexa-647; fibronectin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies were purchased from Jackson Laboratories, raised in donkey, anti-rabbit (Cat#711-586-152) or anti-chicken (Cat#ab150170).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 711-586-152, RRID:AB_2340622)</div></div><div style="margin-bottom:8px"><div>anti-chicken</div><div>suggested: (Abcam Cat# ab150170, RRID:AB_2893330)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the slides were incubated overnight at 4 °C with the first primary antibody followed by an anti-IgG for the appropriate species.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human primary brain vascular fibroblasts (Cat# H-6076) from Cell Biologics, Inc (Chicago, IL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cell Biologics</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 16, 17, 18 and 19. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.30.474580
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.30.474613

1
1. sciscore 06 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.30.474613: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The numbers of nonself SCSs were counted and assigned in sequence maps manually based on the self (0) or nonself (1) assignments calculated by our program and exported into Microsoft Excel [34].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.30.474613
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.01.01.474639

1
1. sciscore 06 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.01.474639: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell line: VeroE6/TMPRSS2 cells (ID 100978) were obtained from CFAR and were grown in minimal essential medium (Life Technologies) with 7⍰.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6/TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All data obtained were analyzed using GraphPad Prism 7 software (Graphpad software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.01.01.474639
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.01.03.474773

1
1. sciscore 06 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.03.474773: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.01.03.474773
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.03.22268599

1
1. sciscore 06 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.03.22268599: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: NSCLC patient cohort: Peripheral blood samples from NSCLC patients were collected at Winship Cancer Institute following written informed consent approved by the Institutional Review Board at Emory University.<br>IRB: NSCLC patient cohort: Peripheral blood samples from NSCLC patients were collected at Winship Cancer Institute following written informed consent approved by the Institutional Review Board at Emory University.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MesoScale Discovery Assay: V-PLEX COVID-19 Respiratory Panel 2 Kit (K15372U panel 2) were used to measure the IgG, IgM and IgA antibody against the antigens SARS-CoV-2 Spike, receptod binding domain (RBD),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigens SARS-CoV-2 Spike , receptod binding domain ( RBD) ,</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following this, 50 uL per well of 1X MSD SULFO-TAG™ Anti-Human IgG Antibody was added and incubated for one hour at room temperature, shaking at a speed of 700 rpm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were incubated with either an anti-SARS-CoV spike primary antibody directly conjugated to Alexaflour-647 (CR3022-AF647) or an anti-SARS-CoV spike primary antibody directly conjugated to biotin (CR3022-biotin) for at least 4 hours at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CR3022-AF647</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV spike</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CR3022-biotin</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viruses and cells: VeroE6 cells were obtained from ATCC (clone E6, ATCC, #CRL-1586) and cultured in complete DMEM medium consisting of 1x DMEM (VWR, #45000-304), 10% FBS, 25mM HEPES Buffer (Corning Cellgro), 2mM L-glutamine, 1mM sodium pyruvate, 1x Non-essential Amino Acids, and 1x antibiotics.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VeroE6-TMPRSS2 cells were generated and cultured as previously described18. nCoV/USA_WA1/2020 (WA/1), closely resembling the original Wuhan strain and resembles the spike used in the mRNA-1273 and Pfizer-BioNTech vaccine, was propagated from an infectious SARS-CoV-2 clone as previously described19.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Using VeroE6-TMPRSS cells, the B.1.1.529 variant was plaque purified directly from the nasal swab, propagated once in a 12-well plate, and expanded in a confluent T175 flask to generate a working stock.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-TMPRSS</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Focus Reduction Neutralization Assay: FRNT-mNG assays were performed on VeroE6 cells and FRNT assays were performed on Vero-TMPRSS2 cells as previously described18,21,22.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analysis was conducted using Graphpad Prism V9 and R 4.1.2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.03.22268599
52.53.155.43 52.53.155.43

https://medrxiv.org/cgi/content/10.1101/2022.01.03.21268582

1
1. sciscore 06 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.03.21268582: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The COSCA study, the RECoVERED study and the S3-study were conducted at the Amsterdam University Medical Centres, the Netherlands, and approved the medical ethical review board of the Amsterdam University Medical Centres (NL 73281.018.20, NL73759.018.20, NL73478.029.20, respectively).<br>Consent: All individuals provided written informed consent before participating.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudoviruses were procedures by cotransfecting HEK293T cells (American Type Culture Collection, CRL-11268) with the pCR3 SARS-CoV-2-SΔ19 expression plasmid and the pHIV-1NL43 ΔEnv-NanoLuc reporter virus plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: ATCC Cat# CRL-11268, RRID:CVCL_1926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Shortly, HEK293T/ACE2 cells were kindly provided by P.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T/ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The spike constructs were ordered as gBlock gene fragments (Integrated DNA Technologies) and cloned SacI and ApaI in the pCR3 SARS-CoV-2–SΔ19 expression plasmid (GenBank: MT449663.1) using Gibson Assembly (Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCR3 SARS-CoV-2–SΔ19</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudoviruses were procedures by cotransfecting HEK293T cells (American Type Culture Collection, CRL-11268) with the pCR3 SARS-CoV-2-SΔ19 expression plasmid and the pHIV-1NL43 ΔEnv-NanoLuc reporter virus plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCR3 SARS-CoV-2-SΔ19</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pHIV-1NL43 ΔEnv-NanoLuc</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The inhibitory neutralization titres (ID50) were determined as the serum dilution at which infectivity was inhibited by 50%, using a nonlinear regression curve fit (GraphPad Prism software version 8.3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spider plots were made in Excel 2016.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

52.53.155.43/29c3e315cf2d23005021f240f790281059e1fe7d/2022.01.03.21268582.full-html.html
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.29.21268499

1
1. sciscore 06 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.29.21268499: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The trial protocol was reviewed and approved by Abu Dhabi Health Research and Technology Ethics Committee.<br>Consent: Written informed consent was provided for all participants prior to inclusion into the trial.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Female volunteers were not pregnant or breastfeeding, and appropriate contraceptive measures had been taken within 2 weeks before enrollment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Trial Design and Participants: This trial was designed as a phase 2, randomised, double-blinded, controlled trial conducted at a single clinical site in UAE.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Participants, investigators and other staffs remained blinded to individual treatment assignment during the trial.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Statistical analysis: Assuming that a 4-fold rise in neutralizing antibody titers for both heterogeneous and homologous booster groups reached at 85% and the non-inferiority threshold was set to -10%, the sample size was determined to be 208 using Miettinen & Nurminen method to achieve 80% power at one-sided significance level of 2·5%.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This study has limitations. First, for the volunteers enrolled in the trial, the number of men was much larger than that of women, and thus the data did not well represent the immune effects on women. Second, the proportion of older individuals aged ≥60 years in the participants was small, and the immune response was analyzed without taking into account different age ranges of the participants. Third, data on immune persistence of the booster vaccination is not yet available, and the long-term immunogenicity needs to be further studied. In summary, heterologous booster vaccination with NVSI-06-07 in BBIBP-CorV recipients was well tolerated and immunogenic against not only SARS-CoV-2 prototype strain but also the VOCs including Omicron, which supported the approval of emergency use of this heterologous booster strategy.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT05033847</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Clinical Trial on Sequential Immunization of Recombinant COV…</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.29.21268499
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.31.474653

1
1. sciscore 06 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.31.474653: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Near infra-red (NIR) secondary antibodies, IRDye® 680RD Goat anti-mouse (abcam; ab216776) and IRDye® 800CW Goat anti-rabbit (abcam; ab216773) were subsequently used to probe membranes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Delta and Omicron virus were isolated by inoculating 100 µL of neat swab material onto Vero E6-ACE2-TMPRSS2 cells, incubating at 37°C for 1 h before replacing with growth media supplemented with 1x penicillin/streptomycin and 1x amphotericin B.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>E6-ACE2-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Isolates were passaged a further two times in Vero E6-ACE2-TMPRSS2 cells12.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6-ACE2-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Overexpression experiments in 293T cells were performed by co-transfecting either pCAGGS-ACE2-FLAG or non-cleavable pCAGGs-ACE2-C4-FLAG, with or without TMPRSS2 into 100 mm dishes of 293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: KCB Cat# KCB 200744YJ, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, BHK cells were transfected with 500 ng of ACE2 or empty vector (pDISPLAY) using TransIT-X2</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T, BHK-21, or Calu-3 target cells stably expressing rLuC-GFP-8-11 (target cells) were co-transfected with ACE2 expression constructs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-21</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry-based Spike-ACE2 affinity assay: HEK 293T cells were transfected with mammalian expression plasmids encoding the relevant SARS-CoV2 spike protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: KCB Cat# KCB 200744YJ, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids, pseudovirus and pseudovirus entry assays: Spike-encoding pcDNA3.1 plasmids were generated by mutagenesis or by gene synthesis as described elsewhere4,37.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pCAGGs-ACE2-FLAG and non-cleavable pCAGGs-ACE2C4-FLAG were used a previously described13,38.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGs-ACE2-FLAG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCAGGs-ACE2C4-FLAG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Overexpression experiments in 293T cells were performed by co-transfecting either pCAGGS-ACE2-FLAG or non-cleavable pCAGGs-ACE2-C4-FLAG, with or without TMPRSS2 into 100 mm dishes of 293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGs-ACE2-C4-FLAG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, BHK cells were transfected with 500 ng of ACE2 or empty vector (pDISPLAY) using TransIT-X2</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pDISPLAY</div><div>suggested: RRID:Addgene_51053)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/content/10.1101/2021.12.31.474653v2
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.01.22268609

1
1. sciscore 06 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.01.22268609: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The ethical committee for clinical research of Phrae hospital approved this study (no. 70/2564).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">In addition, we also excluded those who recently received AP prior to hospital admission, had a history of allergy to AP, had elevated liver enzyme, or were pregnant or breastfeeding from the analysis.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Therefore, sample size calculation was unnecessary, and we planned to calculate statistical power afterwards.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were performed using STATA version 16.1MP</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">P (StataCorp LLC, College Station, Texas) and R version 3.3 with a two-sided alpha error of 5%.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Strengths and limitations: To the best of our knowledge, this is the first cohort study of AP’s use in treating mild COVID-19. Admittedly, Thailand was confronted with the favipiravir and vaccine shortages at the beginning of the second wave of the pandemic crisis, leading to the unproven AP’s use for this condition. Consequently, a pharmacovigilance study is required since the real-world data from using AP has been already available so that its efficacy and safety can be clinically ensured. However, there are some limitations worth noticing. First, we cannot avoid residual confounders embedded in an observational study design. For instance, smoking status and mental disorders (e.g., depression) were suggested to be risk factors for developing severe COVID-19 (Centers for Disease Control and Prevention, 2021b, 2021a), and this can be prevalent in people in their 30s and 40s. In addition, patients receiving AP may have a higher risk of developing pneumonia than those who do not (i.e., confounding by indication). Therefore, the observed association might result from residual confounders instead, and the causality cannot be inferred. However, baseline characteristics between groups were mostly similar in terms of statistical (i.e., p-values) and nonstatistical (i.e., eyeballing) consideration. Furthermore, since our study populations were relatively young, many medical conditions that can increase the risk of severe COVID-19, such as cancer, chronic lung disease, and chronic kid...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.01.22268609
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.01.03.474769

1
1. sciscore 06 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.03.474769: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.01.03.474769
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.01.02.473343

1
1. sciscore 06 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.02.473343: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animal immunization: Approval for animal experiments was taken from ‘Institutional Animal Ethics Committee’.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">24 female BALB/c mice, 6 weeks old, were grouped into four groups and immunization was given intra peritoneal (i.p.).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After permeabilization by 0.1 % Triton X-100 for 2 min at room temperature, cells were incubated with 3 % BSA at 37 °C for 1 h followed by incubation with the indicated antibody for 2 h at 4 °C and then detected by Alexa-633-conjugated anti-mouse or Alexa-488 conjugated anti-rabbit secondary antibody for 30 min (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were then analyzed by western blot using the desired antibodies, anti-SARS-CoV-2 S protein (Cat. No.-40591-T62), anti-SARS-CoV-2 N protein (Cat. No.-40143-MM05)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 S protein</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 N protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, Immunized mice sera followed by the respective secondary antibodies (horseradish peroxidase-conjugated anti-mouse or anti-rabbit IgG; Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Isolation of VLP: The Baculovirus infected Sf21 cells were lysed with TEN buffer [10 mM Tris (pH 7.5), 1.0 mM EDTA, 1.0 M NaCl, 0.1% Triton X100, 1 mM PMSF].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sf21</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero cells (5×105) were added to the mixture of SARS-CoV-2-VLPs and antibody in DMEM and 25 mM of HEPES buffer (100 µl) and incubated for 2 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">24 female BALB/c mice, 6 weeks old, were grouped into four groups and immunization was given intra peritoneal (i.p.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vector DNA pBacPAK9 containing the target gene was transfected into Spodoptera frugiperda cells, along with Bsu36 I-digested BacPAK6 Viral DNA as described earlier (Takara Bio Inc., USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBacPAK9</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were taken using Zeiss microscope and image analysis was done using the Zeiss LSM or ZEN software tools.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ZEN</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using Graph Pad Prism version 8.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graph Pad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 9. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.01.02.473343
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.01.02.474750

1
1. sciscore 06 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.02.474750: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">NT scrapings and lung tissues (20% suspension) were prepared in sterile Minimum Essential Medium (MEM; Gibco, USA) using a homogenizer and were screened using rRT-PCR.7 SARS-CoV-2 positive NT and lung homogenized suspension of hamsters (P1 and P2) were further inoculated onto Vero CCL-81 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero CCL-81</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were examined microscopically for cellular morphological changes following inoculation.5 Simultaneously, the Next-generation sequencing for clinical specimens, hamster specimens and virus isolate was performed on the Illumina MiniSeq Machine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MiniSeq</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A phylogenetic tree was generated using the MEGA software version 7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGA</div><div>suggested: (Mega BLAST, RRID:SCR_011920)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 14. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.01.02.474750
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.30.474610

1
1. sciscore 06 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.30.474610: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We implemented TIPars using Java with BEAST library (Suchard et al., 2018).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BEAST</div><div>suggested: (BEAST, RRID:SCR_010228)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To convert a FASTA file to VCF file with all sequence mutations, i.e. insertion, deletion and substitution, we used a Python package PoMo/FastaToVCF.py (Schrempf, Minh, De Maio, von Haeseler, & Kosiol, 2016)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alignments were constructed using MUSCLE (Edgar, 2004).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MUSCLE</div><div>suggested: (MUSCLE, RRID:SCR_011812)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reference trees of these datasets were built using RAxML (Stamatakis, 2014) standard hill-climbing heuristic search with 100 multiple inferences and GTRGAMMA model.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RAxML</div><div>suggested: (RAxML, RRID:SCR_006086)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">When adding unaligned query samples, it is suggested to align them to the MSA of taxa and ancestral sequences in the reference tree using MAFFT (‘--add’ option) (Katoh & Standley, 2013).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We applied two methods to compute log-likelihoods including FastTree2</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FastTree2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: 99% t-test confident intervals and 99% paired t-test p-value (right tail) for the results of TIPars against other programs were computed by Matlab R2013b.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Matlab</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Although we showed that TIPars resulting trees with higher tree log-likelihood compared to other programs, a general limitation of the phylogenetic placement method is that errors from incorrect placements accumulate as multiple sequences are inserted sequentially. In order to minimize the error due to large numbers of sequence insertions, it is suggested to conduct tree refinements on not only branch length but also tree topology using different techniques such as nearest-neighbor interchanges (NNIs) and subtree-pruning-regrafting (SPRs) (Price et al., 2010). Furthermore, starting such optimization process with an initial tree of higher log-likelihood may achieve a final tree with better log-likelihood using certain of time (Price et al., 2010). As demonstrated in table S7, for the resulting trees of equal RF distance from both TIPars and UShER (n=28), the branch length optimized trees for TIPars had higher (n=14) or equal (n=12) tree log-likelihoods than the ones resulted from UShER. TIPars could facilitate the future development of sequence analysis methods that make use of the phylogenetic placement information. For instance, genome assembly of NGS read data from the metagenome can use phylogenetic positions of the short-read sequences to distinguish between related microbial strains or lineages. With the aid of TIPars, NGS sequences could be inserted to the branches of specific strains or lineages in a reference phylogeny. This can be used in calculating the proportion o...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.30.474610
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.30.474561

1
1. sciscore 06 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.30.474561: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: All animal experiments were approved by the ANSES/EnvA/UPEC Ethics Committee (CE2A-16) and authorized by the French ministry of Research under the number APAFIS#25384-2020041515287655 v6, in accordance with the French and European regulations.<br>IRB: All animal experiments were approved by the ANSES/EnvA/UPEC Ethics Committee (CE2A-16) and authorized by the French ministry of Research under the number APAFIS#25384-2020041515287655 v6, in accordance with the French and European regulations.<br>Euthanasia Agents: SARS-CoV-2 virus infection: At day of infection (day post-infection DPI-0), mice were infected via intra-nasal inoculation of SARS-CoV-2 (10 µL each nostril, 104 TCID50 in total) in Dulbecco’s modified Eagle medium, under isoflurane anesthesia.<br>IACUC: The score for clinical symptoms was attributed following an IACUC approved clinical scoring system, and included the following criteria: body weight, posture/fur, activity/ mobility, eye closure, respiratory rate.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animals: K18-hACE2 C57BL/6 transgenic mice (males, 10-week-old), which expresses human ACE2 driven by a human cytokeratin 18 (K18) promoter (Jackson Laboratory, https://www.jax.org/strain/034860) were housed in an animal facility of biosafety level 3 (BSL3) at the French National Veterinary School in Maisons–Alfort, with water and food ad libitum.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">K18-hACE2 transgenic mice were randomly divided into the following groups (6 mice/group): vehicle, melatonin 10mg/kg (MLT10)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">For all analyses, we imaged four fields from at least two sections per mouse and analysis was performed blinded using ImageJ.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Sample sizes were designed to give statistical power while minimizing animal use.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Cell lines were checked regularly for any mycoplasma contamination. hCMEC/D3 cells: For Mpro-induced cell death assay, hCMEC/D3 cells were cultivated and transfected as described previously 29.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse BD Fc Block™) for 15 min at 37°C before incubation with primary antibodies Alexa Fluor 647 Rat Anti-mouse CD31 (BD Pharmigen cat:563608) for CD31 cell labeling and Alexa Fluor 647 Rat IgG2a,k Isotype control (BD Pharmigen cat:557690)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-mouse CD31</div><div>suggested: (Bio-Rad Cat# MCA2388P647, RRID:AB_871974)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sections were blocked with 3% BSA in PBS containing 0.1% Triton X-100 for 6h at room temperature, and incubation with primary antibodies (collagen IV: Bio-Rad, #134001, 1:200; caveolin-1: Cell Signaling Technology, #3267, 1:400) was performed at 4 °C overnight, while incubation with secondary antibodies was performed in blocking solution at room temperature for 2h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>1:200; caveolin-1: Cell Signaling Technology , #3267</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After RNAscope® assays, a classical immunofluorescence was performed using the Anti-Collagen IV primary antibody (Anti-Collagen IV, Abcam: ab6586, 1:500°) and a secondary Alexa488 Fluor-conjugated antibody (1:500; Molecular Probes, Invitrogen) and DAPI (ACDBio) was used to stain the nuclei.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Collagen IV</div><div>suggested: (Abcam Cat# ab6586, RRID:AB_305584)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Staining was performed as described above using primary antibodies against GFP (Abcam, #ab13970, 1:2000) and DAPI (1:2000), and imaged using a fluorescence microscope (DMI6000B, Leica).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GFP</div><div>suggested: (Abcam Cat# ab13970, RRID:AB_300798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, Lumi4-Tb-labelled ACE2 cells were incubated with d2-labelled anti-FLAG tag antibody (2 μg/mL, 1h at room temperature; 61FG2DLF, Cisbio Bioassays), followed by addition of non-labelled RBD (5 nM) or melatonin (100 µM) and TR-FRET signal was immediately read during 1h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-FLAG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>melatonin</div><div>suggested: (Novus Cat# NB100-62745, RRID:AB_964468)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture and transfection: HEK293T cells: HEK293T (RRID:CVCL 0063) cells were obtained from Sigma-Aldrich and authenticated by the provider.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SNAP-tagged ACE2, expressed in HEK293 cells, were fluorescently labelled by incubating cells with a SNAP suicide substrate conjugated to the long-lived fluorophore Terbium cryptate (Tb;</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, Lumi4-Tb-labelled ACE2 cells were incubated with d2-labelled anti-FLAG tag antibody (2 μg/mL, 1h at room temperature; 61FG2DLF, Cisbio Bioassays), followed by addition of non-labelled RBD (5 nM) or melatonin (100 µM) and TR-FRET signal was immediately read during 1h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animals: K18-hACE2 C57BL/6 transgenic mice (males, 10-week-old), which expresses human ACE2 driven by a human cytokeratin 18 (K18) promoter (Jackson Laboratory, https://www.jax.org/strain/034860) were housed in an animal facility of biosafety level 3 (BSL3) at the French National Veterinary School in Maisons–Alfort, with water and food ad libitum.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">K18-hACE2 transgenic mice were randomly divided into the following groups (6 mice/group): vehicle, melatonin 10mg/kg (MLT10)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, after withdrawing heparin from the medium, we transfected the cells using Lipofectamine 3000 (Thermo Fisher Scientific) and the following plasmids: pCAG-GFP, pCAG-p.Cys145Ala-Mpro-HA or pCAG-Mpro-HA (100 ng per well on 96-well plates).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAG-GFP</div><div>suggested: RRID:Addgene_11150)</div></div><div style="margin-bottom:8px"><div>pCAG-p.Cys145Ala-Mpro-HA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCAG-Mpro-HA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis was performed blinded using ImageJ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Molecular dynamics simulations were computed with GROMACS 2020.5 67.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GROMACS</div><div>suggested: (GROMACS, RRID:SCR_014565)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical comparisons were performed using Prism 9 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.30.474561
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.31.474593

1
1. sciscore 06 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.31.474593: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2 and TMPRSS2 antibodies were purchased from R&D SYSTEMS (AF933) and Santa Cruz (sc-515727)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>TMPRSS2</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-515727, RRID:AB_2892118)</div></div><div style="margin-bottom:8px"><div>AF933</div><div>suggested: (R and D Systems Cat# AF933, RRID:AB_355722)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To improve the infectivity, the cell populations with a higher ACE2 expression in clone 43.20 were FACS sorted using ACE2-specific antibody (AF933, R&D Systems).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2-specific</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fixed cells were either labeled with a human monoclonal antibody conjugated with Alexa-488 against the spike antigen (10.1371/journal.pmed.0030237) or a mouse monoclonal antibody that recognizes the NP antigen (SinoBiological, #40143-MM08) by incubation for 2 hours at 4 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Alexa-488 against the spike antigen (10.1371/journal.pmed.0030237)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing with saline-Tween 20 (0.05%), the cells were labeled with an anti-mouse goat secondary antibody conjugated with Alexa-594 by incubation for 1 h at 4 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse goat</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549 cells (CCL-185), Calu-3 (HTB-55) and Vero E6 (CRL-1586) were obtained from ATCC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: ATCC Cat# HTB-55, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Commercial cell lines, A549ACE2 and A549ACE2/TMPRSS2 were purchased from InvivoGen.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549ACE2/TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antiviral compounds Remdesivir and EIDD-193 were purchased from MedChemExpress</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EIDD-193</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The test compounds were solubilized in DMSO to yield 10 mM stock solutions for cell culture studies. 2.2. Generation of A54943.20, A549ACE2plus, A549ACE2plusC3 cells: A549 cells were first transduced with human ACE2-expressing lentivirus (~2 × 105 CFU/ml) and selected with 1ug/ml of puromycin as previous described (Koupenova et al., 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549ACE2plusC3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">5 Vero E6 cells were seeded to each well of 12-well plates and cultured at 37 °C, 5% CO2 for 18 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The generation of pseudotyped lentiviral particles was based on the protocol as previous described (Crawford et al., 2020). pcDNA3.3-WA1-SARS2, pcDNA3.3-Alpha-SARS2, pcDNA3.3-Beta-SARS2, pcDNA3.3-Delta-SARS2 were gifts from David Nemazee</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.3-WA1-SARS2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pcDNA3.3-Alpha-SARS2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pcDNA3.3-Beta-SARS2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pcDNA3.3-Delta-SARS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Addgene plasmid #170442, #170451, #170449, 172320). pcDNA3.1-Omicron-SARS2 (# MC0101274) was purchased from GenScript.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1-Omicron-SARS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pHAGE-EF1a-ACE2PGK-puroR (internal ID 55490) and pHAGE-EF1a-TMPRSS2-PGK-puroR (internal ID 11816) plasmids were from hOrfeome 5.1 collection in the Maehr lab.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHAGE-EF1a-ACE2PGK-puroR</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pHAGE-EF1a-TMPRSS2-PGK-puroR</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The images were processed using MetaXpress Software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MetaXpress</div><div>suggested: (MetaXpress, RRID:SCR_016654)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All tests were performed using Prism 9 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 18. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.31.474593
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.01.02.474743

1
1. sciscore 06 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.02.474743: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: All animal studies were conducted in compliance with all relevant local, state, and federal regulations and were approved by the BIOQUAL Institutional Animal Care and Use Committee.<br>IACUC: All animal studies were conducted in compliance with all relevant local, state, and federal regulations and were approved by the BIOQUAL Institutional Animal Care and Use Committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study design: Eight week old female and male golden Syrian hamsters (Envigo) were infected with SARS-CoV-2 in a volume of 100 µl (50 µl/nostril) by the intranasal route.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Omicron Stock 2 had a titer of 2.3×108 TCID50/ml and 3.8×106 PFU/ml in VeroE6-TMPRSS2 cells (EPI_ISL_7263803; Yoshihiro Kawaoka, University of Wisconsin).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">9 The gene fragments were subsequently cloned into a pcDNA3.1+ expression plasmid using restriction site cloning (Integrated DNA Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1+</div><div>suggested: RRID:Addgene_117272)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses: Analysis of virologic and body weight data was performed using GraphPad Prism 9.1.2 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.01.02.474743
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.31.474032

1
1. sciscore 06 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.31.474032: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Webplotdigitizer2 was used for the following studies: GMTs for Sigal4 2*Pfizer and Infection(Inf)+Pfizer sera, Sheward5, Ciesek6, Zhang7 (subset), Krammer8, Chen9 and Veesler10 were obtained by Webplotdigitizer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Webplotdigitizer</div><div>suggested: (WebPlotDigitizer, RRID:SCR_013996)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.31.474032
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.01.02.474028

1
1. sciscore 06 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.02.474028: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In vitro assessment of Cilengitide inhibition of SARS-CoV-2 binding: An in vitro para-nitrophenyl phosphate binding assay was performed using human colorectal adenocarcinoma Caco-2 cells and formaldehyde-fixed SARS-CoV-2 to investigate the ability of RGD cyclic pentapeptide compound Cilengitide (0.05 and 0.005 μM) to reduce viral adherence, as described previously18.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structures were energetically repaired in Yasara using the FoldX suite and visually compared using PyMol and CCG Molecular Operating Environment (MOE).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FoldX</div><div>suggested: (FoldX, RRID:SCR_008522)</div></div><div style="margin-bottom:8px"><div>PyMol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Only the best ranked binding pose obtained from AutoDock Vina was used for MD simulations.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AutoDock</div><div>suggested: (AutoDock, RRID:SCR_012746)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.01.02.474028
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.29.21268120

1
1. sciscore 06 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.29.21268120: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data in this study was sourced from the DATA.GOV.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DATA.GOV</div><div>suggested: (Data.gov, RRID:SCR_004712)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.29.21268120
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.31.21268575

1
1. sciscore 06 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.31.21268575: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics statement: The study protocol was approved by the statutory clinical research committee of Leumit Health Services and the Shamir Medical Center Institutional Review Board (129-2-LEU).<br>Consent: Informed consent was waived because this is a large-scale retrospective study and all data were deidentified.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study has several limitations. First, it is based on a population which was vaccinated almost exclusively with the Pfizer/Biotech BNT162b2 vaccine, and with the first two doses spaced by 21 days. It is uncertain how the estimated effect of vaccination under these conditions would apply to populations vaccinated using different vaccines or using a different vaccination schedule. Moreover, factors specific to our health organization may have affected the results, such as criteria for hospital admission, and treatment decisions that influence mortality. Evolving patient management policies could have a confounding effect on the number of vaccine doses at different times. Last, we have yet to assess the model ability to predict disease severity with new viral variants, such as the recently spreading Omicron. Additional studies in different populations would help to ascertain the validity of our models in different settings. To enable such validation studies, we provide the full model formulas and encourage their use. In conclusion, the models described here, and available online as a calculator, allow to identify individuals most at risk for severe disease or death if infected, using very few essential parameters and vaccination status. This approach can guide public health decisions to optimally allocate vaccines and scarce medicines to maximize lives saved5. Calculator address: https://covidest.web.app/
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.31.21268575
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.30.21267090

1
1. sciscore 05 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.30.21267090: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In this study, we used Covasim’s default parameters and the “hybrid” network structure for England (see Section 2.4 of [9] for details), with the default data included in the model for English population age structure and household sizes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Covasim’s</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Using Covasim version 3.0.7, we generated a population of 100,000 agents interacting over the four contact-network layers (households, workplaces, schools, and communities).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Covasim</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(ii) Modelling different SARS-CoV-2 variants: In our previous work we either modelled a single strain (wild type) of SARS-CoV-2 [15,17], or implicitly modelled the effect of two strains (wild type and Alpha variant) [18].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: (BioLegend Cat# 946101, RRID:AB_2892515)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These were necessary since the mobility changes in the Google reports stratify society in different ways to how we stratify society in the layers depicted in Figure 2(c).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Google</div><div>suggested: (Google, RRID:SCR_017097)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) hyperparameter optimisation framework in Python to search the 9-dimensional parameter space for optimal values that minimised the absolute difference between the model’s estimates of daily cases, deaths, and severe infections (representing hospitalisations), and the corresponding data on cumulative and daily infections by date reported, deaths within 28 days, and admissions to hospital by date reported between September 1, 2020 and June 20, 2021.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.30.21267090
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.03.21268111

1
1. sciscore 05 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.03.21268111: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants gave written informed consent to take part in the study.<br>IRB: The DOVE study was approved by the North-West Liverpool Central Research Ethics Committee (REC reference 21/NW/0073).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Measurement of SARS-CoV-2, HCoVs and influenza antibody response by electrochemiluminescence: IgG antibody titres were measured quantitatively against SARS-CoV-2 trimeric spike (S) protein, N-terminal domain (NTD), receptor binding domain (RBD) or nucleocapsid (N), human seasonal coronaviruses (HCoVs) 229E, OC43, NL63 and HKU1; and influenza A (Michigan H1, Hong Kong H3 and Shanghai H7) and B (Phuket HA and Brisbane) using MSD V-PLEX COVID-19 Coronavirus Panel 2 (K15369) and Respiratory Panel 1 (K15365) kits.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 trimeric spike (S) protein, N-terminal domain (NTD), receptor binding domain (RBD) or nucleocapsid (N)</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Caco-2 are an immortalized cell line derived from human colorectal adenocarcinoma, primarily used as a model of the intestinal epithelial barrier.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: CLS Cat# 300137/p1665_CaCo-2, RRID:CVCL_0025)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549 cells, a human alveolar adenocarcinoma line, were modified to stably express human ACE-2 and TMPRSS2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Baby Hamster Kidney clone 21 cells and Vero ACE-2 TMPRSS2 cells were used in the isolation of live Omicron SARS-CoV-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE-2 TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All cell lines were maintained at 37°C and 5% CO2 in DMEM supplemented with 10% foetal bovine serum (FBS), except for Calu-3 cells which were supplemented with 20% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of cell line expressing human ACE2 receptor: Lentiviral vectors encoding human ACE2 (GenBank NM_001371415.1) were produced as described previously69 and BHK-21 transduced cells were selected with 200µg/ml of hygromycin B.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-21</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of cell lines used for fusion assays: Retrovirus vectors were produced by transfecting HEK- 293T cells with plasmid pQCXIP-GFP1-10 (Addgene #68715) or pQCXIP-BSR-GFP11 (Addgene #68716)53 and packaging vectors expressing MLV gal-pol and VSV-G using Lipofectamine 3000 (Invitrogen) according to manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BHK-hACE2 cells previously seeded at a cell density of 3x10^5 cells in T25 flask were inoculated with 400-500µL of resuspended samples in 5ml of complete medium (DMEM 2% FCS supplemented with gentamicin, penicillin- streptomycin and amphotericin B as above).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293, HEK293T, and 293-ACE269 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% FBS, 200mM L-glutamine, 100µg/ml streptomycin and 100 IU/ml penicillin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>293-ACE269</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells were transfected with the appropriate SARS-CoV-2 S gene expression vector (wild type or variant) in conjunction with p8.9171 and pCSFLW72 using polyethylenimine (PEI, Polysciences, Warrington, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fusion assay: AAT-GFP1-10 and AAT-BSR-GFP11 cells were trypsinized and mixed at a ratio of 1:1 to seed a total of 2x10^4 cells/well in black 96-well plate (Greiner) in FluoroBrite DMEM medium (Thermo Fischer Scientific) supplemented with 2% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AAT-BSR-GFP11</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of cell lines used for fusion assays: Retrovirus vectors were produced by transfecting HEK- 293T cells with plasmid pQCXIP-GFP1-10 (Addgene #68715) or pQCXIP-BSR-GFP11 (Addgene #68716)53 and packaging vectors expressing MLV gal-pol and VSV-G using Lipofectamine 3000 (Invitrogen) according to manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pQCXIP-GFP1-10</div><div>suggested: RRID:Addgene_68715)</div></div><div style="margin-bottom:8px"><div>pQCXIP-BSR-GFP11</div><div>suggested: RRID:Addgene_68716)</div></div><div style="margin-bottom:8px"><div>VSV-G</div><div>suggested: RRID:Addgene_138479)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells were transfected with the appropriate SARS-CoV-2 S gene expression vector (wild type or variant) in conjunction with p8.9171 and pCSFLW72 using polyethylenimine (PEI, Polysciences, Warrington, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCSFLW72</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequences were aligned by mapping to the SARS-CoV-2 reference Wuhan-Hu-1 using Minimap2 (https://doi.org/10.1093/bioinformatics/bty191).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Minimap2</div><div>suggested: (Minimap2, RRID:SCR_018550)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analysed using MARS software and plotted with GraphPad prims 9 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structural modelling: The file 6vsb_1_1_1.pdb containing a complete model of the full-length glycosylated spike homotrimer in open conformation with one monomer having the receptor-binding domain in the ‘up’ position was obtained from the CHARMM-GUI Archive [cite Woo et al. 2020, cite CHARMM-GUI 2021].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHARMM-GUI Archive</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.03.21268111
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.02.22268641

1
1. sciscore 05 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.02.22268641: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: This is based on the fact that the project used deidentified specimens from a biobank with a determination that this project did not meet the definition of human subjects research based on specific criteria as described below.<br>Consent: The original samples were collected at Rhode Island hospital by the Lifespan Brown COVID-19 Biobank through an IRB-approved protocol that involved informed consent that was used by the biobank.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293FT cells (Invitrogen) at 75% confluency were co-transfected with the backbone vector pHAGE-fullEF1α-Luciferase-IRES-ZsGreen, plasmids expressing lentiviral proteins Tat, Rev and Gag/Pol, and plasmids expressing D614 or D614G S protein (a gift from Dr. Hyeryun Choe, The Scripps Research Institute, Jupiter, FL), or S protein with N501Y, E484K, N501Y+E484K or N501Y+E484K+K417N mutations.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293FT</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following drug treatment, HSAE cells were spin-infected with SARS-CoV-2 pseudoviruses or a pantropic VsVg positive control lentivirus in a 12-well plate (931 g, 2 hours, 30°C with 8 μg/ml polybrene).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HSAE</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293FT cells (Invitrogen) at 75% confluency were co-transfected with the backbone vector pHAGE-fullEF1α-Luciferase-IRES-ZsGreen, plasmids expressing lentiviral proteins Tat, Rev and Gag/Pol, and plasmids expressing D614 or D614G S protein (a gift from Dr. Hyeryun Choe, The Scripps Research Institute, Jupiter, FL), or S protein with N501Y, E484K, N501Y+E484K or N501Y+E484K+K417N mutations.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHAGE-fullEF1α-Luciferase-IRES-ZsGreen</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An S protein expression plasmid construct containing all Omicron variant (B.1.1.529) mutations (28) was custom-made by GenScript (Piscataway, NJ): pcDNA3.1(+)-SARS-CoV-2-Omicron-(6xHis)-Spike (human codon).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis of ZsGreen+ cells was conducted by flow cytometry 20-24 hours after infection using a BD LSRII flow cytometer and FlowJo software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We completed a human subjects determination form for the Human Subjects Protection Program at Brown University.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Human Subjects Protection Program</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Since we answered “no” to all these questions, our proposed project did NOT involve “Human Subjects.” Based on the information included in the Human Subjects Determination Form, The Human Research Protection Program at Brown University agreed with the investigator’s self-determination that the project does not meet the definition of human subjects research.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Human Research Protection Program</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Two limitations of this study include the small sample size of plasma samples from patients with COVID-19, as well as the lack of serial samples over time from the same patient. Because we only analyzed plasma from patients upon admission to the emergency department, we may have missed fluctuations in TGF-β concentrations, which are thought to peak during the first two weeks post-infection in severe COVID-19 cases (37). Future work should monitor levels of TGF-β in serial patient samples. Since its first identification in South Africa in November, 2021, the SARS-CoV-2 Omicron variant raised serious concerns of a significant reduction in efficacy of vaccines and monoclonal antibody treatments and an increased risk of reinfection due to numerous mutations in its spike protein, which is the antigenic target of infection- and vaccine-elicited antibodies against SARS-CoV-2. Currently, the Omicron variant is on track to outcompete the Delta variant as cases have soared to record highs in parts of Europe and now the U.S. according to the data released by Johns Hopkins University (https://coronavirus.jhu.edu/data). A number of recent studies suggest that much of the Omicron variant’s dominance comes down to its ability to evade the body’s immune defenses (28, 30, 38-40). However, earlier analyses of patients in South Africa suggest Omicron-infected individuals had a reduced risk of severe disease when compared to Delta-infected individuals (39). In the first findings on how the Omicr...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.02.22268641
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.01.22268615

1
1. sciscore 05 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.01.22268615: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants gave informed consent prior to enrollment and this study was approved by the Mass General Brigham Institutional Review Board (IRB; protocol #2020P003538).<br>IRB: All participants gave informed consent prior to enrollment and this study was approved by the Mass General Brigham Institutional Review Board (IRB; protocol #2020P003538).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study Population: To compare vaccine-induced antibody responses to SARS-CoV-2 VOCs in pregnant individuals, samples from 10 pregnant patients receiving the full two dose regimen BNT162b2 (Pfizer) andr from 10 pregnant patients receiving the full two dose regimen mRNA-1273 (Moderna) were obtained 2-4 weeks after the second dose.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IgG subclass, isotype and FcγR binding: Antigen-specific antibody subclass and isotypes, and FcγR binding was analyzed by Luminex multiplexing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG subclass,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Antigen-specific</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Unbound antibodies were washed away and subclasses, isotypes were detected with a respective PE-conjugated antibody (anti-human IgG1, IgG2, IgG3, IgG4, IgM or IgA1 all SouthernBiotech, AL, USA) at a 1:100 dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG3, IgG4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA1</div><div>suggested: (LSBio (LifeSpan Cat# LS-C68444-100, RRID:AB_1649687)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Stabilized (hexa-pro) Spike of D614G (“wildtype” variant) or VOCs was produced in HEK293 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.01.22268615
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.30.21268495

1
1. sciscore 05 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.30.21268495: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Because this study only queried statistics of de-identified patient records through web-applications and did not involve retrieval, storage, collection, use, or transmittal of individually identifiable data, Institutional Review Board approval and informed consent was not needed or sought.<br>Consent: Because this study only queried statistics of de-identified patient records through web-applications and did not involve retrieval, storage, collection, use, or transmittal of individually identifiable data, Institutional Review Board approval and informed consent was not needed or sought.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">diseases, chronic kidney diseases, liver diseases, HIV infection, dementia, substance use disorders, depression and anxiety (assessed by ICD-10 codes); behavioral factors (tobacco smoking, alcohol drinking) (assessed by one or more encounter based on ICD-10 codes); COVID-19-related medications10 including remdesivir, dexamethasone, hydrocortisone, tocilizumab, fluvoxamine, and fluoxetine (assessed by RxNorm codes); and vaccination status documented in patient EHRs (Pfizer, Moderna</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RxNorm</div><div>suggested: (RxNorm, RRID:SCR_006645)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study has several limitations: First, the observational, retrospective nature of this study of patient EHR data could introduce selection, information, testing, reporting and follow up issues. However, because we compared the different population all from the TriNetX dataset, these issues should not significantly affect the relative risk analyses. Second, patients in the TriNetX EHR database are those who had medical encounters with healthcare systems contributing to the TriNetX Platform and do not necessarily represent the entire US population. Therefore, results from the TriNetX platform need to be validated in other populations. Third, both the Emergent Omicron and Delta cohorts in our study were defined based on CDC’s national genomic sequence surveillance. The Emergent Omicron cohort likely contained some infections with the Delta variant, but this admixture would tend to reduce the observed differences. However, our findings of reduced hospitalization in the Emergent Omicron cohort compared to the Delta cohort is consistent with findings from Africa4, Scotland5, and England6 that were based on genomic sequences, and goes further to indicate that the severity in hospitalization is reduced. The fact that there were no marked differences between the two Delta cohorts yet significant differences between the Emergent Omicron and Delta cohorts further corroborates that the differences in outcomes for infections occurring between 12/15/2021–12/24/2021 were likely to be cau...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.30.21268495
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.02.22268621

1
1. sciscore 05 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.02.22268621: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Furthermore, a number of limitations are important to note. For the purpose of this study, we used published estimates of the sensitivity and specificity largely informed by a systematic review and meta-analysis [25]. As is the case for many test validation studies, these values are based on the use of the test relative to a gold standard. For these studies, PCR is used as a pseudo gold standard. However, PCR itself should not be considered a gold standard test and likely has a test sensitivity which is less than 100% [33], therefore the true sensitivity of the RADT may be lower than that used for the analysis. It is also recognised, that ‘reference test’ approaches to diagnostic test evaluation will also likely underestimate the specificity of the evaluated test when the reference test is not a true gold standard [34]. On the other hand, a key consideration for such studies is the target condition which the test aims to identify. In our study, we simulated prevalences of infectious individuals by considering the duration of the infectious window and likely restriction of movement of infected individuals. However, this target condition does not necessarily align with the sensitivity estimated in conventional test validation studies which conventionally will include individuals who are PCR detectable but may not be infectious. It has been shown that sensitivity of RADTs varies according to the Ct-value of the corresponding PCR test [26], with transmissibility increasing at low...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.02.22268621
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.24.21268382

1
1. sciscore 05 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.24.21268382: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Omicron cases were matched to Delta cases using up to 2:1 matching on gender (male, female, other), age (0-4, 5-11, 12-18, 19-29, 30-39, 40-49, 50-59, 60-69, 70-79, 80+), vaccination status (0 doses, 1 dose, 2 doses, 3 doses), time since most recent dose (>7 or 14 days to <3 months, 3-6 months, >6 months), region and onset date (±7 days).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Delta cases included those detected by WGS, those with amplification of the S-gene, and all cases not identified as Omicron prior to December 3 (date of 5% Omicron prevalence)2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>WGS</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study has some limitations, in particular the short follow-up duration and potential misclassification due to incidental findings from hospital admission screening, and incomplete public health follow-up as incidence increased. Nevertheless, Omicron appears to demonstrate lower disease severity for both vaccinated and unvaccinated individuals. While severity is likely to be reduced, the absolute number of hospitalizations and impact on the healthcare system is likely to be significant due to the large number of Omicron infections.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.24.21268382
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.31.21268587

1
1. sciscore 05 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.31.21268587: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: For stratified and incident analyses medication records were required to have a valid pseudo-identifier ID (a non-identifying unique master key that replaces the NHS number following linkage) for data linkage to socio-demographic and regional characteristics.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">We included medications dispensed to individuals who were aged between 18 and 112 years, with sex reported as male or female and at pharmacies in the relevant nation (for example, in England Lower-layer Super Output Area (LSOA) starting with E).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Strengths and weaknesses of the study: This is the largest ever study to date using a medicines lens to investigate the impact of the COVID-19 pandemic on CVD risk factors at a population-scale in England, Scotland and Wales. A strength of using a medicines perspective is that it is closer to the active control of CVD risk factors in the patient population. We developed and applied a new categorisation of CVD medicines according to prescribed medicine use for this purpose informed by pharmacological and clinical knowledge of use of these medicines in practice. A limitation relates to the difficulty in assigning diseases for overlapping indications for some medications. The approach we used aligns with the primary indication for a medication as per the BNF. This may result in underestimates of certain CVDs. For example, heart failure is likely to be underestimated as management options overlap with hypertension and type-2 diabetes (e.g. ACE-I, beta blockers and SGLT-2 inhibitors). This analysis could be extended in future work by linking to disease diganosis codes to refine estimates for heart failure. However, the analyses presented here do give an indication of the overall missed CVD risk factors to alert policy makers to the indirect effect of COVID-19. These analyses do not take account of dispensed quantity with each dispense counting as a single unit and this issue lends itself to further research. We used atorvastatin 40mg and simvastatin 40mg to demonstrate that this i...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.31.21268587
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.24.21268387

1
1. sciscore 05 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.24.21268387: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Some limitations and logistical challenges remain, however. First, as the proportion of vaccinated individuals continues to rise, this subgroup will be increasingly difficult to identify and reach. In the current study context, the proportion of fully vaccinated individuals was well above 70% already at Wave 1 of data collection. However, it is anticipated that booster shots coinciding with future waves will provide an opportunity to shift focus from two vaccines to three and beyond. A further limitation is that hospitalization and other disease-related variables are self-reported. Finally, as the media becomes increasingly saturated with communications about COVID-19, and as the threat posed by the pandemic waxes and wanes, modelling temporal factors over time will become increasingly important. This may also have a disproportionate impact on Study 2, because of the sequencing of execution after the abatement of the fourth COVID-19 wave.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.24.21268387
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.25.21268404

1
1. sciscore 05 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.25.21268404: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Using a custom Python code, we identified the presence of the D614G, N501Y and P681R mutations, and combinations thereof (c.f. ‘Data Availability Statement’ for our code).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Models were simulated in aqueous solution (TIP3, water, 0.15M ions, NVT ensemble, 310K) using NAMD 2.14 software [46].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NAMD</div><div>suggested: (NAMD, RRID:SCR_014894)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.25.21268404
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.01.01.22268603

1
1. sciscore 05 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.01.01.22268603: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics: The Ethics committee of the Charité approved the study as an amendment to a previous POC influenza investigation (EA2/204/19).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.01.01.22268603
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.30.21268540

1
1. sciscore 04 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.30.21268540: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Clinical cohorts and samples: Characterization of these samples at Stanford was performed under a protocol approved by the Institutional Review Board of Stanford University (protocol<br>Consent: All participants gave written informed consent, and all study procedures were approved by the Institutional Review Board of Stanford University (IRB-55619).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">There are 28 males and 29 females in the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Stanford Lambda cohort: 120 participants were enrolled in a phase 2 randomized controlled trial of Peginterferon Lambda-1a (Lambda, NCT04331899) Inclusion/exclusion criteria and the study protocol for the trial have been published(12).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After poly-D-lysine treatment, plates were washed three times with sterile water and then seeded with 1.5e6 cells of HEK 293T per well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: KCB Cat# KCB 200744YJ, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Prior to infection, Vero E6-TMPRSS2-T2A-ACE2 cells were washed with 1X PBS and then 50 μL of the incubated pseudotyped particles and patient plasma mixture was then transferred from the U-bottom 96-well dilution plates onto the monolayer and placed into an incubator at 37°C and 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6-TMPRSS2-T2A-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 spike variant spike construction: The WT SARS-CoV-2 spike gene was previously amplified with KOD Xtreme Hot Start DNA polymerase (Millipore) using cDNA from SARS-CoV-2/human/USA/WA-CDC-WA1/2020 (GenBank MN985325.1) and cloned into pCC1BAC-his3 vector (27).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCC1BAC-his3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">50 fmol of each amplicon and 15 fmol of YCP/BAC vector were covalently joined using standard Gibson assembly reaction (NEB), transformed into E.coli DH10B competent cells (Thermo Fisher), and plated on LB medium with 12.5 mg/ml chloramphenicol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>YCP/BAC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lastly, the spike genes lacking the cytoplasmic domain by deleting the last 18 amino acides were then cloned into the pCAGGS expression vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_127347)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 24 hours (h), cells were transfected with 1 µg of pCAGGS-SΔ18 per well using Lipofectamine 2000 transfection reagent (ThermoFisher, Cat. No., 11668019).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS-SΔ18</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A non-linear curve and the half-maximal pseudoparticle neutralization titer (pNT50) were generated using GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNT50</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">E.coli transformants were verified to contain correct mutations using PCR and Sanger sequencing (GeneWiz).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GeneWiz</div><div>suggested: (GENEWIZ, RRID:SCR_003177)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A non-linear curve and the half-maximal pseudoparticle neutralization titer (pNT50) were generated using GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04331899</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Single-Blind Study of a Single Dose of Peginterferon Lambda-…</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.30.21268540
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.29.21268505

1
1. sciscore 04 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.29.21268505: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Informed consent was obtained after pre-screening.<br>IRB: Ethics: This study was approved by the Ethic Committee Switzerland (Ethikkommission Nordwest-und Zentralschweiz (EKNZ) AO_2020-00018) and the National Health and Research and Ethics Committee of Lesotho (NH-REC; ID-107-2020).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">A posterior-anterior chest x-ray was also performed in all adult non-pregnant participants with at least one symptom compatible with COVID-19 (see above), or with clinical signs of tuberculosis or upon specific request by the physician in case of children and pregnant women.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations are that the study was conducted only at two clinics and that nasal and nasopharyngeal Ag-RDT were read by the same reader by visual inspection without the use of a reading device, which might have allowed for a more standardized test interpretation. Further, the previous nasal swab for Ag-RDT may have influenced the yield of the subsequent two nasopharyngeal swabs in participants with low viral secretions(24). For ethical reasons, we had to exclude critically ill patients, which may have led to a certain spectrum bias by underrepresenting patients with very advanced disease. In conclusion, this prospective study including 2131 not critically ill participants with COVID-19 compatible symptoms or exposure to SARS-CoV-2 in Lesotho showed a rather low overall sensitivity of the STANDARD Q Ag-RDT on nasopharyngeal and nasal sampling of about 70% and 67% whereas the specificity was above 97%. Agreement between nasal and nasopharyngeal sampling for the Ag-RDT was high, suggesting that the more convenient nasal sampling may be sufficient for routine screening and testing in outpatient settings.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.29.21268505
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.30.21267519

1
1. sciscore 04 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.30.21267519: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.30.21267519
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.31.21268580

1
1. sciscore 04 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.31.21268580: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.31.21268580
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.30.21266217

1
1. sciscore 04 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.30.21266217: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was reviewed and approved by the Research Ethic Committee of Fatmawati General Hospital (27/KEP/XII/2020).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Individuals who were pregnant and data for the outcome cannot be achieved excluded from this study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Diabetes was determined based on the patient’s medical history and laboratory parameters, including HbA1C > 6.5 or fasting blood glucose > 126 mg/dL or random blood glucose > 200 mg/dL in two consecutive measurements.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All the analysis was performed using STATA Version 12.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This study has several limitations to be discussed. First, we cannot analyze the time relationship in this study. That is because we did not measure the diabetes duration. Second, diabetes is a heterogeneous population. We included all subjects with diabetes conditions, including type 1 diabetes, type 2 diabetes, newly diagnosed diabetes, controlled or uncontrolled diabetes, those who received insulin or oral diabetes medication. Therefore, there is no specificity in this study, nor we performed a sub-analysis of which of these different factors might play a role in the outcome. Lastly, our study is conducted in a tertiary facility and one of the largest hospitals in Indonesia that the government-appointed as an advanced referral hospital. About 45.85% of subjects in this study already came with critical conditions, and 8.89% were already in severe conditions. Therefore, readers should be careful in generalizing our results. In accordance with our findings, a meta-analysis including 22 studies showed individuals with a more severe diabetes condition have a poorer prognosis of COVID-19 compared to those with milder diabetes conditions.27 A Spanish COVID-19 registry found admission hyperglycemia (RBG > 180 mg/dL) regardless of diabetes diagnosis was a strong predictor of all-cause mortality in non-critically hospitalized patients.28 Moreover, the chronic hyperglycemia condition also leads to increased fibrinogen amyloid changes, leading to hypercoagulability conditions.29 It is...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.30.21266217
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.30.21268538

1
1. sciscore 04 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.30.21268538: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis was performed using SPSS software (IBM SPSS Statistics for Windows, Version 25.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Suggested mechanisms in the literature include Immune- mediated damage to the autonomic nervous system during COVID-19 and a peripheral cardiac limit to exercise resulting from an oxygen diffusion defect [9,10] Limitations: Our study has some limitations, including the small cohort size and differences in baseline characteristics. However, the fact that we measure findings in individuals against their own predicted value adjusts for these differences to a large extent. A sub analysis excluding patients with co-morbidities did not change the findings (data not shown). Two of the patients were only partially vaccinated, possibly leading to a slight underestimation of the effect of vaccination. We did not evaluate blood gas, which could have revealed more about the main cause of exercise limitation for patients with reduced pVO2.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.30.21268538
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.30.21268532

1
1. sciscore 04 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.30.21268532: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the Ethics Committee of the Federal University of São Paulo (CAE-47617621.6.0000.5505).<br>Consent: All participants signed an informed consent form and participated in the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IgG antibody assays against SARS-CoV-2 RBD protein were performed using the Access SARS-CoV-2 IgG antibody (1°IS) (Beckman Coulter, Inc.) according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 IgG</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  One limitation of this study is the use of an immunochemiluminescence test as a surrogate marker of the immune humoral response, and not a plaque reduction neutralization test. Nonetheless, the assay detected the total immunodominant neutralizing antibodies that targeted the viral peak protein (S) receptor binding domain (RBD). It is generally used as a test of high sensitivity and specificity, and is evaluated as a correlate of protection in the recent studies cited above. Indeed, a previous study on IgG antibody tests and their correlation with the SARS-CoV-2 surrogate virus neutralization test (sVNT) in patients with COVID-19 has been evaluated and validated by analyzing convalescent serum and samples from non-COVID-19 patients. (13) Other immunological markers not tested in our study may contribute to the protection of previously immunized patients, even in the absence of antibody persistence. A non-peer-reviewed study of Brazilian professional health workers reported a 50.7% efficacy of CoronaVac in the prevention of severe forms of SARS-CoV-2 infections in a phase 3 clinical trial. (14) Another study published in China showed that HCW maintained their B cells and T cells specific for SARS-CoV-2 detection five months after two doses of the Sinopharm vaccine. (15)
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.30.21268532
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.29.21268525

1
1. sciscore 04 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.29.21268525: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Additionally, anti–SARS-CoV-2 antibody content was assessed in each donation, with a requirement for a SARS-CoV-2 seroneutralization titer ≥40 (≥80 after October 2020) and/or an immunoglobulin G (IgG) enzyme-linked immunosorbent assay (EUROIMMUN, Bussy-Saint-Martin, France) ratio >5.6 (≥8 after October 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti–SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Bussy-Saint-Martin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Covariates considered in univariable analysis were gender, age (≥70 years versus below), comorbidities (diabetes, high blood pressure, and body mass index), type of hematological malignancies, previous B-cell depletion therapy such as anti-CD20 or anti-CD19 monoclonal antibodies (mAbs), time between symptoms onset and CCP transfusion, and disease status (complete remission, partial remission/stable disease, and progressive disease).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD20</div><div>suggested: (BD Biosciences Cat# 643397, RRID:AB_1645743)</div></div><div style="margin-bottom:8px"><div>anti-CD19</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were done using R software version 3.6.1 and SAS® Software version 9.4 (Cary, North Carolina, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS®</div><div>suggested: (SASqPCR, RRID:SCR_003056)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  However, those results present several limitations and raise several questions. In our longitudinal cohort, the risk of death reaches 80% and 64% for myeloid neoplasm and plasma cell neoplasm, respectively, that is twofold higher than reported in previous studies.1 We must point out a higher COVID-19 severity with 34% of patients with myeloid and plasma-cell neoplasm requiring for mechanical ventilation whereas only 13% for B-cell neoplasm at the time of CCP. Similarly, previous studies reported a better outcome after early CCP transfusion in non-hospitalized patients.21 Of note, we observed a lower overall survival in patients transfused within the first ten days after symptoms onset in univariable analysis, an association that disappeared in the multivariable analysis. A similar observation was made in the Recovery trial (in the CCP arm as well as the control arm) and may reflect more severe disease in patients hospitalized early in the course of the disease.22 Furthermore, 62% of patients transfused earlier (within the first ten days) transfusion in our cohort presented with myeloid or plasma-cell neoplasm. In our retrospective nested analysis, data were collected prospectively from two data sources: one for patients exposed to CCP and another one for patients not exposed to CCP. Such comparison could not identify causal effect of treatment exposure with the level of proof provided by randomized clinical trials. We have tried to limit bias by using statistical methods to c...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.29.21268525
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.31.21268583

1
1. sciscore 04 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.31.21268583: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04738331</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Analysing the French COVID-19 Epidemic Using a National SARS…</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.31.21268583
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.31.21268591

1
1. sciscore 04 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.31.21268591: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Branching process simulations: We implemented the superspreading branching process for the number of infected individuals in Python.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The effective reproductive number of the ath variant at time t isWe used MATLAB to simulate the SIR model under a scenario where the number of newly-infected individuals continues to increase and then remains fixed (Supplementary Fig. 2), and a scenario where we fix ra = 1 and adapt the transmission rate over time such that the system follows the typical SIR dynamics (Supplementary Fig. 3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MATLAB</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  To overcome limitations of current methods, we developed a flexible, SIR-based epidemiological model that provides analytical estimates for the transmission effects of SNVs from genomic surveillance data. Applying our model to SARS-CoV-2 data, we identified SNVs that substantially increase viral transmission, including both experimentally-validated Spike mutations and other, less-studied mutations that may be promising targets for future investigation. We further explored the effects of travel and competition between variants on inferred changes in transmission, using the history of 20E (EU1) as an example. Importantly, we found that our model is sensitive enough to detect substantial transmission advantages for variants such as Alpha and Delta even when they comprised only a small fraction of the total number of infections in a region, thus providing an “early warning” for more transmissible variants. Further monitoring will be important to identify and characterize new variants as they arise. The Omicron variant that was recently detected in South Africa provides one such example. While the data in our study only extends to August 6th, 2021, we would estimate a selection coefficient of 55.2% for Omicron based on the mutations that it shares with previous variants alone. While our study has focused on SARS-CoV-2, the epidemiological model that we have developed is very general. The same methodology could be applied to study the transmission of other pathogens such as influen...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.31.21268591
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.30.21268509

1
1. sciscore 04 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.30.21268509: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Search Strategy: The following electronic databases will be searched: LitCovid, medRxiv, Google Scholar and the WHO Covid-19 database.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Google Scholar</div><div>suggested: (Google Scholar, RRID:SCR_008878)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.30.21268509
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.28.21268481

1
1. sciscore 04 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.28.21268481: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Human subjects and sampling: Human plasma samples obtained from vaccinated health care workers without infection, who received two doses of BNT162b2 (Pfizer/BioNTech) mRNA vaccine, were collected on approximately day 51 and day 161 after the first vaccination, with written informed consent prior to enrollment and ethics approval by the medical research ethics committee of the National Institute of Infectious Diseases (NIID) for the use of human subjects (#1321).<br>IRB: Human subjects and sampling: Human plasma samples obtained from vaccinated health care workers without infection, who received two doses of BNT162b2 (Pfizer/BioNTech) mRNA vaccine, were collected on approximately day 51 and day 161 after the first vaccination, with written informed consent prior to enrollment and ethics approval by the medical research ethics committee of the National Institute of Infectious Diseases (NIID) for the use of human subjects (#1321).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VeroE6/TMPRSS2 cells (JCRB1819, Japanese Collection of Research Bioresources Cell Bank) were maintained in low glucose DMEM (Fujifilm) containing 10% heat-inactivated fetal bovine serum (Biowest), 1 mg/mL geneticin (Thermo Fisher Scientific), and 100 U/mL penicillin/streptomycin (Thermo Fisher Scientific) at 37°C supplied with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6/TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T cells transfected with expression plasmids encoding the spike genes of SARS-CoV-2 ancestral strain, D614G, Beta, Delta, and Omicron variants were infected with G-complemented VSVΔG/Luc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant RBD antigens: Human codon-optimized sequences coding the SARS-CoV-2 RBD (amino acids: 331-529) with the following mutations were cloned into the mammalian expression vector pCAGGS: Beta, K417N / E484K / N501Y; Delta, L452R / T478K; Omicron, G339D / S371L / S373P / S375F / K417N / N440K / G446S / S477N / T478K / E484A / Q493R / G496S / Q498R / N501Y / Y505H.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_127347)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant Avi-tagged His-tagged proteins were produced using Expi293F cells, according to the manufacturer’s instructions (Thermo Fisher Scientific), in the presence of the secreted BirA-Flag plasmid (Addgene) and biotin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BirA-Flag</div><div>suggested: RRID:Addgene_64395)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Data analysis and visualization were performed using GraphPad Prism software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This study had several limitations. First, the number of samples evaluated was small. Second, since sera from vaccine recipients without breakthrough infection at 6 months after vaccination had a low neutralization titer even against the ancestral virus in our assay, an accurate fold-reduction in neutralizing antibody titer could not be determined. Third, we did not include serum samples collected immediately (<10 days) after breakthrough infection. It is expected that the longer the interval between the vaccine and infection, the lower the antibody titer at the time of breakthrough infection. The possibility that reduced neutralizing activity at the time of breakthrough infection results in efficient viral replication in the upper respiratory tract, which may contribute to a better antibody response, was not evaluated in the present study. Fourth, we did not assess T cell immunity against SARS-CoV-2, including the Omicron variant, which contributes to protection when antibody titers are low in non-human primate models (McMahan et al., 2021) and may correlate with protection against severe disease. Finally, our investigation did not evaluate the actual risk of reinfection by the Omicron variant in individuals with a history of breakthrough infection. In conclusion, breakthrough sera demonstrated improved cross-neutralization against the Omicron variant, and the time from vaccination to breakthrough infection was a key determinant of the magnitude and breadth of neutralizing a...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.28.21268481
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.29.21268526

1
1. sciscore 04 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.29.21268526: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.29.21268526
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.28.21268461

1
1. sciscore 04 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.28.21268461: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Sample processing and analysis was covered by ethical approval for the use of anonymised oro- or nasopharyngeal specimens from patients for the diagnosis of influenza and other respiratory pathogens, including SARS-CoV-2 (North West-Greater Manchester South Research Ethics Committee [REC], REC Ref:19/NW/0730).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Clinical negative controls were randomly included throughout each plate.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Depth of coverage and cov20 was calculated from primer-trimmed BAM files using Samtools (Li et al., 2009) depth, including aligned deletions in the depth calculation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.28.21268461
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.26.21268408

1
1. sciscore 04 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.26.21268408: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The ethical approval was obtained from the Institutional Review Board (IRB) of the National Institute of Preventive and Social Medicine (NIPSOM), Dhaka, Bangladesh.<br>Consent: Keeping compliance with Helsinki Declaration for medical research involving human subjects, we obtained informed verbal consent from each participant and recorded it in a digital recorder with the permission of the respective participant.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All collected data were compiled together using the Statistical Package for the Social Science (SPSS) software (Version 25.0, IBM Statistical Product and Service Solutions, Armonk, NY, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Despite the limitation of telephone interview, our study findings provide new insight on the proportion of COVID-19 reinfection along with its severity and associated risk factors. The study also portrays information on the association of the severity of reinfection with preventive practices and the vaccination status of patients. The study findings could contribute to designing an efficient preventive algorithm to alleviate COVID-19 reinfection in a more pragmatic approach. The study conserves decisive policy implications for devising effective interventions to prevent the severity of COVID-19 reinfection. Moreover, the study inspires future inclusive studies on the COVID-19 reinfection and offers a scope of comparison considering geographical, demographical, socio-cultural, epidemiological, and clinical determinants.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.26.21268408
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.30.21268553

1
1. sciscore 04 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.30.21268553: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">and Swift normalase amplicon SARS-CoV-2 panels (SNAP) library prep kit (Swift biosciences, Ann Arbor, MI, USA, catalog number SN-5X296) according to the manufacture’s protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SNAP</div><div>suggested: (SNAP, RRID:SCR_007936)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cDNAs synthesized with COVIDseq Test kit were used as starting materials for Swift library prep.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Swift</div><div>suggested: (Swift, RRID:SCR_013018)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For detailed sequence analysis, NCBI BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi) was used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div><div style="margin-bottom:8px"><div>https://blast.ncbi.nlm.nih.gov/Blast.cgi</div><div>suggested: (TBLASTX, RRID:SCR_011823)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.30.21268553
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.31.21268596

1
1. sciscore 04 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.31.21268596: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Prior to starting the survey, students interested in participating followed a link to read and sign an informed consent.<br>IRB: The Institutional Review Board of the UNC-CH Office of Human Research Ethics approved study procedures.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  There are several limitations of this research. First, this study used weighting to make inferences about the UNC-CH student population; findings, however, may not be generalizable to US college students more broadly. Second, we utilized clinically validated screening instruments to assess symptoms of mental health disorders and psychological distress; diagnostic evaluations were not conducted. Next, the survey administration coincided with protests in support of the Black Lives Matter movement across the United States. This may have impacted student responses and confounded our analysis given that Black/African American students reported a slightly higher prevalence of clinically significant depressive symptoms (67%). Lastly, although weighting methods were used to adjust for nonresponse, their effectiveness is limited if there are differences between survey respondents and non-respondents on study variables not accounted for by the weighting.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.31.21268596
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.30.21268554

1
1. sciscore 04 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.30.21268554: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, Omicron variant RBD, full-length wild type spike and the Omciron variant RBD were cloned into pVRC vector containing an HRV 3C-cleavable C-terminal SBP-His8X tag and sequence confirmed by Genwiz.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pVRC</div><div>suggested: RRID:Addgene_49746)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies with manufacturer and clone information is detailed under the STAR Methods section.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_004463)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 29. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.30.21268554
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.30.21268565

1
1. sciscore 04 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.30.21268565: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">For individuals who tested negative for SARS-CoV-2 during the study period and were considered as controls, we randomly selected one negative test to use as the index date.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As of December 6, 2021, all specimens with a positive PCR result were re-tested using Thermofisher Taqpath™ COVID-19 PCR to identify SGTF.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermofisher Taqpath™</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In Ontario, the estimated sensitivity of SGTF relative to WGS for detecting Omicron among samples with Ct ≤30 was 99.5% and the specificity was 99.8%.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>WGS</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were conducted using SAS Version 9.4 (SAS Institute Inc., Cary, NC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our analysis has several limitations. First, we were unable to differentiate individuals who received a third dose as part of an extended primary series (i.e., severely or moderately immunocompromised individuals) as well as those who were eligible for a third dose earlier (e.g., residents of retirement homes). As such, the proportion of our sample with a third dose may reflect these highly vulnerable populations, and thus VE may be lower than for the general population due to underlying comorbidities, for example. Second, due to sample size constraints, we were unable to provide age-specific VE estimates. Third, we were unable to estimate effectiveness against severe outcomes, due to the lag between infection and hospitalization or death. Fourth, there may be residual confounding that was not accounted for in our analysis. This includes an inability to control for previous undocumented infections, which may be differential by vaccination status, as well as confounding due to behavioural patterns. For example, if vaccinated individuals have more exposure to SARS-CoV-2, our VE estimates are likely underestimated.21 Last, changes in testing patterns, including increased use of rapid antigen tests (which are not captured in our data) and decreased PCR testing availability, may have impacted our estimates, but the direction of any resulting bias is uncertain. Our findings have potentially important implications for proof of vaccination requirements. If the goal of these policies ...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.30.21268565
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.29.21268529

1
1. sciscore 04 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.29.21268529: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was reviewed and approved by the University of Maryland (Baltimore) institutional review board (HP-00095043).<br>Consent: For that study, informed consent was obtained and blood samples were collected under IRB HP-00091425.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed as described above before incubation with secondary antibodies against pan-human IgG (Southern Biotech, Cat. No. 2040-04) or IgA (Southern Biotech, Cat. No. 2050-04).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pan-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For non-SARS-CoV-2 antigens, serum dilutions for anti-GST (glutathione-S-transferase) antibodies (Supplemental Table 1) were used as a negative control.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-GST</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>glutathione-S-transferase </div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses: Statistical analyses for serological analyses were performed using GraphPad Prism 9 software (GraphPad Software, San Diego, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.29.21268529
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.29.21268516

1
1. sciscore 04 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.29.21268516: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We use ArcGIS API for Python to update wastewater testing results to the Web GIS dashboard based on ArcGIS Online.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.29.21268516
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.30.21268453

1
1. sciscore 04 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.30.21268453: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: Thank you for sharing your code.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.30.21268453
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.30.21268308

1
1. sciscore 04 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.30.21268308: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical approval: The COCO study was ethically approved for this work by the London - Camden and Kings Cross Research Ethics Committee on behalf of the United Kingdom Health Research Authority – reference 20/HRA/1817.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISAs: Here we have used the core design of an anti-IgG/A/M SARS-CoV-2 ELISA (10,11) to measure IgG antibodies specific for spike protein from the original Wuhan strain (Abingdon Health, York Biotech Campus Sand Hutton, York) (12), B.1.617.2 (Delta -Abingdon Health) and B.1.1.529 (Omicron - SinoBiological China).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IgG/A/M SARS-CoV-2 ELISA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>measure IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HRP-conjugated mouse-anti-human R10-IgG (monoclonal antibody obtained from Dr. Margaret Goodall, Clinical Immunology Service, University of Birmingham) (1:8000 dilution) was then added to the plate and incubated for 1 hour at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HRP-conjugated mouse-anti-human R10-IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Firstly a health care worker cohort from University Hospitals Birmingham from the Determining the immune response to SARS-CoV-2 infection in convalescent health care workers (COCO) study (7,8), who received three doses of PFZ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COCO</div><div>suggested: (CoCo, RRID:SCR_010947)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: All analyses were undertaken on GraphPad Prism 9 (San Diego, California).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.30.21268308
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.29.21268527

1
1. sciscore 04 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.29.21268527: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Anterior nares swab sample collection for SwabFAST: The anterior nares nasal swab was collected under the supervision of a trained healthcare worker.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Remnants of 40 clinical saliva samples that were tested positive or negative for SARS-CoV-2 were assigned a blind random number (1-40) and sent to the Summit Biolabs for testing with SalivaFAST using the protocol detailed below.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Contrived samples: All the contrived samples described in this paper were assembled by spiking the heat-inactivated SARS-Cov-2 virus (VR-1986HK, ATCC) into known negative anterior nares nasal swab or saliva samples.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VR-1986HK</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.29.21268527
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.24.21268373

1
1. sciscore 04 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.24.21268373: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Apart from COVID-19 data, we included the gross domestic product per capita (GDPc), the healthcare expenditures of countries as percentage of GDP (HGDP), and the Universal Health Coverage Index (UHC) from the World Bank (https://data.worldbank.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://data.worldbank.org/</div><div>suggested: (Data World Bank, RRID:SCR_012767)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.24.21268373
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.30.21267928

1
1. sciscore 04 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.30.21267928: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This research activity involving human subjects was reviewed by the Institutional Review Boards (IRB) of the Centers for Disease Control and Prevention (CDC) and Baylor Scott and White Health, Marshfield Clinic Research Institute, University of Michigan, Henry Ford Health System, and University of Pittsburgh and was conducted consistent with applicable federal law and CDC policy (See 45 C.F.R. part 46; 21 C.F.R. part 56).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were conducted using SAS version 9.4 (SAS Institute Inc., Cary, NC, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study was subject to at least five limitations. First, we did not assess the nature of reported contact and do not have information about whether the exposure was a household member, occupational, or other type of exposure. Second, we did not collect information about the timing of the reported known contact within the 14 days prior to illness onset. Participants could have been infected prior to the reported exposure. Third, some participants might have been aware of their SARS-CoV-2 test status when they completed the enrollment questionnaire, which could have influenced responses to the known contact question [11]. While the test-negative design reduces bias due to differences in healthcare-seeking behavior among vaccinated and unvaccinated persons [9], vaccinated cases could have been more motivated to participate in this study. Fourth, we did not ask about NPIs or duration of contact of the known exposure. Differences in exposures and prevention measures among vaccinated and unvaccinated participants could have been associated with likelihood of testing positive for SARS-CoV-2 infection. Finally, our study was unable to account for differences in timing of vaccination. This study contributes to growing evidence of COVID-19 VE against symptomatic illness, including sustained protection in the Delta-variant period, among members of the general population who have contact with persons with COVID-19 disease. These findings support recommendations for COVID-19 vaccination...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.30.21267928
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.30.21268560

1
1. sciscore 04 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.30.21268560: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The work was approved by the Houston Methodist Research Institute Institutional Review Board (IRB1010-0199).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samtools version 1.11 was used for sequence and file manipulation, where maximum depth and minimum depth parameters in mpileup were set to 8,000 and 3, respectively. iVar version 1.3.1 was used for primer trimming and variant calling.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  However, our study has several limitations. Although we sequenced the genomes of SARS-CoV-2 causing 90% of all Houston Methodist COVID-19 cases in the study period, this sample represents only approximately 5% of cases reported in the metropolitan region. Our patient population will underrepresent some demographic groups, for example homeless individuals and pediatric patients. The samples sequenced in this study were obtained from symptomatic individuals, which means that it is possible that we failed to identify Omicron subvariants or features preferentially represented in asymptomatic individuals. In the aggregate, our data add critical new information to features of Omicron genomic epidemiology and patient characteristics in the US. Further, the present study highlights the importance of analyzing SARS-CoV-2 genome data integrated with patient metadata and stresses the need to continue to do this in near-real time as the Omicron surge continues, the virus evolves, and new variants with potentially altered fitness and biomedically relevant phenotypes are generated. Analyses of this type are also important in the context of vaccine formulation and long COVID, an increasing health and economic problem globally. Finally, the strategy we have used in this and previous studies2-6 are readily applicable to future infectious diseases problems that warrant special attention.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.30.21268560
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.30.21267140

1
1. sciscore 04 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.30.21267140: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: 15 Enrolled participants were randomized 1:1 to receive lenzilumab or matched placebo in addition to current standard treatments per institutional guidelines at each site.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Trial Design: LIVE-AIR is a randomized, double-blind, placebo-controlled, phase 3 trial (NCT04351152) and enrolled hospitalized participants with COVID-19 pneumonia.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  12 Limitations are associated with the analytic approach herein. The exploratory analysis of CRP as it relates to the primary endpoint of the likelihood of achieving SWOV was pre-specified, all other analyses were post-hoc, and none were prospectively powered. Therefore, the results should be interpreted with this caveat in mind. The findings herein will be further evaluated in the NIH-sponsored ACTIV-5/BET-B trial, that includes lenzilumab and where the primary efficacy analysis prospectively evaluates incidence of IMV, ECMO, or death in participants with baseline CRP<150 mg/L. In summary, this comprehensive analysis of LIVE-AIR CRP data provides evidence for the utility of CRP to predict progression to IMV and death. GM-CSF neutralization with lenzilumab significantly improved SWOV in adults hospitalized with COVID-19 pneumonia compared to placebo. Those participants who had baseline CRP levels <150 mg/L responded more favorably to lenzilumab treatment, than those with CRP>150 mg/L. These finding suggest that CRP may be a useful biomarker in determining which participants may be most successfully treated with lenzilumab.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04351152</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Phase 3 Study to Evaluate Efficacy and Safety of Lenzilumab …</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04280705</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Adaptive COVID-19 Treatment Trial (ACTT)</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.30.21267140
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.30.21268236

1
1. sciscore 04 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.30.21268236: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Plasma samples and clinical variables were obtained with ethical approval (REC:17/EE/0025) and informed consent from participants enrolled in the Cambridge NIHR Covid-19 Biobank project.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was performed using SPSS version 27 (IBM Corp., USA) for Windows.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations: Our study is limited by its retrospective observational design with all patients enrolled during the first wave of the pandemic, when no specific therapies for Covid-19 were known and prior to the availability of vaccines. Further exploration of the pathophysiological changes resulting from elevated ET-1 levels in critically unwell patients was not feasible in this period.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.30.21268236
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.30.21268558

1
1. sciscore 04 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.30.21268558: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: We enrolled adults (≥18 years of age) who tested positive for SARS-CoV-2 on RT-PCR and were admitted to Johns Hopkins Hospital in Baltimore, Maryland into a larger COVID-19 prospective cohort after verbal informed consent, between April 2020 to September 2021 as a convenience sample.<br>IRB: This protocol was approved by the Johns Hopkins University Institutional Review Board (IRB00245545).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed in R (v4.0.2) and Stata, version 16.0 (StataCorp LLC, College Station, TX, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  There were limitations to the present study. First, not all participants were enrolled prior to admission, and as this was a hospital-based protocol, generally had a minimum requirement of oxygen. Patients were not always enrolled on the day of admission which may have diminished the effect size of differences in POCUS findings. Additionally, those hospitalized with incidental asymptomatic SARS-CoV-2 infection may be less comparable to those with moderate severity, but a sensitivity analysis was performed and inference about risk was unchanged. These factors led to sample size limitations in some of the survival analyses leading to wide confidence intervals, but the qualitative inference was consistent across outcomes and remains important. Further work is ongoing in ambulatory settings and additional sites with standardized follow-up to improve our understanding of the external validity and diagnostic accuracy among additional populations including non-hospitalized individuals with COVID 19. Lastly, while the mLUSS provide valuable prognostic information, additional lung ultrasound features such as consolidations or pleural line changes appear to be useful prognostic findings and should be evaluated for incorporation into models with subsequent validation. Future research with machine learning and unsupervised approaches can help optimize LUS for clinical use.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.30.21268558
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.28.21268458

1
1. sciscore 04 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.28.21268458: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Residents were eligible to participate if they were medically stable, had decision-making capacity, and provided informed consent after testing SARS-CoV-2–positive using BinaxNOW™ COVID-19 Ag Cards (BinaxNOW) (Abbott; Scarborough, ME) in any of three rounds of Centers for Disease Control and Prevention (CDC)-led facility-wide point prevalence surveys (PPS) or by previous testing results generated by the facility (12, 13).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum specimens were tested for anti–SARS-CoV-2 antibodies using an enzyme-linked immunosorbent assay targeting the extracellular domain of the SARS-CoV-2 spike protein (18).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti–SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2 spike protein ( 18</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This assay uses anti–pan-immunoglobulin (Ig) secondary antibodies that detect any SARS-CoV-2 immunoglobulin isotype, including IgG, IgM, and IgA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti–pan-immunoglobulin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2 immunoglobulin isotype , including IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Information from questionnaires and chart abstraction were entered into a Research Electronic Data Capture (REDCap) database (15, 16).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed by Microsoft Excel (Microsoft Office 365</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our evaluation had several limitations. We had a small sample size, preventing statistical comparisons and potentially limiting the generalizability of our findings. Participants enrolled in our evaluation only received the Pfizer-BioNTech COVID-19 Vaccine; therefore, we were unable to describe the impact of vaccination with other products. Some participants were unable to provide blood specimens when requested and most visits occurred only monthly, so we likely missed the exact timing of seroconversion, peak antibody titers, and seroreversion. Not detecting antibodies in one participant during this first 30 days post-infection was possibly an artifact of timing our collections relative to their infection. Descriptions of antibody duration were limited by the length of the evaluation period. Seven participants had visits that occurred one day after their first vaccine; though these visits were categorized as post-vaccination, we do not know if titers observed from this visit were a continuation of responses primed by their previous infection or a result of the vaccine already augmenting that response. Therefore, we may have underestimated the scale of post-vaccination augmentation because those titer calculations were influenced by values from measurements that were likely more reflective of the post-infection time period. Limited electronic medical record documentation of vital signs, including oxygen saturation, and the difficulty of discerning COVID-19 symptomology in a nu...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.28.21268458
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.29.474471

1
1. sciscore 04 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.29.474471: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A chimeric neutralizing antibody specific against SARS-CoV-2 S protein receptor binding domain (NR-55410) was provided by ACROBiosystems through BEI resources.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 S protein receptor binding domain</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Rabbit monoclonal anti-N antibody (Sino Biologicals #40143-R001) was diluted 1:5,000 in 0.1% Tween-20 in PBS (PBS-T), and incubated on samples overnight at 4 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-N</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Huh7.5-hAT cells (provided by Gregory Melikian and Mariana Marin), have been modified to stably express human ACE2 and human TMPRSS2, to enhance infection by SARS-CoV-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7.5-hAT</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549 (ATCC) are derived from human adenocarcinoma cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human embryonic kidney (HEK) 293T cells stably express the SV40 large T antigen, are resistant to neomycin, and were selected for their high transfectability (ATCC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T-hAT cells (provided by Bruce Torbett) have been modified to stably express human ACE2 and human TMPRSS2, to permit infection by SARS-CoV-2</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-hAT</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Chinese hamster ovary (CHO)-K1 cells (ATCC) are a clonal derivative of the parental CHO cell line and were cultured in humidified conditions at 37 °C in 5% CO2 in F12 medium supplemented with 10% FBS, 2 mM L-glutamine, and 100 U/ml penicillin and 100 μg/ml streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO)-K1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CHO</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Both Caco2 and Calu3 cells were cultured in humidified conditions at 37 °C in 5% CO2 in Eagle’s minimum essential medium (EMEM) supplemented with 10% FBS, 2 mM L-glutamine, NEAA, and 100 U/ml penicillin and 100 μg/ml streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Calu3</div><div>suggested: RRID:CVCL_EQ19)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Construction of the SARS-CoV-2 subgenomic replicon (SARS-2R): DNA fragments of SARS-CoV-2 replicon were either synthesized from Integrated DNA Technologies Inc or amplified by reverse transcription and PCR (RT-PCR) with viral RNA template that was extracted from the supernatants of SARS-CoV-2-infected Vero cells (SARS-CoV strain 2019-nCoV/USA_WA1/2020 (WA1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were pulsed once at 280 V for BHK-21 cells and 250 V for 293T cells with Ingenio EZporator MIR51000 electroporation system in low voltage (LV) mode (150 Ω internal resistance and 1050 μF capacitance).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Determination of Replicon EC50 and EC90 values: BHK21 cells seeded in 6-well plate were transfected with SARS-2R using jetPRIME transfection reagent (Polyplus transfection).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK21</div><div>suggested: ECACC Cat# 05062302, RRID:CVCL_6F52)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of cells that carry SARS-2R replicon: BHK-21 cells were seeded into a 6-well plate, then transfected with replicon SARS-2R_NG_NeoR_NL using jetPRIME transfection reagent following the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-21</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">qPCR to determine levels of SARS-CoV-2 nucleic acid: RNA and DNA was harvested from the BHK-SARS-2R_GFP_NeoR_NL cell line using the RNeasy mini kit (Qiagen) and the QIAamp genomic DNA mini kit (Qiagen), respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-SARS-2R_GFP_NeoR_NL</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To titer viral stocks, VeroE6 cells were seeded in a 96-well plate at 20,000 cells per well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Target cells were seeded at 4 × 104 cells/well (293T, 293T-hAT) or 2 × 104 cells/well (Huh-7.5, Huh7.5-hAT) and incubated at 37 °C for 24 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7.5</div><div>suggested: RRID:CVCL_7927)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production of SARS-CoV-2 stocks: SARS-CoV-2 stocks were produced by infection of VeroE6 with SARS-CoV strain 2019-nCoV/USA_WA1/2020 or SARS2 hCoV-19/England/204820464/2020 (B.1.1.7).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids, antivirals and chemicals: Plasmids pLVX-EF1a-IRES-Puro SARS-CoV-2 E_NR-52967 and pLVX-EF1a-IRES-Puro SARS-CoV-2 M_NR-52968 (BEI) were gifts from Nevan Krogan (University of California, San Francisco) (71).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLVX-EF1a-IRES-Puro</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-S in pCAGGS was a gift from Paul Bates (University of Pennsylvania) (72).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_127347)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 S was synthesized (Genscript) and cloned into pcDNA3.1 between two PmeI sites using NEBuilder.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Multi-step cloning strategy was used, whereby the fragments named SARS-CoV-2/1 to SARS-CoV-2/9 were sequentially cloned into pBeloBAC11 vector to generate pBAC-SARS-CoV-2-REP.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBeloBAC11</div><div>suggested: RRID:Addgene_60342)</div></div><div style="margin-bottom:8px"><div>pBAC-SARS-CoV-2-REP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Each well was transfected with 1 μg replicon SARS-2R_GFP_NeoR_NL, and 0.25 μg each of N, E, and M expression vectors, and 0.25 μg of expression vectors for one of SARS-CoV S, SARS-CoV-2 S, VSV-G or an empty vector, with 4 μl jetPRIME transfection reagent (Polyplus).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VSV-G</div><div>suggested: RRID:Addgene_138479)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T-hAT cells (provided by Bruce Torbett) have been modified to stably express human ACE2 and human TMPRSS2, to permit infection by SARS-CoV-2</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: (BioLegend Cat# 946101, RRID:AB_2892515)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were captured as a 5×4 matrix and GFP positive cells were enumerated using Gen5 software (Biotek).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gen5</div><div>suggested: (Gen5, RRID:SCR_017317)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The number of infected cells at each compound concentration was determined by high content microscopy and dose response curves were plotted and EC50s calculated with Prism software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A theoretically perfect assay would have Z’ = 1. Statistics: Data were tabulated and graphs plotted using Excel (Microsoft) or Prism (Graphpad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  A primary limitation in SARS-CoV-2 research is the high risk associated with working with a pathogenic respiratory pathogen, in terms of both the availability of suitable facilities and of suitably trained researchers. Here we present a range of approaches to facilitate research into all facets of SARS-CoV-2 replication, including cell entry, nucleic acid transcription and replication, and virus assembly and release; collectively these systems are tools to identify and characterize inhibitors at any point in SARS-CoV-2 replication. These systems are based on subgenomic SARS-CoV-2 replicons carrying reporter genes, reducing biological hazards and providing means to easily measure viral replication. The most popular strategy for generating replicons from positive-strand RNA virus is to transcribe RNA in vitro that can be electroporated into target cells to initiate replication. To facilitate use of the assay, particularly in the context of large-scale screening, we eliminated the need for in vitro transcription by cloning cDNA for the SARS-CoV-2 replicons into a BAC under control of a CMV promoter. The replicon comprised all replication-essential proteins and sequences but omitted the structural proteins S, E, and M; additionally, reporter genes were included as a separate ORF using the TRS-B of M to drive production of the sgRNA expressing the reporter cassette. Placing the reporter cassette in a sgRNA ensured that formation of a functional RTC was essential for reporter gene ...
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04960202</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">EPIC-HR: Study of Oral PF-07321332/Ritonavir Compared With P…</td></tr></table>
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.29.474471
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.27.21268364

1
1. sciscore 04 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.27.21268364: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Informed consent was judiciously taken before the sample was sequenced.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  The limitation of our study is that although the adopted ARCTIC protocol allowed the confirmation of SARS-CoV-2 infections, given the urgent need for rapid identification and traceability of omicron variants, an indefatigable checking the antibody titer against deleterious mutations and subsequent single cell genomic assay would have been a better proposition (Kannan et al. 2022). Furthermore, the difference in viral loads among samples will possibly affect the stability of average depth and genome-wide coverage with increase in whole-genome mapping. In summary, our study has demonstrated the utility of nanopore sequencing for SARS-CoV-2 genomes from clinical specimens. We firmly hope that prompt diagnosis and rapid whole-genome analysis would allow a decisive response to the SARS-CoV-2 outbreak that will bring disease control and prevention efforts.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.27.21268364
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.26.474085

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.26.474085: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Mice: Animal work was approved by the local University of Liverpool Animal Welfare and Ethical Review Body and performed under UK Home Office Project Licence PP4715265.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Virus infection: Animals were randomly assigned into three cohorts.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IHC was performed in an autostainer (Agilent) using a rabbit polyclonal anti-SARS-CoV nucleoprotein antibody (Rockland, 200-402-A50) and the horseradish peroxidase (HRP) method.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV nucleoprotein antibody (Rockland, 200-402-A50)</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The titres of all isolates were confirmed on Vero E6 cells and the sequences of all stocks confirmed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice carrying the human ACE2 gene under the control of the keratin 18 promoter (K18-hACE2; formally B6.Cg-Tg(K18-ACE2)2Prlmn/J) were purchased from Charles River.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B6.Cg-Tg(K18-ACE2)2Prlmn/J</div><div>suggested: RRID:IMSR_JAX:034860)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.26.474085
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.30.474453

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.30.474453: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study Design: This observational study was carried out on December 20-21 at the Santa Lucia Foundation Hospital and was approved by the local Ethics Committee.<br>Consent: After providing informed consent, 61 volunteers selected among hospital workers, scientists, and their families and acquaintances (Mean age 41.62, range 21-62; 38F/23M) donated 15 ml of blood.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed with FlowJo v 10.8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Methods, and data were visualized using GraphPad PRISM v.9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad PRISM</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 7. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.30.474453
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.29.474402

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.29.474402: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: HEK293T cells (ATCC, CRL-3216) were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% fetal bovine serum (FBS).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To obtain these proteins, the plasmids constructed above were transiently transfected into HEK293 F cells grown in suspension at 37°C in a rotating, humidified incubator supplied with 8% CO2 and maintained at 130 rpm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Automated single particle data acquisition was carried out by SerialEM, with a calibrated magnification of 22,500 yielding a final pixel size of 1.07 A□.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SerialEM</div><div>suggested: (SerialEM, RRID:SCR_017293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All the micrographs were processed with MotionCor2 in Relion3.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MotionCor2</div><div>suggested: (MotionCor2, RRID:SCR_016499)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The CTF value of each micrograph was estimated by Gctf.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gctf</div><div>suggested: (GCTF, RRID:SCR_016500)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">When the potential conformation for the each structure was produced, particles from each candidate model were selected and processed by non-uniform auto-refinement and postprocessing in cryoSPARC to generate the final cryo-EM density for Delta S-trimer, Omicron S-trimer under neutral and acidic pH conditions and neutral Omicron S-trimer-hACE2 complex.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then the structure was manually adjusted and corrected according to the protein sequences and cryo-EM densities in Coot and finally real-space refinement was performing by Phenix.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div><div style="margin-bottom:8px"><div>Phenix</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.29.474402
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.27.21268462

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.27.21268462: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In 20.8 % of the zip code areas we examined, Hispanic/Latino is the dominant ethnicity, surpassing non-Hispanic/Latino White (Fig. 2A).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>non-Hispanic/Latino White</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the other ethnicities including non-Hispanic or Latino White and Asian that respectively represents 54.1% and 3.7% of Arizona populations, we did not detect significant associations with the COVID-19 prevalence or the growth rates at most of the time intervals.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Latino White</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We performed these analyses in R and Python.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study has several limitations. First, because individual-level data are not readily available, we used zip code level data. Thus, the identified vulnerable groups and their evolving patterns had restricted precision. However, the publicly available zip code level data allows us to track COVID-19 disparities easily and continuously throughout the present and into the future. Second, we did not include COVID-19 vaccination data in our analysis, although vaccination rates may have significant associations with COVID-19 prevalence and growth rates. This was again due to data availability. Third, the pandemic has disruptive impact on the financial status of many families [20, 21]. Such changes were not incorporated in our analyses because the population composition data were based on the 2019 US Census. Although our study is restricted to Arizona data, we expect that COVID-19 disparities in other regions may have also evolved. To better support disadvantaged populations, we need to monitor the progression and adjust resource allocations accordingly.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.27.21268462
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.29.21268511

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.29.21268511: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Since there was only one reviewer, random selection and inter-rater reliability scores (e.g., kappa) were not determined. 2.3.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Based on the above, a targeted search was performed using PubMed and the preprint servers, medRxiv and Khub, to identify real-world studies that assessed COVID-19 VE in IC populations between December 2020 and September 30, 2021 (inclusive).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Although our approach of including preprints for this targeted literature review strengthens the comprehensiveness of this review, we acknowledge the potential limitations in the reproducibility of this review and the quality of the collected evidence base. Moreover, of the 10 included studies, study designs, follow-up periods after full vaccination, IC definitions and IC populations, methods of computing VE, and adjustment for confounders significantly varied across these real-world studies. Hence, a comparison of study findings or a meta-analysis estimating the pooled VE for outcomes of interest was considered unfeasible. As discussed earlier, the most notable inconsistency across the studies summarized in this review, was the substantial variability in the definitions of IC populations. In this context, the COVID-19 VE estimates across these studies should be interpreted cautiously. Additionally, the reviewed studies had limited follow-up after vaccination ranging from 7 days to 6.5 months. Four studies by Tenforde et al. [19], Polinski et al. [21], Whitaker et al. [26], and Chemaitelly et al. [27] included VE analyses during time periods of Delta variant predominance; however, only Tenforde et al. [19] reported, albeit in a figure only, mRNA VE in the IC during March to May (Alpha variant predominance) and June to July (Delta variant emerging as predominant) 2021. The study period in Tenforde et al. [19] went through July 2021, which covered only the early period of Delta...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.29.21268511
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.28.474380

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.28.474380: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Particles in well-formed 3D classes were then used for local refinement in cryoSPARC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) and Coot (58) were used to fit atomic models of S2L20, S309, and SARS-CoV-2 S (PDB 7SOB) into the cryo-EM maps.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Model validation and analysis used MolProbity (63), EMRinger (64), Phenix (61), and Privateer (65).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MolProbity</div><div>suggested: (MolProbity, RRID:SCR_014226)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture supernatant was collected eight days after transfection and supplemented to a final concentration of 80 mM Tris-HCl pH 8.0, 100 mM NaCl, and then incubated with BioLock (IBA GmbH) solution. hACE2 was purified using a 5 mL StrepTrap HP column (Cytiva) followed by size exclusion chromatography using a Superdex 200 Increase 10/300 GL column (Cytiva) pre-equilibrated in PBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioLock</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.28.474380
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.25.21268211

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.25.21268211: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study participants: ACTIV-2 is a multi-center randomized, blinded placebo-controlled phase 2/3 platform trial in non-hospitalized adults4.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study participants: ACTIV-2 is a multi-center randomized, blinded placebo-controlled phase 2/3 platform trial in non-hospitalized adults4.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, Vero-E6 cells were maintained in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with HEPES, Penicillin/Streptomycin, Glutamine, and 10%</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics/Calculations: Statistical analyses were performed using PRISM software v9.2.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PRISM</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04518410</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">ACTIV-2: A Study for Outpatients With COVID-19</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.25.21268211
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.21.21268187

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.21.21268187: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A python wrapper for Dynamic Topic Models (DTM) present in gensim26 python package (version 3.8) was used on top of compiled binaries of DTM from the original paper6 to execute DTM on our corpus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 18. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.21.21268187
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.28.21268398

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.28.21268398: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Samples were collected between 31 and 121 days post-second mRNA vaccine dose (n = 23) for 8 breast cancer patients (all female) vaccinated with mRNA-1273 (n = 2) or BNT162b2 (n = 6) and for 15 lung cancer patients (6 female and 9 male) vaccinated with mRNA-1273 (n = 10) or BNT162b2 (n = 5).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells were transfected with pNL4-3-inGluc and various S constructs in a 2:1 ratio using polyethylenimine transfection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following incubation, sera and virus was transferred to seeded HEK293T-ACE2 cells for infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Additionally, we utilized N-and C-terminally Flag-tagged SARS-CoV-2 S expression constructs that were generated and cloned into pcDNA3.1 using Kpn I and BamH I restriction enzyme cloning by GenScript Biotech (Piscataway, NJ).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells were transfected with pNL4-3-inGluc and various S constructs in a 2:1 ratio using polyethylenimine transfection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNL4-3-inGluc</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">50% neutralization titers (NT50) values were calculated from luminescence readout by least-squares-fit, non-linear regression performed in GraphPad Prism 5 (San Diego, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.28.21268398
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.28.21268436

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.28.21268436: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT05148845</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sisonke 2 - A COVID-19 Vaccine Boost Open Label Study.</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.28.21268436
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.27.21268429

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.27.21268429: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.27.21268429
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.28.21268468

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.28.21268468: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The protocol was approved by the Institutional Ethics Committees at each study centre and the study was done in accordance with the revised Declaration of Helsinki (64th WMA General Assembly, Fortaleza, Brazil, October 2013).<br>Consent: Eligible participants were healthy children of either gender from 2 to 18 years of age whose parents or legal guardians supplied written informed and audio-video consent; verbal assent was also obtained from children between 7 and 12 years of age, and written consent from children >12 to 18 years of age.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">A post hoc analysis of randomly selected serum samples (n = 24) was done to measure IgG1:IgG4 ratios as an indicator of the balance of the Th1:Th2 responses [12,13].</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">The sample size was intended to allow separate comparisons of geometric mean neutralisation titres at Day 56 between each of the three age groups, and against titres observed in adults in a phase 2 study [14].</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We also measured the titres of IgG antibodies against the S-protein, receptor-binding domain (RBD), and nucleocapsid protein (N-protein) of SARS-CoV-2 by ELISA expressed as arbitrary ELISA units/mL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S-protein, receptor-binding domain (RBD), and nucleocapsid protein (N-protein</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  The limitations of this study are mainly due to the ethical considerations of doing such a study in children, for which reason it was done open-label with no placebo arm. As such, we cannot compare the reactogenicity and immunogenicity results with a control arm. However, the low rates of reported reactogenicity except for injection site pain suggest that a control arm would not have revealed any medically significant issues. Transient mild-to-moderate injection site pain is the main adverse event reported by adults not only with BBV152 [3,13] but also with other COVID-19 vaccines [23,24]. Also, we have assessed only the immunogenicity of BBV152, not clinical efficacy, in children. In conclusion, the inactivated SARS-CoV-2 vaccine, BBV152, was well tolerated and immunogenic in children from 2 to 18 years of age, with neutralising antibody responses comparable to those observed in adults in whom the vaccine has been proven to be efficacious against symptomatic and asymptomatic COVID-19.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.28.21268468
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.26.21268421

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.26.21268421: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  First, as an ecological study, it has limitations in establishing causal relationships, as the association observed on an aggregate level does not necessarily represent the association that exists at an individual level. However, ecologic analysis may be more appropriate than studies using individual data when investigating the determinants of transmission of infectious diseases with complex and nonlinear infection spread [43]. Second, we did not include ultraviolet radiation in the analyses, although recent studies provide that ultraviolet radiation is associated with incidence rates of COVID 19 [44,45]. Third, it was not our goal to assess other determinants for the spread and mortality of COVID-19, such as social distancing strategies, health system structure, medical resources, people’s endurance, and personal hygiene. These aspects should be examined in future studies. Fourth, we sought to explore data for all Brazilian state capitals and the Federal District from February 20th to April 18th, 2020. However, we could not obtain the meteorological data for Porto Velho, capital of Rondônia State. Finally, further investigations in the countryside cities of Brazil should be explored if a novel epidemic spread occurs. Replication of this investigation might lead to more conclusive results using data from the end of winter, especially for cities located in the southern region of the country.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.26.21268421
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.22.21268218

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.22.21268218: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.22.21268218
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.29.474491

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.29.474491: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression and preparation of antibodies: DNA sequences of heavy and light chain variable regions of antibody CR3022 [32] and of donor S652 antibodies, S652-109, S652-118, and S652-112, and of SARS-CoV-2 antibodies A19-46.1, A23-58.1, A19-61.1, B1-182.1 [18], 5-7 [33], 2-51, and 5-24 [34] were synthesized and subcloned into the pVRC8400 vector, as described previously [43].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S652</div><div>suggested: (Leinco Technologies Cat# S652, RRID:AB_2831816)</div></div><div style="margin-bottom:8px"><div>S652-112</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, VH and VL regions of VRC01 (as a negative control) [46], S652-118, S652-112, S652-109 [19], and SARS-Cov2-specific antibodies LY-555 [40], CB6 [47], REGN10933, REGN10987 [48], A19-46.1, and A23-58.1 [18] were codon optimized for yeast expression using JCat [49], synthesized and cloned by Genscript into pCT-VHVL-K1 or pCT-VHVL-L1 yeast expression vectors [39].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VRC01</div><div>suggested: (bNAber Cat# bNAberID_1, RRID:AB_2491019)</div></div><div style="margin-bottom:8px"><div>SARS-Cov2-specific</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CB6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A19-46.1</div><div>suggested: (Bethyl Cat# A303-978A, RRID:AB_2620327)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Streptavidin, R-Phycoerythrin Conjugate, Thermo Fisher Scientific) or SA-APC (Streptavidin, Allophycocyanin Conjugate, Thermo Fisher Scientific), and an anti-FLAG fluorescein isothiocyanate (FITC) monoclonal antibody (clone M2-FITC, Sigma-Aldrich) was added as a marker for Fab expression.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>R-Phycoerythrin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-FLAG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression and preparation of wildtype and variant SARS-CoV-2 molecular probes: The wildtype and variant SARS-CoV-2 molecular probes were produced by transient transfection of FreeStyle 293-F cells [28] and in-process biotinylation [19] as previously described.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293-F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Construction of expression plasmids for wildtype and variant SARS-CoV-2 molecular probes: DNA sequences encoding the wildtype or variant SARS-CoV-2 spike or specific domains were cloned into a pVRC8400-based expression vector by GeneImmune.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pVRC8400-based</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Micrographs were collected at a nominal magnification of 100,000x (pixel size: 0.22 nm) using SerialEM [44] on an FEI Tecnai T20 electron microscope operated at 200 kV and equipped with an Eagle CCD camera or at a nominal magnification of 57,000x (pixel size: 0.25 nm) on a Thermo Scientific Talos F200C electron microscope operated at 200 kV and equipped with a Ceta camera.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SerialEM</div><div>suggested: (SerialEM, RRID:SCR_017293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reference-free 2D classification was performed with Relion 1.4 [45]</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Relion</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Obtained flow cytometry data was further analyzed using FlowJo 10.6.1 software (BD Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Heat maps were created using GraphPad Prism 8 software (GraphPad Software Inc.)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 49, 50, 51 and 52. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.29.474491
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.30.474516

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.30.474516: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: For each time-point (2020-03-31, 2020-06-30, 2020-09-30, 2020-12-31, 2021-03-31, 2021-06-30, 2021-09-26 the sample collection date was used to generate a subset of sequences that were collected up to that date.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GISAID genomes were filtered to remove poor quality sequences using the following criteria: complete metadata, less than 2% ambiguous DNA sequence (N) or protein (X) with no runs of 4 or more Ns in the genome or Xs in the proteins, all genes (ORFs) in the genome are matched by a BLAST search and were not truncated by premature stop codons.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To obtain full length coding genomes, coding sequences of each open reading frame were aligned with 7911791 The genome sequences that passed QC were also filtered to remove accessions that are not represented in the September 26801 downloaded from GISAID, 427,773 sequences passed all of the QC filters and were also in the Audacity tree.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Audacity</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images of annotated phylogenetic trees were rendered using the Python API to iTOL, the interactive Tree of Life84.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These frequencies were used to annotate the B-factor of PDB file 6VSB85 with PDB ID 6M0J86 with PDB ID 6M0J86 superimposed on one protomer of 6VSB in order to provide resolution on residues in VUS which lacked resolution in 6VSB; The resulting chimeric structure was used to color each atom using PyMOL’s spectrum command.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL’s</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.30.474516
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.28.474369

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.28.474369: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Human sera and monoclonal antibodies: Human sera were collected at the NYU Vaccine Center with written consent of participants under IRB-approved protocols 18-02035 and 18-02037.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells: 293T, ACE2.293T and Vero cells were grown in Dulbecco’s Modified Eagle’s Medium/10% fetal bovine serum at 37°C under 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 spike protein lentiviral pseudotypes: Spike protein pseudotyped lentiviruses were produced by cotransfection of 293T cells with pMDL Gag/Pol packaging vector, lentiviral vector plenti.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: KCB Cat# KCB 200744YJ, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids: Plasmid expression vectors used in the production of lentiviral pseudotypes pMDL, pcVSV.G, pRSV.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pRSV</div><div>suggested: RRID:Addgene_106453)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Rev and the lentiviral dual reporter virus genome pLenti.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLenti</div><div>suggested: RRID:Addgene_125133)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The full-length coding sequence was generated by overlap extension PCR with the two fragments amplified with external primers containing a Kpn-I and Xho-I sites and then cloned into pcDNA6</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA6</div><div>suggested: RRID:Addgene_134280)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression vectors encoding spike proteins with the individual mutations of the Omicron spike protein were generated by overlap extension PCR mutagenesis using the D614G spike protein plasmid pcCOV2.Δ19.D614G as template.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcCOV2.Δ19.D614G</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 spike protein lentiviral pseudotypes: Spike protein pseudotyped lentiviruses were produced by cotransfection of 293T cells with pMDL Gag/Pol packaging vector, lentiviral vector plenti.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMDL Gag/Pol</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed using GraphPad Prism 8 software and statistical significance was determined by the two-tailed unpaired t-test or nonparametric ANOVA test.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses of the structures of the SARS-CoV-2 spike protein with antibody Fabs was performed with the PyMOL Molecular Graphics System,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Study Limitations: This study was done on a relatively small number of participants which limits the resolution of fine difference in antibody titers in the different groups. In addition, it depends entirely on pseudotyped viruses rather than antibody neutralization of live virus. While pseudotyped virus has been shown to provide similar data to that of the live virus assays, it is conceivable that there could be differences [30].
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.28.474369
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.27.21268416

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.27.21268416: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04342182</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Convalescent Plasma as Therapy for Covid-19 Severe SARS-CoV-…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04927936</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Trial Among HealthCare Workers (HCW) Vaccinated With Janss…</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 14. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.27.21268416
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.29.21268469

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.29.21268469: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Written informed consent was obtained from recruited patients.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Evaluation of SARS-CoV-2-specific IgM and IgG: Evaluation of SARS-CoV-2 Spike protein antibodies, including anti-Spike (in trimeric form)-specific IgG (Diasorin),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RBD-specific IgG (Abbott) and IgA (Euroimmun), anti-Spike-specific IgM (Abbot), anti-Nucleoprotein-specific IgG (Abbott), and neutralizing antibodies which block binding of Spike protein with the ACE2 receptor (Dia.Pro Diagnostic Bioprobes) was performed following manufacturers’ instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Spike-specific IgM ( Abbot) , anti-Nucleoprotein-specific IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Evaluation of SARS-CoV-2-Spike-reactive T cells: For T cells stimulation in vitro, 1.5 million PBMNCs were cultured in complete RPMI plus 5% human AB serum in 96 well flat bottom plates in presence of medium alone (background, negative control) or of a pool of Spike SARS-CoV-2 peptide pools (Prot_S1, Prot_S+ and Prot_S to achieve a complete sequence coverage of the Spike protein) at 0.6 µM/peptide, accordingly to manufacturer’s instructions (Miltenyi Biotech).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prot_S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were acquired on a BD LSR II flow cytometer (BD Biosciences) with FACSDiva Software and analysed by FlowJo Software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div><div style="margin-bottom:8px"><div>FACSDiva</div><div>suggested: (BD FACSDiva Software, RRID:SCR_001456)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were acquired on a BD LSR II flow cytometer (BD Biosciences) with FACSDiva Software and analysed by FlowJo Software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div><div style="margin-bottom:8px"><div>FACSDiva</div><div>suggested: (BD FACSDiva Software, RRID:SCR_001456)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RBD-specific IgG (Abbott) and IgA (Euroimmun), anti-Spike-specific IgM (Abbot), anti-Nucleoprotein-specific IgG (Abbott), and neutralizing antibodies which block binding of Spike protein with the ACE2 receptor (Dia.Pro Diagnostic Bioprobes) was performed following manufacturers’ instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.29.21268469
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.29.21268487

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.29.21268487: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Patients are part of the COVID-19 Registry of the LMU Klinikum (CORKUM, WHO trial id DRKS00021225) and the study was approved on March 23, 2020 by the ethics committee (no. 20-245) of the Faculty of Medicine of the LMU (Ethik-Kommission</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Membranes were incubated at 7°C overnight with primary anti-spike antibody (43A11, rat IgG, Helmholtz Zentrum Mu□nchen; 1A9, mouse IgG, GeneTex; PA5-81795, polyclonal rabbit antibody, Invitrogen) at 1:2000 dilution in 5% (w/v) non-fat milk (Carl Roth) in ddH2O, washed 3 times in TBST (Tris-buffered saline with 0.1% Tween-20) and incubated at RT for 1 h with horseradish peroxidase (HRP)-conjugated secondary antibody (1112-035-062, goat anti-rat IgG, Jackson Immuno Research Europe; 7076S</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-spike</div><div>suggested: (Imported from the IEDB Cat# 1A9, RRID:AB_2848025)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">First, wells of a Nunc MaxiSorp plate (Thermo Fisher Scientific) were coated at RT for 5 h with 2 µg mL-1 anti-spike capture antibody (55E10, rat IgG, Helmholtz Zentrum Mu□nchen) or isotype in PBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-spike capture antibody ( 55E10</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Upon washing via a 100 kDa cutoff Amicon ultra filter, the samples were stained with AlexaFluor488 conjugated anti-S antibody (43A11, rat IgG, Helmholtz Zentrum Mu□nchen), diluted and afterwards analyzed in the flow cytometer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Directly coupled AlexaFluor488 labelled antibodies were generated using commercial kits (A10235, Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A10235</div><div>suggested: (ABclonal Cat# A10235, RRID:AB_2757760)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines and cell culture: HEK293T (CID3915); HEK293, S+ (CID4618); U251MG, hACE2+ (CID4663); U251MG, hACE2+, NM∼LgBiT+ (CID4697) and Vero, hACE2+ (CID4608) cells were maintained in DMEM medium (Gibco, Thermo Fisher Scientific), supplemented with 8% FBS (AC-SM-0143, Anprotec) and Pen/Strep (Gibco, Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>U251MG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 VLPs and other engineered EVs: To generate S+ VLPs containing appropriate levels of SARS-CoV-2 spike (D614G or B.1.617.2) and control-EVs, HEK293T cells were transfected using TransIT-293 (MIR2700, Mirus) according to the manufacturers protocol with carefully adjusted ratios of codon-optimized expression vectors coding for S, VSV-G, or mock together with CD63∼HiBiT or CD63∼BlaM and, optionally, M, N and E.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies REGN10987 and REGN10933 were purified from CHO cells transiently transfected with expression plasmids encoding the heavy and light chains.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO</div><div>suggested: CLS Cat# 603479/p746_CHO, RRID:CVCL_0213)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mixture was incubated at 37°C and approximately 20,000 Vero C1008 cells (ATCC, Cat#CRL-1586) were added after 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero C1008</div><div>suggested: ATCC Cat# CRL-1586, RRID:CVCL_0574)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus stock preparation: CaCo-2 cells (American Type Culture Collection, ATCC, Virginia, USA) in cell culture medium (Dulbecco’s Modified Eagle’s Medium containing 2% FBS) were challenged for 2 h with a clinical isolate of SARS-CoV-2 (GISAID EPI ISL 2967222) previously obtained from a nasopharyngeal swab of a COVID-19 patient.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CaCo-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, cell culture medium was exchanged, and three days post infection supernatants were passaged on Vero-E6 cells (ATCC, Virginia, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 VLPs and other engineered EVs: To generate S+ VLPs containing appropriate levels of SARS-CoV-2 spike (D614G or B.1.617.2) and control-EVs, HEK293T cells were transfected using TransIT-293 (MIR2700, Mirus) according to the manufacturers protocol with carefully adjusted ratios of codon-optimized expression vectors coding for S, VSV-G, or mock together with CD63∼HiBiT or CD63∼BlaM and, optionally, M, N and E.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VSV-G</div><div>suggested: RRID:Addgene_138479)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis was performed with GraphPad Prism 9.2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our test overcomes the current limitations of quantitating SARS-CoV-2 NAbs as it is based on harmless, non-infectious VLPs engineered to be authentic morphological and functional mimics of SARS-CoV-2 virions. Firstly, we optimized conditions for in vitro generation of such S+ VLPs and characterized them together with a sample of heat-inactivated SARS-CoV-2 stock using standard approaches together with a novel nano flow technology. By cryo-EM, we confirmed the presence of intact, native S+ VLPs with the characteristics of coronaviruses in our preparations. Furthermore, the S+ VLPs contain SFL trimers, a molecular concentration of S very similar to authentic SARS-CoV-2 virions and particle number and ratio of S+ particles comparable to virus stocks. We calculated the number of S trimers per particle to be 27 and therefore well within the range of published figures which vary from 24 to 40 (Ke et al., 2020; Turonova et al., 2020; Yao et al., 2020). Secondly, we engineered S+ VLPs to carry a chimeric, membrane anchored and luminally oriented enzyme (BlaM) or an activator peptide (HiBiT) and generated hACE2+ Vero cells and a hACE2+ U251MG cell line, which carries hACE2+ together with an inactive, membrane-associated split reporter nLuc enzyme (LgBiT). In quantitative fusion experiments with S+ VLPs we showed that only ACE2+ cells take up S+ VLPs, while ACE2- cells were not susceptible as expected. Uptake strictly depended on spike, the viral entry factor and one of the three SARS-...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 35. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.29.21268487
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.27.21268334

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.27.21268334: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics statement and sample collection: For the spiking experiments, the use of de-identified specimens from healthy or SARS-CoV-2-positive individuals was approved by the Institutional Review Board of the Yale Human Research Protection Program (FWA00002571, Protocol ID. 2000027690) 9.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Ethics statement and sample collection: For the spiking experiments, the use of de-identified specimens from healthy or SARS-CoV-2-positive individuals was approved by the Institutional Review Board of the Yale Human Research Protection Program (FWA00002571, Protocol ID. 2000027690) 9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Yale Human Research Protection Program</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were conducted with GraphPad Prism 9.1.2 (GraphPad Software, Inc., San Diego, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.27.21268334
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.28.21268496

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.28.21268496: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">], Google [51] and Microsoft Bing[52].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Google</div><div>suggested: (Google, RRID:SCR_017097)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Therefore, careful consideration has been made to locate correct WMO/WBAN stations within the given latitude and longitude combinations for each of the 36 regions/states and the weather data were accurately collected and matched with the COVID datasets using the MATLAB algorithm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MATLAB</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 12. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.28.21268496
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.29.474469

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.29.474469: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The alignment was performed with MAFFT (Katoh et al, 2002) using the keeplength option, and with all other parameters set to their default values.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 11. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.29.474469
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.26.21268418

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.26.21268418: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.26.21268418
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.28.21268451

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.28.21268451: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: The sampling was conducted within each ward based on the residential settlement types which included planned colonies, urban slums, resettlement colonies, unauthorized colonies, and rural areas [9].<br>IRB: Ethics: The study was approved by the Institutional Ethics Committee, Maulana Azad Medical College & Associated Hospitals, New Delhi vide F.1/IEC/MAMC/85/03/2021/No428 dated 21.08.2021.<br>Consent: Electronic and informed consent was obtained from all the study participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">A binary logistic regression analysis was conducted by considering IgG antibody as the outcome and the following independent variables; sex: male/female, age: <18/≥18, settlement: planned/other, past-history of Covid-19: present/absent, and vaccination status: no dose/at-least one dose.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Sampling areas within each settlement type by simple random sampling (ii) Household selection by systematic random sampling, and (iii).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-SARS-CoV-2 IgG antibodies were detected using chemiluminescent technology based VITROS® assay on VITROS® 3600 (Ortho Clinical Diagnostics, Raritan, NJ, USA) [10].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This questionnaire data was subsequently merged with the laboratory antibody test result data in Microsoft Excel 2013.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data were analysed using SPSS Version 25 (IBM Corp., Armonk, NY, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  The small number of average daily Covid-19 cases and very low-test positivity rate after the subsiding of the second wave in Delhi is suggestive of the attainment of the herd immunity threshold in the population with the caveat for the expected waning of antibody titres over time [19, 20]. The study has certain limitations. First, due to duplicate unique id generated by field data enumerators and failure of app validated check, questionnaire data of ∼10% participants could not be matched with the unique identification labels of their laboratory samples resulting in a loss of their sociodemographic (except age and sex recovered from laboratory data) and vaccination attributes. During analysis, this missing data was assumed to be missing at random type. For a similar reason, the exact response rate of the survey could not be established although based on consultation with field nodal officers, it was not dissimilar from the previous round (<20%). Second, in this investigation, we could not differentiate between vaccination or natural infection induced antibody response since both anti-S and anti-N antibodies are generated by inactivated vaccines such as Covaxin [11]. Third, the S/CO only provided an indirect marker of IgG SARS-CoV-2 antibody titres and was not an absolute correlate of immunological protection. Moreover, immune protection against SARS-CoV-2 can be both triggered through both humoral and cell media immunity, and consequently, seropositivity may not necessarily be...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.28.21268451
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.26.21268419

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.26.21268419: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.26.21268419
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.27.21268446

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.27.21268446: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Study design and participants: We conducted a cross-sectional study using data from the Collaborative Online Research on Novel-coronavirus and Work study (CORoNaWork study) that was collected on February 18 and 19, 2021.<br>IRB: The present study was approved by the Ethics Committee of the University of Occupational and Environmental Health, Japan (Approval numbers: R2-079 and R3-006).<br>Consent: Informed consent was obtained in the form of the website from all participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were conducted using Stata Statistical Software (Release 16; StataCorp LLC, College Station, TX, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations: This study had some limitations. First, we conducted an internet survey, which includes the possibility of selection bias. To reduce the potential bias as much as possible, sampling was balanced by gender, age, occupation, and area of residence. Second, the outcome variable was self-restraint from social behaviors, which was measured via subjective evaluations; moreover, the specific degree of self-restraint was not investigated. When the second state of emergency was declared in Japan, there was no specific target value for such self-restraint behaviors from the government, so we investigated whether self-restraint changed in response to state of emergency Third, this study was cross-sectional in nature. Our results are different from the survey that was conducted during the first state of emergency in Japan [23,24], so it is possible that the results will continue to change over time. Further investigation is required to see if the same results are obtained for the time period covering the third and subsequent state of emergency.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.27.21268446
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.29.474427

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.29.474427: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The multiple sequence alignment for individual group was conducted consecutively using Clustal Omega.[25].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Clustal Omega.</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 17. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.29.474427
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.27.21268459

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.27.21268459: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics statement: This study was approved by the National Bioethics Committee of the Dominican Republic (CONABIOS).<br>Consent: Informed consent was obtained from all enrolled vaccinated.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">ELISA and neutralizations were performed blinded.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: The cell line has been tested negative for contamination with mycoplasma.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed three times with PBS-T (PBS with 0.1% Tween-20) and 50 μl of HRP anti-Human IgG Antibody (GenScript #A00166, 1:5,000) diluted in dilution solution added to each well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 300 μl of serial fold virus dilutions were used to infect Vero E6 cells in MEM supplemented NaHCO3, 4% FBS 0.6% Avicel RC-581.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Health care worker (HCW) volunteers from the Yale New Haven Hospital (YNHH) were enrolled and included in this study (IRB Protocol ID 2000028924, approved by the Yale Human Research Protection Program Institutional Review Board.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Yale Human Research Protection Program</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The clinical data were collected using REDCap (v5.19.15 @2021 Vanderbilt University) software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: All analyses of patient samples were conducted using GraphPad Prism 8.4.3 and JMP 15.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/content/10.1101/2021.12.27.21268459v1
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.27.474273

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.27.474273: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 17, 19 and 15. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.27.474273
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.28.21268435

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.28.21268435: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All study participants provided written informed consent.<br>IRB: The Nara Medical University Ethics Committee approved the study (No. 3168).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This study had some limitations, including a small sample size, no use of mutant strains in the neutralization responses, and an absence of cellular immune responses. Additionally, other than for the humoral response, data are lacking regarding cell-mediated immune responses and to what extent this protection contributes to the long-term efficacy of the vaccine. Therefore, the effects of long-term transition and boosters on cell-mediated immunity should be investigated in detail.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.28.21268435
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.27.21268264

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.27.21268264: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: After signed informed consent, participants were randomized 1:1 to a once daily i.v. infusion (2 mL/kg) of either placebo (0.9% NaCl) or n-3 PUFA emulsion (Omegaven® bought from ApoEX, Stockholm, Sweden) containing 10 g of fish oil per 100 mL, of which 1.25-2.82 g DHA and 1.44-3.09 g EPA for 5 days.<br>Field Sample Permit: Blood cell isolation: Whole blood was collected into an 8 mL sodium heparinized CPT vacutainer and processed within 2 h of collection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">After signed informed consent, participants were randomized 1:1 to a once daily i.v. infusion (2 mL/kg) of either placebo (0.9% NaCl) or n-3 PUFA emulsion (Omegaven® bought from ApoEX, Stockholm, Sweden) containing 10 g of fish oil per 100 mL, of which 1.25-2.82 g DHA and 1.44-3.09 g EPA for 5 days.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Participants were blinded to the intervention.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Due to the limited statistical power of the study, descriptive outcomes were not tested for significance as defined in the prespecified analysis plan in the study protocol, which is provided as an Appendix online.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were then incubated with APC-conjugated anti-human CD66b antibody, FITC-conjugated anti-human CD14 antibody, and eFluor450-conjugated anti-human CD45 antibody (all from Thermo Fisher Scientific, Waltham, MA, USA) for 15 min on ice.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human CD45</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were then incubated with APC-conjugated anti-human CD66b antibody, PE-conjugated anti-human CD41a antibody, FITC-conjugated anti-human CD14 antibody, and eFluor450-conjugated anti-human CD16 antibody (all from Thermo Fisher Scientific, Waltham, MA, USA) for 15 min at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human CD16</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were analyzed with BD Fortessa flow cytometer (BD Biosciences) and Flow Jo software version v10.7.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flow Jo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">URL https://www.R-project.org/), Bioconductor version 3.13 (15), GraphPad (version 8.4.3, Sand Diego, California, USA), and SigmaPlot for Windows Version 14.5.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bioconductor</div><div>suggested: (Bioconductor, RRID:SCR_006442)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>SigmaPlot</div><div>suggested: (SigmaPlot, RRID:SCR_003210)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  The main limitation is the low number of participants. It is important to consider that the study was a proof-of-concept trial powered to detect significant effects on leukocyte, lipid, and protein inflammatory biomarkers and designed to allow mechanistic exploration of n-3 PUFA metabolism and cellular effects (12). Larger studies are nevertheless needed to determine if the significantly improved NLR by n-3 PUFA translates into better clinical outcomes in COVID-19. The clinical outcomes were not statistically tested in the present trial according to the a priori study plan and were therefore only presented in descriptive analyses. The generalisability of identified lipid metabolites was not established in the present study. The trial was performed during the introduction of cortisone, which may have influenced the cytokine-release to prevent detecting n-3 PUFA-induced effects. The subgroups of n-3 PUFA and placebo groups with or without cortisone are small and were used only for the exploratory mechanistic experiments. The older study population with multiple comorbidities and moderate COVID-19 may limit the extrapolation of the results to younger patients and severe COVID-19 cases. In summary, the primary outcome indicated a beneficial cellular immune response by i.v. n-3 PUFA treatment of COVID-19 detected as lowered NLR. The significantly altered the plasma PUFA metabolite profiles with increased proresolving mediator precursor levels and decreased leukotoxin-diols support...
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04647604</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Resolving Inflammatory Storm in COVID-19 Patients by Omega-3…</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.27.21268264
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.21.21268190

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.21.21268190: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.21.21268190
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.29.474353

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.29.474353: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SciPy1.5.4[20] was used for statistical tests.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SciPy1.5.4</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generic online platform: We developed a general purpose online literature review, author solicitation, and information sharing platform powered by the Django web framework (djangoproject.com) for templating and user management, a MongoDB database backend (mongodb.com), Bootstrap (getboostrap.com) for layout, and jQuery (jquery.com) for streamlined scripting (Figure 1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Django</div><div>suggested: (Django, RRID:SCR_012855)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Two-stage SVM classifier: We developed a two-stage Support Vector Machine (SVM) based classifier for the filtered CORD-19 literature, using sklearnversion 0.24.2 [16] with Python 3.6.10.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data Analysis: Python Data Analysis Library pandas0.24.2 [18] was used to manage the data from CORD-19 and the pipeline for analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python Data Analysis Library</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Data</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.29.474353
www.medrxiv.org www.medrxiv.org

Short-term Projections based on Early Omicron Variant Dynamics in England.

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.30.21268307: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Despite these caveats, our projections show that Omicron, due to its rapid growth, can generate levels of infection that could disrupt many services and levels of hospital admissions that will place a severe burden on the health services. Determining the optimal control policy is highly dependent on the objective, but several general conclusions can be drawn. First, strong controls enacted early bring the greatest reduction in infections, hospital admissions and deaths during the first wave of Omicron. Second, small initial waves lead to larger exit waves, with exit waves of deaths and hospital admission relatively larger than the exit wave of infection due to changes in the age-distribution of infection. However, such later exit waves, which tend to peak in April 2022, provide the opportunity to learn more about the Omicron variant and to instigate specific controls.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.30.21268307
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.27.21268448

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.27.21268448: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study has been approved by the OHSU Institutional Review Board (IRB) and was registered (http://www.clinicaltrials.gov.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The study investigators drew a simple random sample of records from the pool of all EMRs with available results of the COVID-19 test, performed at OHSU Healthcare between March 1st, 2020, and September 13th, 2020.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The study investigators drew a simple random sample of records from the pool of all EMRs with available results of the COVID-19 test, performed at OHSU Healthcare between March 1st, 2020, and September 13th, 2020.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>OHSU Healthcare</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">7 (StataCorp LP, College Station, TX).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">STATA do files are available at https://github.com/Tereshchenkolab/statistics.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations: Important limitations of the study need to be considered. As in any retrospective cohort study, investigators had no control over the quality and completeness of the available EMR data. The likelihood of unobserved and unmeasured confounding cannot be eliminated entirely, as an observational study is susceptible to confounding bias. Two cohorts assembled from the different COVDI-19(+) and COVID-19(-) populations may differ in multiple important ways that influenced the outcomes. We cannot completely rule out the violation of the conditional independence assumption. In our observational study, the treatment (SARS-CoV-2 infection exposure) was not randomly assigned so potential outcomes are not independent of the exposure. We assumed that after conditioning on the covariates, the treatment assignment was as good as random. Nevertheless, we cannot be 100% sure that we observed, measured, and conditioned on enough covariates. We also note that the study was conducted in a single healthcare system. Validation of the study findings in alternative populations will increase the chances that the observed association is causal.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04555187</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cardiovascular Risk Stratification in Covid-19</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.27.21268448
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.28.21268491

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.28.21268491: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: In addition, anonymized left-over samples from apheresis collection of plasma (all collected in 2020) were available under the general informed consent of the University Hospitals of Geneva.<br>Consent: In addition, anonymized left-over samples from apheresis collection of plasma (all collected in 2020) were available under the general informed consent of the University Hospitals of Geneva.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All vaccinated individuals were in addition tested for the presence of nucleocapsid antibodies (Elecsys® Anti-SARS-CoV-2 anti-N) to screen for unrecognized infection prior to vaccination.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-N</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viruses and cells: Vero-E6 and Vero E6-TMPRSS cells were cultured in complete DMEM GlutaMax I medium supplemented with 10% fetal bovine serum, 1x Non-essential Amino Acids, and 1% antibiotics (Penicillin/Streptomycin) (all reagents from Gibco, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6-TMPRSS</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, no primary Beta isolate could be obtained on VeroE6 but only on A549 cells overexpressing human ACE2 [23].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Therefore, after primary isolation, A549-hACE2 cells were mixed with VeroE6 in a 1:1 ratio and inoculated with the passage 1 isolate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-hACE2</div><div>suggested: RRID:CVCL_A5KB)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Omicron variant was primarily isolated on Vero-TMPRSS cells, then transferred to Vero E6 for generation of a virus stock.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All virus stocks were titrated on Vero-E6 cells and full genome sequenced.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The 90% reduction endpoint titers (PRNT90) were calculated by fitting a 4-parameter logistics curve with variable slope to the plaque counts of each serum/plasma using GraphPad Prism version 9.2.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations of our study are the relatively low number of specimens that were available for convalescent specimens of patients previously infected with variants. Furthermore, we cannot exclude that individuals infected with a VOC have not already been infected in 2020 with a first-wave virus and thus antibodies are derived from multiple infections with more than one variant. In addition, the Beta variant, which could not be readily isolated on VeroE6 cell lines had to be adapted to VeroE6 in order to be usable for our PRNT, thus the isolate accumulated mutations, which could affect the neutralization results. No convalescent samples were available from individuals infected with Zeta, and no convalescent samples were yet available from individuals infected with Omicron without prior vaccination. Furthermore, testing of single time points after infection/vaccination can only provide a snapshot and not inform on the duration of antibody responses over time. All our blood specimens were collected at rather early time points after infection or vaccination, thus with time, a broader neutralizing capacity towards the heterologous variant might be observed due to somatic hypermutation and affinity maturation, although in the case of Omicron most likely will not restore neutralization loss [60]. Overall, we could show that responses to variants before Omicron were associated with reduced, but not complete loss in neutralization both by infection-derived as well as vaccine derived immu...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.28.21268491
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.27.21268431

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.27.21268431: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The Institutional Review Board at the College of Medicine and King Saud University approved the study (approval 21/01039/IRB).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SPSS IBM statistical analysis program Version#21 was used for the statistical data analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  4.2 Study limitations and strengths (Hani): While this research is subject to the limitation of cross-sectional studies, such as sampling, response, and recall biases, still, this study is among the first to explore perceptions and worries among HCWs considering the new SARS-CoV-2 Omicron variant. As with the evolving variants situations, HCWs’ experiences and perceptions are likely to change. Moreover, HCWs’ experiences may differ from one setting to another.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.27.21268431
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.28.474336

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.28.474336: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: All animal studies were conducted in compliance with all relevant local, state, and federal regulations and were approved by the Bioqual Institutional Animal Care and Use Committee (IACUC)<br>IACUC: All animal studies were conducted in compliance with all relevant local, state, and federal regulations and were approved by the Bioqual Institutional Animal Care and Use Committee (IACUC)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animals and study design: Outbred adult male and female rhesus macaques (M. mulatta) and cynomolgus macaques (M. fascicularis), 6–12 years old, were randomly allocated to groups.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animals and study design: Outbred adult male and female rhesus macaques (M. mulatta) and cynomolgus macaques (M. fascicularis), 6–12 years old, were randomly allocated to groups.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">All immunological and virological assays were performed blinded.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: The UVC preparations for use in non-human primate studies were analyzed for endotoxin levels (Wickham Laboratories Ltd) and absence of mycoplasma (Mycoplasma Experience Ltd).</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then stained for intracellular spike protein using an Anti-SARS-CoV-2 Spike Glycoprotein S1 antibody (Abcam, ab275759, 1:50) followed by Goat Anti-Rabbit IgG H&L (Alexa Fluor 488) (Abcam, ab150077, 1:500).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ab275759</div><div>suggested: (Abcam Cat# ab275759, RRID:AB_2892127)</div></div><div style="margin-bottom:8px"><div>Anti-Rabbit IgG</div><div>suggested: (Abcam Cat# ab150077, RRID:AB_2630356)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry analysis of cell surface antigen expression: For flow cytometric analysis of cell surface expression of MHC-I, MICA and SARS-CoV-2 spike protein, cells were harvested from culture plates and washed using PBS with 1% Bovine Serum Albumen (Thermo Scientific) and were then stained with PE anti-human MICA/MICB Antibody (6D4, Biolegend)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 spike protein</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human MICA/MICB</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>6D4</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alexa Fluor 647 anti-human HLA-A,B,C (W6/32, Biolegend), and anti-SARS-CoV-2 Spike Glycoprotein S1 antibody (Abcam, ab275759, 1:50) followed by Goat Anti-Rabbit IgG H&L (Alexa Fluor 488) (Abcam, ab150077, 1:500).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human HLA-A</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>W6/32</div><div>suggested: (Bio-Rad Cat# MCA81A488, RRID:AB_324712)</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 Spike Glycoprotein S1</div><div>suggested: (Abcam Cat# ab275759, RRID:AB_2892127)</div></div><div style="margin-bottom:8px"><div>ab150077</div><div>suggested: (Abcam Cat# ab150077, RRID:AB_2630356)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Membranes were blocked in blocking buffer (5% non-fat powdered milk in TBST), before incubation with primary antibodies in blocking buffer (Rabbit polyclonal anti-SARS-Cov2, Sino Biological 40591-T62, 1:6000 dilution or Mouse b-actin, Abcam 8226, 1 μg/ml), detected with HRP conjugated secondaries in blocking buffer (Goat anti-Rabbit HRP, Sino Biological SSA003, 0.5 μg/ml or Goat anti-Mouse HRP, Abcam ab205719, 1: 4000 dilution) and visualised using the SuperSignal West Femto kit (ThermoFisher) as per kit instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-Cov2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>b-actin , Abcam 8226 , 1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Rabbit</div><div>suggested: (Sino Biological Cat# SSA003, RRID:AB_2814815)</div></div><div style="margin-bottom:8px"><div>anti-Mouse HRP</div><div>suggested: (Abcam Cat# ab205719, RRID:AB_2755049)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 48 hours of culture, transfected cells were stained with aqua dye for live/dead discrimination and corresponding antibodies-MICA/MICB (Clone 6D4, PE, BioLegend) or ULBP-1 (clone 170818, PE, R & D Systems).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibodies-MICA/MICB</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-CD107a antibody (clone H4A3, ECD conjugate, BD Biosciences)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-CD107a</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, luciferase reporter plasmid pLenti-CMV Puro-Luc (Addgene), and spike protein expressing pcDNA3.1-SARS-CoV-2 SΔCT were co-transfected into HEK293T cells with calcium phosphate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: KCB Cat# KCB 200744YJ, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To determine the neutralization activity of the antisera from vaccinated macaques, HEK293T-hACE2 cells were seeded in 96-well tissue culture plates at a density of 1.75 × 104 cells per well overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-hACE2</div><div>suggested: RRID:CVCL_A7UK)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, to generate a standard curve, the SARS-CoV-2 E gene sgRNA was cloned into a pcDNA3.1 expression plasmid; this insert was transcribed using an AmpliCap-Max T7 High Yield Message Maker Kit (Cellscript) to obtain RNA for standards.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, the packaging construct psPAX2 (AIDS Resource and Reagent Program)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>psPAX2</div><div>suggested: RRID:Addgene_12260)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, luciferase reporter plasmid pLenti-CMV Puro-Luc (Addgene), and spike protein expressing pcDNA3.1-SARS-CoV-2 SΔCT were co-transfected into HEK293T cells with calcium phosphate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLenti-CMV</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pcDNA3.1-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For analysis by TIDE, PCR amplicons were Sanger sequenced (Eurofins or Genewiz) and paired .</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Genewiz</div><div>suggested: (GENEWIZ, RRID:SCR_003177)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Intracellular spike protein staining: Engineered UVC were harvested and then fixed and permeabilized using BD Cytofix/Cytoperm Fixation/Permeabilization Solution (ThermoFisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Cytofix/Cytoperm Fixation/Permeabilization Solution</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow analysis was carried out on a Fortessa flow cytometer (BD Bioscience), and data analyzed, and flow cytometry figures generated using FlowJo 10 software (BD Biosciences)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GraphPad Prism was used to plot a standard curve and interpolate the sample values using a 4-parameter logistic fit.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, the packaging construct psPAX2 (AIDS Resource and Reagent Program)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AIDS Resource and Reagent Program</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analyses: Statistical differences between two sample groups, where appropriate, were analyzed by a standard Student’s two-tailed, non-paired, t-test and between three or more sample groups using two-way or three-way ANOVA using GraphPad Prism 9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  A limitation of the WA1/2020 UVC in a Delta heterologous challenge was the absence of any meaningful protection in nasal swabs. This discordance between vaccine variant, versus virus variant, is the principal challenge facing current vaccinated populations and might suggest the reason for ongoing infectious spread but more limited morbidity and mortality against these emerging variants29, 31. As regards duration of protection, the theoretical hyper-immunity postulated by creating a self-adjuvanting, hyper-immune UVC established robust initial nAb titers. When these animals were rechallenged 6-month later, the nAb response stayed robust at the higher, and now established for clinical use, 1e8 UVC dose. Moreover, the persistent nAb response at 6-months remained robust for SARS-CoV-2 WA1/2020, Beta and Delta variants. As regards intrinsic safety, the UVC undergoes lethal irradiation during manufacture and rapid apoptosis in the immune microenvironment upon vaccination. This is the principal mechanism of efficacy of the UVC, and fortunately its most redeeming safety feature, by virtue of the impossibility of in vivo persistence and teratogenicity of the cellular antigen carrier. The irradiation-induced apoptosis is further enhanced by CRISPR genetic engineering to remove MHC-I expression and introduce cell surface expression of the NKG2D ligand MICA, making the UVC potent targets for host NK cells. Recruited NK cells will likely recognize the UVC as virally infected cell through ...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.28.474336
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.29.21268501

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.29.21268501: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Informed consent was not retrieved according to Swedish legislation.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were performed with GraphPad Prism 9.0 (GraphPad Software, San Diego, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.29.21268501
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.25.474149

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.25.474149: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(3F10 antibody from Roche) or anti-β-actin antibody (Santa Cruz, #S47778).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>3F10</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-β-actin</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The lentiviral vectors were produced by transfecting 1.5 million HEK 293T cells in a single well of a 6-well plate, using PEI-Max MW 40,000 (PolySciences, CAS Number: 49553-93-7) mixed with 600 ng of PsPax2 (Addgene # 12260), 600 ng of the lentiviral transfer vector pLenti_CMV-EGFP-2A-mNeonGreen (Addgene # 171599), and 600 ng of various viral envelope plasmids.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(Addgene plasmid #171595), and AttB_ACE2[dEcto]_IRES-mCherry-H2A-P2A-PuroR (Addgene plasmid #171596). psPAX2 and pMD2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMD2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(Addgene plasmid #12260; http://n2t.net/addgene:12260; RRID: Addgene_12260) and (Addgene plasmid # 12259; http://n2t.net/addgene:12259; RRID:Addgene_12259), respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_12260)</div></div><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_12259)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The lentiviral vectors were produced by transfecting 1.5 million HEK 293T cells in a single well of a 6-well plate, using PEI-Max MW 40,000 (PolySciences, CAS Number: 49553-93-7) mixed with 600 ng of PsPax2 (Addgene # 12260), 600 ng of the lentiviral transfer vector pLenti_CMV-EGFP-2A-mNeonGreen (Addgene # 171599), and 600 ng of various viral envelope plasmids.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLenti_CMV-EGFP-2A-mNeonGreen</div><div>suggested: RRID:Addgene_171599)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For comparing the singleplex and duplex infection assays, 50,000 cells stably modified with the attB-ACE2(dEcto)_IRES-mCherry-H2A-2A-PuroR plasmid, 50,000 cells stably modified with the attB-ACE2_IRES-iRFP670-H2A-2A-PuroR plasmid, or various combinations of both cells were plated into individual wells of a 24-well plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>dEcto)_IRES-mCherry-H2A-2A-PuroR</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>attB-ACE2_IRES-iRFP670-H2A-2A-PuroR</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BLAST searches and protein sequence alignments: The receptor binding domains of SARS-CoV, WIV1, and SARS-CoV-2 spikes were used as initial query sequences for National Center for Biotechnology Information (NCBI) BLASTp searches.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All RBD fragments were manually curated and aligned using Clustal Omega[58].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Clustal Omega[58</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The aligned sequences were used as the input for a custom python script that performed calculations of amino acid identity at each position for any given pair of RBD sequences.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To perform a comprehensive search for clade 2 RBD spike sequences to gain a near-complete sampling of their sequence diversity, we first performed an NCBI BLASTp search using the YN2013 RBD amino acid sequence as the query.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLASTp</div><div>suggested: (BLASTP, RRID:SCR_001010)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The captured TIFF files were analyzed with a custom Python script utilizing the numpy, scipy, cv2, skimage, and PIL packages.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>numpy</div><div>suggested: (NumPy, RRID:SCR_008633)</div></div><div style="margin-bottom:8px"><div>scipy</div><div>suggested: (SciPy, RRID:SCR_008058)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data Analysis and statistics: Data analysis was performed using version 1.4.1717 of RStudio, with the exception of flow cytometry data, which was first analyzed using version 10.8.0 of FlowJo.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Modeling of Bat ACE2 three-dimensional structures: The HHpred web server was used to perform homology alignment of various Bat ACE2 sequences with human ACE2 structures (pdb: 6m17 and 6m18) [62, 63].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HHpred</div><div>suggested: (HHpred, RRID:SCR_010276)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A structural model was then built with the MODELLER web server [64], and the ACE2 models were each aligned to the SARS-CoV-2 RBD in PDB:6m17 using the default alignment settings in PyMol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MODELLER</div><div>suggested: (MODELLER, RRID:SCR_008395)</div></div><div style="margin-bottom:8px"><div>PyMol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.25.474149
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.30.21268537

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.30.21268537: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.30.21268537
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.27.21268456

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.27.21268456: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical statement: The present study was approved by the ethics committee of the Medical University of Innsbruck (no. 1352/2021).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Second, to investigate differences by population subgroups, we fitted multivariable regression models that included the variables age (<25 vs. ≥25 years), sex (males vs. females), smoking (current vs. never/ex-smokers), body mass index (≥25 vs. <25 kg/m2), prior SARS-CoV-2 infection (yes vs. no) based on complete case analysis.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">In specific, we used (i) a generalised estimating equation with a logit link function, a binomial distribution family, and an independent variance structure to test for differences in seroprevalence among unvaccinated individuals, and (ii) a linear mixed model with a random intercept to test for differences in antibody levels after full vaccination.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">First, between 8 June 2020 and 31 March 2021, we assessed samples for anti-SARS-CoV-2 IgG antibodies targeting the nucleocapsid protein (“anti-N IgG”) using the Abbott SARS-CoV-2 IgG chemiluminescent microparticle immunoassay analysed on the Alinity i instrument (Abbott Ireland, Sligo, Ireland).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>“anti-N IgG”</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Second, between 19 March 2021 and 30 September 2021, we assessed samples for anti-SARS-CoV-2 IgG antibodies targeting the spike protein (“anti-S IgG”) using the Abbott SARS-CoV-2 IgG II chemiluminescent microparticle immunoassay analysed on the Alinity i instrument.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>“anti-S IgG”</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The switch to the anti-S IgG assay was done because the assay allows quantification of absolute antibody levels (in BAU/mL) and detects anti-SARS-CoV-2 IgG antibodies elicited via vaccination.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses: The primary analysis quantified seroprevalence of anti-SARS-CoV-2 IgG antibodies for each of the months between June 2020 and September 2021 and is presented together with Agresti-Coull 95% CIs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">First, between 8 June 2020 and 31 March 2021, we assessed samples for anti-SARS-CoV-2 IgG antibodies targeting the nucleocapsid protein (“anti-N IgG”) using the Abbott SARS-CoV-2 IgG chemiluminescent microparticle immunoassay analysed on the Alinity i instrument (Abbott Ireland, Sligo, Ireland).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  The study we presented herein has several important strengths and limitations. With data on 35,193 participants with 47,363 analysed samples, our study was adequately powered to reliably quantify time- and region-specific seroprevalence. Furthermore, because a subset of participants donated blood repeatedly, we gained important insight into the dynamics of antibody levels over time. Also, while the eligibility criteria for blood donation restricted our study sample to healthy individuals aged 18-70 years, the age- and sex-structure of our study sample was in close agreement with the general population, thereby supporting the generalisability of our findings to these age groups. Still, when interpreting our seroprevalence estimates, it is crucial to take into account that vaccine coverage among children and adolescents who constitute 17.4% of the population in Tyrol is much lower and therefore seroprevalence across all age groups is expected to be lower. Limitations of our study include (i) the availability of anti-N IgG antibody measurements only up to March 2021 (precluding a clear differentiation of infection- and vaccination-induced seropositivity) and (ii) lack of detailed data on the vaccination regimen (i.e. vaccination dates and vaccine type) because of time constraints at the blood donation centres.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.27.21268456
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.27.21268464

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.27.21268464: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We utilise the publicly available data sources for COVID-19 [29] [30] for optimizing the model parameters in MATLAB.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MATLAB</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.27.21268464
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.27.21268424

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.27.21268424: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Models were implemented using Python’s statsmodels library, version 0.9.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python’s</div><div>suggested: (PyMVPA, RRID:SCR_006099)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.27.21268424
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.22.21268176

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.22.21268176: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: In accordance with the ethical guidelines for medical and health sciences research involving human subjects10,11, no review by an institutional review board was required.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using Python 3.6, Numpy (version 1.18.1), Pandas (version 1.0.2), scikit-learn (version 0.22.2. post 1), and Scipy (1.4.1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div><div style="margin-bottom:8px"><div>Numpy</div><div>suggested: (NumPy, RRID:SCR_008633)</div></div><div style="margin-bottom:8px"><div>scikit-learn</div><div>suggested: (scikit-learn, RRID:SCR_002577)</div></div><div style="margin-bottom:8px"><div>Scipy</div><div>suggested: (SciPy, RRID:SCR_008058)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This preliminary study had several limitations. First, we used public data. The image quality varied, and there were some missing clinical data. In fact, the team that created this database advises not to use them to determine diagnostic performance15. However, because we used public data not used for training for validation, the impact of database bias4 is expected to be small. Second, images were evaluated by a single person. Although there is interobserver variability in the diagnosis of pneumonia16, in this study, each group of confidence scores by a single radiologist could be separated by AI-based probability scores with significant differences. The clinical significance of the overlap is unclear, but it is a potential consideration for future research. Third, we did not evaluate all the lesions extracted by our model. This is because there is no gold standard such as CT, and it is difficult to perform a detailed evaluation because of differences in the image quality and size compared to those of DICOM format images for diagnosis. This is an issue for consideration in future research. In conclusion, our hypothesis that commercially available AI-based software could detect opacity regions in CXRs of COVID-19 patients was proved. We hope to conduct clinical research and develop a prognostic model using the output results of this AI to help in the treatment of COVID-19 infections.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.22.21268176
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.28.21268183

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.28.21268183: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: The second collection is a prospective longitudinal cohort study conducted at the laboratory associated with the National reference center for respiratory viruses (University Hospital of Lyon, France).<br>Consent: Ethical Statements: For the vaccinated subjects, a written informed consent was obtained from all participants; ethics approval was obtained from the national review board for biomedical research in April 2020 (Comité de Protection des Personnes Sud Méditerranée I, Marseille, France; ID RCB 2020-A00932-37), and the study was registered on ClinicalTrials.gov (NCT04341142).<br>IRB: Ethical Statements: For the vaccinated subjects, a written informed consent was obtained from all participants; ethics approval was obtained from the national review board for biomedical research in April 2020 (Comité de Protection des Personnes Sud Méditerranée I, Marseille, France; ID RCB 2020-A00932-37), and the study was registered on ClinicalTrials.gov (NCT04341142).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04341142</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Assessment of Serological Techniques for Screening Patients …</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.28.21268183
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.24.21268174

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.24.21268174: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.24.21268174
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.27.474288

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.27.474288: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study protocol was approved by the CUIMC Institutional Review Board (IRB) and all participants provided written informed consent.<br>Consent: The study protocol was approved by the CUIMC Institutional Review Board (IRB) and all participants provided written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lysates and virions were analyzed by Western blotting with the following primary antibodies: rabbit anti-SARS-Spike S1 (Sino Biological, Cat# 40591-T62), rabbit anti-SARS-Spike S2 (Sino Biological, Cat# 40590-T62), rabbit anti-p55/p24/p17 (Abcam, Cambridge, MA (Cat# ab63917)), mouse anti-VSV NP (Millipore, Burlington, MA (Cat# MABF2348)) or mouse anti-GAPDH (Millipore, Cat# CB1001).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-Spike</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-Spike S2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-p55/p24/p17</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-VSV NP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-GAPDH</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Western blots were developed with the following secondary antibodies: HRP-conjugated anti-rabbit antibody (Cytiva, Marlborough, MA (NA934-1ML)) or HRP-conjugated goat antimouse antibody (Jackson ImmunoResearch, West Grove, PA (Cat# 115-035-008)).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (GE Healthcare Cat# NA934, RRID:AB_772206)</div></div><div style="margin-bottom:8px"><div>antimouse</div><div>suggested: (C. Birchmeier - Max Delbruck Center for Molecular Medicine, Berlin, Germany Cat# Guinea pig anti-mouse Lbx1 polyclonal antibody, RRID:AB_2532144)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">S1, S2 and NP were detected as described above; huACE2-Fc bound to the pseudovirus particles was detected with Peroxidase AffiniPure goat anti-human IgG (H+L) antibody (Jackson ImmunoResearch).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: HEK293T, 293T-ACE2 (BEI), Vero-E6, and COS-1 cells were cultured in Dulbecco modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 100 mg/ml penicillin-streptomycin (Thermo Fisher Scientific, Cambridge, MA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COS-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expi293 cells were maintained in suspension culture directly in Expi293TM Expression Medium, supplemented with penicillin and streptomycin, and were incubated at 37°C in a humidified atmosphere of 8% CO2 in air and on a shaker platform rotating at 125 rpm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero-E6 and COS-1 are from African green monkey kidneys.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">S glycoprotein expression, processing and incorporation into pseudovirus particles: HEK293T cells were transfected to produce VSV- and HIV-based particles pseudotyped with SARS-CoV-2 S glycoprotein variants, as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: KCB Cat# KCB 200744YJ, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To measure the infectivity of pseudovirus variants on target cells expressing different levels of human ACE2, serial dilutions (from 2 μg to 24.7 ng) of the human ACE2 expressor plasmid (Addgene, Watertown, MA (Cat# 1786)) were transfected into 293T cells in 12-well plates using 1 mg/ml PEI.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Approximately 3 x 104 target cells (Vero-E6 or 293T-ACE2 cells) per well were then added.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">METHOD DETAILS: Plasmid constructs: The codon-optimized SARS-CoV-2 spike (S) gene (Sino Biological, Wayne, PA) encoding the S glycoprotein lacking 18 amino acids at the carboxyl terminus was cloned into the pCMV3 vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV3</div><div>suggested: RRID:Addgene_161029)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, 7.5 μg of SARS-CoV-2 S glycoprotein expressor plasmid and 7.5 μg pHIV-1NL4-3ΔEnv-NanoLuc reporter construct were cotransfected into the HEK293T cells using Polyethylenimine (Polysciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHIV-1NL4-3ΔEnv-NanoLuc</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">S, S1, and S2 band intensities from unsaturated Western blots were calculated using ImageJ Software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The concentrations of huACE2-Fc that achieved an OD450 of 0.8 and and the serum endopoint dilution that achieved an OD450 value > 3-fold over background were calculated by fitting the data in five-parameter dose-response curves in GraphPad Prism 9 (GraphPad Software Inc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.27.474288
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.29.474432

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.29.474432: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed and sequentially incubated with an oligoclonal pool of SARS2-2, SARS2-11, SARS2-16, SARS2-31, SARS2-38, SARS2-57, and SARS2-71 [40] anti-S protein antibodies and HRP-conjugated goat anti-mouse IgG (Sigma Cat # A8924) in PBS supplemented with 0.1% saponin and 0.1% bovine serum albumin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS2-57</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS2-71</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-S protein</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (Sigma-Aldrich Cat# A8924, RRID:AB_258426)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody-virus complexes were added to Vero-hTMPRSS2 cell monolayers in 96-well plates and incubated at 37°C for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-hTMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed and sequentially incubated with an oligoclonal pool of SARS2-2, SARS2-11, SARS2-16, SARS2-31, SARS2-38, SARS2-57, and SARS2-71 [40] anti-S protein antibodies and HRP-conjugated goat anti-mouse IgG (Sigma Cat # A8924) in PBS supplemented with 0.1% saponin and 0.1% bovine serum albumin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS2-71</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus titration assays: Plaque assays were performed on Vero-hACE2-hTRMPSS2 cells in 24-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-hACE2-hTRMPSS2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Four microliters RNA was used for real-time RT-qPCR to detect and quantify N gene of SARS-CoV-2 using TaqMan™ RNA-to-CT 1-Step Kit (Thermo Fisher Scientific) as described [41] using the following primers and probes: Forward: GACCCCAAAATCAGCGAAAT; Reverse: TCTGGTTACTGCCAGTTGAATCTG; Probe: ACCCCGCATTACGTTTGGTGGACC; 5’Dye/3’Quencher: 6-FAM/ZEN/IBFQ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GACCCCAAAATCAGCGAAAT</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Reverse</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>TCTGGTTACTGCCAGTTGAATCTG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Probe</div><div>suggested: (UniPROBE, RRID:SCR_005803)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations of the study: We note several limitations of our study. (a) We did not evaluate the effects of the vaccine on the transmission of SARS-CoV-2 in Syrian hamsters, which may be an important measure of vaccine protection. (b) We used lower doses of vaccine to mimic suboptimal and possibly waning immunity. Studies that directly compare the quality of a waning immune response to that of a low dose vaccine induced immune response are needed. (c) The challenge dose of SARS-CoV-2 used in our hamster model (103 PFU) is several orders of magnitude higher that the minimal infectious dose (5 PFU) [34]. While this creates a very robust virus challenge model, it could underestimate the protective effects of vaccines. (d) We did not establish correlates of immune protection. We noted that lower serum antibody neutralization titers were associated with high viral loads and infectious virus titers in the Ad26.COV2.S immunized animals, as well as breakthrough infections in some of the mRNA-1273 vaccinated mice, albeit this did not explain all breakthrough infections. A more detailed analysis of T cell and non-neutralizing antibody responses coupled with even lower vaccine doses may be needed to fully establish a correlate of protection against breakthrough infection. Overall, our studies demonstrate that the Moderna mRNA-1273 and Johnson & Johnson Ad26.COV2.S vaccines authorized for emergency use are immunogenic in mice and Syrian hamsters and protect against the B.1.621 (Mu) varian...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.29.474432
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.26.21268434

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.26.21268434: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Despite the considerable heterogeneity in terms of study populations, sites, study designs, treatment regimens, significant individual limitations, as well as the differences in summary measures, the evidence available does largely provide a common pattern in favour of utility of the drug in COVID-19, supported by satisfactory safety of treatment. Further studies, particularly the multiple ongoing RCTs, should be able to provide more definitive evidence in all regards. Among the eleven observational studies, including 9 cohort/cross-sectional and two case control studies, most of the results appear to point towards a similar pattern favouring beneficial improvements of key clinical outcomes and/or biochemical or laboratory parameters with baricitinib therapy in moderate to severe COVID-19 hospitalised patients, generally used in addition to standard of care. Observational studies also compared baricitinib to other drugs such as tocilizumab (25), used various doses of baricitinib (20, 31) assessed therapeutic effects of loading dose changes h or combination with other drugs such as tocilizumab (21), LMWHs like enoxaparin (22–26,31) etc., to investigate outcome parameters such as mortality, improvement in oxygen saturation, hospital stay, need for intensification of treatment like ventilatory requirement, virological clearance and inflammatory biochemical markers like CRP. Most of the above permutations of baricitinib interventions and outcomes depicted results favour of barici...
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04401579</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Adaptive COVID-19 Treatment Trial 2 (ACTT-2)</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.26.21268434
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.22.21268212

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.22.21268212: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.22.21268212
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.20.21268130

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.20.21268130: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.20.21268130
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.20.21267877

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.20.21267877: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The ImmuneRACE study was approved by Western Institutional Review Board (WIRB reference number 1-1281891-1, Protocol ADAP-006).<br>Field Sample Permit: Bloodworks NW donor samples had been consented and collected under the Bloodworks Research Donor Collection Protocol BT001, while the DLS samples had been collected under Protocol DLS13.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.20.21267877
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.21.21268197

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.21.21268197: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum samples were analyzed for anti-SARS-CoV-2 antibody by the Abbott SARS-CoV-2 IgG assay run on the Architect i2000SR immunoassay analyzer (https://www.fda.gov/media/137383/download).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Due to the potential for cross-reaction of sotrovimab with anti-spike antibody assays, only analysis of anti-nucleocapsid serostatus was conducted.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-spike</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum samples were analyzed for anti-SARS-CoV-2 antibody by the Abbott SARS-CoV-2 IgG assay run on the Architect i2000SR immunoassay analyzer (https://www.fda.gov/media/137383/download).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reads were cropped to a common read length of 50 bp and low-quality bases and adapters were further trimmed using Trimmomatic (v. 0.39)27.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Trimmomatic</div><div>suggested: (Trimmomatic, RRID:SCR_011848)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Trimmed sequenced reads per library were then aligned to a custom reference genome using STAR (v 2.7.3a)28 and to a custom reference transcriptome using Salmon (v. 1.0.0)29.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_004463)</div></div><div style="margin-bottom:8px"><div>Salmon</div><div>suggested: (Salmon, RRID:SCR_017036)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The custom reference genome and transcriptome annotation was based on combining the human reference genome and annotation from Gencode (GRCh38, release 30) with the SARS-CoV-2 reference genome and annotation from Ensembl (ASM985889v3 version).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gencode</div><div>suggested: (GENCODE, RRID:SCR_014966)</div></div><div style="margin-bottom:8px"><div>Ensembl</div><div>suggested: (Ensembl, RRID:SCR_002344)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Libraries were assessed for total reads (minimum, maximum, and median of 23.4, 94.4, and 33.2 million read pairs), average read length (49 bp), and adapter content, post-trimming with FASTQC (v. 0.11.8).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FASTQC</div><div>suggested: (FastQC, RRID:SCR_014583)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alignment metrics, such as total aligned reads, aligned reads by feature type, gene body coverage and 3’ bias, were assessed using Picard CollectRnaSeqMetrics (v 2.20.2—0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Picard</div><div>suggested: (Picard, RRID:SCR_006525)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Known junction saturation rate as a function of sequencing depth was also profiled for all libraries using RSeQC (v 3.0.1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RSeQC</div><div>suggested: (RSeQC, RRID:SCR_005275)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis transcriptome: Using the R package DESeq2 (v 1.32.0)31</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For this baseline analysis, UMAP (from the umap-learn python package; https://umap-learn.readthedocs.io/en/latest/) was run with default parameters.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  One caveat of this analysis is that VOCs that have decreased sensitivity to antibodies induced by vaccination (e.g., Delta and Omicron) were not circulating at the time of enrollment in the study. Therefore, additional analysis may be needed to confirm the protective effect of seropositivity in the current phase of the pandemic. Whole blood transcriptome analysis revealed a signature of disease severity that encompassed overexpression of genes involved in interferon response, inflammation and the complement system. We showed that a full transcriptome signature can be captured faithfully with a 10-gene panel. Use of a simple expression signature lowers the bar for an eventual implementation, as recently shown by work to make a three gene tuberculosis signature using point-of-care rapid testing20. An important effort of the present work was to define whether the set of predictive parameters of hospitalization and disease severity was also modified by treatment with sotrovimab; i.e., whether these parameters could serve as surrogate markers of sotrovimab response because they are modified by treatment and strongly associated to the study clinical endpoints of interest. Indeed, sotrovimab accelerated the normalization of NLR and the transcriptome profiles in a statistically significant manner. In particular, hospitalized participants in the placebo group retained the transcriptome profile associated with risk by Day 8 at a time when the majority of study participants normalized t...
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04545060</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">VIR-7831 for the Early Treatment of COVID-19 in Outpatients</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.21.21268197
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.21.21268157

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.21.21268157: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: SARS-CoV-2 cases as well as their close contacts within the respective daycare group and household were examined over a 12-day period, including the collection of biological specimens and the documentation of symptoms.<br>Consent: Written informed consent was obtained from each participant.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Furthermore, we considered information on exposure to SARS-CoV-2 and IgG-antibody status against SARS-CoV-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IgG antibodies against SARS-CoV2 were detected in 22 cases (children: n=8, staff: n=12; adults in households n=2); 6 had a simultaneous positive PCR-test and no history of prior infection, and were determined to be in a state of fresh seroconversion (3 of them were primary cases in the daycare group).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus sequences were determined using covpipe (Illumina data, [17]) or poreCov (MinION data, [18]).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MinION</div><div>suggested: (MinION, RRID:SCR_017985)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Strengths and limitations: The study is subject to some limitations. First, the sample size is relatively small, which is why the results show a relatively high statistical uncertainty. Furthermore, sampling of daycare centers was not random and might not be representative. In addition, with the study being voluntary, the participation among close contacts in daycare groups and households was mostly not complete. We cannot rule out a selection bias, for example severely ill persons may have declined more frequently than others the invitation to participate. When determining the probable primary case, we were sometimes also restricted by the fact that not all daycare group members participated, so we could not rule out that maybe the real primary case would be found outside of our sample. Including additional data from local health authorities and daycare directors was meant to compensate for this drawback. A strength of our study is that we were largely successful in determining primary cases. The reconstruction of the transmission chain in each participating daycare group yielded probable primary cases which differed from the registered index cases in four of the daycare groups, twice with a change from staff member to child, thereby producing a different SAR when stratified for child vs. adult. The prospective design was a strength of the study, as it enabled us to detect additional secondary cases which might have not been noticed if the investigation had taken place only ...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.21.21268157
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.21.21268209

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.21.21268209: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: KP’s institutional review board (IRB) approved the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.21.21268209
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.21.21268203

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.21.21268203: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These analyses were performed using Prism 9.0 by GraphPad LLC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  There are several limitations to our findings. First, we analyzed a convenience sample that may not be applicable to all socioeconomic groups and these data cannot infer cause-effect due to selection bias factors; however, the survey did include a broad geographic distribution, a wide age range and a prolonged home monitoring period. Secondly COVID-19 positive tests were self-reported and may underestimate the number of positive tests. We suspect our control populations may have contained some SARS-CoV-2 infected individuals, and this condition would be expected to underestimate the specificity of fever for detecting the onset of COVID-19. A third concern is the low specificity of fever. In comparison to a matched control population, the specificity of fever for detecting COVID-19 ranged from 0.62-0.73. However, the low specificity of fever is to be expected, and determining the etiology of fever is one of the most frequent reasons for Infectious Disease consultation.41 Fever serves as a nonspecific warning of possible infection and should trigger a more complete history, exam, and the ordering of specific tests to clarify the etiology. However, in the setting of a high incidence of COVID-19 the presence of fever has a higher likelihood of reflecting the onset of this disease. As shown in Figure 3, we propose a simple management algorithm for management of individuals home monitoring for fever. First and most important for preventing spread in the workplace, school or househo...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.21.21268203
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.26.21268414

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.26.21268414: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We then balance classes to account for those labels which have fewer than 300 representatives using class_weight.compute_class_weight in scikit-learn (sklearn) version 1.01, which obtains the weights of samples in a class by dividing the average number of samples in each of all classes by the number of samples in that class.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>scikit-learn</div><div>suggested: (scikit-learn, RRID:SCR_002577)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A Python (Google Colab) notebook including the preprocessing steps performed for Omicron variant sequence data is available for download at https://github.com/bahrad/Covid/blob/main/Covid_Predict_Omicron_Resistance.ipynb. Model Architecture: Fig. 1 shows an overview of our deep neural network model architecture.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The hardware used for neural network model training and evaluation, as well as the data pre-processing described above, consists of Nvidia Tesla P80 GPUs (primarily) and Google Cloud Tensor Processor Units (TPUs) the Google’s Colab environment, running Tensorflow 2.70 and Python 3.7.12, and Nvidia Tesla V100-SXM2 GPUs on the Drexel University Research Computing Facility (URCF), running Tensorflow 2.4 and Python 3.8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Tensorflow</div><div>suggested: (tensorflow, RRID:SCR_016345)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For example, patient metadata classification trains on 44,003 samples, which requires 51 sec/epoch in the Google TPU environment had 51 sec/epoch, while on a GPU unit in the URCF, the time per epoch was 480 seconds, representing a 9.2-fold TPU-speedup.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Google</div><div>suggested: (Google, RRID:SCR_017097)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 23. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.26.21268414
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.26.21268358

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.26.21268358: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was conducted with the approval of the Ethics Committee of Kyorin University School of Medicine (Number R02-041; May 19, 2020).<br>Consent: Informed consent was obtained from all study participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 anti-spike antibody assay: SARS-CoV-2 anti-spike antibody measurements were performed on serum obtained from centrifuged peripheral blood using the Elecsys Anti-SARS-CoV-2 S RUO (Roche Diagnostics International Ltd, Rotkreuz, Switzerland) on a Cobas 6000 (Roche Diagnostics) analyzer via the double-antigen sandwich enzyme-linked immunoassay method [15].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-spike</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation, 100 μL of the mixture was added to the Vero cells in a 96-well plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Percent neutralization was calculated using GraphPad Prism 8.0.2 software (GraphPad Software, California, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This study has some limitations. The number of participants was limited, and all participants were HCWs vaccinated at a single hospital. Multicenter studies with a larger sample size are needed. In individuals with low antibody response to other viral vaccines, the mechanism by which humoral immunity is acquired after mRNA vaccination needs to be clarified through future research. In conclusion, after two doses of the BNT162b2 vaccine, both low and normal responders to previous antiviral vaccines developed adequate levels of SARS-CoV-2 anti-spike and SARS-CoV-2 neutralizing antibodies to protect against SARS-CoV-2. However, both low and normal responders had lower SARS-CoV-2 anti-spike antibody levels in the fifth month than in the first month after receiving the second dose of BNT162b2 vaccine. Therefore, a third dose of BNT162b2 vaccine should be administered to all individuals, regardless of their antibody response to previous antiviral vaccines.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.26.21268358
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.22.21268127

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.22.21268127: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: of Neurology of the Carl Thiem Hospital in Cottbus was approved by the local ethics committee (Votum 2021-2124-BO-ff).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Median age was 42 (range 22-70) there were 54 female and 28 male participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralizing IgG antibodies: Anti-SARS-CoV-2 IgG antibodies were determined using the LIAISON® SARS-CoV-2 TrimericS IgG assay from Diasorin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The trimeric spike glycoprotein is the stabilized native form of the SARS-CoV-2 spike protein and a stabilized trimer can accurately detect the presence of neutralizing antibodies IgG.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 spike protein</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: For visualization and statistical analyses Graphpad Prism 8.2 (GraphPad Software Inc.) was used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Another limitation of this investigation is that no data on the pre-vaccination immune-status is available and thus, previous exposure to SARS-CoV-2 may have occurred. However, apart from PwMS who were excluded for their known history of COVID disease, no other study participant showed an anti-capsid T-cell response in the T-SPOT assay, which exclusively indicates antigen contact by infection. Since, the vast majority of our patients received mRNA based vaccines, it would be of great interest to obtain similar data on PwMS who received vector based vaccines. The data presented in this study provides clear evidence on the cellular and humoral immune responses in MS and NMOSD patients receiving disease modifying therapies. With the notable exception of S1P inhibitors no treatment investigated inhibited the cellular immune response. Furthermore, the majority of patients treated with S1P inhibitors and half of the patients receiving B cell depleting therapies did show a low but detectable vaccination induced SARS-CoV-2 spike protein specific IgG production. This leaves only a small group of patients receiving S1P inhibitors for whom we could detect no immune response after vaccination. We believe that these results may aid clinicians in their decision to select the best immunomodulatory treatments for PwMS under the circumstances of the pandemic and to make informed decisions on the potential benefit of additional vaccinations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.22.21268127
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.21.21268166

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.21.21268166: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Informed consent was confirmed via signatures or thumb prints, while parental consent was obtained for participants who were less than 18 years old.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The presence of IgM antibodies indicates a recent infection (7-28 days prior to sampling), while IgG antibodies typically appear approximately 14 days after infection and endure for at least several months, providing some degree of immunity from further infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Other caveats include those individuals who are unable to mount a detectable antibody response, and the fact that SARS-CoV-2 antibody titres have been shown to decline in the months following exposure. Due to the delay between exposure and development of SARS-CoV-2 antibodies, it is likely the seropositive participants of this survey will have been infected by or vaccinated against the virus by 27 September 2021 (two weeks prior to the commencement of sampling). Across the two sites examined in this study, the overall seroprevalence was 48.0%, and the seroprevalence among unvaccinated participants was 45.4%. If the seroprevalence data reported here is representative of Kaduna State (population 8.25 million13), it would indicate at least 3.75 million SARS-CoV-2 infections since the pandemic began: a figure 387 times greater than the state’s 9,695 confirmed cases as of 27 September 202113. Extrapolating to the whole of Nigeria (population 213 million), this would suggest at least 96.7 million infections. This is in stark contrast to the number of confirmed cases at that time: 206,13813. During sample and data collection, the proportion of the Nigerian population who had received at least one dose of a SARS-CoV-2 vaccine was between 2.3% and 2.7%2. Self-reporting of vaccination in this survey indicated that 8.25% of participants in Kaduna City and 4.0% of participants in Kofar-Gayan had received at least one dose of a vaccine. This indicates that participants were not representa...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.21.21268166
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.22.21268059

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.22.21268059: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used the function solve_ivp from SciPy with the “Radau” method.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SciPy</div><div>suggested: (SciPy, RRID:SCR_008058)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 9, 18 and 4. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.22.21268059
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.21.21268143

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.21.21268143: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Miniaturized wastewater SARS-CoV-2 amplicon sequencing: The Swift Normalase® Amplicon Panels (SNAP) kit (PN: SN-5X296 (core) COVG1V2-96 (amplicon primers)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SNAP</div><div>suggested: (SNAP, RRID:SCR_007936)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Between 5uL and 0.2uL of library material, depending on the data provided from the MiSeq Nano run, was pipetted into a single pool for the NovaSeq run.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MiSeq</div><div>suggested: (A5-miseq, RRID:SCR_012148)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequencing depth and single nucleotide variant (SNV) calls are obtained using samtools mpileup25 and the iVar variants method18.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lineage defining mutations are obtained from the UShER global phylogenetic tree using the matUtils package13.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>matUtils</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Constrained minimization is performed in Python using the cvxpy convex optimization package26,27.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.21.21268143
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.26.473325

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.26.473325: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical statement: Sample collection and research were performed with the approval of Institutional Review Board on Ethics Committee of BGI (Approval letter reference number BGI-NO.<br>Field Sample Permit: The sampling procedures strictly followed the ‘Guidelines on Ethical Treatment of Experimental Animals’ established by the Ministry of Science and Technology, China. Sample collection and dissection: Bats used in this study were all male Rhinolophus sinicus (Chinese horseshoe bat) which were identified the species by the field experts, and obtained from Guangdong province, China, then dissected and stored in -80°C freezer immediately.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">The sampling procedures strictly followed the ‘Guidelines on Ethical Treatment of Experimental Animals’ established by the Ministry of Science and Technology, China. Sample collection and dissection: Bats used in this study were all male Rhinolophus sinicus (Chinese horseshoe bat) which were identified the species by the field experts, and obtained from Guangdong province, China, then dissected and stored in -80°C freezer immediately.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After obtaining the single cell gene expression matrices, we used Seurat 3.2.224 to perform the downstream analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Seurat</div><div>suggested: (SEURAT, RRID:SCR_007322)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cross-species data integration: To facilitate the comparation among four species, we first convert all genes of bats to the homogenous mouse genes using OrthoFinder26.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>OrthoFinder26</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.26.473325
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.22.21268219

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.22.21268219: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study procedures were approved by the institutional review board of Mass General Brigham and participants gave consent for specimen testing for research purposes.<br>Consent: Study procedures were approved by the institutional review board of Mass General Brigham and participants gave consent for specimen testing for research purposes.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">The swabs were then tested according to the manufacturer’s instructions and results interpreted by three readers, blinded to the specimen variant and concentration, as positive, negative, or discordant (if not all three readers agreed).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.22.21268219
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.25.21268392

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.25.21268392: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics committee approval: The CoCo Study and the analysis conducted for this article were approved by the Internal Review Board of Hannover Medical School (institutional review board no. 8973_BO-K_2020,</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Binding is further revealed by an anti-tag peroxidase-labelled antibody and colorimetric quantification.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-tag peroxidase-labelled</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pre-incubation of the Spike-protein with serum or plasma of convalescent patients or vaccinees prevents subsequent binding to ACE2 to various degrees, depending on the amount of neutralizing antibodies present.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed three times with PBST and incubated with an HRP-conjugated anti-His-tag antibody (clone HIS 3D5, provided by Helmholtz Zentrum München) for 1⍰h at 37⍰°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, without washing, an antibody mix of anti-CD3-AF532 (UCHT1; #58-0038-42; Lot # 2288218; Invitrogen; 1:50), anti-CD4-BUV563 (RPA-T4; #741353; Lot # 9333607; BD Biosciences; 1:200), anti-CD8-SparkBlue 550 (SK1; #344760; Lot #B326454; Biolegend; 1:200), anti-CD45RA (HI100, #740298, Lot # 0295003; BD Biosciences; 1:200), anti-CCR7 (G043H7; #353230; Lot # B335328; Biolegend; 1:50), anti-CD38 PerCP-eF710 (HB7; #46-0388-42; Lot # 2044748; Invitrogen; 1:100) and Zombie NIR(tm)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD3-AF532</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD4-BUV563</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD8-SparkBlue</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD45RA</div><div>suggested: (BD Biosciences Cat# 740298, RRID:AB_2740037)</div></div><div style="margin-bottom:8px"><div>anti-CCR7</div><div>suggested: (Fluidigm Cat# 3159003, RRID:AB_2714155)</div></div><div style="margin-bottom:8px"><div>anti-CD38</div><div>suggested: (Thermo Fisher Scientific Cat# 46-0388-42, RRID:AB_1834399)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the rhabdoviral pseudotyped particles were produced in 293T cells transfected to express the desired SARS-CoV-2-S variant inoculated with VSV*DG-FLuc, a replication-deficient VSV vector that encodes for enhanced green fluorescent protein and firefly luciferase (FLuc) instead of VSV-G protein (kindly provided by Gert Zimmer, Institute of Virology and Immunology, Mittelhäusern, Switzerland)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The assay was performed in 96-well plates in which Vero cells were inoculated with the respective pseudotyped particles/plasma mixtures.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">READER (AESKU.GROUP, Wendelsheim, Germany) and the Gen5 2.01 Software for analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gen5</div><div>suggested: (Gen5, RRID:SCR_017317)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: Statistical analysis was done using GraphPad Prism 8.4 (GraphPad Software, USA) and SPSS 20.0.0 (IBM SPSS Statistics, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Ethics committee approval: The CoCo Study and the analysis conducted for this article were approved by the Internal Review Board of Hannover Medical School (institutional review board no. 8973_BO-K_2020,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CoCo</div><div>suggested: (CoCo, RRID:SCR_010947)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 17 and 20. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.25.21268392
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.27.21268278

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.27.21268278: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/content/10.1101/2021.12.27.21268278v1
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.27.474315

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.27.474315: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BLASTp with default parameters were used to find essential proteins.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLASTp</div><div>suggested: (BLASTP, RRID:SCR_001010)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Prediction and analysis of 3D structure: The 3D structure of the target proteins was predicted using online software I-TASSER [20]</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>I-TASSER</div><div>suggested: (I-TASSER, RRID:SCR_014627)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The obtained structures were refined using GALAXYWEB server [21] and the appropriate models were made choice by considering highest C-score value.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GALAXYWEB</div><div>suggested: (GalaxyWEB, RRID:SCR_018558)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To perform docking GALAXY Pepdock server [22] was used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GALAXY</div><div>suggested: (Galaxy, RRID:SCR_006281)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.27.474315
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.27.474251

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.27.474251: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 60 min incubation, plate wash step was repeated and the detection antibody, goat anti-human IgG-HRP (Thermo Fisher, SG) was added at 100 μL/well for an incubation of 60 min in dark.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Similarly, HDX was performed for nine convalescent antibodies - LSI-CoVA-014, LSI-CoVA-015, LSI-CoVA-016, and LSI-CoVA-017 identified in this study; and CR3022, CoVA2-04, CoVA-39, 4A8, and 5A6 (previous studies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div><div style="margin-bottom:8px"><div>CoVA-39</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The peptides showing protection in the presence of antibody were provided as input under attractive amino acid residues at the protein-protein interaction interface in ClusPro, using a specific module for antigen-antibody docking.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-antibody docking.</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Capture ELISA: Monoclonal human IgG1 antibodies LSI-CoVA-014, LSI-CoVA-015, LSI-CoVA-016, and LSI-CoVA-017 were conjugated individually to peroxidase as per manufacturer’s protocol (Abnova, TW).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monoclonal antibodies LSI-CoVA-014, LSI-CoVA-015, LSI-CoVA-016 and LSI-CoVA-017 were tested at several concentrations ranging from 0.01 ng/mL to 10 μg/mL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>LSI-CoVA-015</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>LSI-CoVA-016</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2-Spike construct was expressed in Spodoptera frugiperda Sf9 cells following instructions from bac-to-bac baculovirus expression system (Thermo Fisher, SG).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sf9</div><div>suggested: CLS Cat# 604328/p700_Sf9, RRID:CVCL_0549)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmid Sars-Cov-2 Spike HexaPro (addgene) was used to transfect HEK 293 cells with polyethylenimine (PEI).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">At Day 1, 36 ×106 HEK293T cells were transfected with 27 μg pMDLg/pRRE (Addgene, US), 13.5 μg pRSV-Rev (Addgene, US), 27μg pTT5LnX-WHCoV-St19 (SARS-CoV2 Spike) and 54 μg pHIV-Luc-ZsGreen (Addgene, US) using Lipofectamine 3000 transfection reagent (Thermo Fisher, SG) and cultured in a 37 °C, 5% CO2 incubator.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus neutralization assay (PVNT): On Day 0, CHO cell lines with stable expression of ACE2 were seeded at a density of 5 x104 cells in 100 μL of complete medium [DMEM/high glucose with sodium pyruvate (Thermo Fisher, SG), supplemented with 10% FBS (Thermo Fisher, SG), 10%</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibody:pseudovirus mixtures were then added to CHO-ACE2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody and antigen expression and purification: Genes coding for variable regions of antibody heavy and light chain were synthesized and cloned into vector pTT5 expression vector (National Research Council Canada, NRCC) by Twist</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pTT5</div><div>suggested: RRID:Addgene_52326)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">At Day 1, 36 ×106 HEK293T cells were transfected with 27 μg pMDLg/pRRE (Addgene, US), 13.5 μg pRSV-Rev (Addgene, US), 27μg pTT5LnX-WHCoV-St19 (SARS-CoV2 Spike) and 54 μg pHIV-Luc-ZsGreen (Addgene, US) using Lipofectamine 3000 transfection reagent (Thermo Fisher, SG) and cultured in a 37 °C, 5% CO2 incubator.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMDLg/pRRE</div><div>suggested: RRID:Addgene_12251)</div></div><div style="margin-bottom:8px"><div>pRSV-Rev</div><div>suggested: RRID:Addgene_12253)</div></div><div style="margin-bottom:8px"><div>pHIV-Luc-ZsGreen</div><div>suggested: RRID:Addgene_39196)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GraphPad Prism was used for plots and one-way ANOVA statistical analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Homology modelling of single Fab arm: Homology models of Fab arms of LSI-CoVA-014, LSI-CoVA-015, LSI-CoVA-016, and LSI-CoVA-017 were modelled using Modeller version 9.21 (43).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Modeller</div><div>suggested: (MODELLER, RRID:SCR_008395)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Position specific iterative - BLAST was used to identify the template structures with high sequence identity and structures available at PDB were chosen. 7K8R, 6DWZ, 6DF2, and 7JXE were used as template structures to model peptides spanning heavy chain and light chain of LSI-CoVA-014, LSI-CoVA-015, LSI-CoVA-016, and LSI-CoVA-017 respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Hetero dimers containing heavy and light chain for respective antibodies were complexed by aligning to the respective template structures in PyMol (Schrodiner Inc, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The epitope sites on RBD and NTD identified using HDXMS for each antibody were chosen to perform a biased docking using ClusPro 2.0 webserver (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ClusPro</div><div>suggested: (ClusPro, RRID:SCR_018248)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A total of 20 Fab:RBD/NTD complexes from four different Fab arms were modelled using CHARMM-GUI and simulated in GROMACS package version 2018.4 (50).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GROMACS</div><div>suggested: (GROMACS, RRID:SCR_014565)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.27.474251
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.27.474275

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.27.474275: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.27.474275
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.26.474192

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.26.474192: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HRP-conjugated secondary antibodies against the T7-tag were diluted at 1:5,000 or 1:75,00 in the blocking buffer and incubated for 1 hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>T7-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A validated SARS-CoV-2 antibody-negative human serum control and a validated NIBSC SARS-CoV-2 plasma control were obtained from the National Institute for Biological Standards and Control, UK) and an uninfected cells control were also used to ensure that virus neutralization by antibodies was specific.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Control, UK</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A 96-well ELISA plate (R&D system) was coated with the RBD protein or the HEK-293T cell lysate at an amount of approximately 3-5 ng per well in a coating buffer (15 mM sodium carbonate, 35 mM sodium bicarbonate, pH 9.6) overnight at 4°C, with subsequent blockage with a blocking buffer (DPBS, v/v 0.05% Tween 20, 5% milk) at room temperature for 2 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudotyped SARS-CoV-2 neutralization assay: The 293T-hsACE2 stable cell line (Cat# C-HA101, Lot# TA060720C) and pseudotyped SARS-CoV-2 (Wuhan-Hu-1 strain, D614G, Alpha, Beta, Lambda, Delta and Omicron) particles with luciferase reporters were purchased from the Integral Molecular.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-hsACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Nb–virus mixes (220 μl total) were incubated at 37°C for 1 h, after which they were added dropwise onto confluent Vero E6 cell (ATCC® CRL-1586™, for Munich) or Vero E6-TMPRSS2-T2A-ACE2 cells (BEI cat# NR- 54970, for Delta) monolayers in the six-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Vero E6-TMPRSS2-T2A-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The monomeric Nbs 2-31 and 2-45 were also cloned into a pET-22b(+) vector at the BamHI and XhoI sites for periplasmic expression.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-22b(+)</div><div>suggested: RRID:Addgene_12651)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The PCR fragment was then inserted into the 2-45 pET-21b(+) vector at the same restriction sites to produce the heterodimer 2-45-(GGGGS)3-2-31.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-21b(+)</div><div>suggested: RRID:Addgene_112204)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Crystallographic analysis of psNbs with RBD: The receptor-binding domain (RBD) of the SARS-CoV-2 spike (S) protein (GenBank: QHD43416.1), used in the crystallographic study, was cloned into a customized pFastBac vector (69), and fused with an N-terminal gp67 signal peptide and C-terminal His6 tag (70).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pFastBac</div><div>suggested: RRID:Addgene_1925)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The MS data obtained from different RBD-specific VHH isolations were analyzed by AugurLlama to identify high-affinity Nbs for each RBD (15).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AugurLlama</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were processed by Prism 9 (GraphPad) to fit into a 4PL curve and to calculate the logIC50 (half-maximal inhibitory concentration).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Automated data collection was carried out using serialEM (46) at a nominal magnification of 64,000x with a physical pixel size of 1.329 Å/pixel (0.6645 Å/pixel at super-resolution).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>serialEM</div><div>suggested: (SerialEM, RRID:SCR_017293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Image processing was performed on-the-fly using CryoSPARC Live version 3.2 (47–49).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Models were manually corrected in Coot (version 9.6.0) between rounds of read-space refinement in Phenix.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Maps colored by local resolution were generated using RELION 3.1 (57).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RELION</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Iterative model building and refinement were carried out in COOT (74) and PHENIX (75), respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PHENIX</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antigens were clustered at 70% sequence identity with a minimum length coverage of 15% using CD-HIT (78), the Bio.align pairwise sequence alignment module and CATH domain identifiers.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD-HIT</div><div>suggested: (CD-HIT, RRID:SCR_007105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody hit rate calculation: We constructed a multiple sequence alignment for each antigen cluster using MAFFT (79) and selected a representative structure with highest structure coverage and resolution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Conservation scores range from 0 to ln(20) = 2.99, higher is more conserved.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Conservation</div><div>suggested: (Conservation, RRID:SCR_016064)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The simulation was run starting from the RBD structure (PDB 6lzg) using Gromacs 2020 version with the CHARMM36m force field (82).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gromacs</div><div>suggested: (GROMACS, RRID:SCR_014565)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequences were aligned by MUSCLE (83) with default parameters.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MUSCLE</div><div>suggested: (MUSCLE, RRID:SCR_011812)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The phylogenetic tree was then constructed by the MEGA (84) using the maximized likelihood estimation method.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGA</div><div>suggested: (Mega BLAST, RRID:SCR_011920)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.26.474192
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.26.472655

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.26.472655: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Patients were excluded from this cohort if they had received COVID-19 vaccination by the time of delivery, or if they were deemed unable to provide informed consent and agree to study procedures for any medical or social reason.<br>IRB: This study was approved by the Boston University Medical Campus Institutional Review Board.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">This hospital delivers a significant proportion of pregnant patients from minority groups with comorbidities such as hypertension and obesity and having public insurance, which are characteristics associated with severe SARS-CoV-2 disease (18, 19).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Written informed consent or REDCap e-consent was obtained from all participants.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analysis was performed using SAS software V9.4 (SAS Analytics).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS</div><div>suggested: (SASqPCR, RRID:SCR_003056)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Graphical data for cytokine levels was created using Prism Software (Graphpad)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  The current study has several limitations. First, our cohorts were of moderate sample size and we did not evaluate a complete repertoire of COVID-19 related clinical variables (i.e. c-reactive protein (CRP) levels, white blood cell count). As only a small subset of our cohort had these labs available, they were not included as part of this analysis. Our cohort also had a larger proportion of patients with maternal SARS-CoV-2 infections in early gestation as compared with late gestation. Ongoing analysis with larger cohorts will be required to characterize the cytokine profiles of early vs late pregnancy SARS-CoV-2 infections more completely. As the majority of studies on COVID-19 in pregnancy contain samples exclusively from late pregnancy (3rd trimester) infections, our study highlights the importance of incorporating patients with SARS-CoV-2 infection at multiple gestational stages of pregnancy for ongoing studies in this field. In particular, multivariate analysis to correlate anti-viral antibodies with cytokine profiles will be informative to identify how these inflammatory signatures impact maternal and infant SARS-CoV-2 responses, particularly in relation to gestational timing of maternal infection. This study supports a growing body of evidence that perinatal alterations resulting from maternal COVID-19 in pregnancy have a risk of impacting the health of infants even in the absence of fetal SARS-CoV-2 transmission. Indeed, of all our clinical parameters evaluated betwe...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.26.472655
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.27.474307

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.27.474307: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For antibodies where vectors were unavailable (e.g., S309, CB6, REGN10933, REGN10987, COV2-2196, COV2-2130, CT-P59, C144, C135, S2E12) (12, 13, 21, 22, 25, 27–31), published amino acids sequences were used for synthesis and cloning into corresponding pVRC8400 vectors (Genscript) (46, 47).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C144</div><div>suggested: (Leinco Technologies Cat# C144, RRID:AB_2828501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">TMPRSS2 and ACE2 expression profiles in 293 Flpin-TMPSS2-ACE2 were characterized by flow cytometry using a mouse monoclonal antibody against TMPRSS2 (MillliporeSigma) followed by an anti-mouse IgG1 APC conjugate (Jackson laboratories) and a molecular probe containing the SARS-CoV-2 receptor binding domain tagged with biotin (Sino biological) followed by staining with a BV421 conjugated streptavidin probe (BD Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TMPRSS2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation with the antibodies or ACE2, the cells were washed and incubated with an allophycocyanin conjugated anti-human IgG (709-136-149, Jackson Immunoresearch Laboratories) or BV421 conjugated streptavidin conjugate for another 30 minutes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 709-136-149, RRID:AB_2340526)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Proteins were expressed in Expi293 cells by transfection with expression vectors encoding corresponding genes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of 293 Flpin-TMPRSS2-ACE2 cell line: 293 Flpin-TMPRSS2-ACE2 isogenic cell line was prepared by co-transfecting pCDNA5/FRT plasmid encoding TMPRSS2-T2A-ACE2 and pOG44 plasmid encoding Flp recombinase in 293 Flpin parental cell line (Thermo Fisher, Cat R75007)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flpin-TMPRSS2-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">transducing plasmid pHR’ CMV-Luc, a TMPRSS2 plasmid and S plasmids from SARS CoV-2 variants into 293T cells using Lipofectamine 3000 transfection reagent (L3000-001, ThermoFisher Scientific, Asheville, NC) (48, 49).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T-ACE2 cells (provided by Dr. Michael Farzan) or 293 flpin-TMPRSS2-ACE2 cells were plated into 96-well white/black Isoplates (PerkinElmer, Waltham, MA) at 75,00 cells per well the day before infection of SARS CoV-2 pseudovirus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell surface binding: HEK293T cells were transiently transfected with plasmids encoding full length SARS CoV-2 spike variants using lipofectamine 3000 (L3000-001, ThermoFisher) following manufacturer’s protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Variable heavy chain sequences were human codon optimized, synthesized and cloned into a VRC8400 (CMV/R expression vector)-based IgG1 vector containing an HRV3C protease site (44) as previously described (45).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of 293 Flpin-TMPRSS2-ACE2 cell line: 293 Flpin-TMPRSS2-ACE2 isogenic cell line was prepared by co-transfecting pCDNA5/FRT plasmid encoding TMPRSS2-T2A-ACE2 and pOG44 plasmid encoding Flp recombinase in 293 Flpin parental cell line (Thermo Fisher, Cat R75007)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA5/FRT</div><div>suggested: RRID:Addgene_31984)</div></div><div style="margin-bottom:8px"><div>pOG44</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">S-containing lentiviral pseudovirions were produced by co-transfection of packaging plasmid pCMVdR8.2,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMVdR8.2</div><div>suggested: RRID:Addgene_8455)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">transducing plasmid pHR’ CMV-Luc, a TMPRSS2 plasmid and S plasmids from SARS CoV-2 variants into 293T cells using Lipofectamine 3000 transfection reagent (L3000-001, ThermoFisher Scientific, Asheville, NC) (48, 49).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHR’</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>TMPRSS2</div><div>suggested: RRID:Addgene_53887)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The samples were then acquired in a BD LSRFortessa X-50 flow cytometer (BD biosciences) and analyzed using Flowjo (BD biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flowjo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Iterative manual model building and real-space refinement were carried out in Coot (48) and in Phenix (51), respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data process workflow, including motion correction, CTF estimation, particle picking and extraction, 2D classification, ab initio reconstruction, homogeneous refinement, heterogeneous refinement, non-uniform refinement, local refinement and local resolution estimation, were carried out with C1 symmetry in cryoSPARC 3.3 (50).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Iterative manual model building and real-space refinement were carried out in Coot (48) and in Phenix 1.19.2 (51), respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phenix</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Molprobity (52) was used to validate geometry and check structure quality at each iteration step.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Molprobity</div><div>suggested: (MolProbity, RRID:SCR_014226)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The graphs were generated in GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 49, 53, 54 and 55. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.27.474307
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.28.474325

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.28.474325: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Written or oral informed consent was obtained from all participants.<br>IRB: The study was approved by the Ethics Committee of the Virgen Macarena and Virgen del Rocio University Hospital (protocol code “pDCOVID”; internal code 0896-N-20).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The stimulation was performed in the presence of 10 µg/mL of brefeldin A (Sigma Chemical Co, St. Louis, MO) and 0.7 µg/mL of monensin (BD Biosciences) protein transport inhibitors, anti-CD107a-BV650 (clone H4A3; BD Biosciences, USA) monoclonal antibody and purified CD28 and CD49d as previously described (22).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD107a-BV650</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantification of anti-S SARS-CoV-2 and endemic coronaviruses IgG antibodies: Anti-S IgG SARS-CoV-2 and endemic coronaviruses (NL63, OC43, 229E and HKU1) levels were measured by ELISA as previously described (4,16,23,24).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>endemic coronaviruses IgG antibodies: Anti-S IgG SARS-CoV-2 and endemic coronaviruses (NL63, OC43, 229E and HKU1) levels</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-S IgG SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>NL63</div><div>suggested: (Virostat Cat# 3879, RRID:AB_2889994)</div></div><div style="margin-bottom:8px"><div>HKU1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies, streptavidin-horseradish peroxidase-conjugated mouse anti-human IgG (Hybridoma Reagent Laboratory, Baltimore, MD, #HP6043-HRP) was used at a 1: 2,000 dilutions in 1% milk containing 0.05% Tween-20 in PBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (LSBio (LifeSpan Cat# LS-C6452-25, RRID:AB_834632)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunophenotyping and intracellular cytokine staining: Both cultured PBMCs and cells for phenotypical analysis were washed (1800 rpm, 5 min, room temperature) with Phosphate-buffered saline (PBS) and incubated 35 min at room temperature (RT) with LIVE/DEAD Fixable Aqua Dead Cell Stain (Life Technologies), anti-CD14-BV510 (clone MφP9), anti-CD19-BV510 (clone SJ25C1), anti-CD56-BV510 (clone NMCAM16.2), anti-CD3-BV711 (clone SP34-2), anti-CD45RA-FITC (clone L48), anti-CD8-APC (clone SK-1), anti-CD27-APCH7 (clone M-T271), anti-PD-1-BV786 (CD279, clone EH12-1), anti-CD38 (clone HIT2), anti-CD28 (clone CD28.2) (all of them from BD Bioscience); anti-TIGIT-PerCPCy5.5 (clone A15153G) and anti-HLA-DR (clone L243) (from BioLegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Bioscience)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PBMCs were washed with PBS and fixed and permeabilized with BD Cytofix/CytoPerm following manufacturer’s protocol (Cat. No. 554714, BD Bioscience), and intracellularly stained at 4°C for 30 min with anti-IL-2-BV421 (clone MQ1-17H12), anti-IFN-γ-PE-Cy7 (clone B27) (BD Bioscience), anti-TNF-α-AF700 (clone Mab11) (BD Pharmingen), anti-Perforin-PE (clone B-D48) (BioLegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Cytofix/CytoPerm</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>BD Bioscience</div><div>suggested: (BD Biosciences, RRID:SCR_013311)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed using the FlowJo 10.7.1 software (Treestar, Ashland, OR).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: Non-parametric statistical analyses were performed using Statistical Package for the Social Sciences software (SPSS 25.0; SPSS, Inc., Chicago, IL), RStudio Version 1.3.959 and GraphPad Prism version 8.0 (GraphPad Software, Inc.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Statistical Package for the Social Sciences</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div><div style="margin-bottom:8px"><div>RStudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  One limitation of this study is that all patients included were recruited in the first wave of COVID-19 in Spain, in those dates, experimental therapies with very limited but transitory immunosuppressive effects were administered what may have affected the levels of immune parameters in acute infection. However, in those patients who were treated with IFN-β and corticosteroids, samples were collected time enough after these therapies to reverse the potential effects (24 days [7 – 28] and 9 days [1 – 21], respectively) what may have not affected the results presented herein. Seven months post-infection, one potential bias may come from the group of hospitalized subjects that were composed by patients with previous mild (42%) or severe (58%) disease, however, as no differences were found in any parameter associated to T-cell response (data not shown) between this two subgroups, they formed part of the same group of previously hospitalized and were compared with non-hospitalized patients. ICS needs a notable amount of cells to be assayed, this avoid us to perform endemic virus-specific T-cell response in COVID-19 samples; however, it has allowed us to obtain comprehensive data about the quality of SARS-CoV-2 specific T-cell response. Finally, anti-S IgG levels were assayed against the whole S protein and not for RBD, cross-reactive reaction cannot be excluded and results have to be interpreted taking this into account. In the same way, further research is needed to confirm and c...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.28.474325
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.28.474333

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.28.474333: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.28.474333
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.24.474132

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.24.474132: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animal experiments were performed in compliance with all pertinent National Institutes of Health regulations and approval from the Animal Care and Use Committees of the Vaccine Research Center and Bioqual Inc. (Rockville, MD).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resultant clusters were assigned to following cell types based on the expression of the indicated gene products: club cell (SCGB1A1, SCGB3A1), pneumocyte (PIFO, SNTN, FOXJ1), MARCO- mac (MRC1, APOE), MARCO+ mac (MRC1, APOE, MARCO), cDC.1 (CLEC9A, XCR1), cDC.2 (CD1C, CLEC10A), pDC (GZMB, IRF7), MigDC (CCR7, BIRC3),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pDC</div><div>suggested: RRID:Addgene_166941)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transcript alignment was performed against a Macaca mulataa reference library generated using the Cell Ranger mkref command, the Ensembl Mmul_10 top-level genome FASTA, and the corresponding Ensembl v100 gene GTF.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ensembl</div><div>suggested: (Ensembl, RRID:SCR_002344)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resultant clusters were assigned to following cell types based on the expression of the indicated gene products: club cell (SCGB1A1, SCGB3A1), pneumocyte (PIFO, SNTN, FOXJ1), MARCO- mac (MRC1, APOE), MARCO+ mac (MRC1, APOE, MARCO), cDC.1 (CLEC9A, XCR1), cDC.2 (CD1C, CLEC10A), pDC (GZMB, IRF7), MigDC (CCR7, BIRC3), Mast cell (CPA3, GATA2), CD4+ T cell (CD3E, CD40LG), CD8+ T cell (CD3E, CD8A), and B cells (CD19, MS4A1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MARCO</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All other statistical analysis was performed using GraphPad Prism 8 Software (GraphPad Software, La Jolla, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Despite these potential caveats, our findings were validated by challenge of animals with the SARS-CoV-2 B.1.351/beta variant, wherein mRNA-1273 vaccination also prevented infection-induced lung inflammation. There are some limitations of this study to consider. First, the relatively transient and self-limiting nature of SARS-CoV-2 infection and infection-elicited inflammation in macaques makes it difficult to place these observations into context of human disease. Many of the pathways, cell types, transcriptional signatures, and correlates of protection identified in our analysis have also been defined in humans with acute COVID-19, but the magnitude and timing of the events may not be homologous. Second, the route of virus administration has been shown to influence infection and inflammation in other models of SARS-CoV-2 challenge (35), so that the IN/IT route of infection used in this study may result in subtly different features of infection and inflammation than aerosol-mediated infection. In conclusion, this study defines the lower respiratory tract cellular and transcriptional signature associated with SARS-CoV-2 infection in macaques using two distinct viral variants, and identifies conserved signatures of vaccine-elicited protection from infection-attendant inflammation. These data emphasize the contribution of inflammatory/migratory DCs and macrophages to lower respiratory tract inflammation following SARS-CoV-2 infection, and define a critical relationship between ...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.24.474132
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.24.474095

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.24.474095: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation for 1 hour at 37 °C, the inoculum was removed, and cells were washed with PBS before medium supplemented with anti-VSV-G antibody (clone 8G5F11, Kerafast) was added to neutralise residual input virus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-VSV-G</div><div>suggested: (Absolute Antibody Cat# Ab01401-2.0, RRID:AB_2883992)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Carboxyl groups on the CM5 sensor chip matrix were activated with a mixture of 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS) to form active esters for the reaction with amine groups. anti-mouse-Fc-antibody (BR100838, Cytiva) was diluted in 10 mM sodium acetate buffer pH 5 (30 μg/mL) for covalent coupling to immobilisation level of ~6,000 response units (RU).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse-Fc-antibody (BR100838</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To compute this score, we enumerate the number of unique epitopes involving altered positions, as measured across all the antibody-Spike complex structures deposited in Protein Data Bank.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-Spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This allows to approximate the expected weight of mutations, and to ascribe importance to non-RBD mutations, if and only if sufficient escape potential with regard to RBD-targeting antibodies is achieved.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RBD-targeting</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">It too changes with time with new discoveries of anti-Spike antibodies, but to a lesser extent and is expected to converge to a stable value.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Spike</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum dilutions were mixed 1:1 with pseudovirus for 30 minutes at room temperature prior to addition to Vero 76 cell monolayers and incubation at 37 °C for 24 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero 76</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, HEK293T/17 monolayers transfected to express SARS-CoV-2 S with the C-terminal cytoplasmic 19 amino acids truncated (SARS-CoV-2-S[CΔ19]) were inoculated with the VSVΔG-GFP/Luc vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VSVΔG-GFP/Luc</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  However, we would like to point out that a limitation for the calculation of the latter score for Omicron is the relatively small number of variants that have such a high number of mutations. The Early Warning System can sensitively detect HRVs months ahead of the official WHO designation, sometimes within the same week a sequenced variant enters the database. The only variant with delayed flagging by the EWS compared with WHO designation, the Delta variant, suffers from significant underrepresentation of the lineage in GISAID. This partial and delayed representation of the lineage in the database prevents even growth-based detection, emphasising the importance of extensive, robust, and timely sequencing of SARS-CoV-2 genomic samples globally. Combining comprehensive sequencing with structural modelling and AI can provide unprecedented insights into the COVID-19 pandemic which could be harnessed by public health authorities and governments worldwide to increase their preparedness to HRVs and potentially alleviate the associated human and economic costs. Future development of our approach could be extended to further functionalities such as assessment of known and predicted T cell epitopes, as well as the projection of prospective variant evolution scenarios.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04380701</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Trial Investigating the Safety and Effects of Four BNT162 …</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.24.474095
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.25.474113

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.25.474113: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Sera of vaccinees: Serum was taken 5-7 weeks after the second immunization with the mRNA vaccine Comirnity (median dose interval 21 days (range 21-24) from four SARS-CoV-2 naïve healthcare workers (75% female, median age 46 [IQR 37-59]) which took part in the COMMUNITY study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the incubation period medium was removed from VeroE6 cells, cells were washed once with PBS to remove any non-attached cells and virus/APN01 mixtures.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Preparation of recombinant human ACE2: Clinical grade recombinant human ACE2 (amino acids 18-740) was produced by the contract manufacturer Polymun Scientific (Klosterneuburg, Austria) from CHO cells according to GMP guidelines under serum free conditions and formulated as a physiologic aqueous solution, as described previously (Zoufaly et al, 2021, Lancet Respiratory Medicine).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Visualizations of RBD domains, full-length Spike protein, and Omicron Spike-ACE2 ineractions: Visualizations were rendered with pymol software (the PyMOL Molecular Graphics System, Version 2.0 Schrödinger, LLC), based on a model of the fully glycosylated Spike-ACE2 complex described in Capraz et al. [37] and https://covid.molssi.org//models/#spike-protein-in-complex-with-human-ace2-ace2-spike-binding. Primers: The following tables lists the primers used in this study:</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pymol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations of this study: Our study used VeroE6 cells, the classic cellular model for SARS and SARS-CoV-2 infection studies. The study should be expanded to additional cell types as well as human organoids. Moreover, the affinity of Omicron Spike and Omicron RBD should be determined in direct affinity/avidity measurements as well as the impact of non-RBD Spike mutations on the infection process. Of note, from all our previous studies and studies from other groups, the data on soluble ACE2 inhibiting SARS-CoV-2 infections in VeroE6 cells were always supported by results in all other cell types tested. Moreover, we used sera collected 4-6 weeks after the second mRNA vaccination from 4 SARS-CoV-2 naïve healthcare workers, which needs to be expanded to different vaccine regimens and vaccine types and increased sample numbers, though multiple studies are now being released also demonstrating impaired vaccine efficacies to Omicron.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04335136</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recombinant Human Angiotensin-converting Enzyme 2 (rhACE2) a…</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.25.474113
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.12.27.21268309

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.27.21268309: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Depending on the partner institution, library preparation and sequencing was done either on the Illumina and/or Oxford Nanopore Platform.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Oxford Nanopore</div><div>suggested: (Oxford Nanopore Technologies, RRID:SCR_003756)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral RNA was extracted from nasopharyngeal swabs using an automated protocol and tested for SARS-CoV-2 by multiplex real-time PCR assays: (i) the Allplex 2019-nCoV Assay (Seegene) targeting the envelope (E), the RNA dependent RNA polymerase (RdRp) and the nucleocapsid (N) genes; (ii) the Charité: SARS-CoV2 (E/RP) assay (Bio- Manguinhos/Fiocruz) targeting the E gene, and (iii) the GeneFinder COVID-19 Plus RealAmp Kit (Osang Healthcare, South Korea) supplied by the Brazilian Ministry of Health (BrMoH), Butantan Institute and the Pan-American Health Organization (OPAS)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bio-</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Manguinhos/Fiocruz</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GeneFinder</div><div>suggested: (GENEFINDER, RRID:SCR_009190)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.12.27.21268309
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.27.474250

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.27.474250: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein Production and Purification: RNA isolated from an anonymized leftover sample of a SARS-CoV-2 infected individual was reverse transcribed into cDNA and the Omicron Spike ectodomain was amplified by PCR, sequence verified and cloned into the nCoV-2P-F3CH2S plasmid, replacing the original wild-type Spike.5 Mutations stabilizing the Spike protein in the trimeric prefusion state were introduced simultaneously by PCR and In-Fusion cloning.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>nCoV-2P-F3CH2S</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cryo-EM image processing: On-the-fly processing was first performed during data acquisition for evaluating the data quality during screening by using cryoSPARC live v3.3.1.4 The obtained ab-initio structures were used for better particle picking for template creation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">15 These docked models were extended and rebuilt manually with refinement, using Coot and Phenix.34,35 Figures were prepared in UCSF Chimera and UCSF ChimeraX.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.27.474250
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.12.22.473880

1
1. sciscore 03 Jan 2022
  
  in SciScore
  
  SciScore for 10.1101/2021.12.22.473880: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics: The PASS (IDCRP-126) and EPICC (IDCRP-085) studies were approved by the Uniformed Services University of the Health Sciences Institutional Review Board (IRB) in compliance with all applicable Federal regulations governing the protection of human participants.<br>Consent: All PASS and EPICC study participants provided informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">The antibody identities are blinded for publications per an agreement with the companies.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization assays were performed on 293T-ACE2/TMPRSS2 cells stably expressing ACE2 and transmembrane serine protease 2 (BEI # NR-55293)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2/TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vaccinated participants: Details of the PASS study protocol, including the inclusion/exclusion criteria, have been published(17).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PASS</div><div>suggested: (PASS, RRID:SCR_005490)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization curves were normalized to virus only controls and fitted using nonlinear regression curve (GraphPad Prism, La Jolla, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  The limitations of our study include the relatively small numbers of study subjects, restricted timing of sera collection, and the use of a pseudovirus platform as a surrogate to authentic SARS-CoV-2 viruses. Ultimately neutralization titers need to be tied to clinical outcomes. The rapid and unpredictable evolution of SARS-CoV-2 requires continued development and assessments of medical countermeasures.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.12.22.473880

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL