Hypothesis

24,814 Matching Annotations

Jun 2022
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.06.02.22275900

1
1. sciscore 05 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.06.02.22275900: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: Thank you for sharing your code and data.
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.06.02.22275900
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.06.01.22275778

1
1. sciscore 05 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.06.01.22275778: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Written parental consent was obtained from all student participants.<br>IRB: The study was approved by the Joint Chinese University of Hong Kong – New Territories East Cluster Clinical Research Ethics Committee (Ref. no: 2018.497).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The study adopted a two-stage random sampling method.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Strengths and Limitations: The key strength of this study is the use of a territory-wide, random sampling method. Together with a high response rate, we have captured a representative sample of school-aged children and adolescents in Hong Kong. Furthermore, we kept our sampling methodology consistent before and during COVID, making our data from the two periods comparable. The study has several limitations: First, this study was cross-sectional by nature and not longitudinal. Second, the sleep parameters were derived only from self-report or parent-report, without objective measures such as actigraphy. Third, our data did not capture daytime activities, limiting our interpretation of mediating factors of changes.
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.06.01.22275778
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.06.01.22275882

1
1. sciscore 05 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.06.01.22275882: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics statement: This study was approved by the Ottawa Health Science Network Research Ethics Board (OH SNREB; Protocol# 20200200-01H) and conducted in accordance with the appropriate guidelines.<br>Consent: Written informed consent was obtained from all subjects.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The detection antibody was raised against human plasma (soluble) gelsolin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human plasma (soluble) gelsolin.</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-spike protein antibody assay: A manual colorimetric ELISA was used to measure antibodies targeting SARS-CoV-2 spike protein, a complete description of the methods can be found here (36).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-spike protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Additionally, positive and negative serum controls alongside an isotype-antigen specific calibration curve (CR3022 Human IgG1 (Absolute Antibody, Ab01680-10.0), anti-SARS-CoV-2 S CR3022 Human IgA (Absolute Antibody, Ab01680-16.0), or anti-SARS-CoV-2 S CR3022 Human IgM (Absolute Antibody, Ab01680-15.0)) was added to the plate and incubated for 2h with shaking.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Human IgG1</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 S CR3022 Human IgA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 S CR3022 Human IgM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plates were washed again and 50uL of isotype specific secondary antibodies (anti-human IgG#5-HRP (NRC), anti-human IgA-HRP (Jackson ImmunoResearch Labs, 109-035-011), and anti-human IgM-HRP (Jackson ImmunoResearch Labs, 109-035-129) added and incubated with shaking for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG#5-HRP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgA-HRP</div><div>suggested: (SouthernBiotech Cat# 2050-05, RRID:AB_2687526)</div></div><div style="margin-bottom:8px"><div>anti-human IgM-HRP</div><div>suggested: (MyBioSource Cat# MBS673990, RRID:AB_10891687)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cytokine Assay: The concentrations of pro- and anti-inflammatory cytokines in plasma were quantified using multiplexing immunobead assays analyzed using the BioRad Luminex machine (Bio-Rad Laboratories, Hercules, CA,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bio-Rad Laboratories</div><div>suggested: (Bio-Rad Laboratories, RRID:SCR_008426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Biostatistical methods: The GraphPad Prism 8 (San Diego, CA, USA) and SPSS software version 28</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">8 (SPSS Inc., Chicago, IL, USA) were used to perform all statistical analyses and two-sided P ≤ 0.05 considered to indicate statistical significance.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Despite these promising findings, there are limitations that need to be acknowledged. The sample size of this study is relatively small due to the difficulty in sampling patients longitudinally in a hospital setting. Antibody kinetics (levels and isotype) during the early infection could be influenced by time since infection. Also, the control samples consist of out-patient populations that had no recorded history of respiratory infection during sample collection. Having control samples from patients who are SARS-CoV-2 negative but positive for other respiratory diseases will further strengthen the reliability of pGSN multi-analyte panels. In future studies, patient sample size will be increased while we investigate the prognostic significance of pGSN multi-analyte panel in SARS-CoV-2 variant patients, vaccinated patients as well as convalescent plasma.
  
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04358406</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Rhu-pGSN for Severe Covid-19 Pneumonia</td></tr></table>
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.06.01.22275882
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.06.01.494385

1
1. sciscore 05 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.06.01.494385: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Sera were collected at the U.S. Food and Drug Administration with written consent under an approved Institutional Review Board (IRB) protocol (FDA IRB Study # 2021-CBER-045).<br>IRB: Sera were collected at the U.S. Food and Drug Administration with written consent under an approved Institutional Review Board (IRB) protocol (FDA IRB Study # 2021-CBER-045).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Membranes were probed for the V5-tag and γ-actin using V5 epitope tag antibody (Novus Biologicals, Centennial, CO), and mouse gamma actin polyclonal antibody (Thermofisher), respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>V5-tag</div><div>suggested: (Novus Cat# NB100-62264, RRID:AB_965837)</div></div><div style="margin-bottom:8px"><div>V5 epitope tag antibody (Novus Biologicals, Centennial, CO)</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>mouse gamma actin</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2 genes of various species (African green monkey (AGM), Chinese rufous horseshoe bat (Rhinolophus sinicus), ferret, mouse, Chinese hamster, Syrian golden hamster, white-tailed deer, swine, bovine, and pangolin) with a C-terminal V5 tag were synthesized by GenScript as described previously 42. 293T (ATCC, Manassas, VA, USA; Cat no: CRL-11268), 293T.ACE2 (BEI Resources, Manassas, VA, USA; Cat no: NR-52511) 64 and 293T.ACE2.TMPRSS2 cells stably expressing human angiotensin-converting enzyme 2 (ACE2) and transmembrane serine protease 2 (TMPRSS2) (BEI Resources, Manassas, VA, USA; Cat no: NR-55293) 34 were maintained at 37°C in Dulbecco’s modified eagle medium (DMEM) supplemented with high glucose, L-glutamine, minimal essential media (MEM) non-essential amino acids, penicillin/streptomycin, HEPES, and 10% fetal bovine serum (FBS).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T.ACE2.TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudoviruses comprising the spike glycoprotein and a firefly luciferase (FLuc) reporter gene packaged within HIV capsid were produced in 293T cells by co-transfection of 5 μg of pCMVΔR8.2, 5 μg of pHR’CMVLuc and 0.5 μg of pVRC8400 or 4 μg of pcDNA3.1(+) encoding a codon-optimized spike gene.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Soluble ACE2 Protein Production: His-tagged soluble human ACE2 was produced in FreeStyle™ 293-F cells by transfecting soluble human ACE2 (1-741 aa) expression vector plasmid DNA using 293fectin (Thermo Fisher) and purified using HiTrap Chelating column charged with nickel (GE healthcare) according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293-F</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids and Cell Lines: Codon-optimized, full-length open reading frames of the spike genes of B.1 (D614G) and Omicron variants in the study were synthesized into pVRC8400 (B.1, BA.1, BA.2, and BA.3) or pcDNA3.1(+) (BA.1.1) were obtained from the Vaccine Research Center (National Institutes of Health, Bethesda, MD) and GenScript (Piscataway, NJ, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pVRC8400</div><div>suggested: RRID:Addgene_63163)</div></div><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The HIV gag/pol packaging (pCMVΔR8.2) and firefly luciferase encoding transfer vector (pHR’CMV-Luc) plasmids 62,63 were obtained from the Vaccine Research Center (National Institutes of Health, Bethesda, MD, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHR’CMV-Luc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudoviruses comprising the spike glycoprotein and a firefly luciferase (FLuc) reporter gene packaged within HIV capsid were produced in 293T cells by co-transfection of 5 μg of pCMVΔR8.2, 5 μg of pHR’CMVLuc and 0.5 μg of pVRC8400 or 4 μg of pcDNA3.1(+) encoding a codon-optimized spike gene.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMVΔR8.2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Titers were calculated using a nonlinear regression curve fit (GraphPad Prism Software Inc., La Jolla, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The ACE2 concentration causing a 50% reduction of luciferase activity compared to untreated control was reported as the IC50 using a nonlinear regression curve fit (GraphPad Prism software Inc., La Jolla, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study has several caveats, including the use of pseudoviruses instead of authentic SARS-CoV-2 for conducting experiments. However, our findings using pseudoviruses agree with those reported using authentic SARS-CoV-2. For instance, authentic BA.1 /BA.1.1 VOCs were shown to undergo attenuated replication in TMPRSS2-expressing cells compared to ancestral Wuhan-Hu-1, and Alpha, Beta, and Delta VOCs 6,36. These reports also showed greater sensitivity of BA.1 pseudovirus entry to endosomal inhibitor E64d. While we used pseudovirus entry assays to determine Omicron variant usage of ACE2 receptors of various animal species, it remains unknown whether there may be intrinsic and/or innate host-specific factors that might act to inhibit live Omicron VOCs at an entry or post entry step. Furthermore, although we identified RBM substitutions in Omicron spike that conferred the ability to use mouse or horseshoe bat ACE2, we didn’t confirm ACE2 substitutions that permit or prevent Omicron spike binding. For instance, introducing K35E substitution in horseshoe bat ACE2 should permit Omicron variants’ usage. Finally, analysis of a limited number of serum samples and short follow up after the receipt of three doses of the Pfizer/BNT162b2 mRNA vaccine do not give us insights into the durability of the antibody response. While studies of antibody durability are ongoing, our findings indicate that three dose immunization with the Pfizer/BNT162b2 will likely contribute to protection from sever...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.06.01.494385
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.31.22274922

1
1. sciscore 05 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.31.22274922: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">We listed eligible cases in random order and aimed to include the first 500 cases, who had not been hospitalized or travelled outside of Denmark during the exposure period.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Statistical analyses and power calculation: The required sample size was calculated based on an expected bar visit frequency of 10% among controls [10].</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Methodological strengths and limitation outlined in our previous 2020-study also apply for the current study. Among the limitations of the first study was the small sample size, therefore we went from 600 to 1000 participants to strengthen the power of the present study. Compared to our first study, we also shortened the exposure period inquired about, aiming to provide more specific estimates of associations. The use of the Danish Vaccination Registry enabled us to swiftly and objectively exclude those who had been vaccinated by the time of the study. A potential bias would arise from systematic differences in behavior between cases and controls. Some persons who recently had been in close contact with a person with known infection, would likely have been in isolation and therefore not exposed in the community. Because we frequently found controls to be more exposed than cases (resulting in OR estimates below 1), we were suspicious of such a bias being at play. To explore this further, we performed a sensitivity analysis, in which we excluded all participants who reported to have been close contacts to infected persons. However, this did not change the results. Another potential concern relates to the selection of controls. We used matched controls sampled from the general population, which was made possible because of our access to the Danish Civil Registration System. A different possibility, which we did not opt for, would have been control selection with recruitment from...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.31.22274922
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.06.02.494502

1
1. sciscore 05 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.06.02.494502: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All the experimental protocols were approved by Institutional Animal Care and Use Committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Immunization experiments: Adult (6 to 8 weeks old) females Balb/c mice (inbred, H-2d) were housed at Beijing Vital River Laboratory Animal Technology Co</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Samples (three or five mice per group) were processed individualized, with the exception of the control groups (Placebos) which were processed as pooled samples of three randomly selected mice.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Assessment of cellular immune response by IFN-γ ELISPOT: IFN-γ ELISPOT assay was performed using a Mouse IFN-γ ELISpot antibody pair (Mabtech, Sweden).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IFN-γ</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunization experiments: Adult (6 to 8 weeks old) females Balb/c mice (inbred, H-2d) were housed at Beijing Vital River Laboratory Animal Technology Co</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Balb/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: For statistical analyses the GraphPad Prism version 5.00 statistical software (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.06.02.494502
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.06.01.22275674

1
1. sciscore 05 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.06.01.22275674: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study measures: We pragmatically grouped activity and selected clinical codes relevant to each of the following topics: Cardiovascular disease, Diabetes, Mental health, Female and reproductive health, Screening and related procedures, and Processes related to medication.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Software and reproducibility: Data management and analysis were performed using Python 3.8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Strengths and weaknesses: The key strengths are the scale and completeness of the underlying raw EHR data, available close to real time, and we engaged with clinicians for added context. All processed data and analytical code is openly available in the Supplementary Materials or Github. We will publish our recommended key measures in a live updating report, and we encourage other groups to use OpenSafely for further exploration. Our data-driven approach is intended to generate an overall picture of primary care clinical activity, and explore high volume areas that might otherwise be missed, for example when not included in manually curated codelists. Despite the strengths we recognise some limitations as previously discussed.11 Our data-driven approach and filtering processes may have omitted some relevant codes; codes do not necessarily indicate unique or new events, and may be affected by changes in coding behaviour. All coded activity for patients registered at the end of the study period were included, and all activity was included under their latest practice. Patients who died or deregistered from TPP practices during the study period were not included. Overall, activity counts were up to 6-8% lower than database totals in the earliest months of the study period. Interpretation and context for each clinical area: Given the diversity of clinical areas covered by this overarching analysis, the clinical advisory group evaluated and interpreted the variation for each clinica...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.06.01.22275674
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.06.01.22275889

1
1. sciscore 04 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.06.01.22275889: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.06.01.22275889
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.06.02.22275894

1
1. sciscore 04 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.06.02.22275894: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the enzyme-linked immunosorbent assays (ELISA) for the detection of IgG antibodies against the S1 domain of the SARS-CoV-2 spike (S) protein in serum (Anti-SARS-CoV-2-ELISA (IgG)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2-ELISA (IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">y) detecting human immunoglobulins, including IgG, IgA and IgM against the spike receptor binding (RBD) domain protein, samples with ≥ 264 U/ml were considered to be positive as recommended by Caillard et al.8,9 Any non-zero antibody level below this cutoff was considered low positive (with limit of detection being 0.4 U/mL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgM against the spike receptor binding (RBD) domain protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Outcome and Predictors: The single outcome variable was a positive serological response defined by the maximum anti-SARS-CoV-2 spike (S) IgG or antibody level after a minimum of 14 days following the date of vaccination and before any further immunization event such as SARS-CoV-2 infection, passive or active immunization.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 spike (S) IgG</div><div>suggested: (Leinco Technologies Cat# S540, RRID:AB_2831778)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generally, IgG or antibody positivity was determined based on local laboratory’s pre-defined positivity cutoff, which was mostly the one provided by the manufacturer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For each validation set, we excluded vaccinations with missing SARS-CoV-2 IgG data, missing information about the SARS-CoV-2 spike IgG or antibody assay used, missing medication data, or missing eGFR, lymphocyte count, or hemoglobin level.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 spike IgG</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.06.02.22275894
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.06.02.22275895

1
1. sciscore 04 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.06.02.22275895: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study has some limitations. First, the external test set was sourced from a single institution. It is critical to test the AI algorithm across multiple datasets distributed across geographical regions to ensure that the model’s results are generalizable across cohorts and geographies. Second, we utilized RT-PCR as the gold standard for the diagnosis of COVID-19 infections. However, RT-PCR has a limited sensitivity of approximately 71%, so there may be cases where the person is COVID-19 positive on chest radiographs but negative on RT-PCR results. Third, our study does not incorporate clinical parameters and does not attempt at categorising patients based on COVID-19 severity scores. We avoided providing COVID-19 scores based on chest radiographs as unlike chest CT scans, there is often interobserver disagreement on the extent of lung involvement in radiography for reasons encompassing different acquisition protocols, image quality, and radiologist opinion. The development of an AI system based on the consensus scoring of a few radiologists from an isolated geographical location may not represent the consensus of radiologists globally. However, some researchers did attempt to build such a system, like the one developed by Borghesi & Maroldi (22) on a small dataset of 100 patients. Attempts were also made by Monaco et al. (23) with the dataset of 295 patients and Orsi et al. (24) with the dataset of 155 patients to produce scoring systems for chest radiographs and link them...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.06.02.22275895
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.31.22275835

1
1. sciscore 04 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.31.22275835: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We considered 26 mutually-exclusive categories that deaths could be assigned to: the 5 current and former variants of concern (Alpha, Beta, Gamma, Delta, and Omicron), 19 other variants and lineages which have been recognized by the WHO and detected in the U.S. (A.23.1, A.27, A.28, B.1.1.318, B.1.1.519, B.1.214.2, B.1.617.3, B.1.620, B.1.640, C.16, C.36, Epsilon, Eta, Iota, Kappa, Lambda, Mu, Theta, or Zeta), a composite group of the early non-VOI/VOC/VBM virus lineages, which we will refer to as “non-variant”, and “unknown” (deaths for which the week of occurrence is suppressed).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Zeta</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  In general, reported deaths represent an undercount of total COVID-19 deaths, given limitations in testing and data.46 In addition, there is considerable uncertainty associated with some state variant proportions due to insufficient sequencing. Our model also uses variant proportion figures based on clinical testing which may lag behind actual variant circulation. For example, wastewater surveillance suggests that Omicron was circulating in the country before the first case was reported.47 This would also lead to underestimates of deaths caused by variants. Finally, we do not model disease transmission dynamics so our estimates should not be interpreted as the number of deaths that would have been prevented if novel variants did not emerge. Even in the absence of new variants, the non-variant SARS-CoV-2 would have continued to spread, resulting in additional deaths. SARS-CoV-2 variants detected around the world have imposed a significant mortality burden in the U.S. In addition to national public health strategies, greater efforts are needed to reduce the risk of new variants emerging globally. However, U.S. government officials have warned that they are running out of COVID-19 funds.48 Congressional lawmakers recently excluded $5 billion in funding for global treatment and vaccination campaigns from a new spending proposal, and there has been limited investment in next-generation vaccines that may offer greater protection against transmission.49, 50 Our analysis shows the si...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.31.22275835
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.06.01.494461

1
1. sciscore 04 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.06.01.494461: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: All virological studies were conducted under BSL3 conditions, and personnel wore appropriate personal protective gear.<br>IACUC: Mouse studies and in vivo infections: Mouse studies were performed at the University of North Carolina (Animal Welfare Assurance #A3410-01) using protocols approved by the UNC Institutional Animal Care and Use Committee (IACUC).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">First, F1 mice between CC011 and CC074 were generated by cross males and females in both directions, and then the F2 mice were bred in all 4 possible F1 x F1 combinations, to ensure appropriately balanced sex Chromosome and parent-of-origin effects.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">F2 mice (226 males, 177 females) were weaned such that littermates were randomized to different experimental cages to reduce litter- or batch-effects on the study, and mice were transferred at 5-6 weeks of age to the laboratory for infection between 9-12 weeks of age.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">For Matute-Bello scoring samples were blinded and three random fields of lung tissue were chosen and scored for the following: (A) neutrophils in alveolar space (none = 0, 1–5 cells = 1, > 5 cells = 2), (B) neutrophils in interstitial space (none = 0, 1–5 cells = 1, > 5 cells = 2), (C) hyaline membranes (none = 0, one membrane = 1, > 1 membrane = 2), (D) Proteinaceous debris in air spaces (none = 0, one instance = 1, > 1 instance = 2), (E) alveolar septal thickening (< 2Å∼ mock thickness = 0, 2–4Å∼ mock thickness = 1, > 4Å∼ mock thickness = 2).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were incubated with antibodies against the following markers: efluor506 Viability Dye (Thermo Fisher, 65-0866-14), BUV395 anti-CD45 (Clone 30-F11, BD Biosciences), BV711</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD45</div><div>suggested: (BD Biosciences Cat# 740725, RRID:AB_2740403)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For virus titration, the caudal lobe of the right lung was homogenized in PBS, resulting homogenate was serial-diluted and inoculated onto confluent monolayers of Vero E6 cells (ATCC CCL-81), followed by agarose overlay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For studies in genetically defined knockout mice, 15-week old CCR9-/- mice (strain 027041), 15-week old CXCR6-/- mice (strain 005693) 15-week old female C57BL/6NJ mice (strain 005304), and 15-week old C57BL/6J (strain 000664) were purchased from Jackson Laboratory, and the genotype of these mutant mice were confirmed via genotyping on the MiniMUGA array (Neogen, Inc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CCR9-/-</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CXCR6-/-</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>C57BL/6NJ</div><div>suggested: RRID:IMSR_JAX:005304)</div></div><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: RRID:IMSR_JAX:000664)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CXCR6-/-, CCR9-/-, and appropriate C57BL/6 control mice were inoculated intranasally with 1×105 PFU of either SARS-CoV MA15, SARS-CoV-2 MA10, or HKU3-SRBD MA in 50 μl of PBS. Body weight, mortality, and pulmonary function by whole body plethysmography (56) were monitored daily as indicated.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were incubated with antibodies against the following markers: efluor506 Viability Dye (Thermo Fisher, 65-0866-14), BUV395 anti-CD45 (Clone 30-F11, BD Biosciences), BV711</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Biosciences</div><div>suggested: (BD Biosciences, RRID:SCR_013311)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were acquired on a flow cytometer (BD-X20; BD Biosciences) and analyzed using FlowJo software (Tree Star) (Figure S5).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.06.01.494461
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.25.22275564

1
1. sciscore 04 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.25.22275564: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The trial was approved by the ethics committee of Changzheng Hospital, and the patients signed informed consent forms on admission and agreed to anonymously authorize their clinical data for academic use.<br>Consent: The trial was approved by the ethics committee of Changzheng Hospital, and the patients signed informed consent forms on admission and agreed to anonymously authorize their clinical data for academic use.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Sample types based on source: A total of 213 patients (all male, age: 22.4±3.2 years) with COVID-19 who were admitted to a designated hospital in Shanghai on April 11, 2022 were included.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical methods: Using SPSS 26.0 (IBM) software and a four-grid table, the Kappa coefficient was used to measure the agreement between the interpretation methods using different sample types, which were evaluated using the concordance rate and the Kappa coefficient.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  However, there are still some limitations in this study. First, a cut-off Ct value of 35 was adopted, however, some cellular experiments have now confirmed that an excreted viral load in the environment with Ct values of less than 35 does not result in effective infection. The relationship between a Ct value of 35 and infectivity needs to be supported by more genuine clinical data. Second, although all patients enrolled in this study had asymptomatic infections and mild disease, the inconsistent test results between sputum sample and pharyngeal swab cannot be ruled out as being partially related to differences in patient disease status and distribution of the virus. Third, sputum samples are relatively more accurate in the determination of Ct values, but they are obtained by induced nebulization. Whether nebulization represents the normal state of virus excretion and its relationship with infectivity needs to be further investigated. Nevertheless, the large sample of cases with the same exposure period and similar clinical characteristics and the analysis of multiple synchronous triple-sample collections of pharyngeal swabs, sputum samples, and anal swabs showed that the combined sputum sample detection has an important role in determining the criteria for release from quarantine.
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.25.22275564
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.31.22275010

1
1. sciscore 04 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.31.22275010: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study protocol was approved by each hospital’s Ethical Review committee and conducted according to the Declaration of Helsinki and Council for International Organizations of Medical Sciences International ethical guidelines and ICH GCP guidelines.<br>IACUC: The study protocol was approved by each hospital’s Ethical Review committee and conducted according to the Declaration of Helsinki and Council for International Organizations of Medical Sciences International ethical guidelines and ICH GCP guidelines.<br>Consent: Participants supplied written informed consent at enrolment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Selection was to be based on the safety and immunogenicity, and potential impact on supply of the chosen formulation, i.e. dose-sparing. Participants: Eligible participants were male or female adults, ≥ 18 years of age who had previously received two doses of ChAdOx1-S1-S vaccine 6 months (± 4 weeks) before enrolment and were willing and able to comply with study requirements, including all scheduled visits, vaccinations, laboratory tests, and other study procedures.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">This phase 2 randomized, controlled, observer-blinded, multi-center study is ongoing at three sites in Brazil: Hospital de Clínicas de Porto Alegre, Hospital Gloria D’or, Rio de Janeiro and Centro de Estudos e Pesquisa em Moléstias Infecciosas (CEPCLIN), Natal.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The primary immunogenicity endpoint was ELISA antibody titers against SCB-2019 S-protein expressed as geometric mean titers (GMT), geometric mean-fold rise in titers over baseline (GMFR) and seroconversion rates (SCR) on Days 15 and 29 in all participants who received the correct vaccination and had no major protocol deviation reported or suffered a COVID-19 infection prior to blood draw.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SCB-2019 S-protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GMTs of neutralizing antibodies against prototype strain ELISA GMTs against SCB-2019 S-protein are presented in IU/mL, GMTs of neutralizing antibodies against variants and ACE2 are expressed in reciprocal units.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This is a small study with several limitations as a consequence, but the trends are confirmation of other observations. Several studies have shown that heterologous booster vaccination can heighten and broaden the immune response compared with homologous booster doses [17–19]. We restricted this study to one priming vaccine, ChAdOx1-S, but results need to be confirmed with other vaccines, particularly mRNA and inactivated vaccines. We only assessed the immune responses out to four weeks after the booster vaccination, and persistence of any improved immune responses following the heterologous and homologous boosters will have to be assessed. Finally, we did not assess the efficacy of the booster immunization; although there were several cases of COVID-19 reported in this small study population it was not designed to include an efficacy assessment which would also require a placebo group. Notably, none of these cases were severe and there were no hospitalizations due to COVID-19. In conclusion, the formulation of 30 μg SCB-2019 adjuvanted with CpG-1018 and alum is safe and well tolerated and as a heterologous booster vaccine in those previously primed with ChAdOx1-S and is immunologically more effective than that same vaccine given as a homologous booster.
  
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT05087368</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Not yet recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Immunogenicity and Safety of Heterologous and Homologous Boo…</td></tr></table>
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.31.22275010
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.06.01.22275878

1
1. sciscore 04 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.06.01.22275878: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We created data visualizations in R and Adobe Illustrator CS6.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Adobe Illustrator</div><div>suggested: (Adobe Illustrator, RRID:SCR_010279)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.06.01.22275878
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.06.01.22275775

1
1. sciscore 04 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.06.01.22275775: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: In the UK, the study was approved by the ethics committee of the London School of Hygiene and Tropical Medicine (Reference number: 21795).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study participants: In this analysis, we included pregnant women (self-identified) aged 18-49 years, and non-pregnant women and men of the same age who reported to have no risk factors for serious symptoms if they contracted COVID-19.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: Thank you for sharing your code and data.
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  The findings presented in this study should be interpreted with several limitations in mind. First, more than half of our data came from the UK which may have obscured patterns from other countries. Relatedly, for the analysis of COVID-19 vaccination in countries other than the UK, we grouped 18 countries together due to data availability. This approach neglected variations in vaccination schedules and the evolution of vaccine policies on pregnancy in individual countries. Both risk perceptions to COVID-19 and vaccine hesitancy also likely differ across countries and change over time. Future research is highly warranted as more data become available. Second, we did not collect data on gravidity and gestational age from pregnant women, which likely have important relationships with perceived need of social support and vaccine acceptance. Future studies should explore factors associated with subgroups of pregnant women requiring particular attention. Third, pregnant and non-pregnant individuals may have interpreted the questions on isolation and quarantine due to COVID-19 differently. Terminologies such as “isolation”, “quarantine” and “social distancing” are distinctively different yet somewhat similar notions that might be misinterpreted, especially for high-risk people who have been given stricter guidelines to maintain social distancing as a form of preventive measure. Our finding on isolation and quarantine might have over-estimated the proportion of pregnant women who wer...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.06.01.22275775
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.06.02.22275901

1
1. sciscore 04 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.06.02.22275901: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">The included numbers of SNPs with F-statistics and explained variance of the iron biomarkers is presented for all and separately for men and women, in Supplemental Table S1.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">MR Egger allows directional pleiotropic effects where some SNPs could be acting on the outcome through another pathway than the exposure of interest, but at the cost of statistical power (34).</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Independence between SNPs were ensured by using the LD-reference panel of European populations in 10,000 kb windows and R2 < 0.01 that is included in the TwoSampleMR (version 0.5.6) package in R (25), and we adjusted for correlation between SNPs using MendelianRandomization (version 0.6.0) in R (version 4.2.1) (26)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MendelianRandomization</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We estimated R2 in the TwoSampleMR package and calculated F-statistics using the formula F= ([n-k-1]/k)([ R2/1-R2]) (24).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TwoSampleMR</div><div>suggested: (TwoSampleMR, RRID:SCR_019010)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This is discordant to our MR results where higher genetically-predicted iron status is related to increased risk of sepsis and being hospitalized due to COVID-19, and could be attributed to differences in the epidemiological methods applied, such as residual confounding, but also limitations with the two-sample MR method used that is restricted to assess linear models (37). Few MR studies have explored iron status and risk of severe infections. An MR-study using iron related SNPs identified in the Genetics of Iron Status-consortia (38) found evidence that higher serum-iron, TSAT and ferritin were related to increased risk of sepsis (21). Using a more updated set of genetic instruments for iron status biomarkers, we replicated these findings for serum iron and TSAT, a tendency for TIBC, but not for ferritin. Another MR study found evidence of increased risk of skin and soft-tissue infections with higher serum iron levels (39). To the best of our knowledge, no previous study has conducted MR analysis to investigate the effect of iron status on incidence or outcome of COVID-19. Observational studies that have investigated iron status at the time of infection and found evidence of low iron status being a risk factor for a severe course of COVID-19 (12). Another study with COVID-19 patients compared to non-COVID-19 patients showed lower serum iron and TSAT levels in patients with COVID-19 independently of severity. Whereas COVID-19 patients defined as severe and critical had subst...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.06.02.22275901
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.06.01.494373

1
1. sciscore 04 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.06.01.494373: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">High-density peptide array (HDPA): To analyze the antibody responses to SARS-CoV-2 at the epitope level we used a recently developed high-density peptide array (HDPA), the PEPperCHIP® Microarray (PEPperPRINT GmbH, Germany), covering the proteome of the SARS-CoV-2 isolate Wuhan-Hu-1 as well as the four seasonal hCoVs OC43, HKU1, NL63 and 229E (see Table S12 for accession numbers used).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HKU1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Microarrays were then washed (three times with PBS-T for 1 minute) and peptide binding was detected with isotype-specific secondary goat anti-human IgG (Fc) DyLight680 (ThermoFisher Scientific) and goat anti-human IgA (alpha chain) DyLight800 (Rockland Immunochemicals) antibodies at a final concentration of 0.1 μg/ml and 1 μg/ml, respectively (in 10% RL/PBS-T for 45 minutes at room temperature).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Rockland Cat# 609-145-130, RRID:AB_2614820)</div></div><div style="margin-bottom:8px"><div>anti-human IgA</div><div>suggested: (Rockland Cat# 609-145-130, RRID:AB_2614820)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To identify the top IgG and IgA antibody responses of the human serum samples, the averaged intensity values were sorted by decreasing spot intensities.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Using ImageJ software the resulting 32-bit gray-scale TIFF files were converted into 16-bit gray-scale TIFF files and then further analyzed using the PepSlide® Analyzer (SICASYS</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pymol was used for visualization.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pymol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code.
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Sensitivity limitations of PhIP-seq to broadly detected polio epitopes have been previously reported (20, 22) and might contribute to the observed differences, similarly affecting detectability of CoV antigens. Such limitations are not observed in our HDPA approach (44) which typically yielded strong polio responsiveness in over 90% of sampled individuals (45). Importantly, the cross-reactivity in identified B cell epitope sites positively relates to previous infections with seasonal common cold hCoVs. This suggests that immune memory conferred by previous seasonal hCoV infections positively influences SARS-CoV-2-specific antibody responses and may explain the large portion of SARS-CoV-2-infected individuals with mild and asymptomatic disease symptoms (4). Notably, there was little to no correlation between cross-reactivity and immune response in COVID-19 negative patients, suggesting that resistance to infection is not easily explained by cross reactivity. However, this molecular cross-reactivity can pose important complications in serological tests, particularly when studying asymptomatic patients. Cross-reactivity in immunodominant epitopes can be molecular determinants of strong immunity in individuals and therefore may serve as the basis for future pan-coronavirus vaccine design strategies. In turn, mutations in these cross-reactive epitopes can potentially breach pre-existing immune protection conferred by previous viral exposures, contributing to viral evolution, immun...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.06.01.494373
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.31.22275831

1
1. sciscore 04 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.31.22275831: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: Thank you for sharing your code and data.
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.31.22275831
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.31.22274501

1
1. sciscore 03 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.31.22274501: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the National Health Institute Ethics Committee (CEMIN-4-2021), and all participants signed the informed consent.<br>Consent: The study was approved by the National Health Institute Ethics Committee (CEMIN-4-2021), and all participants signed the informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.31.22274501
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.06.01.494101

1
1. sciscore 03 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.06.01.494101: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein samples were resolved by SDS polyacrylamide gel electrophoresis and transferred onto a nitrocellulose membrane using Trans-Blot Turbo Transfer System (Bio-Rad, Hercules, CA), followed by blocking for 1 h with 5% nonfat milk in Tris-buffered saline-Tween 20 buffer and probing with antibodies against Strep Tag (SAB2702215, Sigma-Aldrich), γ-catenin (sc-514115, Santa Cruz Biotechnology) and GAPDH (A00084, GenScript) (Supplementary Table 6).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>γ-catenin</div><div>suggested: (Immunological Sciences Cat# AB-90215, RRID:AB_2892157)</div></div><div style="margin-bottom:8px"><div>sc-514115, Santa Cruz Biotechnology</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GAPDH</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The washed membranes were incubated with secondary antibody StarBright Blue 700 Goat anti-mouse IgG (Bio-rad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Coverslips were washed three times with PBS before secondary anti-mouse antibodies incubation (1:1000 dilution).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For staining, cells were resuspended in PBS 0.1% BSA 0.01% NaN3 containing the monoclonal antibody PE mouse anti-human CD54 (BD Pharmingen) or its isotype control at a concentration of 1/500.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human CD54</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The primary anti-ZO-1 antibody (ref. 61-7300, Invitrogen) was diluted at 1:100 in PBS containing 1% BSA and incubated for 3 h at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ZO-1</div><div>suggested: (Innovative Research Cat# 61-7300, RRID:AB_138452)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The secondary antibody (anti-rabbit IgG-FITC, ref. 9887, Sigma) was diluted 1:200 in PBS and incubated for 1 h at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (Sigma-Aldrich Cat# F9887, RRID:AB_259816)</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG-FITC</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, VSV-G pseudotyped ORF7a or ORF7b lentivirus was produced by co-transfection of HEK293T cells with the pLVX-ORF7a or pLVX-ORF7b plasmids, pCMV-Gag-Pol and pCMV-VSV-G using Lipofectamine 2000 Reagent (Thermo Fisher Scientific) as per manufacturer instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RNA isolation and sequencing: WT A549, A549-ORF7a and A549-ORF7b cells were seeded (3×10E5) in 6-well plates and lysed using RLT buffer for RNA isolation (RNeasy mini kit, Qiagen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-ORF7b</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 24 h incubation, A549 cells were labeled with calcein-AM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentivirus production, cell culture and transduction: ORF7a or ORF7b coding sequences (codon-optimized for mammalian expression) were cloned into pLVX-EF1α-IRES-Puro Cloning and Expression Lentivector (System Biosciences) to generate pseudotyped lentiviral particles encoding the ORF7a or ORF7b accessory proteins of SARS-CoV-2 (Wuhan-Hu-1 isolate) at the CNIC (Centro Nacional de Investigaciones Cardiovasculares) Viral Vector Unit (ViVU).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLVX-EF1α-IRES-Puro</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, VSV-G pseudotyped ORF7a or ORF7b lentivirus was produced by co-transfection of HEK293T cells with the pLVX-ORF7a or pLVX-ORF7b plasmids, pCMV-Gag-Pol and pCMV-VSV-G using Lipofectamine 2000 Reagent (Thermo Fisher Scientific) as per manufacturer instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLVX-ORF7a</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pLVX-ORF7b</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCMV-Gag-Pol</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCMV-VSV-G</div><div>suggested: RRID:Addgene_8454)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Raw counts were transformed with the vst function in the DESeq2 package (Love et al., 2014) of the R software version 3.6.3 (R Core Team, 2020), and subsequent PCA was performed with the prcomp function.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Finally, the PCA graph was made with Graphad Prism software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphad Prism</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All sequencing data sets are available in the NCBI BioProject database under accession number PRJNA841835.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioProject</div><div>suggested: (NCBI BioProject, RRID:SCR_004801)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Enrichment analyses were carried out by selecting the genomics sources: KEGG Pathway, GO Biological Processes, Reactome Gene Sets, Canonical Pathways, and CORUM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GO Biological</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Relative expression results were calculated using GenEx6 Pro software (MultiD-Göteborg, Sweden), based on the Cq values obtained.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GenEx6 Pro</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For these experiments, a CytoFLEX flow cytometer (Beckman Coulter) was used and data was analyzed using FlowJo v10 (BD Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.06.01.494101
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.31.494262

1
1. sciscore 03 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.31.494262: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, E2 conjugating enzyme UBC9, and E3 ligase PIAS1 were all cloned into pET28B vector for expression in BL21(DE3) cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET28B</div><div>suggested: RRID:Addgene_73018)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Final Gibson reaction of bacterial expression pET28B vector SALI and NOTI and for mammalian expression pCDNA3.1-FLAGtag-Nprotein- YPet were created.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA3.1-FLAGtag-Nprotein-</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tabulated PCR primers are shown in Table 3 for pcDNA3.1. In-Vitro SUMOylation with qFRET Reporter for N Protein Mutants: The in-vitro SUMOylation assay of SARS-CoV-2 N protein mutants is an initial screening to determine impact of lysine sites on SUMOylation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Thus, five pairs of N protein genes, the wild type, Lys mutations on individual 61, 65, 347, and 355, were cloned into pET-28(b</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-28</div><div>suggested: RRID:Addgene_141289)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">raw) raw data was analyzed on Thermofisher Proteome AnalyzerTM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermofisher Proteome</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were imaged on Olympus BX43, and images were stacked and analyzed using ImageJ software. qFRET KD of SUMOylated N Protein: The evaluation of N protein oligomerization by in vitro qFRET based KD affinity assay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.31.494262
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.31.494211

1
1. sciscore 03 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.31.494211: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Infection of BALB/c and hACE2/k18 Mice: All animals were cared for according to the standards set forth by the Institutional Animal Care and Use Committee at the University of Maryland-Baltimore.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">H/E Staining of Lungs and Pathological Scoring: Lungs were scored in a blinded fashion with a 0-5 score given, 0 being no inflammation and 5 being the highest degree of inflammation.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus Reconstitution: 24 hours prior to transfection, 5e4 VeroE6 cells (ATCC,Manassas, VA) were plated per well in 1mL of VeroE6 media (DMEM (Quality Biological, Gaithersburg, MD), 10% FBS (Gibco, Waltham, MA), 1% Penicillin-Streptomycin (Gemini Bio Products, Sacramento, CA), 1% L-Glutamine (Gibco, Waltham, MA)).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infection of BALB/c and hACE2/k18 Mice: All animals were cared for according to the standards set forth by the Institutional Animal Care and Use Committee at the University of Maryland-Baltimore.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The K18-hACE2 mice were inoculated with 1e3 PFU of each virus in 50μL PBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To assemble DNA fragment clones, the TAR vectors were PCR amplified from pCC1BAC-his3 with KOD Xtreme Hot Start DNA polymerase (Millipore, Burlington, MA) using the construction primers (labeled “Con”, Table S1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCC1BAC-his3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">50 fmol of each amplicon and 15 fmol of YCpBAC vector were assembled using a standard Gibson assembly reaction (New England Biolabs, Ipswich, MA), transformed into E. coli DH10B competent cells (Thermo Fisher, Waltham, MA), and plated on LB medium with 12.5 mg/ml chloramphenicol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>YCpBAC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Full-length genome assembly: The TAR vector for assembly of the full-length genome was amplified from pCC1BAC-ura3 using primers ConCMVpR and ConBGHtermF with KOD Xtreme Hot Start DNA polymerase (Millipore, Burlington, MA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCC1BAC-ura3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus Reconstitution: 24 hours prior to transfection, 5e4 VeroE6 cells (ATCC,Manassas, VA) were plated per well in 1mL of VeroE6 media (DMEM (Quality Biological, Gaithersburg, MD), 10% FBS (Gibco, Waltham, MA), 1% Penicillin-Streptomycin (Gemini Bio Products, Sacramento, CA), 1% L-Glutamine (Gibco, Waltham, MA)).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Quality Biological</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were rocked every 15 minutes for 1 hour at 37°C prior to overlay with 2mL of a solid agarose overlay (EMEM (Quality Biological, Gaithersburg, MD), 10% FBS, 1% Penicillin-Streptomycin, 1% L-Glutamine, 0.4% w/v SeaKem agarose (Lonza Biosciences,Morrisville, NC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Lonza Biosciences</div><div>suggested: (Science Exchange, RRID:SCR_010620)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: All statistical analyses were carried out using the GraphPad Prism software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.31.494211
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.31.494147

1
1. sciscore 03 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.31.494147: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by and conducted according to requirements of the ethics committees at the Ludwig Maximilians University of Munich (20-1039).<br>IACUC: All experimental animal procedures were approved by the Institutional Animal Committee of the San Raffaele Scientific Institute and all infectious work was performed in designed BSL-3 workspaces.<br>Euthanasia Agents: After imaging the mice were euthanized by cervical dislocation.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Both male and female mice were used in this study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Platelet depleting antibodies (R300, anti-GPIbα) and isotype control (C301) were purchased from Emfret (Eibelstadt, Germany) and used according to the manufacturer’s protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-GPIbα</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>C301</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pDC depleting antibody (ultra-LEAFTM purified anti-PDCA-1, clone 927, BioLegend) was injected i.p. for 9 consecutive days with a concentration of 150 µg per mouse at day 1 and 100 µg per mouse the following days.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-PDCA-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To monitor pDC activation and IFN alpha production, the following primary antibodies were used: CD69 mouse anti-human (#MA5-15612 Thermo Fisher)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD69 mouse anti-human</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human</div><div>suggested: (Millipore Cat# 4700-0360, RRID:AB_11210063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies (1:200): donkey anti-rabbit-AF488, donkey anti-mouse-AF 555, and donkey anti-gost-AF647.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit-AF488</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse-AF</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-gost-AF647</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lineage-biotin antibodies (Ter-119, CD3e, CD45R, CD11b, Ly-6G,) and streptavidin-PE were used with dilution of 1:200, all antibodies were purchased from eBioscience (San Diego, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Lineage-biotin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD3e</div><div>suggested: (Thermo Fisher Scientific Cat# 88-7774-75, RRID:AB_476399)</div></div><div style="margin-bottom:8px"><div>CD45R</div><div>suggested: (Thermo Fisher Scientific Cat# 88-7774-75, RRID:AB_476399)</div></div><div style="margin-bottom:8px"><div>CD11b</div><div>suggested: (BD Biosciences Cat# 558074, RRID:AB_1645213)</div></div><div style="margin-bottom:8px"><div>Ly-6G , </div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following antibodies were used to identify MKs: 1:100 anti-mouse CD41-FITC+ and anti-mouse CD42d-APC+ (BioLegend); and MKPs: anti-mouse CD41-FITC+, Pacific blue lineage negative (Ter-119-, CD3e-, CD45R-, CD11b-, Ly-6G-)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse CD42d-APC+</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse CD41-FITC+</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Ter-119- , CD3e-</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Ly-6G-</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We identified pDCs using the following antibodies: anti-mouse SiglecH-FITC+, CD11b-PE-Cy7-, B220-APC+ from BioLegend (San Diego, USA) (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1:200). pDC activation: anti-mouse CD69-FITC, CD86-PE, CD11b-APC-Cy7, CD317-APC, SiglecH-PercCy5.5 antibodies all from BioLegend and Life/Dead marker (405 nm excitation; ThermoFisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse CD69-FITC</div><div>suggested: (SouthernBiotech Cat# 1715-02, RRID:AB_2795177)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IFN expression by pDCs: Following staining with pDC surface markers (see above), cells were fixed with PFA and methanol and stained with monoclonal anti-mouse p-IRF7 antibody (cellsignaling, clone D6M2I) in Perm buffer III (BD) as previously described31.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse p-IRF7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, cells were stained with surface marker antibodies (CD41, CD42) for 30 min RT in dark, followed by fixation for 15 min (4% PFA, provided in the kit) and permeabilization 15 min (saponin-based permeabilization and wash reagent, provided in the kit).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD41</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Materials: Mouse strains: C57BL/6J, PF4-Cre (C57BL/6-Tg(Pf4-icre)Q3Rsko/J)44, Rosa26-iDTRflox (C57BL/6Gt(ROSA)26Sortm1(HBEGF)Awai/J)45, IFNαR-/- (B6.129S2-Ifnar1tm1Agt/Mmjax)46, IFNαR1flox (B6(Cg)-Ifnar1tm1.1Ees/J)47 and BDCA2-DTR (C57BL/6-Tg(CLEC4C-HBEGF)956Cln/J)(referred to as pDC-DTR)48 mice were purchased from The Jackson Laboratory. vWF-Cre mice were generated by W.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>PF4-Cre</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>C57BL/6-Tg(Pf4-icre)Q3Rsko/J)44</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Rosa26-iDTRflox</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>C57BL/6Gt(ROSA)26Sortm1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>B6.129S2-Ifnar1tm1Agt/Mmjax)46, IFNαR1flox</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>C57BL/6-Tg(CLEC4C-HBEGF)956Cln/J)</div><div>suggested: RRID:IMSR_JAX:014176)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PF4-Cre were crossed with Rosa26-iDTR mice to induce megakaryocyte cell death in vivo (PF4-Cre; RS26-iDTR)18. PF4-Cre;RS26-iDTR were crossed with vWF-eGFP to visualize the megakaryocytic lineage following induction of MK cell death (referred to as MK-iDTR).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Rosa26-iDTR</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">vWF-Cre mice were crossed with IFNαR1floxto conditionally delete IFNaR in the megakaryocytic lineage. pDC-DTR and IFNαR-/- were cross bred to achieve pDC depletion in IFNaR-/- animals (pDC-DTR; IFNaR-/-).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>vWF-Cre</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Drug treatments: Diphtheria Toxin (DT) was purchased from Sigma-Aldrich (322326, Saint Louis, MO, USA) and was injected intraperitoneally into pDC-DTR- and pDC-DTR-IFNαR-/- mice with a dose of 8 ng/g per day for consecutive 3 days.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pDC-DTR-IFNαR-/-</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse model of SARS-CoV2 infection: B6.Cg-Tg(K18-ACE2)2Prlmn/J mice (on a C57BL/6 background) were purchased from The Jackson Laboratory and bred against FVB mice to obtain C57BL/6 x FVB F1 hybrids.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B6.Cg-Tg(K18-ACE2)2Prlmn/J</div><div>suggested: RRID:IMSR_JAX:034860)</div></div><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>FVB</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blood vessel were visualized by i.v. injection of Dextran Tetramethylrhodamine (TRITC-Dextran, 100µg in 100µl solution, ThermoFisher Scientific) or Dextran Cascade Blue 10.000 MW (D1976, ThermoFisher Scientific) before imaging. vWF-eGFP mice was used to visualize the megakaryocytic lineage; pDCs were labeled with SiglecH-PE antibody (eBioscience) injected intravenously 20 min before imaging (20 µl diluted with 100 µl NaCl).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>vWF-eGFP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">vWF-Cre mice were crossed with IFNαR1floxto conditionally delete IFNaR in the megakaryocytic lineage. pDC-DTR and IFNαR-/- were cross bred to achieve pDC depletion in IFNaR-/- animals (pDC-DTR; IFNaR-/-).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pDC-DTR</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Drug treatments: Diphtheria Toxin (DT) was purchased from Sigma-Aldrich (322326, Saint Louis, MO, USA) and was injected intraperitoneally into pDC-DTR- and pDC-DTR-IFNαR-/- mice with a dose of 8 ng/g per day for consecutive 3 days.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pDC-DTR-</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animals were bred and maintained in the animal facilities of the Walter-Brendel Zentrum, the Zentrum für Neuropathologie und</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Neuropathologie</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Labelling of MKs/MKPs: primary: CD41-FITC+ and CD42-purified hamster anti-mouse (BioLegend); secondary: goat anti-hamster Alexa Fluor 647 (Abcam) (1:100).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioLegend)</div><div>suggested: (BioLegend, RRID:SCR_001134)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were taken with step size of 2 µm, range in z-stack of 40 µm, and analyzed with Zen Blue software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Zen Blue</div><div>suggested: (ZEN Digital Imaging for Light Microscopy, RRID:SCR_013672)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell volumes of 3D rendered bone marrow stacks were measured automatically in Imaris.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Imaris</div><div>suggested: (Imaris, RRID:SCR_007370)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene set enrichment analysis (GSEA): To prepare the data for GSEA, DESeq2 analysis was performed using Galaxy and default parameters51, 52.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene set enrichment analysis</div><div>suggested: (Gene Set Enrichment Analysis, RRID:SCR_003199)</div></div><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For further analysis, the tool GSEA (version 4.0.3) of UC San Diego and Broad Institute was used53 and 54, referring to their RNASeq manual pages for analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GSEA</div><div>suggested: (SeqGSEA, RRID:SCR_005724)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: GraphPad Prism software (9.1.2, San Diego, USA) was used for all statistical analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Statistics: GraphPad Prism</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.31.494147
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.31.493843

1
1. sciscore 03 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.31.493843: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The same experiment was also done using RNA isolated from nasopharyngeal swabs of COVID-19 infected individuals following approvals by the Institutional Human Ethics Committee (IGIB) Cell culture: All inhibition experiments were carried out on African green monkey kidney cells (Vero CCL-81).<br>Euthanasia Agents: All the animals, except unchallenged control, were challenged with 105 PFU of SARS-CoV2 administered intranasally using a catheter while under anesthesia by using ketamine (150mg/kg) and xylazine (10mg/kg) intraperitoneal injection inside ABSL3 facility (Chan et al., 2020; Rizvi et al., 2021; Sia et al., 2020).<br>IACUC: All the experimental protocols involving the handling of virus culture and animal infection were approved by RCGM, institutional biosafety and IAEC animal ethics committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animals: 6-8 weeks old male golden Syrian hamsters were procured from CDRI and transported to small animal facility (SAF), THSTI and quarantined for 7 days.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">SARS-CoV2 infection in golden Syrian hamster and dosing: Golden Syrian hamsters were randomly allotted to different drug groups (n=4), challenge control (n=2), remdesivir control (n=2) and unchallenged control (n=2) were housed in separate cages.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly Vero cells were seeded in 12-well plate at 90% confluency.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus generation for animal experiments: SARS-Related Coronavirus 2, Isolate USA-WA1/2020 virus was grown and titrated in Vero E6 cell line cultured in Dulbecco’s Modified Eagle Medium (DMEM) complete media containing 4.5 g/L D-glucose, 100,000 U/L Penicillin-Streptomycin, 100 mg/L sodium pyruvate, 25mM HEPES and 2% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reverse transcription was done using reverse primers such that ORF1 pG4-1 or a non G4 forming control region gets reverse transcribed (primer sequences below).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pG4-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The efficiency of the reverse transcription reactions was measured by quantifying the generated cDNA by qPCR using primers overlapping the ORF1 pG4 or the non G4 forming control region (primer sequences below).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pG4</div><div>suggested: RRID:Addgene_162605)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The pre-treatment group viz pCPZ & pPCZ started receiving 8mg/kg and 5mg/kg (respectively) of the drug through intraperitoneal administration each day starting from 3 days prior to the challenge and continued till end point (day 4 post infection).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCPZ</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.31.493843
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.06.01.22275786

1
1. sciscore 03 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.06.01.22275786: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.06.01.22275786
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.31.493925

1
1. sciscore 03 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.31.493925: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reads were aligned to an extended Gencode Reference 30 (GRCh38) genome containing SARS-Cov2 genes (kindly provided by Aviv Regev and Carly Ziegler) using CellRanger version 5.0.1, available from 10x Genomics, with default parameters.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CellRanger</div><div>suggested: (SCIGA, RRID:SCR_021002)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene set enrichment analysis: To identify gene sets enriched in COVID donors, we selected the top DE genes for each cell type (COVID vs healthy) and used them as input for pathfindR (Ulgen, Ozisik, and Sezerman 2019), a gene-set enrichment algorithm that includes the fold-change along with potential interactions using a protein-protein interaction network.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene set enrichment analysis</div><div>suggested: (Gene Set Enrichment Analysis, RRID:SCR_003199)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used 4 different pathway databases as references for our analysis to be comprehensive, KEGG, Reactome, GO, and BioCarta.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioCarta</div><div>suggested: (BioCarta Pathways, RRID:SCR_006917)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code.
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.31.493925
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.31.22275746

1
1. sciscore 03 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.31.22275746: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Strengths and limitations: The study used well-established methods to obtain data and had excellent completion rates with the app. Self-report using visual analogue scales on a smartphone app gives participants control over the data they enter and reduces risks of bias when completing scales either at a later time or with a researcher [45]. Importantly, there was patient involvement in the design of the app and in the interpretation of the results. Analysis used a combination of idiographic (within individual) and nomothetic (between individuals) methods including state of the art graphical vector autoregression modelling [41, 46] . The main limitation is that the sample was largely white, female, middle-aged and well-educated. This reflects the opportunistic sample taken from an online panel of research volunteers promoted by peer-support groups, however this has been seen in other studies [8]. This also meant that additional clinical data obtained during routine or specialised care was not available to supplement the data generated in the study. Approximately one third of participants had their initial illness before the widespread availability of PCR testing for SARS-Cov-2 and another third reported that their PCR test had been negative. This raises the possibility that not all participants’ symptoms were sequelae of covid infection [47] however we were unable to test serology in this study nor check records for prior symptoms. Although the number of participants (N=74) wa...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.31.22275746
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.06.01.22275872

1
1. sciscore 03 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.06.01.22275872: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.06.01.22275872
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.06.01.22275858

1
1. sciscore 03 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.06.01.22275858: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This study also has some limitations. Despite the high test rate, we cannot rule out undetected reinfections, especially asymptomatic infections among vaccinated individuals, which might inflate the VE. We also cannot rule out that vaccinated and unvaccinated individuals had different health seeking behavior or risk behavior, which could affect VE. Additionally, from April 2021, a corona pass was introduced in Denmark and a valid corona pass gained by previous infection or vaccination, was required for a broad range of social activities, including restaurants, gyms etc.. This may have affected test activity differently for unvaccinated and vaccinated individuals. However, this was common practice during both the Delta and Omicron period and might therefore not play a role when considering VE in these periods. In summary, this study showed that among previously infected individuals who have completed a primary vaccination series, there is a significant VE against SARS-CoV-2 reinfection for the SARS-CoV- 2 variants Alpha, Delta and Omicron; lasting up to 9 months. Even though vaccination seems to protect to a lesser degree against reinfection with the Omicron variant, these findings are of public health relevance as they show that previously infected individuals still benefit from COVID-19 vaccination in all three variant periods.
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.06.01.22275858
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.31.494162

1
1. sciscore 03 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.31.494162: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the Institutional Review Board at Washington University in St. Louis (IRB number 202003085).<br>Consent: All patients who were enrolled in the study provided informed consent prior to participation. 2.<br>Field Sample Permit: Sample collection, processing, and microbial DNA sequencing: Saliva and nasopharyngeal swab samples were collected at the time of enrollment, which was during or shortly following evaluation at a medical facility.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequencing data processing: Amplicon sequence variants (ASVs) were inferred from de-muliplexed fastq files using the DADA2 R package (https://benjjneb.github.io/dada2/tutorial.html) (51) and taxonomy was assigned from de-muliplexed fastq files using the Ribosomal Database Project’s Training Set 16.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DADA2</div><div>suggested: (dadasnake, RRID:SCR_019149)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To perform differential abundance testing, we used the R Package DESeq2 (https://bioconductor.org/packages/release/bioc/html/DESeq2.html) (53) which uses a generalized regression model with a logarithmic link, following a negative binomial distribution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div><div style="margin-bottom:8px"><div>https://bioconductor.org/packages/release/bioc/html/DESeq2.html</div><div>suggested: (DESeq2, RRID:SCR_015687)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.31.494162
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.31.22275813

1
1. sciscore 03 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.31.22275813: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Initially, a random sample of 100 titles and abstracts were screened independently for eligibility by two reviewers to enable consistency in screening and identify areas for amendments in the inclusion criteria.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Search strategy and selection criteria: A systematic review was conducted to identify peer-reviewed articles published from the 1st January 2020 through 22nd April 2021 in Ovid Medline and EMBASE.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EMBASE</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Comparative economic analysis approach: All cost data were adjusted to a common currency (Euro in 2021) and price year, using the Campbell and Cochrane Economics Methods Group–Evidence for Policy and Practice Information and Coordinating Centre cost converter (13).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cochrane Economics</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Strengths and limitations: This review provides several strengths, including covering within one review both the economic burden of COVID-19 and the cost-effectiveness of the strategies and programs implemented to mitigate the pandemic. Moreover, this review followed a systematic approach to study identification, data extraction and quality apprasial with most of the included studies of good or high quality. Furthermore, this study used the Dominance Ranking Matrix approach, which summarised and interpreted the results of economic evaluation studies. On the other hand there are some limitations, as publication bias can not be excluded and as our search was performed up to the end of April 2021 it only reflects the cost-effectiveness of interventions assessed during the first waves of the pandemic with the majority of the populations unvaccinated, while most studies have a short duration on which modelling was performed. A further limitation is that most studies estimate costs and benefits based on a health care perspective, excluding wider societal effects, with a time horizon of 1 year. As we restricted our search to EU/UK/EEA/US and OECD countries, the studies primarily refer to high-income countries. Finally, as costs and resources varied between different countries, different pandemic settings and over time, and as indicated in this review, dependent on multiple other factors including population vaccination status, preexisting healthcare capacity and the infectivity of t...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.31.22275813
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.31.494153

1
1. sciscore 03 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.31.494153: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: Thank you for sharing your data.
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.31.494153
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.28.22275432

1
1. sciscore 03 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.28.22275432: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">It has a sewage network of 2500 km along with 9 sewage treatment plants (STPs) and 45 sewage pumping stations (SPSs).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSs</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.28.22275432
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.31.494170

1
1. sciscore 03 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.31.494170: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This information is not included in PPT-Ohmnet, hence, we used BioGRID and IntAct as the two largest PPI databases to extract the experimental procedures, such as “pull down”, “two hybrid”, by which the interactions were originally discovered.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioGRID</div><div>suggested: (BioGrid Australia, RRID:SCR_006334)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To train deep learning models we retrieved the sequences of all proteins in our PPIs from the UniProt database.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UniProt</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Collection of Human Receptor Proteins: To extract human receptor proteins, we first performed a search in GO for the term “receptor”.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Human Receptor Proteins</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.31.494170
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.31.22275814

1
1. sciscore 03 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.31.22275814: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">24 The test uses Luminex technology to detect IgG and IgA antibodies binding to the entire trimeric S protein of SARS-CoV-2 and with demonstrated 94.0% sensitivity and 99.2% specificity for testing of IgG. At T4, two different definitions of seroprevalence were considered: a) Seroprevalence in tested children without documented vaccination, or b) Seroprevalence in all tested children (including those reporting vaccination).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Bayesian approach allowed to account for the sensitivity and specificity of the SARS-CoV-2 antibody test and the hierarchical structure of cohort (individual and school levels).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This study also has limitations. Due to the nature of serological testing, exact timing of infections cannot be determined. Therefore, examination of associated infections, in the sense of outbreaks or temporal clusters of infections, is not possible. We used a highly accurate serological test and adjusted for inaccuracy using Bayesian models on a population level, but it is not possible to avoid some false positive or false negative results on an individual level. Additionally, there were likely vaccinated children and adolescents who were also infected, and therefore some underestimation of seroprevalence of the infected only cohort is. Including these children also as infected would increase the seroprevalence estimates due to infection rather than vaccination. Finally, despite the high participation rate, the use of venous blood sampling could have led to a selection bias.
  
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04448717</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">COVID-19: Longitudinal Study of Seroprevalence of SARS-CoV-2…</td></tr></table>
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.31.22275814
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.30.494036

1
1. sciscore 03 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.30.494036: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PDB: https://www.rcsb.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.rcsb.org/</div><div>suggested: (Research Collaboratory for Structural Bioinformatics Protein Data Bank (RCSB PDB, RRID:SCR_012820)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RNA sequencing datasets were obtained from NCBI Gene Expression Omnibus (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene Expression Omnibus</div><div>suggested: (Gene Expression Omnibus (GEO, RRID:SCR_005012)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(Domain Enhanced Lookup Time Accelerated BLAST: https://blast.ncbi.nlm.nih.gov/Blast.cgi).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://blast.ncbi.nlm.nih.gov/Blast.cgi</div><div>suggested: (TBLASTX, RRID:SCR_011823)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene Ontology analysis: Functional enrichment analysis was performed using the Gene Ontology (GO) database (http://geneontology.org) and ClusterProfiler R package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ClusterProfiler</div><div>suggested: (clusterProfiler, RRID:SCR_016884)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Digital gene expression lists were generated using edgeR package and “DEGList” function.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>edgeR</div><div>suggested: (edgeR, RRID:SCR_012802)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The biomaRt package were further used to match Ensembl gene IDs to official gene names extracted from hgu133plus2.db.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>biomaRt</div><div>suggested: (biomaRt, RRID:SCR_019214)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GSEA results were visualized with “gseaplot2” function of R software’s enrichplot package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GSEA</div><div>suggested: (SeqGSEA, RRID:SCR_005724)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.30.494036
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.30.22275783

1
1. sciscore 03 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.30.22275783: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence data preparation: To compile all available genomic data from the Philippines and fit the domestic isolates in the context of global virus transmission, all SARS-CoV-2 sequences and metadata were downloaded from GISAID on February 15th, 2022 (EpiCoV, https://www.gisaid.org).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.gisaid.org</div><div>suggested: (GISAID, RRID:SCR_018279)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A time-scaled phylogeny was inferred using BEAST v10.4 (Suchard et al. 2018) facilitated by the BEAGLE library v3.1 for better computational performance (Ayres et al. 2019).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BEAST</div><div>suggested: (BEAST, RRID:SCR_010228)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical correlation between locations of isolation and the phylogeny was detected by BaTS v0.9 with 1000 posterior trees subsampled from the MCMC process (Parker et al. 2008).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BaTS</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code.
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.30.22275783
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.31.22275827

1
1. sciscore 03 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.31.22275827: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Individuals infected with the Gamma variant were identified through genotyping by polymerase chain reaction (PCR) and WGS from the national COVID-19 Genomics UK Consortium (COG-UK) sequencing initiative (7) (8).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>WGS</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.31.22275827
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.31.22275802

1
1. sciscore 03 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.31.22275802: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used the resulting alignment to estimate an unrooted maximum-likelihood phylogeny using IQ-TREE v2.1.2 under a general time-reversible model with empirical base frequencies and assuming among-site rate heterogeneity by means of a discretized gamma distribution with four rate categories (GTR+F+G4).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IQ-TREE</div><div>suggested: (IQ-TREE, RRID:SCR_017254)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  However, we do acknowledge a limitation in our study in the form of suboptimal sampling in the North-East of Rwanda, which is mostly covered by the Akagera National Park and where the border to Uganda had been closed from February 2019 to January 2022. We can compare our own results to those of a recent study in Benin which focused on the emergence of the Delta lineage (Yadouleton et al., 2022). In Benin, Delta first appeared around May and became dominant by June 2021, similarly to what was observed in Rwanda and in some other neighbouring African countries (see Figure 6). Shortly after Delta became dominant (in August and September 2021), a spike in cases was observed, which is again similar to what was observed in our own study. A large COVID-19 wave around this time period was also observed in Malawi, Zambia, Kenya and Uganda. While Benin is far removed geographically from Rwanda, we also observe notable similarities when comparing the Rwandan lineage replacement patterns with those of Uganda, Rwanda’s neighboring country to the north. A recent Ugandan study using 266 naso-oropharyngeal samples collected during June-December 2021 shows the same pattern of replacement of A.23.1 by Delta, starting March 2021 and peaking in June 2021 (Bbosa et al., 2022). This similarity in patterns is not surprising as this was previously observed with A.23.1, when it became the dominant lineage in both countries by the end of 2020 (Figure 5, (Bugembe et al., 2021). Moreover, our previous s...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.31.22275802
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.26.22275611

1
1. sciscore 03 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.26.22275611: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics statement: The present study was performed in accordance with regulations guidelines and approved by institutional ethical review boards from Clementino Fraga Filho University Hospital and Marcílio Dias Naval Hospital Ethics Committees (protocol numbers 4.551.702, protocol ID 361-20 and 32382820.3.0000.5256 respectively), with written informed consents obtained from all participants or their legal representatives<br>Consent: Ethics statement: The present study was performed in accordance with regulations guidelines and approved by institutional ethical review boards from Clementino Fraga Filho University Hospital and Marcílio Dias Naval Hospital Ethics Committees (protocol numbers 4.551.702, protocol ID 361-20 and 32382820.3.0000.5256 respectively), with written informed consents obtained from all participants or their legal representatives</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">We received samples from 73 patients randomly chosen from the HMMD repository of COVID-19 severe cases (322 total cases), with at least two samples collected in different hospitalization days.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the wells of a 96-well microtiter plate (Greiner Bio-One, Austria) were coated overnight at 4 °C with anti-HMGB1 mouse monoclonal antibody (No H9537, Sigma-Aldrich, San Luis, MO) in PBS buffer (8.06 mM sodium phosphate, 1.94 mM potassium phosphate, 2.7 mM KCl, and 137 mM NaCl) at pH 7.4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HMGB1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, the wells were incubated with rabbit-produced anti-rHMGB1 polyclonal antibody diluted in PBS buffer for 1 h at 37 °C, and then incubated for 1 h at the same temperature with anti-IgG rabbit antibody conjugated to horseradish peroxidase (No W4011, Promega, Madison, WI).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rHMGB1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IgG</div><div>suggested: (Promega Cat# W4011, RRID:AB_430833)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Measurement of serum anti-SARS-CoV-2 antibodies: For quantitative analysis of anti-SARS-CoV-2 spike protein IgM and IgG antibodies, we performed the S-UFRJ test, as described previously (47).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>quantitative analysis of anti-SARS-CoV-2 spike protein IgM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG antibodies</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, the plate was washed with 150 μL of PBS (5x) and 50 μL of 1:10000 goat anti-human IgM and IgG (Fc)-horseradish peroxidase antibody (Sourthen Biotech, Birmingham, AL) were added, and the plate was incubated for 1.5 h at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>1:10000 goat anti-human IgM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG ( Fc)-horseradish peroxidase antibody ( Sourthen Biotech , Birmingham , AL )</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The bands corresponding to both proteins were quantified using Image J software (NIH, Bethesda, MD) and the ratio between tissue factor and transferrin was calculated.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Image J</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The optical density (OD) was read at 450 nm with 655 nm background compensation in a microplate reader (Bio-Rad Laboratories, Inc, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bio-Rad Laboratories</div><div>suggested: (Bio-Rad Laboratories, RRID:SCR_008426)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.26.22275611
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.30.22275753

1
1. sciscore 03 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.30.22275753: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics statement: The trial was reviewed and approved by the Research Ethics Committee of the Center for Disease Control and Prevention of Yunnan province.<br>Consent: Written informed consents were obtained from each participant before the screening.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Participants with a previous clinical or virologic COVID-19 diagnosis or SARS-CoV-2 infection or women with positive urine pregnancy test results were excluded from this study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study design: We conducted a randomized clinical trial involving 300 adults (≥18 years of age) who were tested negative by RT-PCR screening for COVID-19 at the time of participation to elucidate the immunogenicity and safety of an mRNA-based vaccine (AWcorna) as a booster compared to that of homologous booster using an inactivated viral vaccine (CoronaVac).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Since the different appearances of the two kinds of vaccines, inoculators could not keep in blind when vaccines had been used.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Sample size: The sample size was determined based on the hypothesis that the booster vaccination of mRNA vaccine following the two-dose inactivated vaccine regimen be non-inferior to that of the booster of inactivated vaccine in neutralizing antibody.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Randomization: Each participant was assigned a unique subject ID by authorized assigners successively according to a Prespecified allocation kit, which was generated by an independent randomization statistician from Beijing Key Tech Statistical Consulting Co., Ltd. via SAS software (SAS® Institute, Cary, North Carolina, USA) with the ratio of 2:1 to the AWcorna and CoronaVac groups.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Laboratory assays: The neutralizing antibodies in sera against the wild-type strain (GenBank: MT123291), Delta variant (IQTC-IM2175251), and Omicron variant (IQTC-Y216017) (Guangzhou Customs Technology Center, Guangzhou, China) were determined by using a cytopathic effect (CPE)-based microneutralization assay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IQTC-Y216017) (Guangzhou Customs Technology Center, Guangzhou, China)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The WHO reference (NIBSC code: 20/136) is equivalent to a live viral neutralizing antibody titer of 1:139 against wild-type SARS-CoV-2 and a titer of 1:213 against the Delta variant B.1.617.2, while the WHO reference (1,000 BAU/ml in serum) is equivalent to an RBD-specific IgG ELISA antibody titer of 1:5,490.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RBD-specific IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 cells were trypsinized and resuspended in Dulbecco’s Modified Eagle Medium (DMEM) containing 4% of fetal bovine serum and 1% of pen/strep at a concentration of 1.2×105 cells/ml and 100 μl of cells suspension were then added into the 96-well plates, followed by incubation at 37 °C, 5% CO2 for 4 days.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04847102</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Phase III Clinical Study of a SARS-CoV-2 Messenger Ribonuc…</td></tr></table>
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.30.22275753
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.30.22275050

1
1. sciscore 03 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.30.22275050: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This follow-up study was approved by the Institutional Review Board, Faculty of Medicine Siriraj Hospital, Mahidol University (COA: Si 833/2021, COA: Si 732/2021).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The Ct value of ≥30 was shown to correspond to 150 copies per milliliter or less, indicating low viral RNA.15 SEROLOGIC ASSAYS: Patients were randomly invited to test for anti-SARS-CoV-2 receptor binding domain immunoglobulin G (anti-SARS-CoV-2 RBD IgG).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A study protocol and guidelines for COVID-19 standard care was based on a standard recommendation of the National and World Health Organization (WHO) (Methods S1).7,14 PATIENT SELECTION AND PROCEDURES: A subset of 495 patients (age≥12 years) from the aforementioned patients were recruited for the reactogenicity and immunogenicity follow-up study after COVID-19 recovery at 21-150 days post COVID-19 onset to test for SARS-CoV-2 antibodies and a surrogate virus neutralization test (sVNT) against SARS-CoV-2 Wuhan and Delta variants (Method S1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A chemiluminescent microparticle immunoassay for qualitative detection of IgG against RBD of the SARS-CoV-2 spike protein and SARS-CoV-2 nucleocapsid protein (SARS-CoV-2 IgG II Quant for use with ARCHITECT; Abbott Laboratories, USA) were undertaken.7 Anti-SARS-CoV-2 RBD IgG assay was then converted to the WHO International Standard concentration as binding antibody unit (BAU) per milliliter.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 nucleocapsid protein (SARS-CoV-2 IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 RBD IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical significance of Ct values, IgG, and sVNT were determined by Kruskal-Wallis and Dunn’s multiple comparisons test by using GraphPad Prism 9 (GraphPad Software, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  There are several limitations to our study. We only have blood test from a small subset of hospitalized patients and assumed that these findings might be similar to all milder infected cases without hospitalization. At the time of analysis, we didn’t have serology data from patients during the Omicron pandemic and long term follow up data, so we could not determine the antibody levels against the Omicron variants and vaccine efficacy after the COVID-19 infection and its impact on the long COVID-19. Our future COVID-19 direction is to further gain insight into the long-term monitoring of neutralizing antibodies and to study if the breakthrough Omicron infection will have a protective immunity against reinfection of SARS-CoV-2 Omicron sub-lineages BA.4 and BA.5.
  
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT05328479</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Plasma Immunity of Mild SARS-CoV-2 Omicron and Delta Pandemi…</td></tr></table>
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.30.22275050
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.30.22275787

1
1. sciscore 03 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.30.22275787: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All computations were performed with Matlab R2021b (The Mathworks Inc., Natick MA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Matlab</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  There are many limitations in these calculations, in particular the uncertainties of many nt in the sequences. The Omicron sequences contained more uncertain nt than Delta which made estimation of the ORF domains particularly difficult for many of the groups, resulting in approximations in distances between sequences (and clones), and the inability to assess some of the mutational pathways over all ORF (S2 Fig). The Omicron sequences were only collected in some states for individuals whose treatment was dependent on knowledge of the variant, so the networks and resulting mutation rate estimates would have been impacted. However, to the best of our knowledge, this is the first method to provide a population level transmission network for any virus based solely on data, something that has only been possible due to the huge investment in viral sequencing throughout the COVID-19 pandemic. Contact tracing efforts have limited scalability in large outbreaks, while viral sequencing efforts are becoming more popular and more rapid. By using the method developed here, it may be possible to complement traditional contact tracing efforts for not only this virus, but for any infectious diseases where sequencing can be used to link cases. In conclusion, we provide a data driven model of SARS-CoV-2 transmission networks. We observed relatively high mutation and recombination, highlighting the need for ongoing vigilance and research into future escape variants. Further, the model itself may...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.30.22275787
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.30.493765

1
1. sciscore 03 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.30.493765: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: Thank you for sharing your data.
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  However, antibodies have several limitations as therapeutics for treating SARS-CoV-2: (a) antibody production requires sophisticated mammalian cell culture and is expensive with limited global manufacturing capacity; (b) IgG antibody requires subcutaneous or intravenous routes of administration that may be inconvenient or impractical for patients and care providers; (c) intravenously and subcutaneously administered antibodies have poor access to mucosal compartments with an estimated 50- to 100-fold lower antibody levels than in blood29-31, necessitating a high therapeutic dose; and (d) many current COVID-19 antibody therapeutics have a narrow neutralization spectrum and require cocktails to maintain efficacy toward newly emerged SARS-CoV-2 variants. The most recent Omicron variant was resistant to bamlanivimab, etesevimab and REGEN-COV (casirivimab and imdevimab)32-35. Through the use of the stringent K18-hACE2 mouse model of SARS-CoV-2 pathogenesis, we showed that intranasal administration of FSR16m on days 1 and 4 post-infection reduced viral burden and weight loss. As several other studies have demonstrated15,36-38, overexpression of hACE2 in these mice results in severe lung inflammation and disease upon infection with SARS-CoV-2. Therefore, the level of protection we observed by intranasal administration of FSR16m is significant. However, the current format of intranasal delivery likely is not directly translatable to humans. To increase the drug exposure, nasally admin...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.30.493765
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.29.22275262

1
1. sciscore 02 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.29.22275262: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  The use of secondary claims data brings both strengths and limitations that must be considered when interpreting our results. A major strength is the coverage of 85% of the Bavarian population, allowing the formation of a large and representative cohort with comparable control groups over a period of up to two years post-infection. However, the data are collected for billing purposes and are not subject to systematic audit. They are influenced by the treatment provided and the coding practices of the physician. A large proportion of patients with physician contact related COVID-19 have no record of a test result, and it is possible that those with confirmation of the test result had more severe symptoms during the acute infection that required treatment. This impacts somewhat on the generalisability of the results. Our results show however that the newly-introduced code for Post-COVID Syndrome has been used extensively by GPs and office-based physicians, with incidence in the expected range. In contrast, a study by the OpenSAFELY group found that the corresponding SNOMED-CT codes were used rarely by GPs in England [23]. A further strength of the use of routinely collected data is the ability to differentiate between pre-existing and new-onset conditions. This is especially important because some symptoms of Post-COVID Syndrome are common in the general population and may be mistaken for a post-infectious sequalae of COVID-19. However, the deterioration of a previously existin...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.29.22275262
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.29.493850

1
1. sciscore 02 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.29.493850: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibodies used were: PE-conjugated W6/32 (Serotec MCA81PE, 1:10) [11], anti-CD9-FITC (BD Pharmingen 555371, 1:40), anti-CD46-FITC (BD Pharmingen 555949, 1:20), anti-CD49b-PE (BD Pharmingen 555669, 1:20), anti-CD58-PE (BD Pharmingen 555921, 1:30), anti-CDw119-PE (BD Pharmingen 558934, 1:20).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD9-FITC (BD Pharmingen 555371</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The primary antibody used for Spike staining was human anti-SARS-CoV-2 Spike (1:682, REGN #10987), which was kindly provided by Wentao Li and Berend Jan Bosch (Utrecht University, Utrecht, The Netherlands).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The goat anti-human IgM+ IgG (H+L) (1:160, Jackson #109-116-127) antibody was used as secondary antibody Inhibition of proteasome and p97: For proteasome inhibition, we employed 20 μM MG132 (Sigma-Aldrich, Zwijndrecht, NL, C2211-5MG) and for p97 inhibition 4 μM CB-5083 (HY-12861; MCE) for 4h each.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>The goat anti-human IgM+ IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgM+ IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The primary antibodies used for immunoblotting were: HC10, monoclonal mouse anti-SARS-CoV-2 ORF7a (Genetex, 632602, 1:1000), polyclonal rabbit anti-SARS-CoV-2 ORF8a (Genetex, 135591, 1:1000), monoclonal transferrin receptor antibody (H68.4, Invitrogen, 1:1000) and monoclonal StrepII (C23.21, purified in our lab).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HC10</div><div>suggested: (Hidde L. Ploegh Cat# HC10, RRID:AB_2728622)</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 ORF7a (Genetex, 632602</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 ORF8a (Genetex, 135591</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies used were goat anti-mouse IgG-HRP (115-035-174, Jackson ImmunoResearch Europe Ltd, 1:10000) and mouse anti-rabbit IgG-HRP (211-032-171, Jackson ImmunoResearch Europe Ltd, 1:10000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG-HRP</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 115-035-174, RRID:AB_2338512)</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For StrepII IP 25 μl Streptactin Sepharose® High Performance beads (GE Healthcare, GE28-9355-99) and for HLA-I IP 25 μl Protein G Sepharose® 4 Fast Flow (GE Healthcare, GE17-0618-01) were employed with the HC10 antibody for HLA-IP overnight at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GE28-9355-99</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following antibodies were used: mouse anti-SARS-CoV-2 ORF7a (Genetex, 632602, 1:1000) and mouse anti-W6/32 (own production from hybridoma, 1:1000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-W6/32</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies used were goat anti-mouse IgG2a cross-adsorbed secondary antibody, Alexa Fluor 594 (Thermo Fisher, A-21135, 1:600) and goat anti-mouse IgG1 cross-adsorbed secondary antibody, Alexa Fluor 647 (Thermo Fisher, A-21240, 1:600), together with DAPI (Sigma-Aldrich, 1:1000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG2a</div><div>suggested: (Thermo Fisher Scientific Cat# A-21135, RRID:AB_2535774)</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines and viruses: HEK-293T and HK-1 cells were maintained in Roswell Park Memorial Institute medium (RPMI 1640; Life Technologies) supplemented with 5% FCS (Sigma), 2 mM L-glutamine, 100 U/mL penicillin, and 100 mg/mL streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HK-1</div><div>suggested: RRID:CVCL_7047)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The MelJuSo, Huh7 and A549-ACE2-TMPRSS2 cells were maintained in Dulbecco’s modified Eagle medium (DMEM; Life Technologies) supplemented with 5% FCS (Sigma), 2 mM L-glutamine, 100 U/mL penicillin, and 100 mg/mL streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All viruses were propagated and titrated on Vero E6 cells using the tissue culture infective dose 50 (TCID50) endpoint dilution method.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 infections: SARS-CoV-2 viruses (see section ‘cell lines and viruses’) propagated in Vero E6 cells were used to infect Vero E6 or A549-ACE2-TMPRSS2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-ACE2-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids: The plasmids of the SARS-CoV-2 cDNA library as cloned in the pLVX-EF1alpha-IRES-Puro (Takara/Clontech) vector were a kind gift from Prof. Nevan Krogan (University of California San Francisco, USA) [10].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLVX-EF1alpha-IRES-Puro</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines expressing NSP1 and NSP14 did not survive transduction and subsequent antibiotic selection and were, therefore, excluded from the analysis For follow-up studies, we cloned a T2A-mAmetrine cassette in frame downstream of the PuroR gene in the pLV-CMV-IRES-PuroR vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLV-CMV-IRES-PuroR</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the pLV-CMV-IRES-PuroR-T2A-mAmetrine vectors, lentiviruses were produced using standard lentiviral production protocols with third-generation packaging vectors.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLV-CMV-IRES-PuroR-T2A-mAmetrine</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were subjected to flow cytometry (BD FACS Canto II) and the data was analyzed with FlowJo (BD Biosciences) software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.29.493850
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.29.493871

1
1. sciscore 02 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.29.493871: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.29.493871
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.27.493795

1
1. sciscore 02 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.27.493795: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MRC-5 cells labeled with green fluorescent protein (MRC-5 GFP) were purchased from Lugen Sci Co., Ltd. (Bucheon, Korea).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MRC-5 GFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MRC-5 cells were maintained in minimum essential media (MEM) (HyClone Laboratories, Logan, UT) supplemented with 10% (v/v</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MRC-5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, freshly cultured MRC-5 or Hu7 cells (104 cells per well) were seeded in a 96-well plate (Corning) and incubated at 37 °C under 5% CO2 overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Hu7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate unsusceptible cells (U0), MRC-5 or Huh-7 was transfected with either aminopeptidase (APN) small interfering RNA (siRNA) oligonucleotide (sense: 5’-GCA GCA GAU CUG UAU AUU U-3’, antisense: 5’-AAA UAU ACA GAU CUG C-3’) or negative control siRNA from Bioneer Co. (Daejeon, Korea).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: CLS Cat# 300156/p7178_HuH7, RRID:CVCL_0336)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were processed using Image J (NIH, Bethesda,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Image J</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.27.493795
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.26.22275649

1
1. sciscore 01 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.26.22275649: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: Thank you for sharing your code and data.
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.26.22275649
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.29.22273082

1
1. sciscore 01 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.29.22273082: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.29.22273082
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.29.22275277

1
1. sciscore 01 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.29.22275277: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.29.22275277
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.27.22275630

1
1. sciscore 01 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.27.22275630: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the Johns Hopkins institutional review board.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2] Anti-spike serologic testing was performed prior to the Omicron wave (9/23/21-11/5/21), and categories of antibody titers were created based on reported associations with neutralization.[3-4] Participants completed a follow-up questionnaire (1/19/2022-2/7/2022) about COVID-19 test status and symptoms (since 12/1/2021): tested positive for COVID-19, suspected COVID-19 but never tested positive, or no suspected infection or positive test, and classified symptoms as severe, moderate, mild, or none.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-spike</div><div>suggested: (Imported from the IEDB Cat# S34, RRID:AB_2833227)</div></div><div style="margin-bottom:8px"><div>9/23/21-11/5/21</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Recently, reduced vaccine efficacy against Omicron has been described among 4x-vaccinated Israelis, and the additional protection of a 4th dose peaked four weeks post-fourth dose and waned in later weeks.[4-5] Our results add valuable information to the discussion of vaccine versus infection-derived immune protection against Omicron.[6-7] Study limitations include lack of information about direct neutralization against Omicron (though anti-RBD correlation with neutralization is described), lack of viral sequencing (though follow-up occurred when Omicron became the dominant strain in the US), self-reported COVID-19 test results, limited availability of COVID-19 testing during the follow-up period which could lead to underreporting of COVID-confirmed cases, and survivor bias.[3] In conclusion, the presence of anti-RBD antibodies in an unvaccinated healthy adult (natural immunity) was associated with 23% decreased relative risk for COVID-19 reinfection and shorted symptom duration versus those without pre-existing anti-RBD antibodies during the Omicron wave. Among people with antibodies, titer did not appear to be associated with risk of test-confirmed Omicron infection, although our sample size for those ≥1000 U/mL may have been inadequate to detect such a difference in that range. It is important to note that while disease severity for hospitalized Omicron patients was somewhat lower for Omicron versus other variants, patients hospitalized with COVID-19 remain at substantial r...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.27.22275630
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.29.493923

1
1. sciscore 01 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.29.493923: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mouse immunizations: Female BALB/c mice aged 6–8 weeks (Central Lab Animal) were intramuscularly immunized with 0.4 μg/animal VP vaccine (total volume of 50 μL, adjusted with PBS) at week 0.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Surrogate virus-neutralization assay: The sVNT was used to analyze the binding ability of RBD to ACE2 after neutralizing RBD with antibodies in the serum.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The reciprocal of the dilution that resulted in a binding inhibition rate of 20% or more (PI20) was defined as the neutralizing antibody titer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PI20</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The ELISPOT plates were coated with purified anti-mouse IFN-γ capture antibody and incubated overnight at 4 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IFN-γ</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The inactivated SARS-CoV-2 vaccine produced from Vero cells contained 4 μg of viral antigens and 0.225 mg of aluminum hydroxide adjuvant in a 0.5-mL dose.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: RRID:CVCL_A5BG)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse immunizations: Female BALB/c mice aged 6–8 weeks (Central Lab Animal) were intramuscularly immunized with 0.4 μg/animal VP vaccine (total volume of 50 μL, adjusted with PBS) at week 0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vaccines: The COVID-19 GX-19N DNA vaccine, consisting of GX-19 and GX-21 at a ratio of 1:2, was constructed by inserting the antigen genes of SARS-CoV-2 into a pGX27 vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pGX27</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GX-19 (pGX27-SΔTM/IC) contains the SARS-CoV-2 spike (S) gene lacking the transmembrane (TM)/intracellular (IC) domain, and GX-21 (pGX27-SRBD-F/NP) is designed to express the fusion protein of the receptor-binding domain (RBD) of the spike protein, the T4 fibritin C-terminal foldon (SRBD-Foldon), and the nucleocapsid protein (N).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pGX27-SΔTM/IC</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pGX27-SRBD-F/NP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Data analyses were performed using GraphPad Prism 7 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.29.493923
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.27.493798

1
1. sciscore 01 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.27.493798: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: Thank you for sharing your data.
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.27.493798
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.29.22275748

1
1. sciscore 01 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.29.22275748: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Analyses were performed in R version 4.1.[4] Ethics statement: The community cohort study was approved by the National University of Singapore institutional review board (reference H-20-032).<br>Field Sample Permit: The migrant worker cohort study was approved by the Singapore Ministry of Health under the Infectious Diseases Act (Schedule 59A) as part of the national public health response to the COVID-19 epidemic.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">1] The migrant worker cohort included 541 adult males aged 19-59 years residing in a COVID-19 affected dormitory and who provided blood samples in May 2020 and subsequently after two and six weeks.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  At the height of the Omicron wave in early March, two-dose vaccine recipients had a 3.5 times higher risk of being critically ill and intubated in an intensive care unit compared with three-dose vaccinees; the relative risk among unvaccinated individuals was 7.5 times higher.[5] There are two important caveats. First, the sVNT assay used in this study was developed based on the ancestral SARS-CoV-2 strain; neutralising activity specifically against the Delta and Omicron variants is likely to be lower. This is reflected in the dramatic rises in Delta and Omicron transmission in Singapore in late 2021 and early 2022 despite very high levels of vaccine uptake, which coincide with the easing of travel restrictions and social distancing measures. Second, there is continuing uncertainty regarding the relative protection afforded by previous infection and vaccination, as well as the role of neutralising antibodies in immune protection. A recent systematic review suggested that previous infection provided equivalent protection from COVID-19 compared with two doses of mRNA vaccine,[6] although other studies have shown superior protection from two doses of vaccine.[7,8] Our findings indicate considerably lower neutralising antibody levels following natural infection relative to two and three vaccine doses. A major consideration is that infections in our migrant worker cohort were mild or asymptomatic, which tend to elicit lower, more rapidly waning neutralising antibody responses.[9] F...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.29.22275748
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.29.493866

1
1. sciscore 01 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.29.493866: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All animal studies were approved by the Laboratory Animal Welfare and Ethics Committee of Third Military Medical University and were performed in accordance with the institutional and national policies and guidelines for the use of laboratory animals.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Bone marrow derived dendritic cells (BMDC) maturation study: Bone marrow cells were isolated from the femurs of female BALB/c mice and cultured in RPMI 1640 complete medium (Gibco, USA) supplemented with 10% FBS, 1% penicillin/streptomycin, 10 ng/mL of Interleukin-4 (IL-4) and Granulocyte-Macrophage Colony Stimulating Factor (GM-CSF).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animals were randomly divided into groups and conceded an adaption time of at least 7 days before the beginning of the experiments.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: All cell lines used in current study were obtained from original providers who authenticated the cell lines using morphology, karyotyping and PCR-based approaches.<br>Contamination: All cell lines tested negative for mycoplasma contamination.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In order to detect the TEM/TCM and TRM cells, the cell samples were stained with the following indicated antibodies in FACS buffer: anti-CD62L (161204, BioLegend), anti-CD44 (25-0441-82, BioLegend), anti-CD69 (104506, BioLegend) and anti-CD103 (121416, BioLegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD62L ( 161204</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD44</div><div>suggested: (Thermo Fisher Scientific Cat# 25-0441-82, RRID:AB_469623)</div></div><div style="margin-bottom:8px"><div>anti-CD69</div><div>suggested: (BioLegend Cat# 104506, RRID:AB_313109)</div></div><div style="margin-bottom:8px"><div>anti-CD103</div><div>suggested: (BioLegend Cat# 121416, RRID:AB_2128621)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation at 37 °C, 5% CO2 for 24 h, the plates were washed with PBS and incubation with biotinylated anti-mouse IFN-γ or IL-4 antibody for 2 h at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IFN-γ</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IL-4</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: MH-S cell line (Mice alveolar macrophages cells), DC2.4 cell line (Mouse bone marrow-derived dendritic cells), BEAS-2B (human bronchial epithelial cells) cell line and Calu-3 (human lung cancer cells) cell line were obtained from ATCC (Manassas, VA,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MH-S</div><div>suggested: ATCC Cat# CRL-2019, RRID:CVCL_3855)</div></div><div style="margin-bottom:8px"><div>DC2.4</div><div>suggested: Millipore Cat# SCC142, RRID:CVCL_J409)</div></div><div style="margin-bottom:8px"><div>BEAS-2B</div><div>suggested: NCBI_Iran Cat# C561, RRID:CVCL_0168)</div></div><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: KCLB Cat# 30055, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2-293T cells (ACE2-expressing cell line, constructed by hygromycin B screening) were purchased from PackGene (LV-2058, Guangzhou, China).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Another part was serially diluted in DMEM and added into Vero E6 cells in 96-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum or BALF were incubated with 10 μl of Luc-SARS-Cov-2 pseudotyped virus (LV-2058, PackGene, China) for 60 min, then added to the HEK293T cells stably expressing ACE2 to incubate in a standard incubator (37°C, 5% CO2) for 72 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bone marrow derived dendritic cells (BMDC) maturation study: Bone marrow cells were isolated from the femurs of female BALB/c mice and cultured in RPMI 1640 complete medium (Gibco, USA) supplemented with 10% FBS, 1% penicillin/streptomycin, 10 ng/mL of Interleukin-4 (IL-4) and Granulocyte-Macrophage Colony Stimulating Factor (GM-CSF).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV-2 challenge model was based on a novel mouse-adapted SARS-CoV-2 strain, C57MA14 (NCBI GenBank number: OL913104.1, details can be found in: https://www.ncbi.nlm.nih.gov/nuccore/2167992552), that causes severe respiratory symptoms, and mortality to BALB/c mice.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57MA14</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reporter Vectors (pFLuc, E1320) was purchased from Promega (Madison, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pFLuc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids encoding SARS-CoV-2 S protein (pSpike) and pVax were kindly provided by Advaccine Biopharmaceuticals Co., Ltd (Suzhou, China)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pVax</div><div>suggested: RRID:Addgene_141350)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To evaluate the in vivo transfection of PP-sNp, pDNA/PP-sNp complexes encoding firefly luciferase (i.e., pFLuc/PP-sNp) were prepared. pFLuc/PP-sNp and naked-pFLuc were incubated with cells for 4 h in Opti-MEM I Reduced Serum Medium, then were replaced by fresh complete medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pDNA/PP-sNp</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pFLuc/PP-sNp</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To examine the maturation of BMDCs in vitro, BMDCs (1 × 106 mL-1) were co-cultured with pSpike/PP-sNp and naked-pSpike only for 24 h, respectively. Subsequently, FITC anti-mouse CD11c (117305, Biolegend)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSpike/PP-sNp</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Each anesthetized mouse intratracheally received 50 μL of pSpike/PP-sNp formulation containing 15 μg pSpike. pVax/PP-sNp and phosphate buffered saline (PBS) was adopted as a mock control and a negative control, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pVax/PP-sNp</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The trajectories of the nanoparticles were precisely quantified from the videos by software (TrackMate plugin in FIJI (ImageJ)), then the trajectory data was used to calculate the MSD and the corresponding diffusion coefficients (De) in MATLAB through the following equations, as implemented in MSD Analyzer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MATLAB</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data are analyzed with FlowJo software V10.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics and analysis: Statistical analyses were performed using the GraphPad Prism 8 (GraphPad Software, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  There are several limitations that we did not address in this study and will be useful topics for future studies, including the absence of data on the neutralization and protection efficiency elicited by pSpike/PP-sNp against emerging SARS-CoV-2 variants of concern. Similar to those cases of authorized COVID-19 vaccines62, the neutralizing activity of NAb induced by the pSpike/PP-sNp vaccine may suffer a significant decrease within several months/years after vaccination, more boost doses may be necessary. Besides, immunization and challenge studies with larger animals such as non-human primates should be carried out to confirm the extent of protective mucosal immunity conferred by pSpike/PP-sNp. Another limitation relates to the intratracheal dosing which is not appropriate to be applied in humans when considering its poor compliance. Most of the relevant studies chose the intranasal inoculation because of its noninvasive and convenient features, but there are still huge concerns and uncertainties regarding intranasal route of vaccination. For example, negative perception for nasal vaccines was generated from reported cases of Bell’s palsy after intranasal dosing of influenza vaccines63, 64. Alternatively, the noninvasive nebulized formulations seem to be one of the most appropriate approaches in delivering mucosal vaccines to the human airway. However, the nebulized DNA formulations still face many challenges as indicated by a previous study showing that as little as 10% of ...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.29.493866
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.27.493714

1
1. sciscore 01 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.27.493714: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: Thank you for sharing your code and data.
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.27.493714
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.30.22275733

1
1. sciscore 01 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.30.22275733: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.30.22275733
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.27.493767

1
1. sciscore 01 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.27.493767: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The pGEX-6P-1-nsp5 (or Mpro) plasmid was a kind gift from Dr. Martin Walsh, Diamond Light Source. pGBWm4046979 (coding for full-length nsp7, NCBI Reference Sequence: YP_009725303.1, codon-optimized, with an initial Met and a cleavable C- terminal TEV 6x-His tag was a gift from Ginkgo Bioworks (Addgene plasmid 145611; http://n2t.net/ addgene:145611; RRID: Addgene_145611).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pGEX-6P-1-nsp5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pGBWm4046979</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_145611)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pGBWm4046852 (coding for full- length nsp8, NCBI Reference Sequence: YP_009725304.1, codon-optimized, with an initial Met and a cleavable C-terminal TEV 6x-His tag) was a gift from Ginkgo Bioworks (Addgene plasmid 145584; http://n2t.net/ addgene:145584; RRID: Addgene_145584).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pGBWm4046852</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_145584)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The gene encoding SARS-CoV-2 nsp10 was cloned into the pGEX-6P-1 vector to generate an expression construct containing an N-terminal GST tag and an HRV 3C protease cleavage site (GST3CNsp10).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pGEX-6P-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids for codon-optimized pET-28a- His6-nsp7-8 and pET-28a-His6-nsp7-11 (with an HRV 3C protease cleavage site between the 6x- His tag and the coding sequence) were obtained from GenScript (Piscataway, NJ).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-28a-</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pET-28a-His6-nsp7-11</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The pGEX- 6P-1-nsp5 expression plasmid was transformed into E. coli Rosetta gami competent cells and cultured in LB media at 37 °C with 100 μg/mL ampicillin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pGEX-</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>6P-1-nsp5</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The gene encoding SARS-CoV-2 nsp10 was cloned into the pGEX-6P-1 vector to generate an expression construct containing an N-terminal GST tag and an HRV 3C protease cleavage site (GST3CNsp10).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: (Active Motif Cat# 91351, RRID:AB_2847848)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The gel band intensity for nsp7-11 was calculated using ImageJ software (https://imagej.nih.gov/ij/index.html) and plotted against the concentration of binders using the GraphPad Prism Version 9.3.1 (GraphPad Software, La Jolla California USA, www.graphpad.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Crosslink spectral matches found in Proteome Discoverer were exported and converted to sequence spectrum list format using Excel (Microsoft).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Proteome Discoverer</div><div>suggested: (Proteome Discoverer, RRID:SCR_014477)</div></div><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data was reduced using BioXTAS RAW 2.0.3 (81).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioXTAS</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">They are also provided in the SM as PyMOL sessions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.27.493767
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.30.22275757

1
1. sciscore 01 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.30.22275757: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The ethical committee of the University of Turku approved the study protocol.<br>Consent: All study subjects gave their written consent to the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Questions: Gender question included four options 1) Female (Binary Female, BF), 2) Male (Binary Male, BM), 3) Other, 4) I do not wish to tell.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data were analysed using SPSS software (26.0 for Windows).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Advantages and limitations: In addition to important and actual findings related to the Covid-19 pandemic, some strengths as well as limitations should be discussed. The low response rate (7.4%) clearly limits representativeness of the results. On the other hand, the sample size became large enough for studying also small groups of participants and possible associations between various factors and functioning. The survey was not very long but it included also sensitive questions, which may have reduced individuals’ willingness to response. In client satisfaction surveys with no incentives, response rate often remains on the level of 10% or under (PeoplePulse, 2021). During the Covid-19 pandemic, the university students and personnel received several other surveys, thus it is probable that they were tired to response to a new survey. Additionally, the fact that this survey was carried out in May, when the term was near to end, may have affected low response rate. The study focused on people of university community, who do not represent the general population. On the other hand, the study sample represents a quite homogenous population, which faced equal and long-lasting Covid-19 lockdown with its consequences, when the differences in FUNCT between sub-groups of the sample, were mainly due to sub-group qualities than to different impacts of the pandemic. The question on gender included only four options (Female, Male, Other, I do not wish to tell) and all except reported female...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.30.22275757
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.25.22275569

1
1. sciscore 01 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.25.22275569: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: Thank you for sharing your code and data.
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  The two approaches serve different purposes, and each has its strengths and limitations. A main strength of the mechanistic modelling is that all parameters have a biological interpretation, and that these analyses can be used for scenario studies. The results from such analyses, however, depend critically on model assumptions and are surrounded with large uncertainties. Our analyses do not yield a mechanistic interpretation but give precise estimates of latent virus loads that arguably are less dependent on specific model assumptions. In ongoing work, we aim to merge the two approaches by fitting transmission models at a local scale using generalized profiling [26]. Since the infrastructure of receiving sewage samples are in place, the detection of other viruses can be added to the Dutch sewage surveillance program. These might include rotavirus and enteroviruses but also influenza viruses [27, 28], thus providing a comprehensive surveillance tool for pandemic preparedness. Moreover, sewage surveillance for antimicrobial resistance has already shown its potential [29]. In principle, our methods of analysis can directly be applied to other targets and can deal with noise and unbalanced data in a principled manner. The SARS-CoV-2 sewage surveillance program in the Netherlands has contributed to integrating available sewage data in a coherent framework, and also to informing the Dutch government on national and regional trends in SARS-COV-2 circulation [30]. Specifically, data ...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.25.22275569
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.26.22275532

1
1. sciscore 01 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.26.22275532: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  There are also important limitations to our analysis. First, the uncertainty intervals around the estimates are wide, reflecting as yet limited and heterogeneous data. Second, we had to derive separate algorithms for each contributing study to achieve consistency in case definitions of the three chosen symptom clusters. Efforts to achieve standardization of questions and instruments for studies of long COVID are underway.5,63 This would make pooling estimates among studies less prone to measurement bias. Third, we assumed that long COVID follows a similar course in all countries and territories. We used data from western European countries, Iran, Russia, India, China, South Africa, Turkey, Saudi Arabia, Israel, Australia, and the USA. Additional reports from Brazil and Bangladesh suggest that long COVID similarly affects other parts of the world.21,22 As more information becomes available, we can explore whether there is geographical variation in the occurrence or severity of long COVID. We also note that the duration estimates relied on studies from high income countries only. With repeated follow-up being planned in many of the studies and with new studies appearing, it will become clearer over time how generalizable our findings on duration are. Fourth, apart from symptoms and symptom clusters, new diseases have been reported to occur more frequently in patients after COVID-19 diagnosis, including cardiovascular complications like myocarditis, acute myocardial infarction, ...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.26.22275532
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.25.22275533

1
1. sciscore 01 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.25.22275533: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: The Mount Sinai Pathogen Surveillance Program (MS-PSP): Residual nasopharyngeal and anterior nares (AN) swab specimens were collected after completion of the diagnostic process, as part of the Mount Sinai Pathogen Surveillance Program (IRB approved HS#13-00981).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Molecular SARS-CoV-2 diagnostics: SARS-CoV-2 molecular diagnostic testing was performed in the Molecular Microbiology Laboratories of the MSHS Clinical Laboratory by nucleic acid amplification tests (NAAT) that have been validated for nasopharyngeal, anterior nares swabs and saliva specimens.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, Vero-E6 cells expressing TMPRSS2 were cultured in Dulbecco’s Modified Eagle Medium containing 10% heat-inactivated fetal bovine serum and 1% Minimum Essential Medium (MEM) Amino Acids Solution, supplemented with 100 U/ml penicillin, 100 μg/ml streptomycin, 100 μg/ml normocin, and 3 μg/ml puromycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">200ul of viral transport media from the nasopharyngeal or anterior nares swab specimen was added to Vero-E6-TMPRSS2 cells in culture media supplemented with 0.5 μg/ml Amphotericin B.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.25.22275533
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.24.22275478

1
1. sciscore 01 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.24.22275478: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Articles underwent a blind evaluation for inclusion by two assessors (D.S. and D.F.) and disagreements were resolved by a third senior assessor (A.C.).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Medical Subject Heading (MeSH) and key words used were: (“COVID-19” OR “SARS-CoV-2” OR “coronavirus disease 2019”) AND (“treatment” OR “therapy”</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MeSH</div><div>suggested: (MeSH, RRID:SCR_004750)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All the data manipulation and the analyses were performed in Excel and MedCalc (Version 20.106</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Despite these major limitations, the assembly of these effective, yet molecularly disparate RCT outpatient studies shows the consistent importance of early outpatient treatment for patients at risk of progression 40. Treatment within 5 days of illness onset is more effective than later treatment, as would be expected for an antiviral. Importantly, for CCP, increasing the dose in the Argentina RCT and shortening the intervention interval to within five days of illness onset produces a risk reduction for hospitalization close to 80%, comparable to (or superior) to the findings of trials with monoclonal antibodies and small chemical antivirals. Overall, a reduction in mortality is suggested with these outpatient therapies, but the individual RCTs are underpowered to investigate death as an individual outcome. Outpatient RCTs are more difficult for non-industrial institutions to perform during an infectious disease pandemic, requiring separate spaces within clinics or other healthcare structures. By contrast, the pharmaceutical industry has established mechanisms in place for outpatient trials. The relative ease of conducting inpatient trials may have led most CCP trials – all conducted by academic institutions - to have been conducted in hospitals. However most antiviral/antimicrobial therapies are more effective when given before hospital admission. SARS-CoV-2 antibodies, whether elicited by vaccines, or provided as polyclonal (CCP) or monoclonal antibodies, have all been demon...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.24.22275478
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.28.22275707

1
1. sciscore 01 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.28.22275707: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Researchers approached participants in their work environment (usually in doctors’ rooms in their clinics), informed them about the study, obtained their consent and handed them a hard copy of the questionnaire.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analysed via SPSS v25.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations: It is important to note that this study was not longitudinal, i.e., data is not necessarily collected from the same residents in the reference study. There is a constant change in residents in each hospital. Thus, this study does not show a causal relationship between the pandemic and burnout among medical residents. Still, the comparison in this study provides better evidence than existing studies in the Turkish context for both local decision-makers and global researchers. Although the study has achieved an approximate 50% participation rate, selection bias should be always kept in mind while interpreting the findings. Residents who experience burnout may be more or less willing to participate in the study than others. Lastly, 69 participants answered the online form, and they have a significantly higher mean EE score (21.9±7.5) than those who answered the paper form (18.2±7.7). When they are excluded from Model 1, female sex and experience of personal problems during the pandemic turn into non-significant (p=0.51, p=0.67 respectively). No difference was observed for other dimensions by mode of application.
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.28.22275707
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.27.22275037

1
1. sciscore 01 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.27.22275037: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: Thank you for sharing your code and data.
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  There are limitations of our study. First, while our study time frame of Spring 2020 is ideal in terms of corticosteroid experimentation, it includes New York City’s initial pandemic surge conditions and rapidly changing clinical practice. We cannot rule out the presence of unmeasured confounding. Second, we did not have the data to look at individual corticosteroid types, making an exact comparison to a specific randomized trial impossible. Despite these limitations, our study has numerous strengths and serves as an example in which the current standard for clinical research methods fail to recover the correct treatment effect where a modern causal inference method succeeds. Using observational data to guide clinical practice is possible, but relies on the incorporation of advanced epidemiological and statistical methodology principles. We hope this study emphasizes the importance of incorporating these innovative techniques into study designs and statistical analyses of observational data.
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.27.22275037
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.24.22275504

1
1. sciscore 01 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.24.22275504: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Study limitations: The present study is based on two snapshots of a dynamic process. Yet, these snapshots were taken at the points when in many countries, particularly in HICs, vaccination campaigns had already been established for some time. Also, the dataset included more evidence from HICs than LMICs. However, as the aim here was to investigate the interaction between trust and securing high volumes of vaccines, the latter variable had more relevance to the condition of HICs. It also should be noted that vaccination coverage depends on a wide range of regional factors, such as infrastructure and coordination, that call for future studies.
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.24.22275504
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.29.22275732

1
1. sciscore 01 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.29.22275732: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used the MADGRAD as our optimizer as it outperformed other tested alternatives [10].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MADGRAD</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.29.22275732
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.28.22275716

1
1. sciscore 01 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.28.22275716: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: We analyzed electronic health records (EHR) using the VA Corporate Data Warehouse (CDW), which contains patient-level information on all patient encounters in VA medical facilities, including treatments, prescriptions, vaccinations, laboratory results, healthcare utilization, and vital status.9,10 We identified tixagevimab/cilgavimab use through the VA Pharmacy Benefits Management (PBM) EUA prescription dashboard, which captures and links records of recipients, date, and dosage of tixagevimab/cilgavimab administered in medical facilities across VA.11 This study was approved by the institutional review board of the VA Medical Center in White River Junction, Vermont, and was granted a waiver of informed consent because the study was deemed minimal risk and consent impractical to acquire.<br>Consent: We analyzed electronic health records (EHR) using the VA Corporate Data Warehouse (CDW), which contains patient-level information on all patient encounters in VA medical facilities, including treatments, prescriptions, vaccinations, laboratory results, healthcare utilization, and vital status.9,10 We identified tixagevimab/cilgavimab use through the VA Pharmacy Benefits Management (PBM) EUA prescription dashboard, which captures and links records of recipients, date, and dosage of tixagevimab/cilgavimab administered in medical facilities across VA.11 This study was approved by the institutional review board of the VA Medical Center in White River Junction, Vermont, and was granted a waiver of informed consent because the study was deemed minimal risk and consent impractical to acquire.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were performed with Stata 17 software (StataCorp), and SAS software, version 8.2 (SAS Institute).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations: There are some limitations to acknowledge. Firstly, VA data include only healthcare encounters occur in VA medical centers, so we could have missed some infections and hospitalizations that occurred outside VA, which could bias our results towards the null. Secondly, while the EUA criteria are intended for patients who are immunocompromised, a small proportion of patients (%) who received tixagevimab/cilgavimab were not immunocompromised based on our definition and it is possible that we misclassified these patients. Thirdly, the VA has a unique population (mostly male, older), and our results may not be generalizable to a larger population of patients that were not treated at the VA. 34 Fourthly, the 10th revision of the International Statistical Classification of Diseases and Related Health Problems (ICD-10) codes from claims data have been shown to inadequately capture comorbidity and functional status.35 Because only 289 (17%) of patients in our propensity-score matched tixagevimab/cilgavimab cohort received a single dose of 150 mg/150 mg tixagevimab/cilgavimab, we did not have the sufficient sample size to compare the original dosage of 150mg/150mg to the revised dosage of 300mg/300mg to assess the optimal dosing of tixagevimab/cilgavimab in the current analysis. Finally, we could not assess optimal timing of tixagevimab/cilgavimab in relation to COVID-19 vaccine administration, nor could we identify a target population who would be optimal to receive tixage...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.28.22275716
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.27.22275708

1
1. sciscore 01 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.27.22275708: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The Institutional Review Board of the CHUM (Centre Hospitalier de l’Université de Montréal) approved the study and informed consent was waived because of its low risk and retrospective nature.<br>Consent: The Institutional Review Board of the CHUM (Centre Hospitalier de l’Université de Montréal) approved the study and informed consent was waived because of its low risk and retrospective nature.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The raw data was managed using SQLite 3, and further data processing was conducted using Python version 3.7 and R version 4.0.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study presents some limitations. Multiple variables could not be included because they were either not captured in our electronic health record (e.g., time from onset of symptoms, mechanical ventilation parameters, in-hospital complications) or excluded from our study because of missingness. However, missing values are common in clinical practice and investigating risk stratification while considering the inherent characteristics real-world data is of importance at the bedside (54). In addition, this enhances the applicability of our phenotypes, as they are only based on the most common variables available for patients admitted with COVID-19 (55). This differs from studies that have included flux cytometry and CD4+/CD8+ count in their algorithm (34). Besides, those omitted variables do not seem to have had significant impact on our results as the three clusters obtained were consistent in numbers with previous work (33–39). Additionally, our study included patients admitted between January 1, 2020, and January 31, 2021, being before the approval of the majority of targeted therapies against COVID-19 or vaccination. We therefore did not assess the effect of vaccination, treatments and the type of variant on phenotypes. Accordingly, this put our algorithm at risk for temporal dataset shift (56) and calibrating our clustering algorithm will be necessary before exploiting it in the clinical setting. Finally, because race-based data is not recorded in the Quebec healthcare sys...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.27.22275708
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.28.22275691

1
1. sciscore 01 Jun 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.28.22275691: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: For specimens from Colombia, the study was reviewed and approved by the ethics Committee from Universidad del Rosario in Bogotá, Colombia (Act number DVO005 1550-CV1499).<br>Field Sample Permit: SARS-CoV-2 specimen collection and testing: Residual viral RNA from a total of 391 specimens that were previously collected from September 2, 2020 – March 2, 2022 for routine diagnostic testing were utilized for this study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: viral RNA from MSHS underwent RT-PCR and next-generation sequencing followed by genome assembly and lineage assignment using a phylogenetic-based nomenclature as described by Rambaut et al. (36) using the Pangolin v4.0.6 tool and PANGO-v1.2.81 nomenclature scheme (https://github.com/cov-lineages/pangolin) as previously described (4, 37)</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Ethics statement: For specimens obtained through routine testing at MSHS, the Mount Sinai Pathogen Surveillance Program was reviewed and approved by the Human Research Protection Program at the Icahn School of Medicine at Mount Sinai (ISMMS) (HS#13-00981).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Human Research Protection Program</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 sequencing, assembly, and phylogenetics: As part of the ongoing Mount Sinai Pathogen Surveillance Program,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pathogen Surveillance Program</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, long-read Oxford Nanopore MinION sequencing was conducted by the MinKNOW application (v1.5.5).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MinKNOW</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reads were filtered to remove possible chimeric reads, and genome assemblies were obtained following the MinION pipeline described in the ARTIC bioinformatics pipeline (https://artic.network/ncov-2019/ncov2019-bioinformatics-sop.html accessed on 1 February 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MinION</div><div>suggested: (MinION, RRID:SCR_017985)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To measure the level of agreement between WGS and the variant panel, we performed agreement analyses with kappa (κ) results and 95% confidence intervals (95% CI) using the publicly-available GraphPad Prism web calculator (https://graphpad.com/quickcalcs/kappa2/, last accessed April 20, 2022).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>WGS</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Display Items: All figures are original and were generated using the GraphPad Prism software, Microsoft Excel v16.60, and finished in Adobe Illustrator (v.26.1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div><div style="margin-bottom:8px"><div>Adobe Illustrator</div><div>suggested: (Adobe Illustrator, RRID:SCR_010279)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fig. 1A was created in BioRender.com and finished in Adobe Illustrator.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioRender</div><div>suggested: (Biorender, RRID:SCR_018361)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study does present some limitations particularly with respect to limited sampling. While the panel has defined target signatures for 16 different variants, we were only able to recover clinical specimens that corresponded to 11 of these variants for testing. Indeed, variants with the lowest level of agreement and diagnostic performance metrics were those with some of the fewest specimens recovered and tested (e.g., Zeta (n = 1), Beta (n = 4), Eta (n = 7). We also did not include specimens from the early phase of the pandemic including D614 viruses (45, 46) which limited diagnostic analyses of the D614G variant and individual target. It is important to note, however, that the D614G polymorphism has undergone positive selection to eventuate emergent variants (47), and these older viruses have largely been replaced by the emergent Omicron lineage(s) (6, 48). We also recognize that we did not conduct this study at the extraction step of clinical specimens given limited availability of remnant upper respiratory or saliva specimens. A unique benefit of a highly multiplexed molecular assay is its adaptability to the natural evolution of the pathogen at hand which confers the ability to identify changes in circulating viruses that manifest as distinct target result signatures. To assess this potential, we included undefined variants to determine if the discrete assay target result patterns could elucidate a variant’s identity without necessarily providing a defined result as the ...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.28.22275691
May 2022
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.27.22275673

1
1. sciscore 30 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.27.22275673: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: All protocols were approved by the Hamilton Integrated Research Ethics Board, and informed consent was obtained.<br>Consent: All protocols were approved by the Hamilton Integrated Research Ethics Board, and informed consent was obtained.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Measurements of Anti-SARS-CoV-2 Antibodies and Neutralizing Capacity: Serum anti-SARS-CoV-2 spike (S) protein and receptor binding domain (RBD) IgG, IgA and IgM antibodies were measured by a validated ELISA as previously described47, 52, with assay cut-off 3 standard deviations above the mean of a pre-COVID-19 population from the same geographic region.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 spike (S) protein and receptor binding domain (RBD) IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody neutralization capacity was assessed by cell culture assays with Vero E6 (ATCC CRL-1586) cells and live SARS-CoV-2, with data reported as geometric microneutralization titers at 50% (MNT50), which ranged from below detection (MNT50 = 5; 1:10 dilution) to MNT50 = 128052.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data was gated with FlowJo V10.8.1 (TreeStar, Inc.) as previously published47.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Negative control (unstimulated wells) and positive control (polyclonal stimulation with CytoStim™ (0.5 µL/well, #130-092-173; Miltenyi Biotec, Bergisch Gladbach, Germany) conditions were included with each sample, as was stimulation with influenza hemagglutinin (HA) antigens (4 µL; AgriFlu, Alfuria® Tetra Inactivated Influenza Vaccine 2020-2021 season, Seqirus, UK).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CytoStim™</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The beta variant was obtained through BEI Resources, NIAID, NIH: SARS-Related Coronavirus 2, Isolate hCoV-19/South Africa/KRISP-K005325/2020, NR-54009, contributed by Alex Sigal and Tulio de Oliveira. Statistical Analysis: Statistical analyses were conducted using GraphPad Prism version 9 (San Diego, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.27.22275673
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.27.22275672

1
1. sciscore 30 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.27.22275672: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the Clinical Research Ethics Committees of Hospital Universitario de Navarra and informed consents were obtained for all subjects.<br>Consent: The study was approved by the Clinical Research Ethics Committees of Hospital Universitario de Navarra and informed consents were obtained for all subjects.<br>Field Sample Permit: Infected patients were classified for COVID-19 severity according to the Treatment Guidelines of the NIH (https://www.covid19treatmentguidelines.nih.gov/overview/clinical-spectrum/): Sample processing, PBMCs reactivation and flow cytometry: Blood collection, PBMC, myeloid cells and T cell purification, activation and flow cytometry were carried out as previously described [41].</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">The total sample size of the study was established a priori to achieve a minimum power of 0.8 considering a large effect size (f=0.4) using Gpower 3.1 [40].</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following fluorochrome-conjugated antibodies were used: CD14-Violet Fluor 450 (Ref 75-0149-T100, TONBO), CD11b-PerCP-Cy5-5 (Ref 65-0112-U1, TONBO), CD62L-APC (Ref 130-113-617, Miltenyi), CD66b-APC-Cy7 (Ref 130-120-146, Miltenyi), CD54-FITC (Ref 130-104-214, Miltenyi), CD19-PE (Ref 130-113-731, Miltenyi), CD3-APC (Ref 130-113-135, Miltenyi), CD8-APC-Cy7 (Ref 130-110-681, Miltenyi), CD4-FITC (Ref 130-114-531, Miltenyi), CD27-PE (Ref 50-0279-T100, TONBO), CD28-PE-Cy7 (Ref 130-126-316, Miltenyi).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD62L-APC</div><div>suggested: (Miltenyi Biotec Cat# 130-091-755, RRID:AB_244246)</div></div><div style="margin-bottom:8px"><div>CD19-PE</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD3-APC</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD27-PE</div><div>suggested: (Sigma-Aldrich Cat# SAB4700134, RRID:AB_10896453)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For detection of S and N specific antibodies, a 96-well plate was coated with 5 µg/mL of the corresponding protein, followed by blocking with 1X PBS-2% BSA. 1:800, 1:250 and 1:80 sera dilutions were used for detection of anti-S antibodies, anti-N antibodies and anti-M antibodies, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-N</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-M</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-human IgGs HRP-labelled antibody (ThermoFisher) was used as secondary antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-human IgGs</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses: Statistical analyses were performed with GraphPad 8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.27.22275672
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.27.22274752

1
1. sciscore 30 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.27.22274752: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: VeroE6/TMPRSS2 cells were purchased from the Japanese Collection of Research Bioresources (JCRB) Cell Bank.<br>IRB: Specimen collection: This study was approved by the ethics committee of Keio University (approval number: 20210081) and was conducted in accordance with the Declaration of Helsinki and Title 45, U.S. Code of Federal Regulations, Part 46, Protection of Human Subjects, effective December 13, 2001.<br>Consent: All patients provided written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Quantification of SAES-CoV-2 infection: First, multiple fields of view (FOVs) containing observed cells were randomly selected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Visualizing squamous epithelial cells using an antibody against pan-cytokeratin: After reaction with a fluorescent Nb, cells were incubated in 0.7 mL PBS containing 0.1% (wt/vol) Triton X-100 and 1.25 μg/mL anti–pan-cytokeratin mouse mAb (AE1/AE3) (BioLegend, 914204) at RT for 60 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti–pan-cytokeratin</div><div>suggested: (BioLegend Cat# 914204, RRID:AB_2616960)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Delineating individual cells by immunostaining the plasma membrane: After reaction with a fluorescent Nb, cells were incubated in 0.7 mL PBS containing 0.1% (wt/vol) Triton X-100 and 3.3 μg/mL anti–pan-cadherin rabbit polyclonal antibody (abcam, ab16505) at RT for 60 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti–pan-cadherin</div><div>suggested: (Abcam Cat# ab16505, RRID:AB_443397)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing with PBS twice, cells were incubated in a 0.7 mL PBS containing 0.1% (wt/vol) Triton X-100 and 2.0 μg/mL Alexa Fluor 546–labeled donkey anti–rabbit IgG (H+L) antibody (Thermo Fisher/Invitrogen, A10040) at RT for 60 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti–rabbit IgG</div><div>suggested: (Thermo Fisher Scientific Cat# A10040, RRID:AB_2534016)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VeroE6/TMPRSS2 cells were purchased from the Japanese Collection of Research Bioresources (JCRB) Cell Bank.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6/TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene construction (Nb-FP fusion): The K-874A, E9, or N10 gene was amplified using primers containing the 5’-BamHI and 3’-EcoRI sites, and the restricted products were cloned into the BamHI/EcoRI sites of pBS Coupler 4 (Shimozono and Miyawaki, 2008) to generate pBS/K-874A=, pBS/E9=, or pBS/N10=, respectively. ‘=’ denotes the “coupler linker,” a triple repeat of the amino acid linker Gly–Gly–Gly–Gly–Ser [(GGGGS)3].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBS/E9=</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pBS/N10=</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The KikG gene was amplified using primers containing the 5’-HindIII and 3’-SalI sites, and the restricted product was cloned in-frame into the HindIII/SalI sites of pBS/K-874A=, pBS/E9=, and pBS/N10= to generate pBS/K-874A=KikG, pBS/E9=KikG, and pBS/N10=KikG, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBS/K-874A=KikG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pBS/E9=KikG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pBS/N10=KikG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Azalea gene was amplified using primers containing the 5’-HindIII and 3’-SalI sites, and the restricted product was cloned in-frame into the HindIII/SalI sites of pBS/K-874A=, pBS/E9=, and pBS/N10= to generate pBS/K-874A=Azalea, pBS/E9=Azalea, and pBS/N10=Azalea, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBS/K-874A=Azalea</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pBS/E9=Azalea</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pBS/N10=Azalea</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The EGFP or Achilles gene was amplified using primers containing the 5’-HindIII and 3’-SalI sites, and the restricted product was cloned in-frame into the HindIII/SalI sites of pBS/K-874A= to generate pBS/K-874A=EGFP or pBS/K-874A=Achilles, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBS/K-874A=</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pBS/K-874A=EGFP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pBS/K-874A=Achilles</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In parallel, pRSETB was engineered to have a SalI site instead of a HindIII site.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pRSETB</div><div>suggested: RRID:Addgene_89510)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resultant plasmid was named pRSETB(S).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pRSETB(S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The DNA fragments encoding K-874A=KikG, E9=KikG, N10=KikG, K-874A=Azalea, E9=Azalea, N10=Azalea, K-874A=EGFP, and K-874A=Achilles were cloned into the BamHI/SalI sites of pRSETB(S) to generate pRSETB(S)/K-874A=KikG, pRSETB(S)/E9=KikG, pRSETB(S)/N10=KikG, pRSETB(S)/K-874A=Azalea, pRSETB(S)/E9=Azalea, pRSETB(S)/N10=Azalea, pRSETB(S)/K-874A=EGFP, and pRSETB(S)/K-874A=Achilles, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pRSETB(S)/K-874A=KikG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pRSETB(S)/E9=KikG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pRSETB(S)/N10=KikG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pRSETB(S)/K-874A=Azalea</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pRSETB(S)/E9=Azalea</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pRSETB(S)/N10=Azalea</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pRSETB(S)/K-874A=EGFP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pRSETB(S)/K-874A=Achilles</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Second, individual cells were manually delineated using the “Freehand selections” tool (ImageJ) in each FOV.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Third, the average intensity and the texture of the E9=KikG fluorescence were extracted using a customized program written using C++ and OpenCV 3.4.1 (https://opencv.org).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://opencv.org</div><div>suggested: (OpenCV, RRID:SCR_015526)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.27.22274752
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.27.22275706

1
1. sciscore 30 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.27.22275706: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study is subject to certain limitations. First, we cannot directly compare the reporting rate of myocarditis or pericarditis to the incidence rate in the general EU/EEA population because they represent different measures that use different definitions of the time at risk. Consequently, whether the incidence of myocarditis or pericarditis is higher in vaccinated people than in the general population is beyond the scope of this study. Since we do not know the exact background incidence rate, which may vary substantially among different vaccine group populations, as well as knowing that the data were based on different assumptions,28 the findings should be interpreted with caution. Second, we cannot exclude the possibility of ADRs’ registration underestimation. There is a possibility of underreporting myocarditis and pericarditis, which can impose non-differential misclassification. Third, we were unable to calculate myocarditis and pericarditis incidence for each vaccine that is adjusted for demographics and other factors because the information on confounding is absent; except for sex and age group, information on other variables was missing. Fourth, the reporting rates were not standardized for age due to the unavailability of the data; therefore, we were unable to perform a stratified OE analysis. A vaccine’s safety profile may vary depending on the target population (e.g., higher risks in the youngest age groups); therefore, comparing reporting rates for age groups or ...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.27.22275706
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.27.493400

1
1. sciscore 30 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.27.493400: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mammalian cell line HEK 293/T served as host for recombinant production of the glycoprotein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293/T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, pCAGGS based, NCBI accession number: LT727518) was chosen for the mammalian expression system.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_127347)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The amplicon was digested with the respective restriction enzymes (ThermoFisher) and ligated with T4 Ligase (ThermoFisher) into the linearised πα-SHP-H vector to clone πα-SHP-H–Sgene with an N-terminal octahistidin tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>πα-SHP-H</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Raw data (dot mean fluorescence intensity) was processed by GraphPad Prism 9 (GraphPad Software, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.27.493400
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.27.22275715

1
1. sciscore 30 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.27.22275715: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">2.1 Inclusion and exclusion criteria: The inclusion criteria of the current systematic review and meta-analysis were: (1) randomized controlled trials (RCTs) and observational studies; (2) critically ill patients admitted to the intensive care (ICU) or high dependency unit (HDU); (3) adults (≥ 18 years old) hospitalized primarily for COVID-19; (4) SARS-CoV-2 infection confirmed by reverse transcription polymerase chain reaction test of nasopharyngeal or oropharyngeal samples; and (5) vasopressor administration.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Copenhagen: The Nordic Cochrane Centre, The Cochrane Collaboration, 2014.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cochrane Collaboration</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  4.1 Limitations: This analysis included patients from various settings, i.e., HDU, ICU, and Emergency Department. Consequently, it may have included heterogeneous groups of patients with COVID-19. Due to the lack of randomized controlled trials, the synthesis of all the available knowledge on the specific outcomes was difficult. The level of heterogeneity was high and the conclusions drawn from this review must be cautious and reserved. Additionally, no data from the different studies was available to adjust the resulting odds ratios according to age, comorbidities, the presence of septic shock or other known factors that affect ICU mortality. In addition, most of the secondary outcomes could not be assessed. Another limitation is the heterogeneity of definitions of AKI that were used across different studies. Also, many of the included studies were conducted in retrospective fashion. Finally, we did not include non-English publications.
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.27.22275715
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.27.22275696

1
1. sciscore 30 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.27.22275696: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(31) The database developed by the Datafolha data collectors was exported to the Statistical Package for the Social Sciences (SPSS) version 26 for Windows (International Business Machines Corp, New York, USA) and R-GUI version 3.5.3(32) for statistical analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Statistical Package for the Social Sciences</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Despite these limitations, a few conclusions can be safely drawn from our work. We show that over a third of the medical workforce in Maranhão and São Paulo was infected with COVID-19 in the first year of the pandemic, with a substantial loss of labour. This is consistent with the findings from smaller studies from Brazil(20) and other LMICs,(16,18,19) and therefore particularly relevant for those countries with a scarcity of healthcare resources, which will have been hit already particularly hard by the pandemic (35). The higher infection rate among Maranhão physicians was in contrast to lower population infection rates (see Tab.1). Our multivariate analysis confirmed that working in Maranhão was one of the most significant risk factors of physician infections in our cohort. The lower ratio of physicians per capita in Maranhão (1.1 per 1,000 in Maranhão Vs 3.2 per 1,000 in São Paulo)(27) may be a factor here, as during health emergencies a smaller workforce will necessarily engage in multiple functions and tasks across sectors, therefore increasing opportunities for infection. This is consistent with previous work(26) showing the differential impact of health system crises on unequal states in LMICs. If confirmed, such finding would be relevant for those studies forecasting effects of the pandemic on health workforces in different parts of the world (4) Younger age was associated with higher infection rates among physicians in both Brazilian states, which on the one hand con...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.27.22275696
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.25.22275583

1
1. sciscore 30 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.25.22275583: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethics: The present study was approved by the Institutional Ethical Committee (IEC), All India Institute of Medical Science (AIIMS), Raipur on IEC number AIIMSRPR/IEC/2021/705.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Outcome analyses for different biomarkers were performed in the COVID-19 mild, moderate, critical, and death categories associated with females and males.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Box plots were constructed using GraphPad Prism (Version 7) for each biological parameter.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.25.22275583
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.27.22275613

1
1. sciscore 30 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.27.22275613: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This study has a few limitations. The voluntary nature of CPSP reporting means that not all cases may have been reported. Second, the online PIMS case report form was developed soon after the first identification of the clinical entity, therefore data on other important clinical or laboratory markers such as NT-proBNP and lymphopenia were not included in the study. In addition, several indicators ascertained by physician report, including population group of the child and cardiac findings such as myocarditis and shock were not based on pre-defined diagnostic criteria.
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.27.22275613
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.27.22275675

1
1. sciscore 30 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.27.22275675: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.27.22275675
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.27.22275701

1
1. sciscore 30 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.27.22275701: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: in line with the Declaration of Helsinki, ethical approval was obtained from the Cornwall and Plymouth Research Ethics Committee.<br>Consent: As part of the ethical approval where patients had severe disease and were not able to consent, assent was obtained from an independent medical practitioner who was not involved in the direct care of the patient.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis was performed in Anaconda 3 with Python 3.8.8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations: No definite conclusions can be drawn from this pilot study because of the small sample size. The study consisted mainly of Caucasian patients and as coagulation status and predisposition to the development of coagulopathies varies between race and ethnicity (38) this limits the generalisability of our study. Addendum: Dr S. Stanford designed the study, collected the data and wrote the paper. Dr D. Burns, Ms R. Taher and Dr S. Stanford undertook statistical analysis. Ms E. Arbuthnot co-ordinated the study. All other authors reviewed and provided expert comments on the paper.
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.27.22275701
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.25.22274904

1
1. sciscore 30 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.25.22274904: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: It was approved by the “CPP Ile de France III” Ethics Committee and the French Health Products Safety Agency (ANSM).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study design: We conducted a randomized, single-blinded, multicenter trial across 11 centers in France.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">The central laboratories performing the antibody analyses were also blinded to limit measurement bias.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The main other prespecified immunological endpoints were the rate of increase between day 0 and day 15 in neutralizing antibody titers against SARS-CoV-2 Wuhan (D614) and variants Beta, Delta and Omicron BA.1, geometric mean of anti-Spike IgG levels (expressed as BAU/mL) and IFNγ and IL-2 secreting CD4+ T-cells after stimulation with Spike peptides derived from wild-type SARS-CoV-2 or Omicron variant in each randomized group.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 Wuhan ( D614</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Spike IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As no data was available on the BNT162b2 vaccine, the sample size calculation was based on published data on the mRNA-1273 vaccine in which an increase rate of neutralizing antibody titer of 23 against ancestral SARS-CoV-2 (D614G) and 32 for the B.1.351 variant after mRNA-1273 boost was described.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>D614G</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For each group, the anti-SARS-CoV-2 IgG antibody titers directed against the S1 domain of the spike protein and the neutralizing antibody titers measured by a microneutralization technique against Wuhan strain (D614) and variants (B.1.351, Delta, Omicron BA.1) measured at day 0, day 15 were described as geometric means with two-sided 95% confidence intervals (95% CI).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, TMPRSS2-expressing VeroE6 cells and relies on cytopathic effect (CPE) identification at 5 days post-infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The statistical analysis was conducted using SAS software version 9.4 (SAS Institute, Inc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS</div><div>suggested: (SASqPCR, RRID:SCR_003056)</div></div><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">R freeware (version 3.6.3) and GraphPad Prism software (version 9.2.0, San Diego, California USA) were used for the graphs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This study has some limitations. Compared to the at-risk population for severe forms of SARS-CoV-2 infection, the study population was younger and included a smaller percentage of people ≥65 years than previously planned. Indeed, by the time the study was started, the elderly population had already received a third dose. Another limitation is the priming with a unique vaccine. The primary endpoint was based on an increase in neutralizing antibodies against the Wuhan (D614) and B.1.351 (Beta) strains, which are variants of SARS-CoV-2 that no longer circulate. However neutralizing antibodies against more recent variants were also evidenced. Despite these limitations, our study is the first to report immunization and reactogenicity data on the heterologous boost with an adjuvanted recombinant protein vaccine containing a variant of concern different from the one present at the priming. The higher neutralizing response elicited by the vaccine containing the Beta Spike protein will need further investigations to understand the mechanisms underlying these results. Of interest, this higher immunogenicity was not associated with higher reactogenicity. However, the observed higher immunogenicity should be interpreted with caution, as the relationship between antibody levels at 15 days and the long-term protection remains to be fully characterized. These results, which address the possibility of combining different vaccines for priming and boosting, are important for vaccination campai...
  
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT05124171</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Immunogenicity and Reactogenicity Following a Booster Dose o…</td></tr></table>
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.25.22274904
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.25.22275517

1
1. sciscore 30 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.25.22275517: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The University of Kansas Medical Center Institutional Review Board approved this project (STUDY00145615).<br>Consent: Before the interview, all participants completed an informed written consent online either via their computers, tablets, or phones.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We recruited two groups of participants: 1) family caregivers of people living with ADRD and 2) PCPs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ADRD</div><div>suggested: (Resources for Enhancing Alzheimers Caregiver Health, RRID:SCR_003638)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This study has some limitations. Remote recruitment and interviews increased the representation of participants in rural areas and other states. However, videocalls and phone calls led to some communication issues, which in some cases reduced the amount of information we could collect and affected the quality of the audio. The inability to conduct in-person recruitment and interviews may have excluded the most underserved individuals, who could have been contacted via health fairs before the pandemic started. We did not interview individuals with ADRD, which did not allow a full triangulation between them, their caregivers, and PCPs. While Latino caregivers tend to be women,36 these were over-represented in our study, likely also due to women’s higher likelihood to participate in health-related research.37,38 The sample size was relatively small and not probabilistic, which reduces the generalizability of the findings. As with most studies, individuals who participated in the study were motivated to participate. We do not know how much their discourse compares to those who decided not to participate. This study has implications for public health. Given the efficacy of existing COVID-19 vaccines,39 ensuring access to ongoing boosters among Latinos with ADRD and their families will be needed. To do so, it will continue to be necessary to hold events at flexible times and days, convenient venues, and improve the communication with them by using a wide range of communication moda...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.25.22275517
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.26.22275624

1
1. sciscore 30 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.26.22275624: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: Thank you for sharing your data.
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.26.22275624
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.27.22275689

1
1. sciscore 30 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.27.22275689: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants provided informed consent, and Institutional Review Board (IRB) approval was provided by the Wake Forest School of Medicine.<br>IRB: All participants provided informed consent, and Institutional Review Board (IRB) approval was provided by the Wake Forest School of Medicine.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Other limitations include the use of self-report to determine mask use and a lack of nuance in the masking question to allow for improper use (e.g., not covering mouth or nose), type of mask (e.g., cloth, surgical or KN95/N95 mask), duration of use, and frequency and duration of interactions. Our results suggest decreased protection for the wearer from masks during the Omicron-predominant wave. These findings may also be explained by more frequent exposures outside of one’s household later in the pandemic, increased transmissibility of the Omicron variant, high rates of vaccination and increasing population immunity during the Omicron-predominant period, and a decrease in mask wearing as guidance for vaccinated individuals evolved over time.6,7 While masking continues to be one of the valuable tools to decrease risk of COVID-19 infection, the level of protection for an individual wearer appears to have declined during the Omicron phase of the pandemic. Recent studies have suggested that facemasks have the potential to not only decrease odds of infection but also reduce severity of COVID-19.8 Future research may focus on not only odds of infection but also symptoms and severity of disease associated with mask wearing.
  
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04342884</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">COVID-19 Community Research Partnership</td></tr></table>
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.27.22275689
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.26.22275645

1
1. sciscore 30 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.26.22275645: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.26.22275645
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.26.22275279

1
1. sciscore 29 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.26.22275279: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All study participants provided written consent and all studies were approved by the Institutional Review Board of Stanford University (Numbers: 55479, 57686, 56032, and 55619).<br>IRB: All study participants provided written consent and all studies were approved by the Institutional Review Board of Stanford University (Numbers: 55479, 57686, 56032, and 55619).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">(b) A randomized, single-blind, placebo-controlled trial of Peginterferon Lambda-1a (Lambda) for reducing the duration of viral shedding or symptoms[17] in which oropharyngeal swabs were collected for 28 days following enrollment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence data is available at SRA (BioProject ID: PRJNA842503).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioProject</div><div>suggested: (NCBI BioProject, RRID:SCR_004801)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We also used this pipeline to remove reads mapping to the host genome with Kraken2[24], map reads with Bowtie 2[22], generate consensus sequences with bcftools[25], and assign Nextclade lineages[26].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Kraken2</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study has several limitations. First, we focused on a convenience sample of residual samples with accompanying household information collected in California from March 2020 through May 2021. Replicating these findings in other settings and with more recently emerged SARS-CoV-2 lineages is critical to understand the generalizability of our findings. Second, our study focused on the potential epidemiological value of within-host viral variation. Our focus was on transmission linkage rather than in viral evolutionary dynamics or transmission bottlenecks, which might have different optimal variant identification approaches. Third, many groups have hypothesized that evolution within immune-compromised or immune-suppressed populations may be an important driver of the emergence of new variants of concern or interest[37–41]. Our sample collection did not enable us to test these hypotheses. Forth, the epidemiological utility of within-host variation depends on SARS-CoV-2 sampling and sequencing. Routine sequencing may always not generate sufficient depth to accurately recover within-host variation. In conclusion, we find that SARS-CoV-2 variation within individual hosts may be shared across transmission pairs and may contribute information on transmission linkage on a backdrop of limited diversity among consensus sequences. More broadly, pathogen diversity within individual infections holds largely untapped information that may enhance the resolution of transmission inferences.
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.26.22275279
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.26.22275639

1
1. sciscore 29 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.26.22275639: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study oversight: The study was approved by the institutional review board at Stanford University (protocol #55835).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Staff were matched on prison, position (custody, healthcare), age group (18-39, 40-54, ≥55), and gender (male, female).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study also has several limitations. As an observational cohort study, potential for bias due to confounding is an important consideration. While we aimed to limit confounding by matching on a variety of covariates, including those related to vaccine acceptance and risk of prior infections, the potential for confounding from unmeasured covariates remains. Vaccine uptake varied between residents and staff, and there were differences in the timing of uptake between populations. Moreover, there were differences across the two populations in the timing of prior infections. Differences between the two populations in relative infection risks by vaccination and prior infection status may in part reflect complex interactions of vaccine and prior infection timing, as could the order of vaccination and prior infection among those with both vaccine and infection-acquired immunity. Furthermore, CDCR conducted limited viral sequencing or molecular testing historically and during the study period, and thus we cannot disentangle the effects of variants from temporal waning, nor confirm that all cases observed during the study period were Omicron infections. One potential violation of the assumptions in the test-negative design that testing was not compulsory for all staff during the entire study period. Estimates derived from staff who were boosted or vaccinated with two doses but ineligible for boosters may be biased downward since those staff were no longer required to undergo routine ...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.26.22275639
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.27.493682

1
1. sciscore 29 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.27.493682: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Euthanasia Agents: At the end point of the experiment, all remaining animals in the monoclonal antibody-administered group received an overdose of isoflurane and were humanely euthanized.<br>IACUC: Ethics statement: This study was approved by the Experimental Animal Welfare and Ethical Review Board of Wuhan Institute of Biological Products Co.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Male K18-hACE2 mice (6–8 weeks old, purchased from GemPharmatech Co., Ltd. Company.) were randomly distributed into groups (n = 3–6 mice per group).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Male K18-hACE2 mice (6–8 weeks old, purchased from GemPharmatech Co., Ltd. Company.) were randomly distributed into groups (n = 3–6 mice per group).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then cells were stained with anti-mouse IgG Taxes red conjugated antibody and anti-human IgG FITC-conjugated antibody (Sigma, USA) for another 30 min then analyzed by FACS Aria II (BD, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody Binding Kinetics Measured by SPR: The binding kinetics of mAbs to SARS-CoV-2 Delta-RBD or Omicron-RBD monomer were analyzed using SPR (Biacore 8K; GE Healthcare).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Delta-RBD</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells, Viruses and Proteins: Cell lines (HEK293T and Vero E6 cells) were initially acquired from the American Type Culture Collection (ATCC; USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T-hACE2-cells were generated via the overexpression of the human ACE2 receptor in HEK293T cells and were used in the neutralization assays of pseudoviruses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-hACE2-cells</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then mixtures were added to 2.5 × 105 HEK293T cells expressing ACE2 and incubated at 4 °C for another hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: RRID:CVCL_HA71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293-hACE2 cells (2.5 × 104 cells/100μL per well) were then added into the mixture and incubated at 37 °C in a humidified atmosphere with 5% CO2 for 23 h to 25 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293-hACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Male K18-hACE2 mice (6–8 weeks old, purchased from GemPharmatech Co., Ltd. Company.) were randomly distributed into groups (n = 3–6 mice per group).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV-2 Spike ectodomain (1-1208) with a C-terminal Strep tag for purification and a foldon tag for trimerization was inserted into the pFastBac-Dual vector (Invitrogen) and was expressed using Bac-to-Bac baculovirus system (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pFastBac-Dual</div><div>suggested: RRID:Addgene_137166)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cDNA encoding SARS-CoV-2 Omicron Spike was synthesized (GenBank ID: ULC25168.1) and cloned into the pCAG vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAG</div><div>suggested: RRID:Addgene_74288)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All of these data were analyzed using Flow Jo.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flow Jo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analysis was performed using GraphPad Prism 8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Coot v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Figures were generated using PyMOL 2.0.779</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.27.493682
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.26.22274729

1
1. sciscore 29 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.26.22274729: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.1 Clinical cohort: Whole blood RNA-Sequencing (RNA-Seq) datasets arising from adults (age ≥18 years) presenting with SARS-CoV-2 infection in March to May 2020, were employed from Gene Expression Omnibus (adult COVID-19 and healthy controls from United Kingdom [UK]; adult COVID-19 and inflammatory bowel disease from Spain).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene Expression Omnibus</div><div>suggested: (Gene Expression Omnibus (GEO, RRID:SCR_005012)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To complement and validate the MaSigPro analysis, time-course differential expression analysis was performed in DESeq2, using the likelihood ratio test.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  To the best of our knowledge, this is the first reported analysis of pseudotemporal transcriptomic trends in SARS-CoV-2 infection with comparisons of severity phenotypes, however it has some limitations. There were differences in age and sex between the severity groups, with age and male sex increasing with severity, which is in keeping with the epidemiology of COVID-19 disease [61, 62]. Therefore it is possible that some of the SDE genes we have identified are driven by age or sex, rather than COVID-19 severity. However, given COVID-19 severity, age and sex are so closely intertwined, adjusting for these two variables could mask key drivers of severity, and thus our unadjusted analysis may be a more sensitive approach. This study combines data from UK and Spanish cohorts. Both cohorts were recruited and sampled during the first wave in early 2020, but there may have been differences between the two countries, for example in government advice for staying at home and clinical management. The complexity of this analysis required us to minimise potential interference of the transcriptome by variables such as COVID-19 treatments and coinfections. Therefore a strict set of pre-determined exclusion criteria were employed that resulted in just two thirds of the samples being included in the analysis. Thus the sample size in some of the later severity-pseudotime groups was modest. We only included samples for which “Sample Severity” and “Worst Severity” classification were the same. ...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.26.22274729
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.27.493569

1
1. sciscore 29 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.27.493569: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Euthanasia Agents: Each serial dilution was then mixed 1:1 with 2,000 TCID50/mL SARS-CoV-2 variant virus (Delta variant: strain hCoV-19/USA/MD-HP05647/2021; Omicron variant: strain hCoV-19/USA/MD-HP20874/2021) and incubated for 1 h at + 37 °C ± 2 °C and 5% ± 0.5% of CO2.<br>IACUC: All experimental animal procedures were approved by the Institutional Animal Committee of San Raffaele Scientific Institute.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Female transgenic K18-hACE2 mice, aged 8-10 weeks, were infected via the intranasal route with 1×105 TCID50/mouse of SARS-Cov-2 variant Delta B.1.617.2 virus [hCoV-19/Italy/LOM-Milan-UNIMI9615/2021 (GISAID Accession ID: EPI_ISL_3073880)], obtained from the Laboratory of Microbiology and Virology of San Raffaele Scientific Institute.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Images shown in all figures are representative of at least five random fields (scale bars are indicated).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">One hour after infection, the virus solution was discarded and replaced by a volume of growth medium containing scFv76 or not-neutralizing scFv5 antibody, in a concentration ranging from 214 to 2.6 nM, in triplicate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>scFv5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The modelling was performed with antigen-binding fragment (Fv) as antibody format.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-binding fragment (Fv)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We analyzed 130 CoV-AbDab structures of antibodies (Abs) bound to RBDs (23) and found that 39 out of 42 entries with IGHV3-53/IGHV3-66 HCs, usually coupled with IGKV1-9 (16 Abs) or IGKV3-20 (10 Abs) LCs, share a common binding mode to the RBD.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IGKV3-20</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral Neutralization in Calu-3 cells: To measure the SARS-CoV-2-neutralizing capability of scFv76, a live SARS-CoV-2 assay was performed by measuring the viral load in human lung adenocarcinoma Calu-3 cells, by real-time reverse transcription-quantitative PCR (RT-qPCR), 72 h after virus infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: KCLB Cat# 30055, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Thirty-five μL of each diluted sample/virus mix were then applied in octuplicate to Vero E6 cells seeded at a density of 104 cells/well in a 96-well plate at day -1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell-cell fusion assay: Human alveolar type II-like epithelial A549 cells and embryonic kidney 293T cells were obtained from ATCC (Manassas, VA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: KCB Cat# KCB 200744YJ, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were grown at 37 °C and 5% CO2, in RPMI-1640 (A549 cells) or DMEM (293T cells) medium (Euroclone) supplemented with 10% fetal calf serum (FCS), 2 mM glutamine, and antibiotics.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of A549 cells stably expressing the human ACE2 receptor (A549-hACE2 cells) has been described previously (20).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-hACE2</div><div>suggested: RRID:CVCL_A5KB)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Kinetic constants were obtained by BIAevaluation 3.2 software (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BIAevaluation</div><div>suggested: (BIAevaluation Software, RRID:SCR_015936)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were processed using GraphPad Prism software (V8.0) and the IC50 values calculated using a four-parameter logistic curve fitting approach.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was performed using one-way ANOVA (Prism 6.0 software; GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Both models were independently refined with COOT (25) and PHENIX (26) using the full reconstruction and the local refined map, at 3.4 Å and 4.0 Å resolution, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The images were prepared using ChimeraX (27) and Pymol (http://www.pymol.org/pymol).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pymol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cryo-EM movies were deposited in the Electron Microscopy Public Image Archive under the accession code EMPIAR-10990.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Image Archive</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  In the search of easily deployable therapeutic measures against COVID-19, we recently described 76clAbs, a cluster of human single chain antibody fragments that, in principle, could bypass all limitations of traditional monoclonal antibodies. Indeed, the use of monoclonal antibodies for the therapy of COVID-19 is being challenged by several issues: 1) difficulties in the deployment of therapy, being monoclonal antibodies parenteral drugs to be administered in hospital environments; 2) the risk of antibody-dependent enhancement (ADE) that can be ignited by different routes involving the immunoglobulin Fc interaction with Fc receptor (16) or with the ACE2, recently found to possibly act as a secondary receptor (17), or with Fcγ-expressing cells including monocytes and macrophages that, by triggering the inflammatory cell death, needed to abort the production of infectious virus, cause systemic inflammation that contributes to the severity of COVID-19 pathogenesis (18); 3) evasion properties of SARS-CoV-2 variants, particularly recently emerged Omicron lineages for which most of approved and investigational antibodies lost their neutralization activity (4-10). The single chain antibody format, because of its high stability, can be easily used for friendly self-administrable aerosol treatments. Furthermore, single-chain antibodies are, in principle, devoid of ADE risk because of lack of Fc sequence. 76clAbs, which were selected on the original SARS-CoV-2 Wuhan strain, were found ...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.27.493569
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.25.22275516

1
1. sciscore 29 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.25.22275516: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Additional data limitations stem from the fact that VE estimates for more than one vaccine were reported.
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.25.22275516
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.26.22275661

1
1. sciscore 29 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.26.22275661: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the Indian government and the institutional review boards at participating institutions.<br>IACUC: Patients with severe acute respiratory illness (SARI) or influenza like illness (ILI) i.e., clinically symptomatic population are recruited as per the guidelines of the Institutional Ethics Committee.<br>Consent: The study excluded those individuals who refused to give written consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">For quality control, 5% of negative samples were randomly tested by standard qRT-PCR to check the false-negative rate.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.26.22275661
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.27.493693

1
1. sciscore 29 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.27.493693: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: This study was performed in accordance with the guidelines for the care and use of laboratory animals published and approved by the Committee for Ethics on Animal Experiments and the Committee for Animal Biosafety Level 3 Research of the Egyptian Military Scientific Commission.<br>Euthanasia Agents: Doses were mixed with Fc of IgG mouse anti-Human IgM added as an adjuvant immunogen dissolved in human albumin, phosphate buffer, and sodium chloride without any stabilizers or preservatives.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">For the production of different IC antibodies, twenty-four male rabbits were divided into six groups (numbered 1 through 6), each comprising four rabbits.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mice were randomly divided into twelve groups, five mice per group, and classified into two categories.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">nucleocapsid antibody, and membrane antibody (by AMSBIO) were procured, diluted with 1 ml of PBS; i.e. (1/400, 1/200, 1/100, 1/50, 1/25) and incubated at room temperature for at least 2 hours. 1.6. Preparation of Immune Complexes: Two different modes of immune complexes formulation were used in which mixing of a specific concentration of an antigen with its relevant concentration of an antibody took place and named A1, A2, A3, B1, and B2, where A1, A2, and A3 constitute the CRCx3 series and B1 and B2 constitute the CRCx2 series.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The first mode (a non-specific mixture composed of coronavirus antigens and their non-specific antibodies) included SARS-CoV-2 spike protein (S1 subunit) with anti-nucleocapsid antibodies (A1), nucleocapsid antigen (N) with anti-membrane antibodies (A2) and membrane antigen (M) with anti-spike antibodies (A3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S1 subunit ) with anti-nucleocapsid antibodies ( A1) , nucleocapsid antigen ( N ) with anti-membrane antibodies ( A2 ) and membrane antigen ( M</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The second mode (a specific mix composed of coronavirus antigens and their specific antibodies) included spike antigen (S1) with anti-spike antibodies (B1), and nucleocapsid antigen (N) with anti-nucleocapsid antibodies (B2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>spike antigen ( S1 ) with anti-spike antibodies ( B1)</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>nucleocapsid antigen ( N ) with anti-nucleocapsid antibodies ( B2)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To finalize the complex preparations (A1, A2, A3, B1, and B2) for inducing anti-complex antibodies production in immunized rabbits, 3 ml of the adjuvant goat IgG anti-human IgM Fc (5 ng/ml) (by ABCAM, Cambridge, UK) was dissolved in human albumin and phosphate-buffered normal saline added to the remainder of the sediments and packaged in 1 ml vials of injectable solution with labels (See Supplement: Fig. 4). 1.7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-complex</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Six weeks later, all vaccinated animals were bled and, from their sera, anti-complex precipitated globulin antibodies were collected.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-complex precipitated globulin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Each group of rabbits produced 15 ml of immune serum (200 mg) containing antibodies to the immune complexes A1, A2, A3, B1, or B2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The amounts of anti-complex antibodies precipitated from each rabbit’s sample are then estimated according to the different concentrations of injected complexes mixtures by ELISA. 1.9. ELISA Assay of Produced Immune Complexes Antibodies: For quantitative titration of anti-immune-complexes produced from experimental rabbits’ sera to the different immune complexes formulae, an ELISA assay was performed by coating each one of five 96-well plates with a specific immune complex of A1, A2, A3, B1, or B2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-immune-complexes</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Component B is an anti-complex-antibodies standard calibrator: 5, 10, 20, 30, 40, and 50 μg/ml (previously prepared from rabbits’ sera) for each of the immune complexes (A1, A2, A3, B1, or B2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Also, from day zero, blood samples were taken on days 14, 28, 42 & 56 to measure serum immunological markers and anti-complexes antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-complexes</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sera optical density at 450 nm was measured and the levels of anti-CRCx3 and anti-CRCx2 neutralizing antibodies (NAbs) were evaluated.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CRCx3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CRCx2 neutralizing antibodies ( NAbs )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Increasing serum anti-ICs antibody titers in vaccinated mice was monitored from the beginning and after days 14, 28, 42 & 56 (ELISA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ICs</div><div>suggested: (Kadrmas JL; J Cell Biol. 2004 Cat# ics, RRID:AB_2568207)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The highest produced NAb was Anti-B1 produced against the immune complex of the spike protein and its specific anti-spike antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-B1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, the infected T-helper cell will send signals to excite the B-cells to produce a number of immune antibodies to attach to the viral antigens that are configured by the respiratory cells, thus forming a circulating immune complex that comprises coronavirus antigen (M, N, and S and its specific neutralizing antibody as IC1, IC2, and IC3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IC2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IC3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CRCx was formulated with twenty-five micrograms (25 μg) of different antigens including spike protein (S1 subunit), nucleocapsid (N), or membrane antigen (M) as well as forty micrograms (40 μg) of different antibodies including anti-nucleocapsid, anti-membrane or anti-spike (S1 subunit) antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-nucleocapsid, anti-membrane or anti-spike (S1 subunit)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The main aim of this novel immune peptide CRCx is to stimulate the CD8+ T-cells against the foreign antigenic non-complexes as well as any other hidden circulating immune complex form with any antigenic similarity (antigen/specific-antibodies) and to put the whole immunity system on alert and restoring its normal functions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigenic similarity</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The results also did not find the vaccine to cause antibody-dependent enhancement (ADE) [66] as all the data obtained in this study support the safety and immunogenicity of this candidate vaccine series.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-dependent enhancement (ADE) [66</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antigen/nonspecific-antibody-IC vaccine series needs more experiments to validate our primary hypothesis that they may prompt more potent and more long-lasting protection against mutating versions of SARS-Cov-2 as results showed that within the time limit of this trial, the antigen/specific-antibody-IC vaccine series produced higher NAbs against the vaccine ICs. 1.4. Conclusion: The new immune complex (IC) anti-SARS-Cov-2 candidate vaccine CRCx is composed of 5 different combinations: a series of three antigen/nonspecific-antibody termed (CRCx3) and two antigen/specific-antibody termed (CRCx2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen/nonspecific-antibody-IC</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antigen/specific-antibody-IC</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-Cov-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CRCx2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">However, again, the highest titer in these groups was seen with the high dose CRCx3 subtype composed of spike and its nonspecific antibody of anti-nucleocapsid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-nucleocapsid</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Conclusively, according to the results, the spike antigen/anti-spike specific-antibody combination of CRCx2 gives the highest immunogenicity against Covid-19 virus infection both as a prophylaxis and as a therapy.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen/anti-spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In addition, even though both vaccines were found to significantly reduce or abolish viral load and broncho-alveolar effects in animal models challenged with SARS-CoV-2 within 14 days after receiving the booster dose of the vaccines with no signs of pneumonia in histopathological sections of the virus-challenged animals after vaccination, a higher preference was found to the double-dose antigen-specific-antibody (CRCx2) series and/or those from both CRCx series with the spike protein antigen.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific-antibody (CRCx2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 cells with an average population of 104 cells were cultured for 18–24 h in each well in the growth medium [Eagle’s Minimum Essential Medium (EMEM)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The genomic content of Vero cells of each well with the minimal number of plaques was extracted for further molecular characterization.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Trail 2: For 14 days, starting on the day 15 from primary immunization in trail 1, the BALB/c mice of groups A, B, C, D, E, and F were intramuscularly challenged in the upper leg with a daily dose/mouse of 0.25 ml (total of 108 IU) of live SARS-Cov-2 virus to which 5 IU of DNA polymerase was added.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(Lonza Bioscience) +L</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Lonza Bioscience</div><div>suggested: (Science Exchange, RRID:SCR_010620)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: The SPSS software Version 25 was used to analyze the level of significance, using one-way ANOVA, paired t-test (2-tailed), and Pearson’s correlation methods.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.27.493693
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.25.22273991

1
1. sciscore 29 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.25.22273991: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RNA Extraction of STAT samples at LIC R&D site: Reagent plates including binding plate, wash plate, 80% ethanol plate, and elution plate are prepared in advance for RNA extraction using ThermoScientific KingFisher Flex instrument.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoScientific KingFisher</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequencing STAT samples: A separate STAT pipeline was established at LIC in order to process high priority patient swabs sent directly from hospital emergency departments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAT</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Genome assembly and variant calling: For each specimen, sequencing adapters are first trimmed using Trim Galore v0.6.634, then aligned to the SARS-CoV-2 Wuhan-Hu-1 reference genome (NCBI Nucleotide NC_045512.2) using BWA MEM 0.7.17-r118835.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Trim Galore</div><div>suggested: (Trim Galore, RRID:SCR_011847)</div></div><div style="margin-bottom:8px"><div>BWA</div><div>suggested: (BWA, RRID:SCR_010910)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.25.22273991
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.26.22275641

1
1. sciscore 29 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.26.22275641: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.26.22275641
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.25.493484

1
1. sciscore 29 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.25.493484: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.25.493484
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.25.22275614

1
1. sciscore 29 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.25.22275614: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics Statement: We submitted all study materials to the Georgetown University Institutional Review Board for ethical review.<br>Consent: As the study was granted exemption, informed consent was not required to be obtained.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used Microsoft Excel and STATA v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  These mechanisms for collaboration and communication should also be tested using robust simulation exercises that could help identify weaknesses, ambiguities, and bottlenecks [31]. This study and its results suffer from several limitations. First, and most significantly, the results relied on the completion of a survey by one individual. While we attempted to distribute the survey to the local authority who would be most knowledgeable about epidemic and pandemic preparedness in the city, we cannot guarantee that the data captured by responses are completely valid or factual. One person’s knowledge regarding all of the preparedness efforts, activities, and arrangements in their city may be limited. For instance, a majority of survey participants had served in their current professional role for one to four years and may not have been aware of preparedness efforts in their city before this time. Future research may wish to more deeply examine preparedness efforts in specific cities or to validate the results of this study by reviewing the legislation, regulations, and other legal frameworks that provide the foundation for public health preparedness and coordination between levels of government. Additionally, the specific results from each city are unlikely to hold great amounts of external validity. The governance contexts in which participating cities exist vary widely, and it would be inappropriate to generalize results across contexts without examining the specific authoriti...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.25.22275614
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.25.493467

1
1. sciscore 29 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.25.493467: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All cell lines used in this study were monitored by SYBR® Green real-time PCR RT assay periodically to ensure the absence of retroviral contamination and were stained with DAPI to test for mycoplasma contamination.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies: Primary antibodies, including anti-ORF7a, anti-pan HLA ABC, HLA allele-specific antibodies, and peptide-loading complex antibodies, are listed and described in the Supplementary Information Table.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antibodies</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-ORF7a,</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies included goat anti-rabbit and goat anti-mouse from Novus conjugated to DyLight 650 or Janelia Fluor 646 and goat anti-mouse from ThermoFisher Scientific conjugated to Alexa Flour 488 for immunofluorescence, or IRDye® 800CW, or IRDye® 680 (LI-COR Biosciences) for Western blot analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (GenWay Biotech Inc. Cat# GWB-646B8F, RRID:AB_10260289)</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Novus Cat# NBP1-72739JF646, RRID:AB_2857337)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">At 48 h post-transduction, cells were detached from plates with 5 mM EDTA in PBS and stained for cell surface HLA-A, B, C expression with anti-HLA-A, B, C antibody conjugated to AF647 (W6/32, Biolegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HLA-A</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In some experiments, cell surface HLA-A level was determined with antibody against the HLA-A allele (YTH862.2), followed by Goat anti-Rat Alexa Fluro 488.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Rat</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The same procedure was done to quantify tetherin downregulation, except that 293T cells stably expressing HA-tagged tetherin were used as target cells, and cells were stained with anti-HA antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 48 h, cells were washed with PBS (Corning) and harvested using TrypLE (Life Technologies) before staining with Live/Dead Blue dead cell stain (Invitrogen) and a BV510-conjugated pan-HLA class I antibody (clone W6/32, BioLegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pan-HLA class I</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Intracellular staining was performed in Perm/Wash Buffer with an AF647-conjugated pan-HLA class I antibody (clone W6/32, BioLegend) and a SARS-CoV-2 nucleocapsid antibody (clone A20087H, mouse IgG2b isotype, BioLegend) followed by a secondary antibody stain with PE-Cy7-conjugated anti-mouse IgG2b (BioLegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>mouse IgG2b</div><div>suggested: (Bioss Cat# bs-0330R-Cy7, RRID:AB_10894111)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After lysis on ice for 20 min, followed by centrifugation at 10,000 rpm for 10 min at 4°C, clarified lysates were mixed with 2 μg mouse anti-ORF7a monoclonal antibody (Genetex), mouse anti-HLA-A (Proteintech 66013-1-Ig), or rabbit anti-HLA-B (ThermoFisher Scientific PA5-35345)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ORF7a</div><div>suggested: (SICGEN Cat# AB0409, RRID:AB_2895426)</div></div><div style="margin-bottom:8px"><div>anti-HLA-B</div><div>suggested: (Thermo Fisher Scientific Cat# PA5-35345, RRID:AB_2552655)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">+ 0.1 μg/mL each of anti-CD3 (Ultra-LEAF purified anti-human CD3 antibody clone OKT3; BioLegend, San Diego, CA) and anti-CD28 (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human CD3</div><div>suggested: (STEMCELL Technologies Cat# 10971, RRID:AB_2827806)</div></div><div style="margin-bottom:8px"><div>anti-CD28</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Ultra-LEAF purified Anti-human CD28 antibody clone 28.2; BioLegend), 37°C 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-human CD28</div><div>suggested: (Fitzgerald Industries International Cat# 10R-CD28aHU, RRID:AB_1283221)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then washed in 2% FBS phosphate-buffered saline + 2mM EDTA and surface stained with fluorochrome-conjugated antibodies to CD3-Brilliant Violet 785 clone OKT3, CD8-BV605 clone SK1, MHC-I-PacBlue clone W6/32, (all from BioLegend),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD8-BV605</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following 10 min permeabilization at room temperature with 0.2% IGEPAL CA-630 (Sigma I3021), 10% goat serum in PBS, cells were probed for 1 hr at RT with primary antibodies in 0.1% Tween20 (Fisher BP337-500), 10% goat serum in PBS as indicated: HLA-A (Sigma H1650-100STS, 0.4 μg/ml), beta-2 microglobulin (Novus NBP2-44471, 0.4 μg/ml) or ORF7a (Bioworld NCP011, 2 μg/ml).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>beta-2 microglobulin</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: The human embryonic kidney HEK-293T cell line, human hepatoma-derived HuH-7.5 cell line, and human alveolar basal epithelial A549 cell line were maintained in DMEM supplemented with 10% fetal bovine serum (Sigma F8067) and gentamicin (Gibco).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HuH-7.5</div><div>suggested: RRID:CVCL_7927)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The viral stocks were then used to inoculate105 target cells (293T, U2OS, or HuH7.5) in 12-well plates at an MOI of 0.5.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>U2OS</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Assessment of MHC-I downregulation after live SARS-CoV-2 infection: Viral stocks of USA-WA1/2020 (BEI Resources) and icSARS-CoV-2-mNG (UTMB WRCEVA (32)) were generated by expanding virus on Vero-E6 cells (BEI Resources) and determining viral titers by plaque assay on Vero-E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549-ACE2 cells (ATCC) were plated at 1 × 106 cells per well in a 6-well plate in DMEM (Corning) supplemented with HEPES (Corning), penicillin/streptomycin (Corning)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To measure the sensitivity of MHC-I to Endo H treatment, A549 cells were transduced with lentivirus stocks expressing ORF7a proteins from SARS-CoV, SARS-CoV-2, or bat SARSr CoVs at an MOI of 0.5.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After digestion with XhoI and NotI, the purified PCR products were then inserted into the pSCRPSY expression vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSCRPSY</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Assessment of MHC-I downregulation by ORF7a: To assess HLA downregulation by SARS-CoV viral proteins, viral stocks were generated by transfecting 5 μg of pSCRPSY-based expression plasmids encoding either no SARS-CoV viral protein (empty vector) or individual SARS-CoV open reading frame, 5 μg of an HIV-1 Gag-Pol expression plasmid (pCRV1/GagPol) and 1 μg of VSV-G expression plasmid in 293T cells in 10-cm dishes using polyethylenimine (PolySciences)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSCRPSY-based</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCRV1/GagPol</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>VSV-G</div><div>suggested: RRID:Addgene_138479)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry was performed on a BD Symphony (BD Biosciences, San Jose, CA) and analyses were performed using FlowJo v10.7.1 and GraphPad Prism 9 software. Immunoprecipitation: HEK-293T cells were seeded at 2 X105 in 6-well plates and, on the next day, were inoculated with ORF7a-expressing SCRPSY lentivirus stocks.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Image analysis was done using ImageJ (Version 2.0.0-rc-59/1.51w).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.25.493467
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.25.22275599

1
1. sciscore 29 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.25.22275599: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The ordering of the statements in the involvement and attitude scales was randomised to avoid bias in responses.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were conducted using SPSS [29].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.25.22275599
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.26.493517

1
1. sciscore 29 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.26.493517: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike proteins were captured through their C-terminal His-tag over an anti-His antibody surface.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For each residue within the RBD, the frequency of antibody recognition was calculated as the number of contact antibodies32.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibodies32</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The structures of antibody-spike complexes for modeling were also obtained from PDB (7L5B (2-15), 6XDG (REGN10933), and 7KMG (LY-CoV555)).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REGN10933</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Heavy chain variable (VH) and light chain variable (VL) genes for each antibody were synthesized (GenScript), then transfected into Expi293 cells (Thermo Fisher Scientific), and purified from the supernatant by affinity purification using rProtein A Sepharose (GE).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A14527); Vero-E6 cells were obtained from the ATCC (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CRL-1586); HEK293T cells were obtained from the ATCC (CRL-3216).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization curves and IC50 values were derived by fitting a nonlinear five-parameter dose–response curve to the data in GraphPad Prism v.9.2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PyMOL v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.26.493517
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.24.22275467

1
1. sciscore 29 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.24.22275467: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">anti-SARS-CoV-2-S anti-receptor binding domain (RBD) pan immunoglobulin assay (units/mL, approximately 1:1 with World Health Organization binding antibody units [BAU]).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2-S anti-receptor binding domain ( RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Additionally, the Meso Scale Diagnostics (MSD, Rockville, MD) research assay was used to measure anti-RBD and anti-nucleocapsid (anti-N) binding antibody via the V-PLEX COVID-19 Respiratory Panel 3 Kit at 1:5000 dilution per manufacturer’s protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-nucleocapsid</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-N</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were conducted on Stata/SE 17.0 (College Station, TX) and Microsoft Excel (2019).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  A limitation of this study is that includes a small, heterogeneous sample. While this study aims to capture the real-life efficacy of T+C, the true effect of T/C is difficult to capture due to confounding factors from varying vaccination timeline, SARS-CoV-2 infection status, and other monoclonal antibody injections. Another limitation is the lack of long-term follow-up to assess rates of clinical breakthrough and safety. The study relied on participant surveys sent out a week after T+C doses and unsolicited patient self-reported to assess the safety and clinical breakthrough. Considering that preliminary safety and breakthrough data revealed events months after injections, future studies should be conducted on the long-term safety and breakthrough rate of T+C, particularly in SOTRs as their interaction with T+C has been understudied. T+C is a reasonable complementary strategy to vaccination in high-risk SOTRs to improve neutralizing capacity against select Omicron sublineages. Assessment of the real-world efficacy and safety of T+C in SOTR is of utmost importance, since SOTRs face heightened risks of severe illness or death from COVID-19 and since only few SOTRs were included in the PROVENT trial. Studies such as ours incorporating both clinical and laboratory data offer valuable insights into the real-world efficacy and safety of T+C in one of our most vulnerable population. Further research examining the durability of neutralization against emerging Omicron sublineages is ...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.24.22275467
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.25.22275006

1
1. sciscore 29 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.25.22275006: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The WCG Institutional Review Board approved this study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was performed using SAS Enterprise Guide version 7.15 and visualizations in R statistical software version 4.0.5 (R Project for Statistical Computing).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>R Project for Statistical</div><div>suggested: (R Project for Statistical Computing, RRID:SCR_001905)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations: These overuse measures are indicators of low-value care, and are limited by the diagnostic information available in claims data. We used measures from the Lown Institute overuse metric that had a specific denominator cohort.7 We did not include the two measures from this metric that have a denominator of all patients at the hospital over the selected time period (inferior vena caval filters and renal stenting). We adjusted for and investigated state-level beneficiary counts and COVID-19 incidence rates. A more granular approach could have used counts at the hospital referral region or county level and explored within and across region differences. COVID-19 incidence at more local regional levels may be more predictive of overuse or patient volumes than at the state level. This could be future research built from this current study, which presents a more high-level overview of specific denominator and numerator overuse measure rates throughout 2020. This study only investigated the impact on services through 2020. By the end of 2020, the US was entering another COVID-19 surge that lasted most of the winter. Later in 2021, the COVID-19 Omicron variant wave caused another surge in cases and hospitalizations. The changes to denominator and overuse rates of these measures may be different during each pandemic stage. Conclusions: For most investigated overuse measures, we observed the largest decrease in overuse rates during the COVID-19 shutdown period. These were lar...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.25.22275006
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.25.22275586

1
1. sciscore 29 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.25.22275586: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">We aimed to find, assess and synthesize all randomized controlled trials (RCTs) of severe or critical COVID-19 and acute hypoxemic respiratory failure (AHRF).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  There are several limitations in the included RCTs that should be considered alongside the findings. There was no evidence located for use of non-invasive ventilation strategies in infants or children or important subpopulations (e.g., pregnant women), very limited evidence to support the specific use of named interfaces for the ventilation strategies considered (e.g., nasal cannula, simple face mask, venturi mask, oronasal, helmet or other), and only one RCT reported patient-important outcomes. The hospital LOS data are challenging to interpret as competing risk for death may not have been appropriately accounted for in most RCTs, or it is not possible to assess how competing risk was handled in an RCT66. In the set of included RCTs, the LOS outcomes are generally either secondary or exploratory outcomes, and as such, the estimates presented may be confounded by death. The LOS data for survivors and non-survivors is rarely presented. Patient heterogeneity was noted by Perkins et al. in the pragmatic RECOVERY-RS RCT but not explored in-depth41. Owing to the rapid synthesis approach, there was no formal extraction or synthesis of harm outcomes. When non-invasive ventilation supports are considered, potential benefits must be consiered alongside any conceivable harms. Use of ventilation strategies could delay other clinical intervention that could lead to worsening patient prognosis, cause discomfort to the patient during use, or result in surficial wounds or pressure sores whe...
  
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04326075</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Early CPAP in COVID-19 Patients With Respiratory Failure.</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04381923</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Withdrawn</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">COVIDNOCHE Trial (HFNO Versus CPAP Helmet) in COVID-19 Pneum…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04507802</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Not yet recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Helmet vs Face Mask in Patients With Acute Respiratory Distr…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04667923</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Noninvasive Ventilation in Moderate-to-severe COVID-19-assoc…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04477668</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Helmet Non-Invasive Ventilation for COVID-19 Patients</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04390191</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Terminated</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Early CPAP in COVID-19 Confirmed or Suspected Patients</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04395807</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Terminated</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Helmet CPAP Versus HFNC in COVID-19</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04655638</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">HFNT vs. COT in COVID-19</td></tr></table>
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.25.22275586
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.26.22275631

1
1. sciscore 29 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.26.22275631: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the institutional review board of the University of Hong Kong / Hospital Authority Hong Kong West Cluster (reference no. UW 20-493).<br>Consent: Given the extraordinary nature of the COVID-19 pandemic, individual patient-informed consent was not required for this retrospective cohort study using anonymized data.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Up to ten control patients were randomly matched with each of the case according to age (within the same year), sex, date of COVID diagnosis (within the same date), Charlson Comorbidity Index (CCI), and full SARS-CoV-2 vaccination (with at least two doses of Comirnaty or three doses of CoronaVac).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were performed using Stata version 17 (StataCorp LP, College Station, TX).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Nevertheless, a number of study limitations should be acknowledged. Firstly, residents at the RCHE were excluded from the current analysis because of substantial missing records, complex referral patterns between different levels and categories of treatment facilities and/or prolonged delays in oral antiviral prescription during the peak of this pandemic wave. Further studies are needed to examine the real-world safety and effectiveness of oral antivirals in specific healthcare settings, for instance, nursing homes and residential care facilities. Secondly, indication bias could not be eliminated in the prescription of oral antivirals, as reflected by the considerably older age and lower percentage of patients who had been fully vaccinated among oral antiviral users than matched controls at baseline. Indication bias might also be present in the clinical decision to prescribe molnupiravir versus nirmatrelvir/ritonavir, as the latter could be confounded by its significant drug-drug interactions. After matching, patient characteristics between oral antiviral and respective control groups were well balanced at baseline. Thirdly, some information biases might exist in the collection of data during the peak of this pandemic wave, such as the self-reporting of COVID-19 cases based on positive RAT with varying sensitivity. Lastly, there might have been an underreporting of COVID-19 cases during the study period, and the overwhelmed public healthcare system might have prevented some p...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.26.22275631
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.26.22275585

1
1. sciscore 29 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.26.22275585: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Participants provided informed consent (recorded digitally on the survey platforms).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Strengths and limitations: LCSS was informed by theory and other stigma scales, co-designed with people with Long Covid and validated in a large UK sample, and takes less than 10 minutes to complete. This study has two notable limitations. First, the convenience non-probability sampling limits generalisability: university-educated white women from England are over-represented, and this may have resulted in an under- or over-estimation of Long Covid stigma. Women and ethnic minorities may be more stigmatised by other similar conditions such as ME/CFS or fibromyalgia(39), though there is little quantitative evidence to support this. The survey did not include patients hospitalised with COVID-19 in the first two weeks of illness, indicating severe acute disease. Stigma levels could be higher in this group as they may have a higher prevalence of prolonged ongoing symptoms(40), or could be lower due to legitimisation of their illness given by the severity of its acute stage. However, the community sample renders this study unique within a largely clinical evidence-base where diagnostic coding for Long Covid remains patchy and inconsistent due to varying knowledge and the absence of specific guidelines(41). The social media recruitment strategy aimed to include an underrepresented group of people living with Long Covid – those not actively engaged with the healthcare system. Second, stigma is a non-pathological construct and measurements do not have standardised diagnostic criteria...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.26.22275585
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.25.22275300

1
1. sciscore 29 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.25.22275300: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics statement: This study was performed in accordance with the Declaration of Helsinki and approved by the corresponding Institutional Review Board (PR(AG)212/2020) of the Vall d’Hebron University Hospital (HUVH), Barcelona, Spain.<br>Consent: Written informed consent was provided by all patients recruited to this study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, anti-CD3 (BV650, BD Biosciences) and anti-CD45 (BV605, BD Biosciences) antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD45</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were subsequently fixed and permeabilized using the FoxP3 Fix/Perm kit (BD Biosciences) and stained with anti-IL-4 (PE-Cy7, eBioscience), anti-IL-10 (PE, BD Biosciences), anti-T-bet (BV421, Biolegend) and anti-IFNγ (AF700, Invitrogen) antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IL-4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>PE-Cy7</div><div>suggested: (Bioss Cat# bs-0698R-PE-Cy7, RRID:AB_11041615)</div></div><div style="margin-bottom:8px"><div>anti-IL-10</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-T-bet ( BV421</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IFNγ</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell surface antibody staining included anti-CD3 (Per-CP), anti-CD4 (BV605) and anti-CD56 (FITC) (all from BD Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD56</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 serology: The serological status of patients included in this study was determined in serum samples using two commercial chemiluminescence immunoassays (CLIA) targeting specific SARS-CoV-2 antibodies: (1) Elecsys Anti-SARS-CoV-2 (Roche Diagnostics, Mannheim, Germany) was performed on the Cobas 8800 system (Roche Diagnostics, Basel, Switzerland) for the determination of total antibodies (including IgG, IgM, and IgA) against nucleocapsid (N) SARS-CoV-2 protein; and (2) Liaison SARS-CoV-2 TrimericS IgG (DiaSorin, Stillwater, MN) was performed on the LIAISON XL Analyzer (DiaSorin, Saluggia, Italy) for the determination of IgG antibodies against the spike (S) glycoprotein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA ) against nucleocapsid ( N</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To neutralize contaminating VSV*ΔG(Luc)-G particles cells were incubated overnight in media containing 10% of the supernatant from the I1 hybridoma (ATCC CRL-2700), containing anti-VSV-G antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-VSV-G</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells were transfected with 3µg of the omicron plasmid (pcDNA3.1 omicron).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: KCB Cat# KCB 200744YJ, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next day, viral particles were harvested and titrated in VeroE6 cells by enzyme luminescence assay (Britelite plus kit; PerkinElmer).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses: Flow cytometry data was analyzed using FlowJo v10.7.1 software (TreeStar).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data and statistical analyses were performed using Prism 8.0 (GraphPad Software, La Jolla, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.25.22275300
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.25.22275487

1
1. sciscore 29 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.25.22275487: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Daily vaccination rates of BioNTech and CoronaVac were collected from the COVID-19 Thematic Website [</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioNTech</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations: Some limitations exist in our study. First, the study mainly focus on the disease transmissibility while not explore the impact of vaccine or seasonal factors on disease severity. Second, the number of total infections may be underestimated since the proportion of cases that are underreported is largely unknown when the testing capacity is limited. Therefore, we attempted to capture the changes in underreporting and reporting delay in our modelling. Third, model validation may be sensitive to the assumption of the protectiveness of vaccine or natural infections. Here the data used in our study were based on a published empirical study without age stratification [7]. Conclusion: A recent work has suggested a striking effect of temperature on the spread of COVID-19 [10]. Here, we found that temperature was associated with a larger impact on the transmissibility than strict public health interventions without lockdown throughout a significant outbreak in a single city. Incorporating seasonal variation in temperature can improve the accuracy of modelling of SARS-CoV-2 transmission, which helps to find a balance between normal life and low health impact.
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.25.22275487
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.25.22275592

1
1. sciscore 29 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.25.22275592: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">35 Exposure and Outcomes: Pregnant women exposed to the pandemic restrictions during the first and second waves between March 1, 2020, and March 31, 2021, were compared to those who were pregnant before the pandemic period.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">42 Analyses were conducted using SAS, version 9.4 (SAS Institute, Inc)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS</div><div>suggested: (SASqPCR, RRID:SCR_003056)</div></div><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  The main limitations of this study should be acknowledged. We did not examine the influence of COVID-19 infection on the study outcomes; however, the number of reported COVID-19 positive pregnant women was small in relation to the total pregnancies in our cohort, and it is unlikely that viral infection would change our results.43 Although, we did not investigate variations across the different regions of Manitoba, the changes to maternal healthcare were implemented across the provincial healthcare system minimizing any differential variability within the data. However, some rural regions may have been substantially impacted during the pandemic compared to larger cities. Moreover, we did not include out of hospital births, maternal smoking and alcohol/substance use, and vaccination rates among pregnant women in Manitoba
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.25.22275592
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.25.22275603

1
1. sciscore 29 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.25.22275603: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: 17 The study protocol was approved by the Institutional Review Board at the City University of New York (CUNY).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our cross-sectional study has limitations, including self-report of testing outcomes over a 14-day recall period (subject to recall bias) and limited sample size especially in subgroups of those with evidence of COVID-19. For those with prior COVID, we did not capture information on timing of prior infections, which underestimates the degree of hybrid protection, though a substantial proportion of NYC adults were infected during the recent BA.1 surge.9,16 Our case definition would likely capture some, but not all, of the estimated 20-30% of individuals whose SARS-CoV-2 infection may remain asymptomatic throughout their infection,30,31 as well as those who were symptomatic but were not aware of a close contact. Finally, our survey could not include those whose primary language was not English or Spanish. Strengths include the representative nature of the study, the study’s timing at the start of the BA.2 /BA.2.12.1 surge, and measurement of several important factors that are not currently available through routine surveillance, including outcomes among those who do not test positive with a provider, prevalence among individuals vulnerable to COVID-19, hybrid protection, and awareness/uptake of nirmatrelvir/ritonavir.
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.25.22275603
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.24.22275326

1
1. sciscore 29 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.24.22275326: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Individuals were identified through the Mass General Brigham health system or upon referral from treating providers and contacted by phone for informed consent at the time of symptom recurrence.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">After 15 minutes, result were interpreted as positive, negative, or discordant by a reader blinded to the viral load result.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, aliquoted viral transport media were filtered with 0.45-0.65um centrifugal filters and added to Vero-E6 cells plated in DMEM culture media supplemented with 2% fetal bovine serum, HEPES, antibiotic-antimycotic solution and 5ug/mL of polybrene.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antigen testing using Abbott BinaxNow SARS-CoV-2 Rapid Antigen Assay: Frozen viral transport media aliquots were thawed on ice and 50uL was transferred to a test tube.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott BinaxNow</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study should be interpreted in the context of limitations. Most notably, this represents a small case series so precise estimates of culture positivity, duration of viral shedding, or incidence of drug resistance cannot be made. We also enrolled individuals after clinical rebound, so cannot determine the incidence of this syndrome among individuals taking nirmatrelvir-ritonavir treatment. Finally, we use viral culture as a proxy measure of contagiousness but cannot quantify the risk of transmission for this patient population. In summary, recurrent clinical disease after nirmatrelvir-ritonavir therapy for COVID-19 is associated with high viral load and, in some cases, culturable virus. Culturable virus was present for up to two weeks after completion of therapy. Consideration should be given to revising public health guidelines to specifically recommend repeat testing and isolation in these cases. Future work is needed to better understand the causes, clinical significance, and public health consequences of symptomatic relapse after nirmatrelvir-ritonavir.
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.24.22275326
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.25.22275590

1
1. sciscore 29 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.25.22275590: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">We use a single-group ITSA because it is a quasi-experimental tool that is particularly useful when data cannot be fully randomized, there is no comparison group, and there is a need to consider the effect of only one intervention.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: Thank you for sharing your data.
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.25.22275590
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.25.22275610

1
1. sciscore 29 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.25.22275610: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lineages were determined by running sequences through PANGO v1.8, Pangolin v4.0.6, and pangoLEARN v1.2.133, and Scorpio v0.3.17 (O’Toole et al., 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PANGO</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.25.22275610
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.26.493529

1
1. sciscore 28 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.26.493529: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.26.493529
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.26.493539

1
1. sciscore 28 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.26.493539: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To measure the surface expression level of S protein, effector cells were stained with rabbit anti-SARS-CoV-2 S S1/S2 polyclonal antibody (Thermo Fisher Scientific, Cat# PA5-112048, 1:100)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Normal rabbit IgG (SouthernBiotech, Cat# 0111-01, 1:100) was used as negative controls, and APC-conjugated goat anti-rabbit IgG polyclonal antibody (Jackson ImmunoResearch, Cat# 111-136-144, 1:50) was used as a secondary antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 111-136-144, RRID:AB_2337987)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The deparaffinized sections were exposed to EnVision FLEX target retrieval solution high pH (Agilent, Cat# K8004) for 20 minutes at 97°C to activate, and mouse anti-SARS-CoV-2 N monoclonal antibody (clone 1035111, R&D systems, Cat# MAB10474-SP, 1:400) was used as a primary antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 N</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: HEK293T cells (a human embryonic kidney cell line; ATCC, CRL-3216)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, HEK293 cells (a human embryonic kidney cell line; ATCC, CRL-1573) and HOS-ACE2/TMPRSS2 cells (HOS cells stably expressing human ACE2 and TMPRSS2) (Ferreira et al., 2021; Ozono et al., 2021) were maintained in DMEM (high glucose) (Sigma-Aldrich, Cat# 6429-500ML) containing 10% fetal bovine serum (FBS, Sigma-Aldrich Cat# 172012-500ML), and 1% penicillin-streptomycin (PS) (Sigma-Aldrich, Cat# P4333-100ML).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HOS-ACE2/TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293-ACE2/TMPRSS2 cells (HEK293 cells stably expressing human ACE2 and TMPRSS2) (Motozono et al., 2021) was maintained in DMEM (high glucose) containing 10% FBS, 1 µg/ml puromycin, 200 ng/ml hygromycin (Nacalai Tesque, Cat# 09287-84) and 1% PS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293-ACE2/TMPRSS2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293-C34 cells (IFNAR1 KO HEK293 cells expressing human ACE2 and TMPRSS2 by doxycycline treatment) (Torii et al., 2021) were maintained in DMEM (high glucose) containing 10% FBS, 10 μg/ml blasticidin (InvivoGen, Cat# ant-bl-1) and 1% PS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293-C34</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero cells [an African green monkey (Chlorocebus sabaeus) kidney cell line; JCRB Cell Bank, JCRB0111] were maintained in Eagle’s minimum essential medium (EMEM) (Sigma-Aldrich, Cat# M4655-500ML) containing 10% FBS and 1% PS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VeroE6/TMPRSS2 cells (VeroE6 cells stably expressing human TMPRSS2; JCRB Cell Bank, JCRB1819) (Matsuyama et al., 2020) were maintained in DMEM (low glucose) (Wako, Cat# 041-29775) containing 10% FBS, G418 (1 mg/ml; Nacalai Tesque, Cat# G8168-10ML) and 1% PS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 cells (a human lung epithelial cell line; ATCC, HTB-55) were maintained in EMEM (Sigma-Aldrich, Cat# M4655-500ML) containing 20% FBS and 1% PS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: ATCC Cat# HTB-55, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3/DSP1-7 cells (Calu-3 cells stably expressing DSP1-7) (Yamamoto et al., 2020) were maintained in EMEM (Wako, Cat# 056-08385) containing 20% FBS and 1% PS. 293S GnTI(-) cells (HEK293S cells lacking N-acetylglucosaminyltransferase (Kubota et al., 2016) were maintained in DMEM (Nacalai tesque, #08458-16 containing 2% FBS without PS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293S</div><div>suggested: RRID:CVCL_A784)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the amount of pseudoviruses prepared was quantified by the HiBiT assay using Nano Glo HiBiT lytic detection system (Promega,Cat# N3040) as previously described (Ozono et al., 2021; Ozono et al., 2020), and the same amount of pseudoviruses (normalized to the HiBiT value, which indicates the amount of p24 HIV-1 antigen) was inoculated into HOS-ACE2/TMPRSS2 cells, HEK293-ACE2 cells or HEK293-ACE2/TMPRSS2 and viral infectivity was measured as described above (see “Neutralization assay” section).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">On day 3 (24 hours posttransfection), 16,000 effector cells were detached and reseeded into 96-well black plates (PerkinElmer, Cat# 6005225), and target cells (VeroE6/TMPRSS2 or Calu-3/DSP1-7 cells) were reseeded at a density of 1,000,000 cells/2 ml/well in 6-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3/DSP1-7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 infection: One day before infection, Vero cells (10,000 cells) and VeroE6/TMPRSS2 cells (10,000 cells) were seeded into a 96-well plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6/TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Preparation of mouse sera: BALB/c mice (female, 7 weeks old) were immunized with 1 μg SARS-CoV-2 BA.2 RBD protein in 50% AddaVax (Invivogen, Cat# vac-adx-10) at day 0 and 14.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting PCR fragment was digested with KpnI and NotI and inserted into the corresponding site of the pCAGGS vector (Niwa et al., 1991).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_127347)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2 S RBD (residues 322-536) was cloned into the expression vector pHLsec containing the N-terminal secretion signal sequence and the C-terminal His6-tag sequence (Aricescu et al., 2006).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHLsec</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">kit (Roche, Cat# KK2601) and assembled in vivo by yeast [Saccharomyces cerevisiae strain EBY100 (ATCC, MYA-4941)] homologous recombination with pJYDC1 plasmid (Addgene, Cat# 162458) as previously described (Dejnirattisai et al., 2022; Kimura et al., 2022a; Kimura et al., 2022b; Motozono et al., 2021; Yamasoba et al., 2022a; Zahradnik et al., 2021a)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pJYDC1</div><div>suggested: RRID:Addgene_162458)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To prepare effector cells, HEK293 cells were cotransfected with the S-expression plasmids (500 ng) and pDSP8-11 (500 ng) using PEI Max (Polysciences, Cat# 24765-1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pDSP8-11</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To prepare target cells, HEK293 and HEK293-ACE2/TMPRSS2 cells were transfected with pDSP1-7 (500 ng) (Kondo et al., 2011).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pDSP1-7</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequencing reads were trimmed using fastp v0.21.0 (Chen et al., 2018) and subsequently mapped to the viral genome sequences of a lineage A isolate (strain WK-521; GISAID ID: EPI_ISL_408667) (Matsuyama et al., 2020) using BWA-MEM v0.7.17 (Li and Durbin, 2009).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA-MEM</div><div>suggested: (Sniffles, RRID:SCR_017619)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Variant calling, filtering, and annotation were performed using SAMtools v1.9 (Li et al., 2009) and snpEff v5.0e (Cingolani et al., 2012).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAMtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The viral genome sequences were mapped to the reference sequence of Wuhan-Hu-1 (GenBank accession number: NC_045512.2) using Minimap2 v2.17 (Li, 2018) and subsequently converted to a multiple sequence alignment according to the GISAID phylogenetic analysis pipeline (https://github.com/roblanf/sarscov2phylo).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Minimap2</div><div>suggested: (Minimap2, RRID:SCR_018550)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tree reconstruction was performed by RAxML v8.2.12 (Stamatakis, 2014) under the GTRCAT substitution model.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RAxML</div><div>suggested: (RAxML, RRID:SCR_006086)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Parameter estimation was performed via the MCMC approach implemented in CmdStan v2.28.1 (https://mc-stan.org) with CmdStanr v0.4.0 (https://mc-stan.org/cmdstanr/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CmdStan</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>https://mc-stan.org</div><div>suggested: (Stan, RRID:SCR_018459)</div></div><div style="margin-bottom:8px"><div>CmdStanr</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The assay of each serum was performed in triplicate, and the 50% neutralization titer (NT50) was calculated using Prism 9 software v9.1.1 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RBD expression and ACE2 signal were recorded by using a FACS S3e cell sorter device (Bio-Rad), background binding signals were subtracted and data were fitted to a standard noncooperative Hill equation by nonlinear least-squares regression using Python v3.7 (https://www.python.org) as previously described (Kimura et al., 2022a; Kimura et al., 2022b; Motozono et al., 2021; Yamasoba et al., 2022a; Zahradnik et al., 2021b).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div><div style="margin-bottom:8px"><div>https://www.python.org</div><div>suggested: (CVXOPT - Python Software for Convex Optimization, RRID:SCR_002918)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Surface expression level of S proteins (Figures 3C and S2B) was measured using FACS Canto II (BD Biosciences) and the data were analyzed using FlowJo software v10.7.1 (BD Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The size of syncytium (GFP-positive area) was measured using Fiji software v2.2.0 (ImageJ) as previously described (Suzuki et al., 2022; Yamasoba et al., 2022a).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The stained cells were washed with tap water and dried, and the size of plaques was measured using Fiji software v2.2.0 (ImageJ).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were incorporated as virtual slide by NDP.scan software v3.2.4 (Hamamatsu Photonics).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NDP.scan</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These analyses were performed in R v4.1.2 (https://www.r-project.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.r-project.org/</div><div>suggested: (R Project for Statistical Computing, RRID:SCR_001905)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.26.493539
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.24.22275552

1
1. sciscore 28 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.24.22275552: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, ProQuest Health and Medical Complete, ScienceDirect, Ovid, HERDIN, Google Scholar, and Cochrane Library.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Google Scholar</div><div>suggested: (Google Scholar, RRID:SCR_008878)</div></div><div style="margin-bottom:8px"><div>Cochrane Library</div><div>suggested: (Cochrane Library, RRID:SCR_013000)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Another limitation is the possibility that some relevant studies were not taken into account because they have been published in languages other than English (e.g., Chinese). We also did not have access to some other databases that may store some articles on COVID-19 and cognitive dysfunctions. And lastly, there could be some other studies on this theme in the literature that skipped our attention and analyses. However, a comprehensive search strategy that covers a broad range of evidence was implemented. This systematic review gathered evidence that could provide clarity on the association between brain fog and COVID-19 infection. The information acquired in this study may help re-evaluate the impact of the virus. Furthermore, the use of the data gleaned from this analysis may assist in earlier treatment, allowing physicians and clinicians to manage the neurological manifestation effectively. Additionally, this will aid in the development of various therapeutic strategies to support COVID-19 patients in recovering from impaired cognitive capacity. Finally, the analysis of such data could provide an insight into the challenges that this virus could cause people in their prime years, particularly those in the workforce.
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.24.22275552
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.24.22275549

1
1. sciscore 28 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.24.22275549: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: Thank you for sharing your code and data.
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  4.3 Limitations and future research opportunities: This study has several limitations, which pose opportunities for future research. This is an ecological study using aggregated data at the county level. It is subjected to ecological fallacy. Future studies can use individual level data or experimental studies to confirm the causal relations and the potential underlying mechanisms (Jiang et al., 2021). Second, the unit of analysis is the county due to the availability of COVID-19 mortality data and other confounding variable. Though county data are widely used in nationwide studies, future studies should use finer-grained data (i.e., census tract level data). Different scales of analyses may reveal different associations between neighborhood greenspace and health outcomes (Richardson et al., 2012). Third, our research investigated associations using data from 2020, but the situation has continued to evolve with the emergence of vaccines and COVID-19 variants (e.g., Delta and Omicron). Future studies should consider the new situations accordingly.
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.24.22275549
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.24.22275508

1
1. sciscore 28 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.24.22275508: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: Thank you for sharing your code and data.
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations: There are several limitations to this study, First, mortality during 2020 is almost certainly under-estimated. Deaths during 2020 were based on an early release file for the National Death Index (NDI), which according to the National Center for Health Statistics, accounted for only about 95% of all recorded US deaths in 2020 at the time of the NDI search (Ryff et al., 2022). Second, the MIDUS sampling frame excluded the institutionalized population, who suffered especially high mortality early during the early stages of the pandemic. Thus, mortality among the MIDUS cohort is likely to be lower than pandemic-related mortality for the population as a whole. Third, we have no information about the degree to which MIDUS participants complied with public health orders during the pandemic and whether it differed by personality. Nor do we have any information about self-destructive behaviors (e.g., alcohol and drug abuse) during the pandemic. Fourth, personality was measured in 1995-96, approximately 25 years prior to the pandemic. Finally, the MIDUS sample under-represents minorities, who suffered higher mortality during the pandemic. Future Analyses: It will be useful to replicate this analysis using the Health Retirement Survey (HRS), which samples Americans older than 50, once mortality data become available for 2020. HRS has a much larger sample than MIDUS and thus, will yield more statistical power for modeling excess mortality. HRS also has a more ethnically dive...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.24.22275508
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.24.22275529

1
1. sciscore 28 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.24.22275529: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Following the monthly data collection, additional follow-ups were carried out in January 2022 and March 2022.<br>IRB: The study was approved by the UCL Research Ethics Committee [12467/005] and all participants gave informed consent.<br>Consent: The study was approved by the UCL Research Ethics Committee [12467/005] and all participants gave informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">When the survey was converted to monthly, participants were randomly assigned into four groups.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: Thank you for sharing your data.
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  However, our study is not without any limitation. First, it is important to acknowledge that our data were from a non-probability sample. Despite the effort to recruit a heterogeneous sample and make our sample representative to the adult population in England by weighting, there is still the possibility of potential biases due to omitting other demographic factors that could be associated with survey participation in the weighting process. We therefore advice caution when generalising these findings to the population. Moreover, the fixed effects approach cannot rule out the possibility of bidirectional associations of depressive/anxiety symptoms with individual level factors. This calls for further research in this area. Since July 2021, England removed most of its legal restrictions, making it one of the countries with the least strict COVID-19 policies (see Figure S4) and highest vaccine coverage (Figure S5) at the time of writing. The United Kingdom is also one of the countries with highest cumulative number of COVID-19 cases and deaths (Figure S6-S7). But there is a lot of variation in COVID-19 situation and policy stringency across countries and over time. Our results provided empirical evidence on how changes in contextual measures, including stringency index, COVID-19 cases, COVID-19 deaths and national vaccination, as well as individual level factors, such as COVID-19 related stress, COVID-19 infection and social support were related to depressive and anxiety symptom...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.24.22275529
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.22.22275422

1
1. sciscore 28 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.22.22275422: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.2 Sequence analyses and processing: Python 3.8.0 language programming and ′Numpy′ and ′Pandas′ libraries were used in this research to preprocess FASTA files, extract NSP3, NSP4, and NSP6 from other genes, and perform sequence alignment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.22.22275422
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.21.22275421

1
1. sciscore 28 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.21.22275421: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Once aligned using the MEGA X program (TAMURA et al., 2018), ambiguous sites, lost data and gaps, were excluded. 2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGA X</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.21.22275421
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.24.22275498

1
1. sciscore 28 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.24.22275498: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Ethical approvals and consent to participate: The Jaramogi Oginga Odinga Teaching and Referral Hospital (JOOTRH): Institution and Ethical Review Committee provided research and ethical approval with license number IERC.<br>IRB: Ethical approvals and consent to participate: The Jaramogi Oginga Odinga Teaching and Referral Hospital (JOOTRH): Institution and Ethical Review Committee provided research and ethical approval with license number IERC.<br>Field Sample Permit: Additional research and ethical approval was provided by the National Commission for Science, Technology and Innovation (NACOSTI) with License Number ABS/P/20/7959.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  There were two limitations that the health workers noted about the study. First, the study was designed as a pilot to the Kisumu County Department of Health, in which the usage of AgRDT was done alongside confirmatory PCR testing. Although participants were informed about the possibility of discrepant results, these did result in some confusion. It was found out that a major cause of the discrepancy was attributed to non-adherence by healthcare staff to the study procedures where sometimes one and the same nasal pharyngeal swab was used for both AgRDT and PCR testing. This could result in false-negativity, due to dilution of the sample (15). Secondly, the test-result communication channels were not always clear and changed during the project, involving 3 different partners in addition to the participating facilities. There were no formal DoH protocols on communication channels, and in some cases feedback was not relayed to patients in a timely manner causing frustration and anxiety (16).
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.24.22275498
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.25.22275562

1
1. sciscore 28 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.25.22275562: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.25.22275562
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.24.22275398

1
1. sciscore 28 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.24.22275398: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Study limitations: While our study provides insight into the variability and natural history of long COVID, there are limitations that should be considered. While the U09.9 code provides a simple inclusion criterion, its application in health systems across the country is not uniform and may differ from one data partner to another. Also, since the use of the code began only recently, patients with long COVID that were diagnosed prior to the introduction of the code are not included, limiting our ability to compare the current clinical manifestations with those observed earlier in the pandemic before widespread vaccination and with different distributions of SARS-CoV2 strains and variants. However, in a pilot study in Denmark, coding with U09.9 was found to have a positive predictive value of 94% for long COVID.56 Our ability to capture clinical manifestations of long COVID is limited by the accessibility of clinical data in EHR systems. Of the 287 HPO terms we identified as being used in published cohort studies on long COVID,19 only 116 were identified in our data. The reasons for this presumably include unstructured data such as symptoms and radiological findings that are not well represented in the OMOP data that is the source of our data. Examples include Gaze-evoked nystagmus (HP:0000640), Pericardial effusion (HP:0001698), and Exercise intolerance (HP:0003546) that are typically diagnosed using specialist examinations or medical history that may not be easily coded in s...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.24.22275398
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.24.493347

1
1. sciscore 27 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.24.493347: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: At regular intervals, aliquots of the supernatant were taken for measurement in the plate reader as described above, and the sampled volume was replaced with PBS. 2.6 In vitro diffusivity measurements: All fluorescence recovery after photobleaching (FRAP) experiments were conducted in the Stanford University Cell Sciences Imaging Facility (CSIF) at room temperature or 37 °C.<br>IACUC: 2.13 In vivo Centi-C10 mAb pharmacokinetic study: All animal studies were performed in accordance with National Institutes of Health guidelines and with the approval of the Stanford Administrative Panel on Laboratory Animal Care (APLAC-32109).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Female B6.Cg-Fcgrttm1Dcr Prkdcscid Tg(FCGRT)32Dcr/DcrJ (The Jackson Laboratory, Stock No. 018441) mice age 12-14 weeks were administered Centi-C10 antibody via IV (retro-orbital) or SC injection under brief isoflurane anesthesia.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fragment Goat Anti-Human IgG, Fcγ fragment specific (Jackson Immunoresearch, 109-036-008, RRID: AB_2337591), and incubating for 1 hr.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fragment Goat Anti-Human IgG</div><div>detected: (Jackson ImmunoResearch Labs Cat# 109-036-008, RRID:AB_2337591)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Hydrogel samples were prepared for the in vivo study from a stock solution of 4 wt% HPMC-C12 dissolved in PBS containing the appropriate concentration of Centi-C10 antibody and 20 wt% NPs stock solution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Centi-C10</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.9 Spike-pseudotyped lentivirus production and viral neutralization assays: Spike-pseudotyped lentivirus was produced in HEK293T cells as previously described.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: RRID:CVCL_HA71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike-pseudotyped lentiviral neutralization assays were performed using HeLa cells overexpressing human ACE2, as described in.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: CLS Cat# 300194/p772_HeLa, RRID:CVCL_0030)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">46 HeLa/ACE2 cells were plated in 96-well clear bottom, white-walled plates 1 day prior to infection at a density of 5,000 cells per well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa/ACE2</div><div>suggested: JCRB Cat# JCRB1845, RRID:CVCL_B3LW)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For in vitro release assays and diffusion measurements, a total concentration of 10 mg/mL rat IgG was loaded into the hydrogels (9 mg/mL rat IgG and 1 mg/mL fluorescently-labeled rat IgG). 2.3 Dynamic and flow rheometry: All rheometry experiments were performed on a torque-controlled Discovery Hybrid Rheometer (DHR2, TA Instruments).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DHR2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Female B6.Cg-Fcgrttm1Dcr Prkdcscid Tg(FCGRT)32Dcr/DcrJ (The Jackson Laboratory, Stock No. 018441) mice age 12-14 weeks were administered Centi-C10 antibody via IV (retro-orbital) or SC injection under brief isoflurane anesthesia.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B6.Cg-Fcgrttm1Dcr Prkdcscid Tg(FCGRT)32Dcr/DcrJ</div><div>suggested: RRID:IMSR_JAX:018441)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The library was subjected to 4 rounds of selection and ScFv were tested for the binding of SARS-CoV-2 RBD and blocking its interaction with of hu-ACE-2 on high-throughput surface plasmon resonance (SPR) on Carterra LSA Array SPR instrument (Carterra) equipped with HC200M sensor chip (Carterra) at 25 °C. 2.8 Antibody cloning into expression vectors for transient transfection: Heavy chain and light chain sequences of the complimentary determinant regions (CDRs) of centi-C10 ScFv was cloned into each constant region of human IgG1 heavy chain, and human kappa constant IGKC, in the mammalian expression pTT5 vector (Licensed from National Research Council of Canada, Toronto Canada), respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pTT5</div><div>suggested: RRID:Addgene_52326)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were transfected using calcium phosphate transfection with 5 plasmids previously described in45 in the following ratios: 10 μg luciferase-containing lentivirus packaging vector (pHAGE-Luc), 3.4 μg FL SARS-CoV-2 Spike, 2.2 μg HDM-Tat1b, 2.2 μg pRC-CMV-Rev1b, and 2.2 μg HDM-Hgpm2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHAGE-Luc</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pRC-CMV-Rev1b</div><div>suggested: RRID:Addgene_164443)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.12 Pharmacokinetic (PK) modeling: The IV bolus data was fit to a two-phase exponential decay with the plateau constrained to zero in GraphPad Prism 9 to determine kelim; Vd was calculated from M0/C0, where C0 is the initial concentration from the two-phase exponential.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">47 Simulated pharmacokinetic profiles were generated in MATLAB.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MATLAB</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.24.493347
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.23.22275454

1
1. sciscore 27 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.23.22275454: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.23.22275454
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.25.493397

1
1. sciscore 27 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.25.493397: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Antisera and ethics: Hamster antisera was generated as we have described previously7, and was carried out under a United Kingdom Home Office License, P48DAD9B4.<br>Consent: All DOVE participants gave informed consent to take part in the study, which was approved by the North-West Liverpool Central Research Ethics Committee (REC reference 21/NW/0073).<br>IRB: All DOVE participants gave informed consent to take part in the study, which was approved by the North-West Liverpool Central Research Ethics Committee (REC reference 21/NW/0073).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK 293T cells were transfected with lentiviral packaging plasmids and the named Spike construct - D614G(WT), BA.1, BA.2 or BA.4/5 to produce</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sera was then combined with target cells expressing human ACE2 (HEK293T or HeLa) and incubated for 48-72 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.25.493397
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.23.22275444

1
1. sciscore 27 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.23.22275444: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethics: This study was approved by the Ethical Review Committee of NUH (permission number 21101927), and the study was conducted in accordance with the Declaration of Helsinki.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  The study has several limitations. First, this was a retrospective study and, therefore, has a potential for biases from incomplete clinician documentation. Second, follow-up information was not available after patients were discharged, which may have led to underestimated rates of hospitalization or mortality. Third, members of the team reviewing the ED revisits were not blinded, which may have introduced assessment bias. Fourth, since different variants of coronavirus have different clinical characteristics, important factors at the triage may be different during other pandemic waves. Lastly, the generalizability of the current study findings to other settings is limited by single-center design. Because of site-specific characteristics, it is possible that other ED sites with differences in availability of transportation and access to professional medical support may have different rates of outcomes than our own patient cohort. In summary, approximately 80% of patients with mild COVID-19 disease can be safely isolated at home in a facility. Ten percent of patients will experience progression of symptoms in the ensuing week that will require hospitalization for treatment—typically at 10 days of symptomatic illness. Clinicians should inform patients, especially those aged >□50 years, or those that are obese with BMI > 25, or those with underlying hypertension, or those presenting to the hospital > 3 days after symptom onset and presenting tachycardia (PR > 100/min) or high bl...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.23.22275444
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.22.22275323

1
1. sciscore 27 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.22.22275323: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.22.22275323
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.23.22275460

1
1. sciscore 27 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.23.22275460: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Ethics: Collection of samples from the Orleans cohort had been approved by the Comité de Protection des Personnes Ile de France IV (NCT04750720).<br>IRB: Collection of samples from the Strasbourg cohort was approved by Institutional Review Board of Strasbourg University Hospital (NCT04441684).<br>Consent: Informed consent was obtained from all participants, and parents provided informed consent for any children under the age of 18 years.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The antigen associated with the lowest sum of residual sum of squares among the four different variant-specific random forest regression models was kept in the model.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Cells tested negative for mycoplasma.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples: Viral neutralization studies: To correlate antibody measurements with neutralization titers, we collected 304 serum samples from individuals with either vaccine-induced or infection-acquired immunity to SARS-CoV-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">R-PE) conjugated goat or donkey anti-human IgG antibody was used as detector antibody at 1/120 dilution and goat anti-human IgA at 1/200.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This assay allowed simultaneous detection of antibodies to 30 antigens, including stabilized trimeric Spike ectodomain (16), RBD, Membrane protein (M), Membrane Envelope protein (E), Nucleocapsid protein (NP), and a Membrane-Envelope fusion protein (ME).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RBD , Membrane protein ( M) , Membrane Envelope protein ( E) , Nucleocapsid protein ( NP) ,</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In addition to the measurement of the presence of antibodies to antigens, we also measured the strength of antibody (Ab) binding with an avidity assay (Garcia et al, submitted to Viruses, 2022).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigens</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After these 5 minutes and washing, 100μL of secondary antibodies conjugated to R-phycoerythrin (Jackson Immunoresearch) for detection of specific IgG, diluted at 1/100 was added for 15 minutes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>R-phycoerythrin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, Nucleocapsid-specific IgG antibodies were assessed using an ELISA-based assays on sera incubated in antigen-coated wells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Nucleocapsid-specific IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Anti-Fc IgG VHH (Fc1) was derived from an antibody from immunized alpaca and expressed as a tandem with an optimized catalytic domain nanoKAZ from Oplophorous gracilirostris luciferase.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Fc IgG</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  A limitation of our study was that we assessed levels of immunity from serum only. There is clearly also a role for mucosal immunity in protecting against SARS-CoV-2 infection, especially in the case of infection-acquired immunity. For the last three session in our study we collected nasopharyngeal samples, which we plan to incorporate in future research. Our analysis is dependent on the suitability of neutralizing titers as a correlate of protection against symptomatic COVID-19, based on meta-analyses of vaccine studies (7, 8). This assumption is supported by an analysis of data from phase 3 trials of Moderna’s mRNA-1273 vaccine, which indicated that 68% of vaccine efficacy can be explained by neutralizing titers (31). This leaves up to 32% variation that may be explained by other effects such as cellular immunity or host factors. An additional limitation is that the evidence base for neutralizing titers as a correlate of protection is built on studies of infection with the Ancestral variant. However, antibody levels have been observed to be associated with reduced infection with other variants, most notably Delta (32). Although neutralizing titers have frequently been shown to be associated with protection against severe COVID-19 (7-9), there is a weaker evidence base for their use as a correlate of protection. A final, important limitation is that there is uncertainty in the statistical relationships utilized in this analysis. When considering the inferred protection from ...
  
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04750720</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Study of the Kinetics of COVID-19 Antibodies for 24 Months i…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04441684</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Seroprevalence of SARS-CoV-2 in Strasbourg University Hospit…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04644159</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Longitudinal Follow-up of a Population Cohort in a French Ci…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04325646</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sero-epidemiological Study of the SARS-CoV-2 Virus Responsib…</td></tr></table>
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.23.22275460
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.23.22275445

1
1. sciscore 27 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.23.22275445: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Institutional board review was conducted, and The Ethics Committee of South-East Norway confirmed (June 4th 2020, #153204) that external ethical board review was not required.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Finally, because persons testing negative may be more prone to get tested and subsequently visit primary care due to (persistent) symptoms from similar bodily systems as those affected by SARS-CoV-2, we repeated the time-differentiated analyses using a comparison group consisting of untested persons (aged 18-70 years, non-hospitalized, never tested for SARS-CoV-2 and assigned a random, hypothetical test date during our study period) in a sensitivity analysis.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Strengths and limitations: Strengths of our study include the use of sequenced data allowing comparison of omicron vs delta during the same calendar period when the two variants had the largest overlap, combined with health care register data with no attrition. Further, equal access to SARS-CoV-2 testing at no cost for the individuals as well as a universal tax-funded health care system, improve generalizability of findings to other countries. A limitation of our study is that we could not include antigen or home tests as they were not registered. Polymerase chain reaction testing was however mandatory for everyone with a positive antigen test during our study period. Moreover, all parcitipants in our study had a PCR test in a period characterized by great uncertainty regarding the severity of the new SARS-CoV-2 omicron variant. It is possible that our population consisted of particularly health-conscious persons who were highly prone to get tested and who were more prone to seek medical care after knowing they had been ill. We believe our methodological approach ensuring comparison of persons who were tested in the same calendar week limits this potential bias arising due to anxiety. Further, we have previously reported that register-based studies comparing persons with positive test with persons with negative test likely will lead to an underestimation of post-covid outcomes’ prevalence, as persons testing themselves may represent a particularly health-conscious sample of t...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.23.22275445
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.22.22275183

1
1. sciscore 27 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.22.22275183: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.22.22275183
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.23.22275458

1
1. sciscore 27 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.23.22275458: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: Thank you for sharing your code and data.
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.23.22275458
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.24.493187

1
1. sciscore 27 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.24.493187: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">The binding affinity energies (ΔG, kcal·mol-1) of Hemin with proteins were calculated with blind docking (supplementary material, DockingRawData.zip).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 cells were harvested as control, solvent control and drug treatment groups with Trypsin-EDTA (2X) and single cell suspensions were stained using an antibody against TMPRSS2 (Santa Cruz, sc-515727).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TMPRSS2</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-515727, RRID:AB_2892118)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The monoclonal anti-ACE2 antibody (ProSci, Poway, CA,1:750 diluted in 5% BSA blocking buffer) and the goat anti-rabbit IgG-horseradish peroxidase (HRP)-conjugated antibody (Santa Cruz Biotechnology, Dallas, TX, 1:2500) were used as primary and secondary antibodies, respectively, for ACE2 protein expression.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG-horseradish</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The monoclonal anti-β-actin antibody (SantaCruz,1:1500) and the goat anti-mouse HRP conjugated (Pierce, Rockford, IL) were used as primary and secondary antibodies, respectively, for β-actin expression.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-β-actin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse HRP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell and Virus Culture: The cell culture media used for Vero E6 (African green monkey, kidney epithelial) cells consisted of high glucose Dulbecco’s modified Eagle medium (DMEM) (Capricorn) with 10 % fetal bovine serum (FBS) (Biolegend), 100 U/mL of penicillin (Lonza) and 0.1 mg/mL of streptomycin (Lonza).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Results were evaluated statistically using the Two-way ANOVA (ordinary) technique (Prism 8 v8.2.1, GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis was performed using NovoExpress</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NovoExpress</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.24.493187
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.24.22275411

1
1. sciscore 27 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.24.22275411: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The trial protocol was approved by UT Southwestern Institutional Review Board and was overseen by an independent data safety and monitoring board, and all patients provided written informed consent.<br>Consent: The trial protocol was approved by UT Southwestern Institutional Review Board and was overseen by an independent data safety and monitoring board, and all patients provided written informed consent.<br>Field Sample Permit: RNA Isolation: Saliva was collected using the DNA/RNA Shield Saliva Collection Kit (Zymo Research) following the manufacturer’s protocol.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Patients were excluded if they met any of the following criteria: enrolled in another COVID-19 antiviral therapy, breastfeeding women, known hypersensitivity to atovaquone, treatment with rifampin, patients with AIDS who required treatment for Pneumocystis jirovecii or Toxoplasma gondii, not expected to survive for 72 hours, >14 days from symptom onset.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Design: This is a randomized, double-blind, placebo-controlled trial of atovaquone therapy in adult participants hospitalized with COVID-19.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">All investigators remained blinded to study assignment until completion of follow-up and database lock.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04456153</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Atovaquone for Treatment of COVID-19</td></tr></table>
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.24.22275411
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.23.22275364

1
1. sciscore 27 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.23.22275364: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.23.22275364
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.24.22275544

1
1. sciscore 27 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.24.22275544: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The Children’s Hospital of Philadelphia’s Institutional Review Board designated this study as not human subjects’ research and waived informed consent.<br>Consent: The Children’s Hospital of Philadelphia’s Institutional Review Board designated this study as not human subjects’ research and waived informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: Thank you for sharing your code and data.
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our findings have limitations that warrant discussion. This EHR-based study identified symptoms, signs, and diagnoses that were significant enough to prompt health service use and be coded by clinicians as a reason for an encounter. Our approach may have missed some findings that may be stored in laboratory, procedural, radiological and other unstructured text data. The true burden of PASC may be underestimated from EHR data, with data from open health systems, with the potential for infrequent follow-up visits to academic centers of excellence for milder symptoms. For this reason, we limited our cohort to at least one visit in the prior three years, to identify active patients within the health system; similar strategies have been employed in other PEDSnet studies of COVID-19;39,40 the benefits of such approaches have been reported previously.41 However, this may underestimate the burden of PASC by excluding previously healthy children who did not have prior health encounters. Next, our test negative cohort may include individuals with SARS-CoV-2 infection who may have had testing conducted outside our health systems. These limitations may have biased results towards the null. Further, we did not identify specific race/ethnic groups as a risk factor for PASC despite the fact that SARS-CoV-2 disproportionally affects minority communities, which may reflect differences in care seeking behavior and access to care. Finally, children who tested positive may be more likely to seek...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.24.22275544
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.23.22275439

1
1. sciscore 27 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.23.22275439: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The US Centers for Disease Control and Prevention (CDC) institutional review board provided non-research determination approval.<br>Consent: Written informed consent was obtained for all enrolled participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Sample size calculation: To evaluate the diagnostic performance of the Panbio™ Ag RDT device, we assumed a prevalence of 10% among symptomatic individuals and 5% in asymptomatic contacts of laboratory-confirmed persons based on current SARS CoV 2 local surveillance data.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitation: The number of persons enrolled in the two groups, symptomatic and asymptomatic, may not reflect the true prevalence in the general population as we evaluated the Ag RDT during a period of high COVID-19 prevalence.
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.23.22275439
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.24.493348

1
1. sciscore 27 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.24.493348: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All animal experiments were performed in accordance with the Guide for Animal Experiments Performed at the National Institute of Infectious Diseases (NIID) and were approved by the Animal Care and Use Committee of NIID.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Immunization and sampling: Female BALB/c mice (20-24 weeks old) (Japan SLC Inc., Hamamatsu, Shizuoka, Japan) were maintained in specific pathogen-free facilities.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV-2 challenge was performed in a biosafety level 3 facility according to the Guidelines for Animal Experiments performed at NIID. 2.4. Estimation of SARS-CoV-2 S-specific antibody responses: SARS-CoV-2 S-specific antibodies were estimated using ELISA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 S-specific</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IgG antibodies were detected using biotin-conjugated goat anti-mouse IgG antibody (Jackson Immunoresearch, West Grove, PA), followed by alkaline phosphatase-conjugated streptavidin (Invitrogen, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The S-specific IgG antibody titer was defined as the reciprocal of the highest dilution of the test sample, giving a higher absorbance than the cut-off value obtained as 2-fold mean absorbance of serial dilutions of control naive mouse serum set in each plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S-specific IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantification of S-specific IgG1 or IgG2a antibodies in the serum and IgA antibodies in nasal or lung washes was performed as previously described [23].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG2a</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Chimeric human-mouse monoclonal IgG1, IgG2a, and IgA antibodies bearing variable regions of the S-specific human monoclonal antibody S309 [33] were used as standard antibodies for quantification.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Horseradish peroxidase (HRP)-conjugated polyclonal anti-mouse IgG1 antibody (Bethyl Laboratories, Montgomery, TX), anti-mouse IgG2a antibody (Bethyl Laboratories), or polyclonal anti-mouse IgA antibody (Bethyl Laboratories) were used as detection antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG2a</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, in plates pre-coated with anti-mouse IFN-γ, IL-4, or IL-5 antibodies, 3 × 105 cells harvested from the spleen or cervical lymph nodes were incubated for 16 h in the presence of a peptide pool derived from the S protein of SARS-CoV-2 (a mixture of PepTivator SARS-CoV-2 Prot_S, S1, and S+; Miltenyi Biotec, Bergisch Gladbach, Germany).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IFN-γ</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IL-4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IL-5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing the cells with PBS, biotin-conjugated anti-IFN-γ, IL-4, or IL-5 detection antibodies were added and incubated at RT for 2 h, followed by incubation with ALP-conjugated streptavidin at RT for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IFN-γ</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">One million cells were stained with FVD506 (Thermo Fisher Scientific) for dead cell removal and blocked with anti-mouse CD16/CD32 monoclonal antibody (BD Pharmingen, San Jose, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse CD16/CD32</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 50uL of QHmusX (100TCID50) and 50uL of heat-inactivated serum serially diluted by two-fold were mixed and incubated in 96-well microtiter plates for 1h at 37□, followed by the addition of 100 µL of VeroE6-TMPRSS2 cells (JCRB1819, Japanese Collection of Research Bioresources Cell Bank) [35, 36].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunization and sampling: Female BALB/c mice (20-24 weeks old) (Japan SLC Inc., Hamamatsu, Shizuoka, Japan) were maintained in specific pathogen-free facilities.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Horseradish peroxidase (HRP)-conjugated polyclonal anti-mouse IgG1 antibody (Bethyl Laboratories, Montgomery, TX), anti-mouse IgG2a antibody (Bethyl Laboratories), or polyclonal anti-mouse IgA antibody (Bethyl Laboratories) were used as detection antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bethyl Laboratories</div><div>suggested: (Bethyl, RRID:SCR_013554)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spots formed by cytokine-secreting cells were counted and analyzed using ELISpot reader S6 Universal with ImmunoSpot 7.0 software (Cellular Technology, Ltd., Shaker Heights, OH). 2.7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImmunoSpot</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were analyzed with CantoII (BD Biosciences), and data were analyzed using FlowJo software version 10.8.0 (Tree Star Inc., Ashland, OR). 2.8. Quantification of SARS-CoV-2 subgenomic RNA: Total RNA was extracted from 125 µL of nasal or lung wash using ISOGEN-LS (Nippon gene, Toyko, Japan) and purified using a Maxwell RSC 48 Instrument (Promega, Madison, WI) with a Maxwell RSC miRNA Plasma and Serum Kit (Promega).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Biosciences</div><div>suggested: (BD Biosciences, RRID:SCR_013311)</div></div><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Data analysis and visualization were performed using GraphPad Prism 7.0 software (GraphPad Software Inc., San Diego, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.24.493348
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.22.492976

1
1. sciscore 27 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.22.492976: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: Thank you for sharing your code.
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.22.492976
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.23.493138

1
1. sciscore 27 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.23.493138: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Polarization Anisotropy: Fluorescent RNA was ordered from IDT as a 10-nt degenerate sequence (random nucleotide at every position) with a 3’-FAM modification.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, a codon-optimized synthetic DNA (Integrated DNA Technologies, IDT) was inserted into a pET28 expression vector by Gibson assembly, fused to DNA encoding an N-terminal 6xHis-SUMO tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET28</div><div>suggested: RRID:Addgene_21766)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The template for in vitro transcription of 5’-600 RNA was a synthetic DNA (IDT), inserted by Gibson assembly into a pUC18 vector with a 5’ T7 promoter sequence.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pUC18</div><div>suggested: RRID:Addgene_50004)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data from three independent N protein titrations were fit to a one-site binding curve using GraphPad Prism to determine KD.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.23.493138
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.22.492693

1
1. sciscore 27 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.22.492693: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After blocking with 3% albumin (Sigma-Aldrich) and primary antibody incubation RAGE (ab3611, Abcam), ACE2 (XXX), ADAM17 (ab2051, Abcam)), TMPRSS2 (ab109131, Abcam), the membranes were incubated with an anti-rabbit peroxidase-conjugated secondary antibody (GE healthcare).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ADAM17</div><div>suggested: (Abcam Cat# ab2051, RRID:AB_302796)</div></div><div style="margin-bottom:8px"><div>TMPRSS2</div><div>suggested: (Abcam Cat# ab109131, RRID:AB_10863728)</div></div><div style="margin-bottom:8px"><div>anti-rabbit peroxidase-conjugated secondary</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">500 μg of protein lysate was incubated with Anti-6X His tag® antibody [HIS.H8] (ab18184, Abcam) overnight at 4°C, anti-Mouse IgG (Invitrogen) was used as isotype control.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-6X</div><div>suggested: (Abcam Cat# ab18184, RRID:AB_444306)</div></div><div style="margin-bottom:8px"><div>anti-Mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">P4417-100TAB-Sigma-Aldrich) plus 1% Bovine Serum Albumin (BSA) (Cat.A9647-500G-Sigma-Aldrich) and 0,02% NP-40 alternative (Cat.492016-100ML) for 1h at room temperature prior to overnight incubation at 4°C with primary antibody 1:100 (6xHisTag clone#HIS.H8 Cat.ab18184-Abcam or SARS-CoV-2 spike polyclonal antibody, GeneTex).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>6xHisTag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were collected and stained using primary RAGE antibody 1:100 (PA5-24787, Thermo Scientific) for FACS analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RAGE</div><div>suggested: (Thermo Fisher Scientific Cat# PA5-24787, RRID:AB_2542287)</div></div><div style="margin-bottom:8px"><div>PA5-24787</div><div>suggested: (Thermo Fisher Scientific Cat# PA5-24787, RRID:AB_2542287)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1 × 105 THP-1 cells were seeded on a 24-well plate in their culture medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>THP-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">THP1 and Monocytes infection with SARS-CoV-2: THP1 cells were plated at 5×105 cell/ml in 48-well plates in 200 μl of RPMI-1640 supplemented with 1% fetal bovine serum (FBS) (Euroclone).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>THP1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture supernatants were collected 24, 48, 72 and 144 h post-infection and stored at – 80°C until the determination of the viral titers by a plaque-forming assay in Vero cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following day, cells were pretreated or not with 2μM Azeliragon (Cat.S6415-Selleckchem) for 30 minutes before adding 100 ng/mL of Sars-CoV-2 spike protein (RBD, HisTag) (Cat. ZO3483-1-GenScript) or infected using Heat-inactivated SARS-CoV-2 (VR-1986HK, ATCC) at 4 TCID50/mL for 2h at 37°C 5%CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VR-1986HK</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequencing: Different library types were pooled at different ratios based on their targeted reads per cell and the nanomolarity of the library pools was confirmed using the Agilent Bioanalyzer 2100.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Agilent Bioanalyzer</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Separately for the two selected categories of disease severity (mild vs severe/critical), the pseudo-bulk counts were then fitted with a generalised linear model using the EdgeR package, to identify those genes characterised by a well-defined decreasing or increasing trend of the expression over the sample time-points.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EdgeR</div><div>suggested: (edgeR, RRID:SCR_012802)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Among these sets, the GO:0050786 genelist was then expanded using the Cytoscape ‘stringApp’ (81) in order to identify among the nearest neighbours with confidence score > 0.7 the ones showing the highest absolute FC values in Myeloid cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cytoscape</div><div>suggested: (Cytoscape, RRID:SCR_003032)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The GSEA has been done with the clusterProfiler library (82, 83), using gene lists ranked by the FDR of the differential analysis and the sign of the logFC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GSEA</div><div>suggested: (SeqGSEA, RRID:SCR_005724)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The gating strategy and the relative analysis were performed with FlowJo software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.22.492693
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.18.22275112

1
1. sciscore 27 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.18.22275112: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Both studies were approved by the Ethics Committee of Eastern Switzerland.<br>Consent: The first study was exempt from patient consent, because only minimal data were included and it would have been impossible to obtain consent from all patients, while inclusion of all cases was essential to calculate true incidence.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Because the availability of serologic testing for anti-PLA2R autoantibodies may have influenced biopsy practice over time,16 we performed a sensitivity analysis excluding MN.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-PLA2R</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This study has several limitations. First, due to the limited population size of Switzerland and the low incidence of glomerulonephritis, we cannot exclude a small effect of vaccinations, in particularly for MCD, as discussed above. Second, due to the decentralized health care system in Switzerland, patients were cared for by a variety of hospital-based and private practice nephrologists. Patient evaluation and care were thus not standardized and the study relied on patient- and physician-reported data. Third, due to the retrospective design of the study, patient-reported symptoms were subject to potential recall bias and onset of symptom dates were not precise in some patient questionnaires. Therefore, we chose biopsy proven glomerulonephritis as the primary outcome. Fourth, we were not able to include all patients with biopsy-proven glomerulonephritis in the second study and cannot exclude selection bias. However, the major reason for non-inclusion of patients was non-participation of their treating nephrology divisions or practices due to time constraints, which should not introduce bias. Finally, our results are limited to new-onset glomerulonephritis and cannot answer the question, whether SARS-CoV-2 vaccination could trigger relapses in patients with previously diagnosed glomerulonephritis, because relapses are usually diagnosed clinically without repeat biopsy. In conclusion, combining two complementary approaches, we did not find an association between mRNA-based vacc...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.18.22275112
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.24.493068

1
1. sciscore 27 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.24.493068: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: Cells were seeded in 24-well tissue culture plates and incubated at 37 °C in media and densities (cells per well) for the given times as indicated below; human nasal epithelial cells (HNECs) in HNEC medium at 4.5×104 (72 h) and HeLa Ohio cells in HeLa Ohio medium at 2×105 (16-20 h).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">LLC-MK2 and MRC-5 cells were cultured in T25 cell culture flasks in the corresponding media at densities of 8×105 and 9×105, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MRC-5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus titration: Samples from SARS-CoV-2, HCoV-229E and HCoV-NL63 were titrated on Vero cells, MRC-5 cells, and LLC-MK2 cells, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div><div style="margin-bottom:8px"><div>LLC-MK2</div><div>suggested: BCRJ Cat# 0146, RRID:CVCL_3009)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Titration was performed using eightfold replicates of serial half-log10 (for SARS-CoV-2, HCoV-229E and HCoV-NL63) or log10 (for RV-B14) dilutions of virus-containing samples followed by incubation at 36 °C (SARS-CoV-2, HCoV-229E), 33 °C (HCoV-NL63) and 34 °C (RV-B14) for 5-7 days (SARS-CoV-2, HCoV-229E, RV-B14) or 9-11 days (HCoV-NL63).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV-229E</div><div>suggested: JCRB Cat# JCRB1838, RRID:CVCL_B3M4)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  As conventional RT-PCR holds limitations to detect the negative strand in excess of positive strand copies, we employed a recently published strategy by Wiehler and Proud [32] to analyze the negative strand level. We observed that 2-DG significantly reduced the genomic (+)ssRNA as well as the template (-)ssRNA, a likely cause for the measured significant reduction in detectable extracellular viral RNA (Figure 4A&B). These findings point at a 2-DG-mediated impairment in viral RNA replication and amount of released virus. In line with this, titration of the released virus on HeLa Ohio cells showed a reduction in viral load (Figure 4C). To be noted, HeLa Ohio cells used in this experimental setup, due to their cancerous origin, have a high glucose demand and are especially sensitive to glucose starvation and 2-DG treatment. Therefore, low amounts of 2-DG were used, and the cells were treated only once after the start of the RV infection. This could explain the relatively small difference in viral load (Figure 4C) in contrast to the significant difference in released extracellular viral RNA (Figure 4B). In our subsequent analysis, we found that 2-DG exerted a protective effect by significantly reducing virus-induced cell death in HeLa Ohio cells (Figure 4D). In contrast, RV infection does not cause cell lysis in cultures of healthy bronchial epithelial cells [39]. Interestingly, the same study reported increased viral replication and cell lysis after RV infection in asthmatic bro...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.24.493068
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.21.492554

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.21.492554: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: A blood sample was taken following consent at least 14 days after symptom onset.<br>IRB: Sera from Beta, Gamma and Delta and BA.1 infected cases: Beta and Delta samples from UK infected cases were collected under the “Innate and adaptive immunity against SARS-CoV-2 in healthcare worker family and household members” protocol affiliated to the Gastro-intestinal illness in Oxford: COVID sub study discussed above and approved by the University of Oxford Central University Research Ethics Committee.<br>Field Sample Permit: The study was approved by the Human Research Ethics Committee of the University of the Witwatersrand (reference number 200313) and conducted in accordance with Good Clinical Practice guidelines.<br>IACUC: Gamma samples were provided by the International Reference Laboratory for Coronavirus at FIOCRUZ (WHO) as part of the national surveillance for coronavirus and had the approval of the FIOCRUZ ethical committee (CEP 4.128.241) to continuously receive and analyse samples of COVID-19 suspected cases for virological surveillance.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">The mean age of vaccinees was 37 years (range 22-66), 21 male and 35 female.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">AstraZeneca-Oxford vaccine study procedures and sample processing: Full details of the randomized controlled trial of ChAdOx1 nCoV-19 (AZD1222), were previously published (PMID: 33220855/PMID: 32702298).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">EXPERIMENTAL MODEL AND SUBJECT DETAILS: Bacterial Strains and Cell Culture: Vero (ATCC CCL-81) and VeroE6/TMPRSS2 cells were cultured at 37 °C in Dulbecco’s Modified Eagle medium (DMEM) high glucose (Sigma-Aldrich) supplemented with 10% fetal bovine serum (FBS), 2 mM GlutaMAX (Gibco, 35050061) and 100rnU/ml of penicillin– streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>VeroE6/TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T (ATCC CRL- 11268) cells were cultured in DMEM high glucose (Sigma-Aldrich) supplemented with 10% FBS, 1% 100X Mem Neaa (Gibco) and 1% 100X L-Glutamine (Gibco) at 37 °C with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: ATCC Cat# CRL-11268, RRID:CVCL_1926)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting S gene-carrying pcDNA3.1 was used for generating pseudoviral particles together with the lentiviral packaging vector and transfer vector encoding luciferase reporter.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The gene fragment was amplified with pNeoRBD333Omi_F (5’- GGTTGCGTAGCTGAAACCGGTCATCACCATCACCATCACACCAATCTGTGCCCTTTCGAC-3’) and pNeoRBD333_R (5’-GTGATGGTGGTGCTTGGTACCTTATTACTTCTTGCCGCACACGGTAGC-3’), and cloned into the pNeo vector (Supasa et al., 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNeo</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate the BA.4/5 RBD construct containing a BAP- His tag, the gene fragment was amplified with RBD333_F (5’- GCGTAGCTGAAACCGGCACCAATCTGTGCCCTTTCGAC-3’) and RBD333_BAP_R (5’-GTCATTCAGCAAGCTCTTCTTGCCGCACACGGTAGC-3’), and cloned into the pOPINTTGneo-BAP vector (Huo et al., 2020a).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pOPINTTGneo-BAP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To express biotinylated RBDs, the RBD-BAP plasmid was co-transfected with pDisplay-BirA-ER (Addgene plasmid 20856; coding for an ER-localized biotin ligase), in the presence of 0.8 mM D-biotin (Sigma-Aldrich).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RBD-BAP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pDisplay-BirA-ER</div><div>suggested: RRID:Addgene_20856)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sensorgrams were plotted using Prism9 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The percentage reduction was calculated and IC50 determined using the probit program from the SPSS package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04324606</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Study of a Candidate COVID-19 Vaccine (COV001)</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04400838</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Investigating a Vaccine Against COVID-19</td></tr></table>
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.21.492554
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.21.492922

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.21.492922: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(iv) Wash the cells 3 times with PBS. (v) Dilute the TRITC-labeled donkey anti-mouse IgG secondary antibody in blocking solution to a final concentration of 1 µg/mL, and incubate with the cells (1 mL/well) at 37°C for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(iv) Wash the cells 3 times with PBS. (v) Dilute the biotinylated horse anti-mouse secondary antibody in blocking solution, and incubate with the cells (1 mL/well) at 37°C for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Rescue of rSARS-CoV-2 using the pBeloBAC-FL: Transfection of the pBeloBAC-FL into Vero E6 cells: 33.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CRITICAL The pBeloBAC plasmids that are used for cloning must be purified.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBeloBAC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The PCR-positive clone is further confirmed by sanger sequencing using the CMV/F and bGH/R primers (Table 2) and designated as pBeloBAC-F1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBeloBAC-F1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Set up a restriction digestion of PacI and MluI to linearize the purified pBAC-F1, similar to step 13.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBAC-F1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, assemble F4 (using MluI and BstBI), F2 (using KasI and PacI), and F5 (using BstBI and BamHI) into pBeloBAC-F13 one by one as previously described for F3 into pBeloBAC-F1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBeloBAC-F13</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resultant plasmids are named, respectively, pBeloBAC-F134, pBeloBAC-F1342, and finally pBeloBAC-FL, which contains F1, F2, F3, F4 and F5.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBeloBAC-F134</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pBeloBAC-F1342</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CAUTION Transfection to generate rSARS-CoV-2 using the pBeloBAC-FL must be performed in a biosafety level (BSL) 3 laboratory following institutional biosafety guidelines.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>rSARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cloning of the Venus reporter gene into the pBeloBAC-FL: Cloning of Venus into the pUC57-F1: 47.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBeloBAC-FL</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Set up a PCR reaction in a 0.2 mL tube according to the list below to amplify pUC57F1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pUC57F1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The positive plasmid is designated as pUC57-F1/Venus-2A.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pUC57-F1/Venus-2A</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The positive clone is named as pBeloBAC-FL/Venus-2A.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBeloBAC-FL/Venus-2A</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.21.492922
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.23.493121

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.23.493121: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was performed in compliance with all relevant ethical regulations and the study protocols were approved by the Ethical Committee of the Canton Ticino (ECCT): CE-3428 and CE-3960.<br>Consent: Written informed consent was obtained from all participants, and all samples were coded to remove identifiers at the time of blood withdrawal.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">All assays were done in triplicate, and for each well the migrated cells were counted at 100-fold magnification in 5 randomly selected high-power fields (5HPF).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Chemotaxis was performed with preB 300.19 expressing CCR2, at a final IgG concentration of 200 µg/ml, in the presence of the chemokine concentration resulting in peak migration when no antibodies were added (CCL2 [10nM], CCL7 [100nM], CCL8 [100nM]).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CCR2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CCL2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CCL7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CCL8</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were subsequently washed 4 times with washing buffer and incubated with anti-human IgG secondary antibody conjugated to horseradish peroxidase (HRP) (GE Healthcare, NA933) at a 1:5000 dilution in PBS + 0.05% Tween-20.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (GE Healthcare Cat# NA933-1ml, RRID:AB_772208)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Kinetic of signature anti-chemokine IgG antibodies (fig.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-chemokine IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single cell sorting by flow cytometry: B cells were enriched from PBMCs of uninfected controls or of COVID-19 convalescent individuals 6 months after COVID-19 (participant CLM9 for anti-CCL8 antibodies; CLM64 for anti-CCL20 antibodies; CLM5, CLM7 and CLM33 for anti-CXCL13 antibodies; and CLM8 and CLM30 for anti-CXCL16 antibodies), using the pan-B-cell isolation kit according to manufacturer’s instructions (Miltenyi Biotec, 130-101-638).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CCL20</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CXCL13</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CXCL16</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The enriched B cells were subsequently stained in FACS buffer (PBS + 2% FCS + 1mM EDTA) with the following antibodies/reagents (all 1:200 diluted) for 30 min on ice: anti-CD20-PE-Cy7 (BD Biosciences, 335828), anti-CD14-APC-eFluor 780 (Thermo Fischer Scientific, 47-0149-42), anti-CD16-APC-eFluor 780 (Thermo Fischer Scientific, 47-0168-41), anti-CD3-APC-eFluor 780 (Thermo Fischer Scientific, 47-0037-41), anti-CD8-APC-eFluor 780 (Invitrogen, 47-0086-42)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD20-PE-Cy7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD14-APC-eFluor 780</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD16-APC-eFluor 780</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD3-APC-eFluor 780</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD8-APC-eFluor 780</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Amplicons from this first PCR reaction served as templates for sequence and ligation independent cloning (SLIC) into human IgG1 antibody expression vectors.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Where indicated, the anti-Zika virus monoclonal antibody Z021 (75) was used as an isotype control.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Zika</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 pseudotyped reporter virus and neutralization assay: To generate (HIV-1/NanoLuc2AEGFP)-SARS-CoV-2 particles, HEK293T cells were co- transfected with the three plasmids pHIVNLGagPol, pCCNanoLuc2AEGFP, and SARS- CoV- 2 S as described elsewhere (47, 80)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, threefold serially diluted plasma samples (from 1:50 to 1:328’050) were incubated with SARS-CoV- 2 pseudotyped virus for 1h at 37 °C, and the virus-plasma mixture was subsequently incubated with 293TACE2 cells for 48 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293TACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 pseudotyped reporter virus and neutralization assay: To generate (HIV-1/NanoLuc2AEGFP)-SARS-CoV-2 particles, HEK293T cells were co- transfected with the three plasmids pHIVNLGagPol, pCCNanoLuc2AEGFP, and SARS- CoV- 2 S as described elsewhere (47, 80)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHIVNLGagPol</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCCNanoLuc2AEGFP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">S5E): Experiments were performed with plasma samples assayed at a 1:50 dilution side-by-side on the same plate, and the average optical density at 450 nm obtained from two independent experiments was plotted with GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Live single Zombie-NIR−CD14−CD16−CD3−CD8−CD20+Ova−N-loop-PE+N-loop- AF647+ B cells were single-cell sorted into 96-well plates containing 4 μl of lysis buffer (0.5× PBS, 10 mM DTT, 3,000 units/ml RNasin Ribonuclease Inhibitors [Promega, N2615]) per well using a FACS Aria III, and the analysis was performed with FlowJo software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1 was generated from the structure of inactive CCR2 (PDB code: 5T1A) (81), together with the electron microscopy structures of CCR5 and CCR6 (PDB codes: 6MEO and 6WWZ, respectively (82, 83) by using SWISS-MODEL (84) server and the molecular graphics program PyMOL 2.5.0 for modeling the N- and C-terminus of the receptor.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">t-SNE: t-SNE analysis was performed using the Rtsne R package v 0.15 (https://CRAN.R-project.org/package=Rtsne) using the AUC values for all chemokines.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Rtsne</div><div>suggested: (Rtsne, RRID:SCR_016342)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code.
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.23.493121
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.21.492923

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.21.492923: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Immunization and challenge of rhesus macaques: All animal studies were approved by the NIAID Animal Care and Use Committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Eight juvenile to young adult male Indian-origin rhesus macaques (Macaca mulatta), confirmed to be seronegative for HPIV3 and SARS-CoV-2, were immunized intranasally (0.5 ml per nostril) and intratracheally (1 ml) with a total does of 6.3 log10 plaque-forming units (PFU) of B/HPIV3/S-6P or the empty vector control B/HPIV3.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infected monolayers were overlaid with culture medium containing 0.8% methylcellulose, and incubated at 32°C for 6 days, fixed with 80% methanol, and immunostained with a rabbit hyperimmune serum raised against purified HPIV3 virions to detect B/HPIV3 antigens, and a goat hyperimmune serum to the secreted SARS-CoV-2 S to detect co-expression of the S protein, followed by infrared-dye conjugated donkey anti-rabbit IRDye680 IgG and donkey anti-goat IRDye800 IgG secondary antibodies (LiCor).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit IRDye680 IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-goat</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Dissociation-enhanced lanthanide fluorescent (DELFIA) time resolved fluorescence (TRF) immunoassay, ELISA and live HPIV3 and SARS-CoV-2 neutralization assay: Levels of anti-SARS-CoV-2 S antibodies elicited by B/HPIV3/S-6P were determined by DELFIA-TRF (Perkin Elmer) from NW or BAL following the supplier’s protocol and from serum samples by ELISA (Liu et al., 2021) using the recombinantly-expressed secreted version of S-2P (Wrapp et al., 2020), or a fragment (aa 328-531) containing the receptor binding domain (RBD) of the SARS-CoV-2 S protein (Walls et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The secondary antibodies used in both assays were goat anti-monkey IgG(H+L) horseradish peroxidase (HRP) (Thermo Fisher, Cat #PA1-84631)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-monkey IgG(H+L</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibodies used for extracellular and intracellular staining were: CD69 (FITC, clone FN50, Biolegend)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD69</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">African green monkey kidney Vero (ATCC CCL-81) and Vero E6 (ATCC CRL-1586) cells were cultured in Dulbecco’s MEM with GlutaMAX (Thermo Fisher Scientific) with 5% FBS and 1% L-glutamine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The B/HPIV3/S-6P cDNA was used to transfect BHK21 cells (clone BSR T7/5, stably expressing T7 RNA polymerase (Buchholz et al., 1999)), together with helper plasmids encoding the N, P and L proteins (Buchholz et al., 2004; Liu et al., 2021), to produce the B/HPIV3/S-6P recombinant virus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK21</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, Vero cell monolayers in 24-well plates were infected in duplicate with 10-fold serially diluted samples.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, luciferase reporter (pHR’ CMV Luc), lentivirus backbone (pCMV ΔR8.2), and human transmembrane protease serine 2 (TMPRSS2) at a ratio of 1:20:20:0.3 into HEK293T/17 cells (ATCC) with transfection reagent LiFect293™.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV ΔR8.2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Standard curves were generated using serially diluted pcDNA3.1 plasmids encoding gN, gE, or sgE sequences.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IC50 titers were determined using a log (agonist) vs. normalized response (variable slope) nonlinear function in Prism v8 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed using FlowJo version 10.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04816643</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Phase 1/2/3 Study to Evaluate the Safety, Tolerability, an…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT00686075</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Study to Evaluate the Safety, Tolerability, Immunogenicity…</td></tr></table>
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.21.492923
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.21.492903

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.21.492903: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical statement: The study protocol was approved by the Ethics Committee of the Institute of Beijing Ditan Hospital, Capital Medical University (IRB#2021-(024)-02).<br>Consent: Written informed consent was obtained from all participants before the enrollment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK-293T cells were transfected with the plasmids expressing different S protein respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell transfection and pseudotyped virus production: The pSectag2 vector was used to construct recombinant plasmid of codon optimized spike proteins of SARS-CoV-2 prototype (Wuhan-1 reference strain containing D614G mutation) and variants, with a 19 amino acid truncation at the C-terminus of the spike protein1 (with mutations shown in Fig.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSectag2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pVNT50 was interpolated from the neutralization curves determined using the log(inhibitor) vs. normalized response -- Variable slope fit using automatic outlier detection in GraphPad Prism Software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.21.492903
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.21.492928

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.21.492928: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  We now briefly mention several caveats pertaining to our study. At the current stage, we have intentionally used a relatively simple model that focuses on the magnitude of the antibody response following WU- and OM-vaccination. This is because at present, data on the dynamics following immunization and boosting is largely limited to titers of antibodies (6, 8, 37–40), serum biomarkers (8, 37, 38), and the virus inoculum (41, 42). We have much more limited data on the dynamics of different populations of cells responsible for the generation of humoral immune responses in the lymph nodes (39, 43). These would include different populations of dendritic cells, follicular CD4 T cells, as well as different populations of B cells and plasma cells (33, 34, 44–50). Further complexities specific to CoV-2 include the spatial aspect of infections of the respiratory tract (51–54) as well as the dynamics of production and distribution of antigen by mRNA based vaccines (55) as well as infections. As more data becomes available, it will be possible to construct more nuanced and refined models of the dynamics of humoral immunity as well as affinity maturation (56–62). Other directions that could be taken include modeling how protection is lost as the antibody titers elicited by the different immunizations wane. Gagne et al. showed that shortly after vaccination #3, both vaccines elicited similar levels of protection following virus challenge, and it will be important to know if and how this p...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.21.492928
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.21.22274939

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.21.22274939: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Sampling and Study Size: Convenience sampling was used given the logistical constraints to conduct field data collection during the pandemic.<br>IRB: Ethics Statement: This research was given ethical approval by the Ateneo University Research Ethics Committee<br>Consent: Digital written informed consent was obtained from participants prior to the interview.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">We described participants according to their age in years, sex (male or female), setting of residence (urban or rural), residence by island group (Luzon, Visayas, Mindanao), educational attainment (secondary or lower, college, post-graduate), employment status (full-time employment, part-time employment, unemployed, student, retired), monthly household income, monthly household health expenditure, and monthly individual health expenditure, membership to any health insurance (yes, no), overall health rating measured as a 5-point Likert scale.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data Analysis: Quantitative Analysis: We analyzed our quantitative data using descriptive statistics: percentage for categorical variables, and median for continuous variables using SPSS Statistics version 25.0 (20).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  However, the inherent limitations of telemedicine restrict its utility, especially for health conditions that require physical assessments and laboratory tests. We found that telemedicine use and satisfaction are influenced by a number of factors including: safety during the pandemic, privacy, affordability, convenience and accessibility, and availability of more avenues of communication. Safety was a major concern that prompted participants to use telemedicine. Telemedicine enables patients to avoid situations that would expose them to SARS-CoV-2, the causative agent of COVID-19, such as traveling and staying for long periods in high-risk environments. These safety concerns, together with lockdown restrictions, resulted to significant declines in hospital admissions for non-urgent procedures (2). Innovative solutions through telemedicine have been introduced including video visits (25). Participants also mentioned that telemedicine assisted in maintaining privacy. The benefits of anonymity are especially important with regards to sensitive and potentially stigmatizing health issues such as mental or sexual health conditions (29). Because telemedicine removes the need to travel, participants also viewed it as more affordable and convenient. This was noted by participants as an enabling factor to use telemedicine, especially since a third of our participants are full-time employees, while a quarter are students. Traveling for healthcare purposes could mean missing work or scho...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.21.22274939
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.17.22275005

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.17.22275005: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Inclusion criteria were having registered in a database for at least one dose of BNT162b2 that was administered before reaching the age of 5 years, and informed consent of a parent/legal representative to participate in the survey of the current study.<br>IRB: The present study protocol was approved by the Ethics Committee of the University of Rostock, Germany (ID: A 2022-0065).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using MATLAB R2020a and STATA version 15. Chi-Square or Fisher’s exact tests were used to compare categorical variables over pre-defined strata of age groups and BNT162b2 dosage.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MATLAB</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  The present study contains some limitations. First, the study relies on retrospective self-reported data by proxy, which i) may not directly reflect what a child had experienced and ii) underlies a risk of recall bias i.e. not recalling some not life-threatening symptoms several months later. However, the extensive public debate about SARS-CoV-2 vaccinations including their potential side effects, the off-label use investigated, and the study results showing dosage-dependent associations between vaccination and local reactions in ≥24 to <60 months old children suggest that symptoms were adequately reported. The retrospective design did not allow for a structured real-time documentation of symptoms nor an estimation of causality and severity to infer the frequency of vaccine-related serious adverse reactions, but such data should be expected from the ongoing prospective manufacturer-sponsored BNT162b2 studies (5). As vaccinations themselves were not directly part of the study, the study relied on vaccination information as reported by the respondents. However, a potential risk of manipulation by individual respondents was minimized by dispensing study participation codes only via vaccinating centers/initiatives, and the availability of BNT162b2 lot numbers. Moreover, potential duplicate entries were identified by overlap in demographic data and were removed. The reported post-vaccination symptoms could potentially be unrelated to the vaccine. To mitigate this problem, a non-BN...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.17.22275005
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.20.22275319

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.20.22275319: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: Thank you for sharing your code and data.
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.20.22275319
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.20.22275396

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.20.22275396: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.20.22275396
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.20.22275407

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.20.22275407: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: Thank you for sharing your code.
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.20.22275407
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.23.22275442

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.23.22275442: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Participants were included in this study if they were aged 18-65 years, willing and able to give informed consent, and capable of taking part in the assessment.<br>IRB: The study was approved by the ethics committee of the Friedrich-Schiller-University [amendment to 5082-02/17].</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  The study has certain strengths and multiple limitations. Strengths include a large sample of well-defined post-COVID patient group, a socio-demograpically matched control group and the use of an innovative and sensitive tablet-based assessment tool with automated scoring. The most critical limitation is that our study cannot inform about whether the identified deficits pre-existed prior to infection. This is true even though we excluded patients with known relevant neurological disorders. Our study is furthermore prone to selection bias. As we tested a clinically referred sample of post-COVID patients, findings might not generalize to all post-COVID patients, but only to those who have symptoms severe enough to visit a specialized clinic. The OCS-Plus testing identified subtle long-term cognitive deficits persisting for more than 3 months in patients with post-COVID syndrome. A relevant next step will be obtain longitudinal data on memory, attention and executive functions from the presented cohort, in order to differentiate between deficits that might improve and those that might become chronic. This will provide specific information on targets for interventions, such as cognitive training. As many patients affected by post-COVID syndrome are living in medically underserved, rural areas, the mobile, cost-effective and highly scalable OCS-Plus assessment could be used for testing patients outside specialized facilities.
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.23.22275442
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov

https://biorxiv.org/cgi/content/10.1101/2022.05.21.492920

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.21.492920: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: , Radiation Safety, and Animal Care and Use Committees.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Male golden Syrian hamsters (7 to 8 weeks of age) were purchased from Envigo (Haslett, MI).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The wells were washed and then incubated with rabbit anti-ERα (1:2000, 1 h, RT) and horseradish-conjugated secondary antibody (1:2000, 1 h, RT) that were provided with the kit.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ERα</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-542, RRID:AB_631470)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were then incubated at 4°C overnight with 2 μg/ml each of anti-ERα(H222) rat IgG1 monoclonal antibody (mAb) (Santa Cruz Biotech, sc-5349, 1:100) and HA-probe (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ERα(H222</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>rat IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Afterwards, the cells were washed 4 times with PBS + 0.1% Tween-20 (PBS-T) for 5 minutes and incubated at room temperature for 1 hour in the dark with a fluorescent secondary antibody mixture contaning mouse IgGk BP-CFL594 (Santa Cruz Biotech, sc-516178, 1:100) and anti-rat IgG AF488 (ThermoFisher Scientific, cat no. A-11006, 1:500).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rat IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, cells were washed and were incubated with detector anti-BrdU antibody for 1 hour at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-BrdU</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the incubation cells were washed and incubated with the horseradish peroxidase conjugated goat anti-mouse antibody for 30 minutes at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 50 μl of standard were added to standard wells and 40 μl of sample-to-sample wells and then added 10 μl of anti-TRAP antibody to sample wells and 50 μl of streptavidin-HRP to sample wells and standard wells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-TRAP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 72 hours, cells were washed, fixed with 4% formaldehyde, permeabilized with 0.1% Triton X-100 in PBS and stained overnight at 4°C with ACE2 protein-specific antibody (Abcam Ab15348).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then incubated with anti-rabbit secondary antibody (Alexa Fluor 536 anti-rabbit, Invitrogen Life Technologies) for 1 hour at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sections were then incubated with cocktails of primary antibodies: rabbit anti-SARS-CoV-2 Spike Protein (1:100, Invitrogen, #MA5-36087) + rat anti-ERα H222 (1:100, Santa Cruz Biotechnology, #sc53492) overnight at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 Spike Protein ( 1:100 , Invitrogen , #MA5-36087 )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sections were then incubated with the primary antibodies rat anti-ERα H222(1:100, Santa Cruz Biotechnology, #sc53492), diluted in 1% normal goat serum (NGS), 4% BSA, 0.02% saponin in PB at 4°C overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ERα H222</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sections were rinsed and incubated overnight at 4°C in the secondary antibody Nanogold-Fab’ goat anti-rat-IgG (1:100</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rat-IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">On day one, slides were blocked with a peroxidase blocker (Bio SB Catalog No. BSB 0054), washed with an immunoDNA washer buffer (Bio SB, Catalog No. BSB 0150); then, incubated with 0.2 μg/mL of anti-SARS-CoV-2 spike glycoprotein antibody (abcam, Catalog No. ab272504) for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 spike glycoprotein</div><div>suggested: (Abcam Cat# ab272504, RRID:AB_2847845)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, MCF-7 nuclear extracts (5 μg; ab14860, Abcam) were treated with either S (0.01-300 nM; Acro Biosystems)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MCF-7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Proliferation assays: MCF-7 and MDA-MB-23 cells were obtained from ATCC and growth in DMEM without phenol red, supplemented with 10% fetal bovine serum (FBS), penicillin/streptomycin at 37 °C in a 5% CO2 and 95% humidified atmosphere.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDA-MB-23</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">TRAP activity by ELISA assay in RAW-OCs: RAW264.7 (murine macrophages ATCC, USA) were cultured as manufacturer’s protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RAW264.7</div><div>suggested: CLS Cat# 400319/p462_RAW-2647, RRID:CVCL_0493)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2 expression in Calu-3 cells: Calu-3 cell line was obtained from ATCC and maintained in Eagle’s Minimum Essential Medium(EMEM; Lonza) supplemented with 10% fetal bovine serum (FBS), 1% L-glutamine and 1% penicillin/streptomycin solution at 37°C in a humidified atmosphere of 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The next day, cells in each well were transfected with 1.5 μl of ViaFect reagent (Promega, cat no. E498A) and 0.5 μg of empty pcDNA3.1 vector, or an expression vector for the wild-type (WT) SARS-CoV2 S with a C-terminal hemagglutinin (HA) epitope tag (pBOB-CAG-SARS-CoV2-S-HA) or the double mutant (R682S,R685S) SARS-CoV2 S with a C-terminal flag epitope tag (pCAGGS-SARS2-S-FKO).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div><div style="margin-bottom:8px"><div>pBOB-CAG-SARS-CoV2-S-HA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pBOB-CAG-SARS-CoV2-S-HA was a gift from Gerald Pao (Addgene plasmid # 141347; http://n2t.net/addgene:141347; RRID:Addgene_141347).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_141347)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pCAGGS-SARS2-S-FKO (C-flag) was a gift from Hyeryun Choe & Michael Farzan (Addgene plasmid # 159364; http://n2t.net/addgene:159364; RRID:Addgene_159364).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_159364)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were fitted using the non-linear curve fitting routines in Prism® (Graphpad Software Inc).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The digitized images were also analyzed using ProtoArray Prospector v5.2 and potential hits were identified using the software’s algorithm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ProtoArray Prospector</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein binding responses were analyzed using BiaEval software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BiaEval</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Interactome analysis: The STRING database52, that integrates all known and predicted associations between proteins, including both physical interactions as well as functional associations has been used to analyses functional associations between biomolecules.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STRING</div><div>suggested: (STRING, RRID:SCR_005223)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were prepared for presentation using ImageJ v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After three washes, the Mouse/Rabbit PolyDetector Plus link &HRP label (Bio SB, Catalog No. BSB 0270) were applied.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Mouse/Rabbit PolyDetector Plus</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>PolyDetector</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

ncbi.nlm.nih.gov/pmc/articles/PMC9164441/
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.19.22274968

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.19.22274968: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics statement: The study was conducted under a public health surveillance program that was reviewed by the UCSF Committee on Human Research and determined to be exempt and waived from IRB oversight.<br>Consent: All participants provided informed consent in their preferred language prior to survey administration and COVID-19 testing.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study had certain limitations. Although it was cross-sectional, our data provide an important synthesis of symptomatology within a diverse population of people seeking community testing. Second, symptoms and timing of onset were self-reported which, may introduce bias; however, symptom data were collected prior to persons knowing their COVID-19 test result and thus would not be expected to result in differential bias between those who were COVID-19 positive and negative. Additionally, we did not characterize the severity of COVID-19 symptoms across waves, and even a single very severe symptom can cause substantially greater morbidity in an individual than multiple mild symptoms. Finally, testing was undertaken with rapid antigen tests, and thus may have resulted in misclassification of individuals during the earliest phases of their illness. Nonetheless, strict quality control measures were implemented to ensure accuracy of results and the use of rapid antigen tests. In summary, the clinical presentation of symptomatic persons changed over time during several COVID surges characterized by increasing population immunity and different SARS CoV-2 variants. During Omicron, when population immunity was higher, persons with symptoms often did not see improvement after 5 days and antigen tests frequently remained positive. These findings highlight the importance of work assurances to protect workers and requirements for rapid antigen testing to shorten isolation to protect the w...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.19.22274968
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.22.22275417

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.22.22275417: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Software and reproducibility: Data management was performed using Python, with analysis carried out using Stata 16.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Strengths and weaknesses: The key strengths of this study are the scale, level of detail and completeness of the underlying primary care EHR data and the linkage to multiple COVID-19 relevant national databases within the OpenSAFELY-TPP platform. In addition, the concurrent national rollout of sotrovimab and molnupiravir under similar indications between December 16, 2021 and February 10, 2022 enables us to make direct head-to-head comparisons for their effectiveness. Several limitations of this study need to be considered. Since the Omicron BA.1 variant was the dominant variant during the treatment period (December 2021-February 2022) [13], it is likely that our results can mainly be applied to this variant [14,15]. Whether the beneficial effect of sotrovimab persists for other variant subtypes warrants further investigation [14-17]. For instance, the Omicron BA.2 sublineage was shown to exhibit marked resistance to sotrovimab in in vitro experiments [18,19], whereas an in vivo experiment found both molnupiravir and sotrovimab can restrict viral replication in the lungs of BA.2- infected hamsters [20]. In addition, the patients included in this study are assumed to be only those who met the eligibility criteria made by NHS England [3], thus limiting further generalisation of our findings to people not in a known high-risk group. The possibility of residual confounding or measurement error cannot be ruled out in this real-world observational study, in particular related to di...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.22.22275417
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.21.22275412

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.21.22275412: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">With these considerations, we set the final number of topics as 10 for both INSIGHT and OneFlorida+ cohorts as it achieved the best topic coherence and reasonable data likelihood (we do not want the data likelihood to be too perfect as that may suggests overfitting).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>OneFlorida+</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For determining the optimal number of clusters (subphenotypes), we applied NbClust R package25, which includes 21 cluster indices to evaluate the quality of clusters.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NbClust</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">On both ISNIGHT and OneFlorida cohort, we found that all confounders on all subphenotypes were balanced.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>OneFlorida</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used the python package GENSIM (https://radimrehurek.com/gensim/) to calculate the topic coherence.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study is not without limitations. First, our analysis is based on longitudinal observational patient data, which cannot explain the biological mechanisms behind PASC directly. Second, the PASC diagnoses we investigated were encoded as CCSR categories, which may not reflect the co-incidence patterns of fine-grained diagnosis conditions in the context of PASC. Third, we focused on new incidences of conditions in the post-acute infection period for COVID-19 patients and did not consider pre-existing conditions that are persistent or exacerbated due to the acute SARS-CoV-2 infection. Finally, our study period did not represent the recent wave dominated by the Omicron variants of SARS-CoV-2. To summarize, our study dissects the complexity and heterogeneity of newly incident conditions in 30-180 days after SARS-CoV-2 infection confirmation into four reproducible subphenotypes based on the EHR repositories from two large CRNs using machine learning. These four subphenotypes included a severe one involving problems with the blood and circulatory system and associated with high baseline comorbidity burden and disease severity in its acute phase, a milder one in younger people mainly with respiratory problems, and two pain-dominated ones (musculoskeletal/nervous system pain and abdominal pain respectively). Overall, patients in each subphenotype tend to have higher rates of related conditions in the baseline period. Our study provides the first systematic study on the co-incidence ...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.21.22275412
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.21.22275368

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.21.22275368: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: Thank you for sharing your code and data.
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study has limitations. Response rates varied between 11.7% and 26.5% for rounds 2–19, so the samples may not be fully representative of, or results fully generalisible to, the population. Nevertheless, our random community sampling procedure included individuals from all of the 315 lower tier local authority areas in England in each round, ensuring wide geographical coverage and socio-economic and demographic diversity. Of those who provided valid swabs and consented to linkage in rounds 1–19 of REACT-1 (2,191,597 people in total), approximately 3% (65,915 people) participated in more than one round. On this basis, a correction factor of 1.015 could therefore be applied to the standard error estimates. We are not able to definitively identify instances of participation in more than one round among those who did not consent to linkage. However, because the consent-based estimate of the correction factor is so close to one, we feel confident reporting uncorrected SEs and confidence intervals. The symptoms surveyed were not exhaustive but, while not specific to COVID-19, were all shown to be predictive of SARS-CoV-2 swab positivity. Our analysis covers a period of 22 months, during which time background levels of natural and vaccine-acquired immunity varied substantially, making it difficult to differentiate the effect of viral mutations from the impact of vaccines and prior infection.18 As REACT-1 data collection was non-continuous, we may have captured different stages of ...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.21.22275368
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.21.22275420

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.21.22275420: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The use of the INSIGHT data was approved by the Institutional Review Board (IRB) of Weill Cornell Medicine following NIH protocol 21-10-95-380 with protocol title: Adult PCORnet-PASC Response to the Proposed Revised Milestones for the PASC EHR/ORWD Teams (RECOVER).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">The collected baseline covariates included age (categorized into 20-39 years, 40-54 years, 55-4 years, 65-74 years, 75-84 years, 85 years and older), gender (female, male, other/missing), race (Asian, Black or African American, White, other, missing), ethnicity (Hispanic, not Hispanic, other/missing).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: Thank you for sharing your code.
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  There are also several limitations. First, our study was based on observational data analysis, assignment to a particular exposure group was not randomized. However, we balanced high-dimensional hypothetical confounders and got consistent results from several negative outcome control analyses across two datasets, suggesting little confounding. Second, our study included the patient population from the NYC and Florida areas, which may not be representative of other geographical regions of the US or other countries. Third, the PASC is currently defined in the RECOVER protocols as “ongoing, relapsing, or new symptoms, or other health effects occurring after the acute phase of SARS-CoV-2 infection”. 27 Our study only studied incident events, and the worsening and relapsing conditions were left for future investigations. Fourth, the way these CCSR categories were defined may not reflect the actual co-occurring risk of the individual conditions contained in each in the context of PASC. In addition, our study period was from March 2020 to November 2021, which did not include patients infected during the phase dominated by the Omicron variants of SARS-CoV-2. Lastly, our analyses did not include information on vaccination status. In conclusion, this study demonstrated that adult patients surviving beyond 30 days of their SARS-CoV-2 infection exhibited high incident risks and burdens across a broad range of conditions and signs. Our findings verified that PASC is a complex condition in...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.21.22275420
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.23.492800

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.23.492800: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the other three donors (Leu163, Leu158. Leu184), naive and effector/memory CD8+ T cells were isolated by Fluorescence-activated Cell Sorting (FACS) upon staining with anti-CD8 antibody (344710 BioLegend), anti-CCR7 antibody (353227 BioLegend) and anti-CD45RA antibody (304108 BioLegend) for 30 min at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Leu184</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD8</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CCR7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD45RA</div><div>suggested: (BioLegend Cat# 304108, RRID:AB_314412)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) fluorophore-conjugated anti-human antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human antibodies.</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For TCR transfection, 1×106 Jurkat cells were co-electroporated with 3 μg of each TCR chain using a Neon Transfection System 100μl kit (Thermo Fisher Scientific) with the following parameters: 1325V, 10ms, 3 pulses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Jurkat</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.23.492800
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.20.22275409

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.20.22275409: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.20.22275409
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.19.22275214

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.19.22275214: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">ALSPAC is a prospective population-based cohort of pregnant women with expected delivery dates between April 1991 and December 1992 who lived in Bristol, UK and the nearby surrounding area; with follow-up of these women and their partners (collectively known as Generation 0, G0), and their children (Generation 1, G1), ever since [34,35].</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In addition to the above criteria, for analysis of variables associated with post-vaccination infection within TwinsUK, individuals must have participated in Q2 antibody testing followed by either Q4 antibody testing and/or concurrent COVID-19 questionnaire.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Q4</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Questionnaires administered during the COVID-19 pandemic: TwinsUK COVID-19 questionnaires were administered in April-May 2020 [51], July-August 2020, October-December 2020, April-July 2021 (approximating first round of antibody testing, Q2), and November 2021-February 2022 (approximating second round of antibody testing, Q4).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Q2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantitative IgG anti-Spike SARS-CoV-2 antibody levels and qualitative IgG anti-Nucleocapsid antibody status were assayed using CE-marked capillary blood Roche Elecsys Anti-SARS-CoV-2 immunoassays [59].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Spike SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantitative enzyme-linked immunosorbent (ELISA) assays testing anti-Nucleocapsid and anti-Spike antibody levels were performed using previously published methods [4].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Nucleocapsid</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Multivariable models testing associations with low anti-Spike antibody levels used the following set of adjustment variables: age, sex, most recent vaccine received and number of weeks since most recent vaccination.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Spike</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ALSPAC analyses were performed using python v3.9.7 and packages: numpy v1.20.3, pandas v1.3.4, matplotlib v3.4.3, and seaborn v0.11.2, and R v4.1.2 [81] and packages: plyr v1.8.6, dplyr v1.0.7 and broom v0.7.11.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div><div style="margin-bottom:8px"><div>matplotlib</div><div>suggested: (MatPlotLib, RRID:SCR_008624)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This exposes a limitation to our analytical approach, as we have limited scale and power to examine the intersection of likely risk factors in combination. Further, of the several variables associated with antibody levels, only serology-based evidence of prior SARS-CoV-2 infection was directly associated (here, negatively associated) with subsequent post-vaccination infection between April-May 2021 and November 2021-January 2022 (with the majority sampled before the peak of the current Omicron wave). We found no consistent associations of lower antibody levels with age or employment status, but a very strong age gradient (lower incidence with older age) and lower likelihood among retired (vs. employed) individuals of post-vaccination infection. These results again are consistent with risk of infection being a complex combination of SARS-CoV-2 case prevalence, individual immune response to vaccination, and individual level of exposure (i.e., behaviour). Such aspects often oppose each other by design (for example, higher shielding behaviours by more elderly individuals). Nevertheless, given the ongoing relaxation of measures across many countries, groups previously less exposed may become more at risk. Consequently, our findings regarding factors associated with post-vaccination infection may change over time, to align more closely with variables identified as associated with lower antibody levels. Longitudinal antibody testing within TwinsUK at Q4 highlighted the effectiveness...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.19.22275214
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.21.22275413

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.21.22275413: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  We also acknowledge several limitations of our study. First, the GWAS data for COVID-19 and VTE used in this study were derived from the European population, so the associations may not be applicable to other ancestries. Second, although GWAS summary statistics conducted study-specific quality control, misclassification of COVID-19 might exist. Third, the summary statistics limit us to assess sex and age-specific genetic effects. Fourth, the GWAS of COVID-19 related traits might be conducted at different time periods, so there might be differences in the SARS-COV-2 infection strain. However, our study does not aim to assess the association with specific strain of SARS-COV-2 infection. Finally, although our study provides evidence of genetic correlation and genetic overlap between COVID-19 and VTE, the underlying biological mechanisms are still unclear, and further studies are still needed for validation. In conclusion, our findings provided novel evidence of genetic correlations between severe COVID-19, COVID-19 hospitalization, SARS-CoV-2 infection and VTE, and highlighted their common genetic architecture, with shared genes closely related to coagulation and immunity. Our works contribute to the understanding of COVID-19 and VTE etiology, and open up new insights into the prevention and comorbidity management of COVID-19.
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.21.22275413
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.18.22275240

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.18.22275240: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Participants were eligible if they were living in the UK, identified with one or more of the target groups, had good understanding of English and were willing and able to provide informed consent (or parental consent was given for adolescents).<br>IRB: Ethical approval was provided by the University College London (UCL) research ethics committee ((project identifier 14895/005), and all participants provided informed written consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Interviewers were male and female postgraduate researchers who had prior experience of conducting qualitative interviews with people experiencing physical and mental health difficulties, and vulnerable groups.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Then, initial codes were generated inductively from a randomly selected sub-set of six transcripts, second coded by AB and AF.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Therefore, coding and the subsequent processes of thematic analysis; generation, reviewing and grouping of themes (Braun & Clarke, 2006; Braun & Clarke, 2021) were conducted for the remaining interviews by CR using Microsoft Excel and NVIVO12.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Finally, it is important to consider the merits and limitations of this study. Particularly, this study had a large sample size of 116 semi-structured interviews, which enabled inclusion of a broad range of views and experiences. Furthermore, three researchers met regularly throughout data analysis to discuss themes and to ensure that thematic analysis was applied appropriately. Thirdly, this study gives context to the quantitative findings relating to PA during the COVID-19 pandemic. Fourthly, in conjunction with the COM-B model (Michie et al., 2011), this study can be used to consider intervention components for increasing PA in future lockdowns and pandemics. However, this study also has several limitations. Firstly, the interviews were with individuals who were predominantly female, white British and educated to degree level, which limits the range of perspectives represented. The use of online and telephone interviews may also have excluded those who did not have online access. Additionally, as the CSS focused on broader mental health effects of the pandemic on several aspects of life, the depth of reflections relating to PA may be limited, however all participants were explicitly asked to reflect on their PA both before and during the pandemic. In conclusion, this study is the first to explore barriers and facilitators to PA for different demographic groups during the COVID-19 pandemic, and to map these onto a theoretical framework to aid understanding of PA behaviours ...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.18.22275240
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.18.22275283

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.18.22275283: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All individuals or their legal guardian gave informed consent prior to enrollment.<br>IRB: This study was overseen and approved by the MassGeneralBrigham Institutional Review Board (</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary natural killer cells for the antibody-dependent natural killer activation (ADNKA) assays were isolated from buffy coats from health donors using the RosetteSep NK cell enrichment kit (STEMCELL Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-dependent natural killer activation ( ADNKA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody Isotype and Fc Receptor Binding: Antigen-specific antibody isotype, subclass, and Fc receptor binding profiles were analyzed using a custom multiplex Luminex assay as previously described 35.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antigen-specific antibody isotype , subclass ,</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following overnight incubation, non-specific antibodies were washed off and the immune complexes were incubated with Ig isotypes or subclasses with a 1:100 diluted PE-conjugated secondary antibody for IgG1 (clone: HP6001), IgG2 (clone: 31-7-4), IgG3 (clone: HP6050), IgG4 (clone: HP6025), IgM (clone: SA-DA4), IgA1 (clone: B3506B4), or IgA2 (clone: A9604D2) (all Southern Biotech).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following incubation, excessive antibodies were washed off and relative antigen-specific antibody levels were determined on an iQue analyzer (Intellicyt)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">C3 deposited on beads were stained with anti-guinea pig C3-FITC antibody (MP Biomedicals, 1:100</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-guinea pig C3-FITC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody-Dependent Neutrophil Phagocytosis (ADNP) Assays: ADNP assays were performed as previously described 37.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antibody-Dependent Neutrophil Phagocytosis ( ADNP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell Lines and Primary Cells: THP-1 cells, a human leukemia monocyte cell line, were maintained in RPMI-1640 Medium (Sigma-Aldrich) with 10% fetal bovine serum (FBS, Sigma-Aldrich), 1% L-glutamine (Corning), 2% of 5000 IU/mL of Penicillin and 5,000 ug/ml of Streptomycin Solution (Pen-Strep, Corning), 1% of 1M HEPES (Corning), and 5mM 2-Mercaptoethanol (Gibco).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>THP-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human embryonic kidney (HEK) 293T cells expressing ACE2 for neutralization assays were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM, Corning) with 10% FBS (VWR) and 1% Pen-Strep (Corning) and incubated in 37°C with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Three-fold serial dilutions of plasma samples starting at 1:12 or 1:30 were performed before adding pseudovirus expressing either SARS-CoV-2 wild-type spike or omicron variant spike to HEK293T expressing ACE-2 cells for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: RRID:CVCL_HA71)</div></div><div style="margin-bottom:8px"><div>ACE-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary neutrophils for antibody-dependent neutrophil phagocytosis (ADNP) assays were isolated from whole blood from healthy donors using Ammonium-Chloride-Potassium (ACK) Lysing Buffer (Quality Biological) followed by centrifugation and multiple wash steps prior to assay usage.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Quality Biological</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data Analysis and Statistics: Data analysis was performed on GraphPad Prism (v.9.3) and RStudio (v.1.3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.18.22275283
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.18.22275217

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.18.22275217: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The first-stage logistic regression modeled the probability of parental hesitancy as a function of fixed effects for documented gender (male, female), age group (18-24, 25-34, 35-44, 45-54, 55-64, 65+), education (high school or fewer years of education, some college or a two-year degree, four-year degree, graduate degree), and race/ethnicity (Hispanic, non-Hispanic American Indian or Alaska Native, non-Hispanic Asian, non-Hispanic Black, non-Hispanic Native Hawaiian or Other Pacific Islander, non-Hispanic White, non-Hispanic multiracial or other race), and age group of child (unknown, 12 to 17, and 5 to 11), and nested random intercepts on state and county: We did not perform a weighted regression to include the CTIS survey weights, instead adjusting for the probability of inclusion and non-response through post-stratification.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>non-Hispanic White</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  The results of our study should be interpreted in the context of several limitations. First, to predict plateau coverage for children ages 5 to 11 years we assumed that the relationship between hesitancy and coverage observed for children ages 12 to 17 applies to this younger age group. Our three-month validation supports this assumption, which is necessary for prospective estimation. Second, estimates of hesitancy for children of different age groups only became available in Wave 12 of the CTIS survey, and respondents are only asked about intentions to vaccinate their oldest child. Third, we rely on historical relationships between hesitancy and observed coverage, which will not capture the evolving COVID-19 policy and epidemiologic landscape. Fourth, our analytic framework is designed to capture geographic variation in coverage but not variation by other important population characteristics such as race/ethnicity within small geographic areas. Despite these limitations, our estimates reflect a principled approach to generating bias-adjusted estimates of vaccination coverage that can be used to inform decisions and evaluate actual progress against a reference scenario.
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.18.22275217
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.18.22275234

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.18.22275234: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Procedures: Until April 11, 2022, eligibility for outpatient COVID therapy required adjudication and approval by an institutional committee which included an infectious diseases physician (MM).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This study does have limitations. Most importantly, this is not a randomized controlled trial, and we do not have controls for comparison. Comparing these data with historical controls would be biased, given changing vaccination status, variants, and therapeutic options over time. A comparison with patients who did not receive nirmatrelvir/ritonavir also would be biased, as these patients would be importantly different from the treated group.. Lastly, the purpose of this case series is not to demonstrate the efficacy of nirmatrelvir/ritonavir, rather to report that a modified dose is well tolerated in this population. The importance of our experience is to allow faster implementation of modified dose protocol of nirmatrelvir/ritonavir for dialysis patients and shorten the period of therapeutic nihilism. Though monoclonal antibodies are easier and considered safer to use in the dialysis population, since there is no need for dose adjustment, their efficacy also changes as newer and resistant variants arise with mutations in the receptor binding domain (RBD) of the spike protein. This is less likely to happen with antiviral drugs, and the experience we describe will be useful for management of dialysis patients in the next few waves. We do not have robust evidence in the form of a randomized controlled trial. It should be noted that the phase 3 trial which led to the drug approval included 2246 patients, and to do such a large trial specifically in dialysis patients may not be ...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.18.22275234
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.19.22275310

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.19.22275310: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: Thank you for sharing your data.
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.19.22275310
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.19.22275316

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.19.22275316: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The University of Alberta Research Ethics board approved this study (Pro00111835).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study had several limitations. Due to the heterogeneity of our populations tested, it is difficult to exclude confounders that may have contributed to ID NOW performance. However, we previously observed no differences in sensitivity based on common patient, collecting and testing characteristics, including age, gender, and swab type.2 Our current study also did not demonstrate any difference in performance with these characteristics, though the sample size was not large enough to make any concrete conclusions. Another limitation is the inability to exclusively study Omicron by itself. While the Delta variant only represented 0.7% of variants detected from the assessment centres during our study period, there was still a moderately high proportion (14.5%) of delta variant still circulating within our hospitals. This study did not assess the Omicron BA.2 sublineage, as it was not circulating in our population during the study period. Other limitations include missing parallel RT-PCR results that could affect the sensitivity observed in our study. As previously mentioned, many (45.5%) ID NOW positive samples did not undergo variant testing which would affect our calculated specificity. ID NOW sensitivity may be slightly lower than we calculated due to the exclusion of 398 ID NOW negative samples that subsequently did not have a second sample tested with RT-PCR. Reasons behind missing parallel RT-PCR are multifactorial and include sample lost or discarded prior to testing, te...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.19.22275316
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.18.22275242

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.18.22275242: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the Ethics Committee of Hyogo Medical College (registration number 3866) and was described in line with the SQIURE (Quality Improvement Reporting Excellence) 2.0 checklist[15].</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  There are some limitations to this study. The setting and description of each “Function” has a high degree of freedom, and the reproducibility and universality of the model may be poor. In addition, since the scope of each function acting on the entire system is infinitely broad and can be infinitely subdivided, it is essential to examine the validity of the breadth and fineness of the descriptions in this report. Although we have attempted to formulate some prospective functions, the analysis of disturbances that occur suddenly and without warning must be performed retrospectively. The usefulness of FRAM from a predictive perspective is an important issue for the future. In this study, we conducted FRAM system analysis of the process of establishing a safe and uninterrupted system to provide rehabilitation for COVID-19 patients and attempted to develop a strategy to deal with foreseeable problems. The presentation of “Functions” and the analysis of the elements of each “Function” are useful for constructing a system can be modified from time to time, and may be applied to the operation of different systems in different situations. From our results, we conclude that the analysis of our medical rehabilitation provision system by FRAM allows the prediction of necessary measures in the future and contributes to the establishment of a safe and uninterrupted system for providing rehabilitation.
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.18.22275242
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.19.22275026

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.19.22275026: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Ethics approval: All participants provided written informed consent.<br>IRB: This study was approved by the University of British Columbia/Providence Health Care and Simon Fraser University Research Ethics Boards (protocol H20-03906).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">At each visit, serum was tested for the presence of SARS-CoV-2 anti-nucleocapsid (N) antibodies, which indicate seroconversion following infection, using the Elecsys Anti-SARS-CoV-2 assay on a Cobas e601 module analyzer (Roche Diagnostics).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-nucleocapsid (N)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Binding antibody assays: We quantified anti-Spike Receptor Binding Domain (RBD) binding IgG concentrations in serum using the V-plex SARS-CoV-2 (IgG) Panel 22 ELISA kit (Meso Scale Diagnostics), which features wild-type and Omicron BA.1 RBD antigens.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Spike Receptor Binding Domain (RBD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2 (IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Data visualization and statistical analysis was conducted in Prism v9.2.0 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  A limitation of our study is that it did not assess T cell responses, which can reduce disease severity but may have less impact on virus transmission (53, 54), and thus we may be underestimating the protection that results from infection and reinfection in this case. Indeed, the participant’s symptoms following both infections were not severe enough to require hospitalization, demonstrating that vaccination was effective in its primary goal of preventing disease. Our results nevertheless illustrate the potentially limited ability of current vaccines to prevent recurrent infections and symptomatic disease caused by Omicron variants.
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.19.22275026
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.18.22275293

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.18.22275293: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Oracle Crystal Ball (Version 11.1.2.4.900) and IBM SPSS Statistics (Version 28) were used for the analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This study has some limitations. First, the target population was employees of companies and their dependent family members. The findings of this study cannot be generalized to the entire population and other countries. Furthermore, only the population aged 74 years and below were included in this study. Although COVID-19 isolation measures are known to worsen cognitive and mental health among people with dementia [36], this study was unable to assess the secondary health effects among the population aged 75 years and older. Second, we could not fully examine the possibility of changes in accessibility to healthcare facilities after the Fukushima disaster or the COVID-19 outbreak compared to accessibility to health care before the disaster and outbreak. However, it is unlikely that NCDs were overlooked before the disaster or outbreak, since employees of companies, the target population of this study, generally receive regular health checkups. Third, this study was based on an ecological study design and did not identify the causes of changes in the prevalence of various diseases. Long-term cohort studies based on individuals exposed to disasters and pandemics are expected to assess the impact of disasters and pandemics on secondary health and identify the factors that influence this impact. Despite these limitations, this study provided unique insights into the secondary health effects of the Fukushima disaster and COVID-19 outbreak and identified age and sex groups that were...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.18.22275293
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.18.22275203

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.18.22275203: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants provided informed consent after the purpose and objectives of the study were thoroughly explained to them.<br>IRB: 2.7 Ethics: The present study was carried out in accordance with Institutional Research Ethics and the Helsinki Declaration.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">In the present study, the WEMWBS showed content reliability (Cronbach’s alpha =0.89) 2.5 Sampling procedure: The sample size was calculated using the following equation: The calculated sampling size was 384.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations: There are several limitations to the study that should be considered. The main limitation of this study is that participation in the study required access to a smartphone/computer, implying that respondents from the lower socioeconomic subgroup could not be included. Second, because this study relied on self-reported data, it was not completely free of recall or reporting bias. Third, because the study was conducted online using a convenience sampling technique, the possibility of selection bias should be considered. Finally, the study’s cross-sectional design includes method bias because a causal relationship cannot be accurately elucidated in this design. Future qualitative and longitudinal studies will be required to determine the true scenario in the context of the COVID-19 pandemic.
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.18.22275203
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.19.22275325

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.19.22275325: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Due to the time-sensitive nature of this research topic, a rapid review was conducted in accordance with the interim guidance from the Cochrane Rapid Reviews Group.(17) Compared to a traditional systematic review, abbreviated steps in a rapid review include searching fewer databases, double screening 20% of titles and abstracts, single screening of full texts, and synthesising evidence narratively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cochrane Rapid Reviews Group.</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data extraction form was piloted with members of the screening team (LG, MF, FM), data extraction then carried out using Microsoft Excel.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Strengths and Limitations: Due to the emerging nature of the review topic, a rapid review was carried out which, according to the Cochrane Rapid Reviews Methods Group, ‘accelerates the process of conducting a traditional systematic review through streamlining or omitting specific methods to produce evidence for stakeholders in a resource-efficient manner’.(17) A strength of this review was the timely provision of high-quality evidence. This rapid review followed guidance from the Cochrane Rapid Reviews Methods Group and included a search strategy developed with input from a wide group of experts, including a librarian and a systematic reviews expert. Although study selection, data abstraction and risk of bias assessment performed were not performed in duplicate, each step was verified by a second reviewer. However, as with any review, there were also some limitations. Results were limited to English language studies published since the year 2000, and the search was limited to two online databases. The majority of the included studies were conducted in the US, which could limit the generalisability of the review findings. Finally, Ireland has implemented a system for the electronic transfer of prescriptions, as opposed to a comprehensive e-prescribing system, therefore the findings of this study may not accurately reflect the issues currently encountered in the Irish healthcare system. Further Research: This review has highlighted a number of important areas for further resear...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.19.22275325
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.19.22275317

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.19.22275317: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics and data collection: The study was reviewed and approved by the Ethical Review Boards ATS Sardegna - Prot. N° 2492/CE.<br>Consent: The patients/participants provided their written informed consent to participate in this study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantification of SARS-CoV-2 antibodies direct against the proteins Spike (S) or Nucleocapsid (N) in human serum was performed using the electrochemiluminescence immunoassays Elecsys® Anti-SARS-CoV-S and Elecsys® Anti-SARS-CoV-N (Roche).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-SARS-CoV-N</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differences between patient groups - stratified according to therapy and selected for Anti-N antibody negativity - were assessed with a negative binomial generalized linear mixed-effects model, which takes into account the nature of the outcome variable (anti-S, non-negative count data); in addition to therapy, the models also consider the contribution of other variables such as age, smoke, sex, Expanded Disability Status Scale (EDSS), disease duration, and clinical sampling center.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-N</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.19.22275317
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.18.22275292

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.18.22275292: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study participants: This study was approved by the SingHealth Centralized Institutional Review Board (CIRB/F 2021/2014).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  There are limitations in this study; in addition to the small sample size, phenotypic analysis of the nasal T cells and analysis of their SARS-CoV-2 specificity was limited to few markers of tissue residency (CD69 and CD103) and memory (CD45RA and CCR7) and to selected SARS-CoV-2 proteins (NP, membrane, Spike and NSP-12). The limited number of T cells collected impose these limitations. To better define the breath of the nasal resident T cell response against SARS-CoV-2 it will be necessary to analyze their ability to recognize epitopes derived from others structural, non-structural proteins or out-of-frame Open Reading Frames that have been shown to induce robust CD8 T cell response in circulation(Weingarten-Gabbay et al., 2021). The potential distinct functionality of Nasal SARS-CoV-2 T cells will need also to be analyzed by analysis of their transcriptomic profile, in addition their ability to produce IFN-γ and degranulate. Finally, as already mentioned, study of the durability of the nasal resident SARS-CoV-2 T cells over 3 months are warranted to understand the long-term impact of nasal resident T cells in SARS-CoV-2 protection.
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.18.22275292
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.20.492779

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.20.492779: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Animal research was carried out under a United Kingdom Home Office License, P48DAD9B4.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Stably transduced ACE2-expressing 293T cells were produced as previously described (32), and maintained with the addition of 1 μg/ml puromycin to growth medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: KCB Cat# KCB 200744YJ, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All viral stocks used in this study were grown in the VeroE6-ACE2-TMPRSS2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-ACE2-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral particles were produced in a 10 cm dish seeded the day prior with 5×106 HEK293T/17 cells in 10 ml of complete Dulbecco’s Modified Eagle’s Medium (DMEM-C, 10% FBS and 1% Pen/Strep) containing 10% (vol/vol)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T/17</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, Hela cells stably expressing the ACE2 receptor were added (10,000 cells/25μL per well) and the plates were left for 72 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Hela</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analysis was performed using Graphpad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.20.492779
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.20.492815

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.20.492815: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The experiments were not randomized, and the investigators were not blinded to allocation during experiments and outcome assessment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">The experiments were not randomized, and the investigators were not blinded to allocation during experiments and outcome assessment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">No statistical methods were used to predetermine sample size.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, a pQE-30/pcl-ts ind+ plasmid containing a His6-SUMO SARS-CoV-2 nsp12 and untagged nsp7 & 8 (Addgene #160540) was transformed into E. coli BL21 cells (Agilent).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pQE-30/pcl-ts ind+</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E. coli BL21 (DE3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDFDuet-1</div><div>suggested: RRID:Addgene_15917)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow-through was collected, concentrated by centrifugal filtration (Amicon), and loaded on a Superdex 200 Hiload 16/600 (Cytiva).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Amicon</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The CTF was estimated for each summed image using the Patch CTF module in cryoSPARC v3.1.0 38.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Models were inspected and modified in Coot 0.9.5 45 and the refinement process was repeated iteratively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For data processing, the acquired MS spectra were visualized using Thermo Xcalibur Qual Browser (v. 4.2.47).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo Xcalibur Qual Browser</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The quantification and statistical analyses for model refinement and validation were generated using MolProbity 49 and PHENIX 50.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MolProbity</div><div>suggested: (MolProbity, RRID:SCR_014226)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.20.492815
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.20.492834

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.20.492834: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethics statement: This study was approved by the Virginia Polytechnic Institute & State University Institutional Animal Care and Use Committee (Protocol # 20-228, approved 02/01/2021).<br>Field Sample Permit: Tissue types collected, methods of collection, and downstream assays were the same as described for the mice.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mouse infections: Eight to ten-week-old male and female B6.Cg-Tg(K18-ACE2)2Prlmn/J mice (Stock # 034860; Jackson Laboratory; n=12, 2 groups of 6 mice), and their wild-type C57BL/6J counterparts (n=12, 2 groups of 6 mice) were inoculated intranasally with SARS-CoV-2 isolate USA-WA1/2020 (Extended Data Fig 1a).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animals were randomly assigned to either inoculum group or control group ensuring the groups were age-matched.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 N protein was visualized using an Alexa Fluor® 488 conjugated rabbit monoclonal anti-SARS-CoV-2 nucleocapsid antibody at a 1:1000 concentration (NBP2-90988AF488; Novus Biologicals).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">hACE2 was visualized using an Alexa Fluor® 594 conjugated mouse monoclonal anti-ACE2 antibody at a 1:1000 concentration (sc-390851 AF594; Santa Cruz Biotechnology).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-7385 AF594, RRID:AB_2847914)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">NeuN was visualized using an Alexa Fluor® 647 conjugated rabbit monoclonal anti-NeuN antibody at a 1:1000 concentration (ab190565; Abcam).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-NeuN</div><div>suggested: (Abcam Cat# ab190565, RRID:AB_2732785)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tyrosine hydroxylase was visualized using an Alexa Fluor® 594 conjugated mouse monoclonal anti-TH antibody at a 1:500 concentration (818004; Biolegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-TH</div><div>suggested: (LSBio (LifeSpan Cat# LS-C40052-500, RRID:AB_972074)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Glutamine synthetase was visualized using a mouse monoclonal anti-GS antibody at a 1:100 concentration (MA5-27750; Invitrogen) followed by an Alexa Fluor® 594 conjugated goat anti-mouse monoclonal antibody at a 1:1000 concentration (A11005; Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-GS</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Molecular Probes Cat# A-11005, RRID:AB_141372)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neuropilin-1 was visualized using a goat polyclonal anti-NRP1 antibody at a 15 μg/mL concentration (AF566; R&D Systems) followed by an Alexa Fluor® 647 conjugated donkey anti-goat monoclonal antibody at a 1:1000 concentration (ab150135; Abcam).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-NRP1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-goat</div><div>suggested: (Abcam Cat# ab150135, RRID:AB_2687955)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The undiluted tissue homogenate as well as a ten-fold dilution of homogenate was inoculated in duplicate onto confluent monolayers of Vero E6 cells in 24-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neurons were pretreated with 100 μM of the NRP-1 antagonist EG00229 (6986; Tocris) dissolved in DMSO prior to infection as described for Caco-2 cells24.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse infections: Eight to ten-week-old male and female B6.Cg-Tg(K18-ACE2)2Prlmn/J mice (Stock # 034860; Jackson Laboratory; n=12, 2 groups of 6 mice), and their wild-type C57BL/6J counterparts (n=12, 2 groups of 6 mice) were inoculated intranasally with SARS-CoV-2 isolate USA-WA1/2020 (Extended Data Fig 1a).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B6.Cg-Tg(K18-ACE2)2Prlmn/J</div><div>suggested: RRID:IMSR_JAX:034860)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Uninfected K18-hACE2 control mice (n=2) and C57BL/6J wild-type control mice (n=2) were housed in a separate on campus ABSL-1 facility.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: RRID:IMSR_JAX:000664)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were imported into ImageJ and contrast and brightness was adjusted identically across all images within tissue types.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were performed in JMP Pro 16 (SAS Institute) and confirmed in GraphPad Prism version 8 during figure creation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.20.492834
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.20.492819

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.20.492819: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The outputs let us identify and visualize the pockets observed throughout the whole simulation time with the PyMol software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">25 potential fragment hits were discovered by running PanDDA, and one of them was verified by manual inspection in COOT followed by refinement in Phenix.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sequences were aligned with MEGA, version 11.0.11. 53 The resulting multi sequence alignment was used to construct the Maximum-Likelihood Tree with MEGA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGA</div><div>suggested: (Mega BLAST, RRID:SCR_011920)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/content/10.1101/2022.05.20.492819v3
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.16.491922

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.16.491922: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: All of the data was generated from public available database and did not required ethics committee approval.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.16.491922
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.19.492636

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.19.492636: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: Thank you for sharing your data.
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.19.492636
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.20.22275356

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.20.22275356: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Stage 1: From the three senatorial districts in Oyo state, 8 LGAs were selected from each senatorial district using simple random sampling by balloting.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were coded, cleaned and analysed using SPSS version 25 software and MS-Excel.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.20.22275356
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.19.22275149

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.19.22275149: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: This study received approval from the Ethical Review Committee, The Aga Khan University (<br>Field Sample Permit: The first 10 positive specimens were identified and collected through consecutive convenience sampling.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.19.22275149
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.19.22275126

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.19.22275126: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics: The EDSAB-HOME study was approved by NHS Research Ethics Committee (Health Research Authority, IRAS 284980) on 02/06/2020 and PHE Research Ethics and Governance Group (REGG, NR0198) on 21/05/2020.<br>Consent: All participants gave written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Study participants: The study population consisted of key workers recruited to the Evaluating Detection of SARS-CoV-2 AntiBodies at HOME (EDSAB-HOME) prospective cohort study (ISRCTN56609224) (27).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ISRCTN56609224</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The AbC-19, OrientGene, and SureScreen devices detect anti-Spike protein antibodies while the Biomerica device detects anti-Nucleoprotein antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Spike protein</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Nucleoprotein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The OrientGene, SureScreen, Biomerica devices contain separate bands to detect IgG and IgM antibodies, while AbC-19 detects IgG antibodies only.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For each antibody test, we describe the number of participants who tested positive for SARS-CoV-2, and observed rate per 100 person years, in each of these three periods, stratified by baseline test result.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Kaplan-Meier survival curves were also produced, to describe the development of SARS-CoV-2 positivity over time in those who were antibody-positive or antibody-negative according to each test.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-negative</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  While this study shows a strong association between lateral flow device results and subsequent SARS-CoV-2 infection, it has several limitations. Firstly, it applies to a historical cohort of unvaccinated individuals. Secondly, lateral flow devices were applied and read using stored plasma, obtained by venesection, in a laboratory setting by trained professionals, rather than relying on measurement in the field by the public using finger-prick technology. This arrangement had the advantage that the subjects did not know their lateral flow device results, minimising potential bias, but leaves open the possibility that performance on finger prick samples might differ from that in the laboratory setting we used. This concern has been addressed for the SureScreen device,, for which data has now been published showing very similar accuracy of the SureScreen device on finger-prick samples taken from individuals and serum samples analysed in a laboratory (24). Finally, some healthcare workers in the cohort received a single vaccine dose in late December 2020 and early January 2021 in the UK, in the final weeks of our follow-up period; it is possible that some individuals acquired protection through vaccination in the last weeks of follow-up, so the true protection associated with LFIA positive tests may be higher than we observed. Lateral flow devices have very different reported accuracy. This is likely to be explicable in part by device design, and in part by selection of samples u...
  
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">ISRCTN5660922</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">ISRCTN56609224</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td></tr></table>
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.19.22275126
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.19.22275029

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.19.22275029: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the Northwestern University Institutional Review Board (IRB).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">a, GA) for 1 hr at room temperature and then exposed to a 1:2,000 concentration of polyclonal anti-ExoU antibodies overnight at 4°C on a slow rocker (29).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ExoU</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The membrane was washed three times with 1x TBS-T at room temperature and then exposed to a goat anti-rabbit secondary antibody (LI-COR Biosciences, Lincoln, NE) at a 1:5,000 concentration in 20 mL of 5% milk buffer in 1x TBS-T for 1 hr at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For certain experiments, P. aeruginosa strains PA14, PA14exoU, and PAO1 were used as controls.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>P. aeruginosa</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequences were trimmed using Trimmomatic v0.32 (17) and then de novo assembly was performed with SPAdes 3.9.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Trimmomatic</div><div>suggested: (Trimmomatic, RRID:SCR_011848)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Illumina reads were aligned to the assembly using BWA v0.7.17 (21), and assembly errors were corrected using Pilon v1.23 (22) with a minimum depth setting of 0.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA</div><div>suggested: (BWA, RRID:SCR_010910)</div></div><div style="margin-bottom:8px"><div>Pilon</div><div>suggested: (Pilon , RRID:SCR_014731)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single nucleotide variants relative to the reference were identified using bcftools v1.9 skipping bases with base quality lower than 25, alignment quality less than 30, and using a haploid model.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>bcftools</div><div>suggested: (SAMtools/BCFtools, RRID:SCR_005227)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.19.22275029
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.20.22275380

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.20.22275380: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Local ethical approval was given by the Hull York Medical School Ethics Committee (Reference 20 62).<br>Consent: Only participants who gave their active digital informed consent were allowed to complete the survey and memory quiz.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">First, we assessed the contributions of COVID status (x2 groups: non-COVID, COVID), symptoms (2 groups: symptoms, no symptoms), ongoing symptoms (2 groups: ongoing symptoms, no ongoing symptoms), age (8 groups: 18-24, 25-34, 35-44, 45-54, 55-64, 65-74, 75-84 and 85+) and gender (2 groups: female, male).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">’ The animal category was presented first to encourage participants to engage with the memory task, followed by either the number or fruit categories (randomised).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All images were edited using Adobe Photoshop CC 2015 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Adobe Photoshop</div><div>suggested: (Adobe Photoshop, RRID:SCR_014199)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis: Statistical analysis was performed using SPSS (Version 27.0, IBM Corporation, Armonk, N.Y., USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  One limitation with our survey and memory quiz was that it was not conducted under controlled laboratory conditions. For instance, the presence of a researcher may encourage a participant to take the survey more seriously and answer the questions accurately. However, requiring the presence of a researcher would make the study more practically challenging and would limit the number of participants that could be recruited. Furthermore, the presence of a researcher does not necessarily ensure that participants will complete all aspects of the survey and memory quiz accurately. It is also possible that participants may have been distracted during our memory quiz thereby affecting the scores. We attempted to mitigate against this possibility by instructing participants to complete the quiz in a quiet place without distractions. Nevertheless, the large number of participants in both the COVID and non-COVID groups was able to provide sufficient power to reveal a highly significant difference. In our study, 31.4% of participants reported having had COVID-19 between January 2020 and July 2021. These included those who self-reported, tested positive and were hospitalised with COVID-19. Since COVID-19 tests were not commonly available in the earlier stages of the pandemic, we allowed participants to self-report whether they thought they may have had COVID-19. We cannot be certain whether these participants in fact had COVID-19. However, we found no significant difference in memory score...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.20.22275380
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.20.22275313

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.20.22275313: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">We included studies of the babies of pregnant women with a diagnosis of SARS-CoV-2 during pregnancy.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were extracted into Microsoft Excel (Version 2201) by SS or SA using a proforma with the outcomes described above, study type and dates, location, participant definition and numbers, and method of SARS-CoV-2 diagnosis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was completed using Microsoft Excel, SPSS (IBM SPSS Statistics for Macintosh, Version 25, 2017[16]) and R (R Studio Version 2021.09.01[</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study has several limitations. Although we identified many studies reporting perinatal outcomes, there was little information reporting neonatal morbidity in depth. Granular detail describing the indirect neonatal consequences of maternal SARS-CoV-2 infection during pregnancy remain unclear. This limitation is particularly pronounced for neurodevelopmental outcomes. With the SARS-CoV-2 declared pandemic two years ago, we hope that more information regarding these crucial outcomes will emerge soon; one trial is currently recruiting (the ASPIRE trial) which will follow up infant outcomes for 1.5 years[40], and another (the SINEPOST study) will examine development from 18 months onwards[41]. Furthermore, we found that studies varied widely on their reporting of severity of maternal disease and maternal symptoms; therefore, we were unable to study the effect of maternal symptomology on neonatal outcomes. Finally, we found limited evidence from middle-, and particularly, low-income countries, and little data regarding infections in early pregnancy. These are key research priorities to allow clinicians to adequately inform expectant families.
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.20.22275313
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.18.22275245

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.18.22275245: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Informed consent with participation in this study was signed by the participants’ legal guardians in accordance with the Declaration of Helsinki and the study was approved by the Ethical Committee of the University Hospital in Motol, reference no. EK-1376/21.<br>IRB: Informed consent with participation in this study was signed by the participants’ legal guardians in accordance with the Declaration of Helsinki and the study was approved by the Ethical Committee of the University Hospital in Motol, reference no. EK-1376/21.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">In total, 50 MIS-C patients were recruited during the inclusion period between October 2020 and April 2021, 24 female, age 11 months to 18 years (7.8 ± 4.35 years, mean ± SD).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry measurement was performed on BD FACSLyrics (BD Immunocytometry Systems, San Jose, CA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Immunocytometry Systems</div><div>suggested: (South Florida University College of Medicine Fred Wright Jr Flow Cytometry Core Facility, RRID:SCR_017901)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FlowJo software was used for data analysis (TreeStar, Ashland, OR).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: Statistical analysis was performed using using Brown-Forsythe and Welch one-way analysis of variance (ANOVA) and unpaired t-tests with Welch’s correction in GraphPad Prism 8.0 (San Diego, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.18.22275245
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.20.22275359

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.20.22275359: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: Thank you for sharing your data.
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.20.22275359
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2022.05.20.492832

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.20.492832: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All the cell lines were cultured at 37°C under a 5% CO2 atmosphere, and were routinely screened for mycoplasma.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The membrane was blocked with 5% dried milk in PBS Tween 0.1 %, before incubation with three primary antibodies (S1, S2, and p24 Gag or actin) for 1h at room temperature (RT), followed by 3 washes in PBS Tween 0.1 %, and incubation with secondary antibodies for 30 min at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Gag or actin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies consisted in two anti-spike antibodies (rabbit anti-S1 Genetex #GTX135356, 1:1000 and mouse anti-S2 Genetex #GTX632604, 1:1000), and one normalization antibody: mouse anti-p24 Gag (R&D Systems # MAB7360; 1:1000) or mouse anti-actin (Cell Signaling #8H10D10, 1:2000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-spike</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-p24</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-actin (Cell Signaling #8H10D10</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-rabbit and anti-mouse IgG secondary antibodies, conjugated to DyLight-800 (Bethyl Laboratories, #A80-304D8) and DyLight-680 (ThermoFisher, #SA5-35521), respectively, were used at a 1:5000 dilution each.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-rabbit</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (Thermo Fisher Scientific Cat# SA5-35521, RRID:AB_2556774)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After two PBS washes, cells were stained with a Goat anti-human AF647 antibody (ThermoFisher, #A21445) at 1:500 for 30 min at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human AF647</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To evaluate ACE2 and TMPRSS2 expression in the target cell lines used, cells were surface-labelled with the goat anti-ACE2 antibody (R&D #AF933) at 5 mg/mL for 30 min at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, cells were incubated with the secondary antibody donkey anti-goat-AF647 (ThermoFisher #A21447) at a 1:500 dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-goat-AF647</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were intracellularly stained with a rabbit anti-TMPRSS2 antibody (Atlas antibodies, HPA035787) at 0.3 mg/mL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-TMPRSS2</div><div>suggested: (Sigma-Aldrich Cat# HPA035787, RRID:AB_2674782)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, the secondary staining was done with a donkey anti-rabbit-AF555 antibody (Fisher #16229260) at a 1:500 dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit-AF555</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: HEK 293Tn (purchased from SBI Biosciences) and Calu-3 (ATCC</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: KCLB Cat# 30055, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK 293T-hACE2-TMPRSS2 cells (called herein HEK-ACE2-TMPRSS2) were induced for TPMRSS2 expression by addition of doxycycline (0.5 μg/mL, Sigma) and were maintained in DMEMc with blasticidin (10 μg/mL, InvivoGen) and puromycin (1 μg/mL, Alfa Aesar).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T-hACE2-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">U2OS cells expressing hACE2 and GFP1-10 or hACE2, TMPRSS2, and GFP1-10 were maintained in DMEMc supplemented with blasticidin (10 μg/mL, InvivoGen), puromycin (1 μg/mL</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>U2OS</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK 293T and Vero-E6 cells expressing GFP1-10 and GFP11 were maintained in DMEMc supplemented with 1 μg/mL and 4 μg/mL of puromycin, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production of spike-pseudotyped lentivectors: GFP lentiviral particles pseudotyped with the SARS-CoV-2 spike were prepared by transfection of HEK 293Tn cells using the CaCl2 method.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293Tn</div><div>suggested: RRID:CVCL_UL49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infection with spike-pseudotyped lentivectors: The day before infection with spike-pseudotyped GFP-lentivectors, 100,000 HEK-ACE2-TMPRSS2 cells were plated in 96-well plates, and TMPRSS2 was induced when needed by the addition of doxycycline.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-ACE2-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK and U2OS were infected with 0.125 μg of p24 Gag equivalent, while Calu-3 were infected with 1 μg of p24 Gag equivalent, all in a final volume of 100 μL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For infection, 50 μL of medium containing 0.065 μg of p24 Gag equivalent was added onto HEK ACE2 +/− TMPRSS2 and U2OS ACE2 +/− TMPRSS2, while 0.5 μg of p24 Gag equivalent in 50 μl added onto Calu-3 cells, resulting in a 2x dilution of the protease inhibitors.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 30 min, transfected cells were washed in DMEMna and spun at 500 g for 5 min before being mixed at a 1:1 ratio with Vero GFP11 cells in DMEMna.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero GFP11</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids: All the spike mutations were inserted into a codon-optimized version of the Wuhan-Hu-1 SARS-CoV-2 spike (GenBank: QHD43416.1) cloned into a phCMV backbone ( GenBank: AJ318514).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>phCMV</div><div>suggested: RRID:Addgene_15802)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids used to produce GFP-lentiviruses were the lentivector backbone pCDH-EF1α-GFP (System Biosciences), the packaging plasmid psPAXII (Addgene), and the pRev plasmid (a gift from P. Charneau).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDH-EF1α-GFP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>psPAXII</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pRev</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transfection of HEK 293Tn cells with spike vectors: Transfection was performed with Lipofectamine 2000 (ThermoFisher, #11668019), using 125 ng of phCMV-Spike plasmid diluted in OptiMem medium in a final volume of 25 μL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>phCMV-Spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The lentiviral vector pCDH-EF1a-GFP, the packaging plasmid psPAXII, the spike expression vector phCMV-Spike and the pRev plasmid were mixed at a 2:2:1:1 ratio, with a total DNA amount of 252 μg used per 175 cm2 flask.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDH-EF1a-GFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The pQCXIP-empty plasmid was used to generate a spike-negative control.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pQCXIP-empty</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Luciferase lentiviral particles were produced according to the same protocol, but with different plasmid ratios: the lentiviral backbone pHAGE-CMV-Luc2-IRES-ZsGreen, the packaging plasmid pHDM-Hgpm2, the Tat and Rev plasmids pHDM-tat1b and pRC-CMV-rev1b, and the spike plasmid phCMV-Spike were used at ratio 4.4:1:1:1:1.5 to transfect a 175 cm2 flask.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHDM-Hgpm2</div><div>suggested: RRID:Addgene_164441)</div></div><div style="margin-bottom:8px"><div>pHDM-tat1b</div><div>suggested: RRID:Addgene_164442)</div></div><div style="margin-bottom:8px"><div>pRC-CMV-rev1b</div><div>suggested: RRID:Addgene_164443)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed with the FlowJo software v10.7.1 (Becton Dickinson).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: All statistical analyses were carried out with the GraphPad Prism software (v9).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All the graphs were generated in GraphPad Prism, except for the spider plots, which were made using Microsoft Excel (v16.16.27).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2022.05.20.492832
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.19.22275339

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.19.22275339: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This work was determined to be a public health surveillance activity by the Yale University Institutional Review Board.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Additionally, we generated race/ethnicity-specific (non-Hispanic Black, non-Hispanic White, Hispanic) Kaplan Meier curves and age-adjusted HRs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>non-Hispanic White</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our analysis was subject to limitations. First, not all vaccine offers are recorded, and our acceptance numbers are based solely on recorded offers. Second, our vaccination rates are based on recorded doses (from the community or facilities). Third, the DOC racial data is subject to missing data and reporting errors. Finally, our selection of residents and at-risk time for the survival analysis may have introduced bias. While the sensitivity analyses highlight the robustness of our findings, the magnitude of the observed association varied by examined sample. Public Health Implications: Despite observing moderate levels of vaccine acceptance among residents of state jails, we found newly incarcerated persons were far more likely to initiate vaccination following incarceration than prior to incarceration. Though our findings highlight the utility of vaccination programs within correctional facilities, they also speak to the need for ongoing, evidence-based vaccination program development within correctional facilities and the community.
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.19.22275339
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.20.22275350

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.20.22275350: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics: We obtained ethical approval for this study from Keele University’s Research Ethics Committee (reference: PS-200129).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Power: We conducted a post-hoc power analysis based on linear regression analyses.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: Thank you for sharing your data.
  
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.20.22275350
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.19.22275291

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.19.22275291: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the institutional review board of the University of Hong Kong / Hospital Authority Hong Kong West Cluster (reference no. UW 20-493).<br>Consent: Given the extraordinary nature of the COVID-19 pandemic, individual patient-informed consent was not required for this retrospective cohort study using anonymized data.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were performed using Stata version 17 (StataCorp LP, College Station, TX).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Nevertheless, several limitations of our study should be acknowledged. Firstly, we cannot exclude the possibility of selection bias or confounding by indication in this observational study, despite our population-based cohort was fully representative of the local COVID-19 patient population who did not require supplemental oxygen on admission. Besides, the clinical profile of our patients who would be deemed at risk of progression to severe COVID-19 might be different from those in the major trials of molnupiravir and nirmatrelvir/ritonavir, for instance, their dominant risk factor was overweight or obesity 22,23, whilst ours was old age. Secondly, since the Ct value was no longer adopted as one of the discharge criteria during our study period, patients might have already been deemed clinically stable for discharge before reaching the specific cutoff. Accordingly, further studies are needed to confirm our findings on viral load reduction and length of hospital stay associated with oral antiviral use. Results from ongoing trials (namely PANORAMIC and RECOVERY) and observational studies are awaiting 35-39, and further research is needed to explore the safety and effectiveness of oral antivirals in different patient populations (especially by COVID-19 vaccination status and VOC), drug combinations, and other healthcare settings such as nursing homes or residential care facilities. As proposed by the medical and research community, logistics and distribution issues should be ade...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.19.22275291
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2022.05.20.22275397

1
1. sciscore 25 May 2022
  
  in SciScore
  
  SciScore for 10.1101/2022.05.20.22275397: (What is this?)
  
  Please note, not all rigor criteria are appropriate for all manuscripts.
  
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was vetted and categorized as exempt by the Institutional Research Board.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  
  No key resources detected.
  
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations and future directions: Our study utilized aggregate data on a per-county basis instead of individual patient data; therefore, it is not possible to evaluate factors that contribute to COVID-19 case-fatality on a per case fashion which could help avoid any erroneous generalizations of specific regions. Another limitation of using county level data is that there is significant variability in the size and number of counties across the United States. Some counties may have only a few hundred people, while other counties may have a few million and this may lead, to some extent, representation bias. Future directions of this study include using these results to guide the evaluation of individuals’ factors that contribute directly to illness outcomes. Conclusion: Our study evaluated a multitude of factors that may affect COVID-19 case-fatality rate. Unlike previous studies that evaluated these factors separately, we performed a comprehensive analysis of all these variables together where they interact amongst each other. We identified several unique regionally dependent and independent relationships that highlighted the various factors that might influence COVID-19. Like other studies, we determined that comorbidities and demographic factors together are strong drivers of COVID-19 case fatalities. However, our study presents an assessment that puts them side to side for direct comparison. Our study highlights how any association is often dependent on the regional context...
  
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  
  Results from JetFighter: We did not find any issues relating to colormaps.
  
  Results from rtransparent:
  
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  
  Results from scite Reference Check: We found no unreliable references.
  
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2022.05.20.22275397

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL