24,814 Matching Annotations
  1. Nov 2021
  2. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.11.04.467246
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.11.04.467246: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, Alexa Fluor secondary antibody (Invitrogen) in blocking buffer was incubated on cells for 1 h, followed by washing, labeling of nuclei using 4’,6-diamidino-2-phenylindole (DAPI; Sigma Aldrich) or ToPro3 (ThermoFisher) and mounting onto glass slides with Vectashield (Vector Labs, Peterborough).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vectashield ( Vector Labs , Peterborough) .</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Huh7 cells (ATCC) were maintained in DMEM supplemented with 10% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VeroE6 cells (LGC Standards Ltd.) were maintained in DMEM supplemented with 10% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Porcine LLC-PK1 cells (ATCC CL-101 [46]) were maintained in DMEM supplemented with 10% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>LLC-PK1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BrU; Sigma Aldrich) and 15 μM actinomycin D (ActD; Sigma Aldrich) at 30 min prior to each timepoint.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BrU; Sigma Aldrich</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ActD; Sigma Aldrich</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, Alexa Fluor secondary antibody (Invitrogen) in blocking buffer was incubated on cells for 1 h, followed by washing, labeling of nuclei using 4’,6-diamidino-2-phenylindole (DAPI; Sigma Aldrich) or ToPro3 (ThermoFisher) and mounting onto glass slides with Vectashield (Vector Labs, Peterborough).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DAPI; Sigma Aldrich</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">STED Images were deconvolved using Huygens Professional software 18.10 (Scientific Volume Imaging, Netherlands).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huygens Professional</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Figures were assembled using Adobe Photoshop.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Adobe Photoshop</div><div>suggested: (Adobe Photoshop, RRID:SCR_014199)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.11.04.467246
  3. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.11.02.463717
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.11.02.463717: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Some validation measures are used to select the most suitable clustering method among hierarchical, k-means, and PAM (Partitioning Around Medoids) methods using clValid package [44].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>clValid</div><div>suggested: (clValid , RRID:SCR_014626)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.11.02.463717
  4. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.10.26.466019
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.10.26.466019: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Using the Pennylane program (freely available on Pennylane.ai) and the Anaconda Python application, we were able to design a properly working quantum variational classifier.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Initially, the Iris data set was used to test the classifier and determine if it worked.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Iris</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.10.26.466019
  5. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.10.27.466182
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.10.27.466182: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analyses were performed using GraphPad Prism 7.04 software (GraphPad Software, La Jolla, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.10.27.466182
  6. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.11.10.468129
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.11.10.468129: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SuPER [28], the only other method for identifying TRSs in annotated coronavirus genomes, employs a heuristic by defining the candidate region wi of a gene , i.e. the candidate region wi is a subsequence of 170 nt immediately upstream of gene xi for 1 ≤ i ≤ n.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SuPER</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We implemented both methods in Python.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.11.10.468129
  7. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.11.09.467981
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.11.09.467981: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">IMR90 E6E7 (female) cells were a gift from Anthony Cesare (Children’s Medical Research Institute, Sydney,</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Cell lines have been authenticated.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">At 72 hours post transduction the surface expression of ACE2 was measured by immunostaining the cells with anti-ACE2 monoclonal antibody (Thermo Fisher Scientific, MA5-32307)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: (Thermo Fisher Scientific Cat# MA5-32307, RRID:AB_2809589)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1 μg of anti-LRRC15 antibody (Abcam, EPR8188(2)) or rabbit IgG (Covance, CTL-4112) was added to 1 mg protein lysate and incubated at 4°C with rotation for 2.5 h before precipitation with protein G (ThermoFisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-LRRC15</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Experimental model and subject details: Cell culture: HEK293T cells (female; ATCC, CRL-3216, RRID: CVCL_0063) were cultured in Dulbecco’s Modified Eagle Medium (ThermoFisher Scientific, Cat #11995065) with 10% HyClone Fetal Bovine Serum (Cytiva, SH30084.03) and 1% Penicillin-Streptomycin (Gibco, 15140122) at 37°C, 5% CO2 and atmospheric oxygen.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>detected: (CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expi293F™ cells (female; ThermoFisher Scientific, A14527, RRID:CVCL_D615) were cultured in Expi293™ Expression Medium (ThermoFisher Scientific, A1435101) with 5% CO2 and atmospheric O2 at 37 °C for 24 h and then lowered to 32 °C for 72 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293F™</div><div>detected: ( RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For individual sgRNA constructs, neat viral media was added to HEK293T-CRISPRa cells with Polybrene Infection / Transfection Reagent (Sigma-Aldrich) at a concentration of 8 μg/mL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-CRISPRa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To transduce HEK293T cells, 10,000 cells per well were seeded in a 96 well tissue culture plate and virus supernatant added in a 2-fold dilution series.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentiviral transductions were then performed on HEK293T-ACE2 cells to generate HEK293T-ACE2-TMPRSS2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For infection of cells with SARS-CoV-2 pseudovirus, WT HEK293T, HEK293T-ACE2 and HEK293T-ACE2-TMPRSS2 cells were transfected with cDNA for myc-DDK-tagged LRRC15 transcript 1, empty myc-DDK construct as a control plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of CRISPR activation cell line: HEK293T cells were co-transfected with pPB-R1R2_EF1aVP64dCas9VP64_T2A_MS2p65HSF1-IRESbsdpA (Addgene #113341) and the Super PiggyBac Transposase Expression Vector (System Biosciences, PB210PA-1</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pPB-R1R2_EF1aVP64dCas9VP64_T2A_MS2p65HSF1-IRESbsdpA</div><div>suggested: RRID:Addgene_113341)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Oligonucleotides were annealed at 4°C for 16 h and pXPR-502 (Addgene #96923) was digested with Esp3I (ThermoFisher Scientific, ER0451) or BsmBI-v2 (New England Biolabs)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pXPR-502</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentivirus production and viral transduction: Lipofectamine 3000 Transfection Reagent (ThermoFisher Scientific) in Opti-MEM Medium (Gibco) was used to co-transfect HEK293T cells with psPAX2 (Addgene #12260), pCAG-VSVg (Addgene #35616) and either individual sgRNA constructs ligated into pXPR-502 (Addgene #96923) or pooled CRISPRa library (Human CRISPR activation pooled library set A, Addgene #92379) according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>psPAX2</div><div>suggested: RRID:Addgene_12260)</div></div><div style="margin-bottom:8px"><div>pCAG-VSVg</div><div>suggested: RRID:Addgene_35616)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, ACE2 ORF was cloned into a 3rd generation lentiviral expression vector, pRRLsinPPT.CMV.GFP.WPRE (Follenzi et al., 2004) using Age1/BsrG1 cut sites, thus replacing GFP ORF with ACE2 to create a novel expression plasmid, herein referred to as ppt-ACE2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pRRLsinPPT.CMV.GFP.WPRE</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentiviral particles expressing ACE2 were produced by co-transfecting ppt-ACE2, a 2nd generation lentiviral packaging construct psPAX2 and VSV-G plasmid pMD2.G (Addgene #12259) in HEK293T cells by using polyethylenimine as previously described (Aggarwal et al., 2012).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VSV-G</div><div>suggested: RRID:Addgene_138479)</div></div><div style="margin-bottom:8px"><div>pMD2 . G</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(synthetic gene fragment; IDT) was cloned into lentiviral expression vector pLVX-IRES-ZsGreen (Clontech) using EcoR1/XhoI restriction sites and lentiviral particles expressing TMPRSS2 were produced as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLVX-IRES-ZsGreen</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunoprecipitation: For SARS-CoV-2 spike pulldown, 2×107 HEK293T cells transfected with LRRC15-TurboGFP (transcript 1 and 2) or p□M1-EGFP (Addgene #19319) were incubated with 50 μg/mL spike hexapro for 30 min at 4°C with rotation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>p□M1-EGFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmid encoding the SARS-CoV-2 spike protein with an 18 amino acid truncation of the C-terminus was co-transfected into HEK293T cells with pBCKS(HIV-1SDmCMBeGFP-P2A-luc2pre-IIU), which permits equimolar expression of firefly luciferase and EGFP, and packaging plasmids pHCMVgagpolmllstwhv, pcDNA3.1tat101ml and pHCMVRevmlwhvpre.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBCKS(HIV-1SDmCMBeGFP-P2A-luc2pre-IIU</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pHCMVgagpolmllstwhv</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pcDNA3.1tat101ml</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 live virus infection assays: For assessing the inhibitory effect of native overexpression of LRRC15, HEK293T-ACE2-TMPRSS2 cells were transfected with myc-DDK-tagged LRRC15 transcript 1 plasmid (Origene, RC225990) for transient overexpression, with empty myc-DDK plasmid as a control plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>myc-DDK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1.25 μg empty TurboGFP plasmid were transfected for 0 μg LRRC15 cells, 0.3125 μg LRRC15 plasmid was mixed with 0.9375 μg empty TurboGFP plasmid for Lo LRRC15 cell transfection and 1.25 μg LRRC15-TurboGFP was transfected for Hi LRRC15 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TurboGFP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Conjugated spike proteins were loaded onto Bio-Rad BioGel P-30 Fine size exclusion purification resin column and eluted via gravity (Alexa Fluor™ 488) or centrifugation (Alexa Fluor™ 647).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioGel</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">LRR Tollkin Phylogenetic Tree: Protein sequences of LRR Tollkin family members (Dolan et al., 2007) were clustered using Clustal Omega (v1.2.2</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Clustal Omega</div><div>suggested: (Clustal Omega, RRID:SCR_001591)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Two single nucleus RNAseq datasets were downloaded from the Single Cell Portal (Broad Institute, SCP1052 and SCP1219) and one single cell RNAseq dataset from Gene Expression Omnibus (GSE158127)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene Expression Omnibus</div><div>suggested: (Gene Expression Omnibus (GEO, RRID:SCR_005012)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Densitometry analysis of LRRC15, COL1A1 and ACTB were performed with ImageJ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantification and statistical analysis: SARS-CoV-2 spike glycoprotein titration experiments were analyzed on GraphPad Prism and fitted with non-linear regression (one site --specific binding) to identify maximal binding (Bmax) and dissociation constants (KD)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All density plots were generated using ggplot2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 42. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.11.09.467981
  8. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.11.08.467705
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.11.08.467705: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The NGS library was prepared after cytoplasmic and mitochondrial rRNA depletion, using TruSeq Stranded Total RNA Gold kit per manufacturers’ instructions (Illumina, 20020598).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NGS</div><div>suggested: (PM4NGS, RRID:SCR_019164)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Host transcriptome analysis: Raw Illumina sequencing reads were checked for quality using FastQC (version 0.11.9) (Babraham Bioinformatics - FastQC A Quality Control Tool for High Throughput Sequence Data, n.d.) followed by adapter clipping and trimming using Trimmomatic (version 0.39) (Bolger et al., 2014) with default parameters.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FastQC</div><div>suggested: (FastQC, RRID:SCR_014583)</div></div><div style="margin-bottom:8px"><div>Trimmomatic</div><div>suggested: (Trimmomatic, RRID:SCR_011848)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Trimmed reads were then aligned to the human reference genome (GRCh38, GENCODE v36) (Frankish et al., 2019; Schneider et al., 2017) using STAR aligner (version 2.7.8a) (Dobin et al., 2013).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GENCODE</div><div>suggested: (GENCODE, RRID:SCR_014966)</div></div><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_004463)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FeatureCounts (subread package version 2.0.1) (Y.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FeatureCounts</div><div>suggested: (featureCounts, RRID:SCR_012919)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quality checks were performed at each step using the MultiQC tool (version 1.10.1) (Ewels et al., 2016).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MultiQC</div><div>suggested: (MultiQC, RRID:SCR_014982)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ClusterProfiler package (version 3.18.0) (Yu et al., 2012) was used for the Gene Ontology (GO) term Over Representation Analysis (ORA) of differentially expressed genes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ClusterProfiler</div><div>suggested: (clusterProfiler, RRID:SCR_016884)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GSVA package (version 1.38.2) (Hänzelmann et al., 2013) was used for all GSVA analysis and heatmaps of GSVA enrichment scores were visualized using the package pheatmap (version 1.0.12) (Pheatmap: Pretty Heatmaps, n.d.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pheatmap</div><div>suggested: (pheatmap, RRID:SCR_016418)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Boxplots and other visualizations were made using the ggplot2 package (version 3.3.3) (Wickham, 2011).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For identification of transcription factors driving gene expression, we used the Enrichr tool (Kuleshov et al., 2016) using lists of genes upregulated in severe COVID-19 samples (and sub-groups as identified in the paper) when compared with controls.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Enrichr</div><div>suggested: (Enrichr, RRID:SCR_001575)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">KEGG pathways were utilized from MSigDB (Liberzon et al., 2011).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Connectivity Map (CMap) analysis: Connectivity Map (CMap) (Lamb et al., 2006) analysis was performed using the online portal https://clue.io/cmap to determine perturbagens (potential drugs reversing the aberrant gene expression) using the L1 version of CMap with L1000 data repository, Touchstone data set as a benchmark for assessing connectivity among perturbagens and Individual query option.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CMap</div><div>suggested: (CMAP, RRID:SCR_009034)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The filtered unmapped reads were then input into Seal (from the suite of bbtools) and binned into bacterial rRNA (using SILVA bacterial rRNA database) (Quast et al., 2013), human genome (GRCh38) and microbial bin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SILVA</div><div>suggested: (SILVA, RRID:SCR_006423)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The alpha diversity (Shannon diversity index) and bacterial taxon abundance was assessed using the PhyloSeq package (version 1.34.0) (McMurdie & Holmes, 2013).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PhyloSeq</div><div>suggested: (phyloseq, RRID:SCR_013080)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Filtered microbial reads from these samples were aligned against the SARS-CoV-2 reference genome (F. Wu et al., 2020) using BBMap (version 38.9) (Bushnell, 2014).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BBMap</div><div>suggested: (BBmap, RRID:SCR_016965)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Depth and coverage of the viral genome were obtained using samtools (version 1.9) (Li et al., 2009).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Full length genomes were assembled for samples with high depth and coverage using SPAdes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPAdes</div><div>suggested: (SPAdes, RRID:SCR_000131)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transcriptome analysis was performed by aligning filtered viral reads to the reference strain (Wuhan-Hu-1) using Bowtie2 (Langmead & Salzberg, 2012).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bowtie2</div><div>suggested: (Bowtie 2, RRID:SCR_016368)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.11.08.467705
  9. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.05.17.444407
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.05.17.444407: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In order to amplify viral progeny and titrate recombinant CoVs by plaque assay, Vero E6 cells were used for SARS-CoV and SARS-CoV-2, HuH7 cells for MERS-CoV, and 17Cl1 cells for MHV.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HuH7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transfected BHK-21 cells were mixed in a 1:1 ratio with cells susceptible to CoV infection: Vero E6 cells (for SARS-CoV and SARS-CoV-2), HuH7 cells for MERS-CoV, or 17Cl1 cells (for MHV).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-21</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bioinformatics analysis: Forty-seven CoV nsp14 sequences were retrieved (a complete list is provided in Table S1) and aligned using MAFFT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Delineation of motif I to VI was done manually using Seaview and WebLogo (74,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Seaview</div><div>suggested: (SeaView, RRID:SCR_015059)</div></div><div style="margin-bottom:8px"><div>WebLogo</div><div>suggested: (WEBLOGO, RRID:SCR_010236)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In vitro nsp14 N7-MTase activity assay: Reaction mixtures contained 50 or 200 nM of SARS-CoV or MERS-CoV recombinant nsp14, 7 nM GpppACCCC synthetic RNA substrate, 40 mM Tris-HCl (pH 8.0), 10 mM DTT, 5 mM MgCl2, 1.9 μM SAM, 0.1 μM 3H-SAM (Perkin Elmer).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAM</div><div>suggested: (SAM, RRID:SCR_010951)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.05.17.444407
  10. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.11.01.466834
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.11.01.466834: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mouse immunization: Groups of female BALB/c mice (6 to 8 weeks old) (n=5 per group) were obtained from the National Laboratory Animal Center, Taipei, Taiwan.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 S proteins were probed with anti-SARS-CoV-2 primary antibodies (GTX135356, GeneTex) overnight at 4°C, and detected with horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (KPL) for 1 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GTX135356</div><div>suggested: (GeneTex Cat# GTX135356, RRID:AB_2887482)</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following this, the plates were incubated with 100 μl of HRP) conjugated anti-mouse IgG antibody (1:30000 in dilution buffer) for 1 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To determine the Ad titers, HEK293A cells were seeded into 6-well plates at a density of 106 cells/well and incubated at 37°C overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293A</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 pseudotyped lentivirus neutralization assay: To produce SARS-CoV-2 pseudoviruses, a plasmid expressing the full-length S protein (Wuhan-Hu-1, B.1.1.7, or B.1.351) of SARS-CoV-2 was co-transfected into HEK293T cells with packaging and reporter plasmids pCMVΔ8.91 and pLAS2w.FLuc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mixture was then inoculated with an equal volume of 10,000 HEK-293T cells stably expressing the ACE2 gene in 96-well plates, which were seeded one day before infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse immunization: Groups of female BALB/c mice (6 to 8 weeks old) (n=5 per group) were obtained from the National Laboratory Animal Center, Taipei, Taiwan.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Wild-type S and glycan-masking S genes were first cloned into the pENTR1A vector (Invitrogen), and then cloned into the adenoviral plasmid pAd/CMV/V5-DEST (Invitrogen) using LR ClonaseTM II Enzyme Mix (Invitrogen) to produce the Ad plasmid expressing SARS-CoV-2 S gene.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pENTR1A</div><div>suggested: RRID:Addgene_37431)</div></div><div style="margin-bottom:8px"><div>pAd/CMV/V5-DEST</div><div>suggested: RRID:Addgene_66112)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 pseudotyped lentivirus neutralization assay: To produce SARS-CoV-2 pseudoviruses, a plasmid expressing the full-length S protein (Wuhan-Hu-1, B.1.1.7, or B.1.351) of SARS-CoV-2 was co-transfected into HEK293T cells with packaging and reporter plasmids pCMVΔ8.91 and pLAS2w.FLuc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMVΔ8.91</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pLAS2w.FLuc</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These cells were grown in Dulbecco’s modified Eagle medium (DMEM) (Thermo Scienific) supplemented with 10% fetal bovine serum (FBS) (Gibco) and 100 units/ml penicillin/streptomycin (P/S), and maintained in an incubator at 37°C with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo Scienific</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The exposed loops or the protruding sites of the exposed loops on the NTD and RBD of the S protein were examined using PyMol (The PyMol Molecular Graphics System, version 4.0; Schrödinger, LLC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The IC50 values of the neutralization were obtained from the fitting curves using GraphPad Prism v6.01</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.11.01.466834
  11. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.10.30.466586
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.10.30.466586: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Given the observational (cross-sectional, case-control) nature of our study which was conducted on autoptic specimens and did not entail neither an intervention, nor the collection of subject’s sensitive information, we have not obtained an informed consent.<br>Consent: Given the observational (cross-sectional, case-control) nature of our study which was conducted on autoptic specimens and did not entail neither an intervention, nor the collection of subject’s sensitive information, we have not obtained an informed consent.<br>IRB: Therefore, our Institutional Review Board does not require an ethical approval for studies conducted on autoptic specimens and not collecting personal or sensitive data.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Five random fields were analyzed and at least 1700 lipid droplets were measured for each sample, and the difference between infected and non-infected cells was assessed by unpaired t-test.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: They were routinely tested for the absence of mycoplasma.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To study SARS-CoV2 presence in VAT, we used the SARS-CoV2 nucleocapsid (Invitrogen #MA-17404) and spike protein (Sino Biological #40150-T62) antibodies at different dilutions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>spike protein ( Sino Biological #40150-T62 ) antibodies at different dilutions</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Supernatants, collected as above, and cell pellets, collected at 96 hours post-infection, were analyzed using RT-qPCR as described in the VeroE6 cell section.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For each subject the number of total macrophages and the density of CLS/104 adipocytes were counted with the ImageJ morphometric program (RRID:SCR_003070).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>detected: ImageJ ( RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Adipocytes’ area was measured in all patients by counting 100 adipocytes for each paraffin tissue section using ImageJ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed with Prism 6.0 (GraphPad Software Inc.,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">La Jolla, CA) and IBM SPSS Statistics Data Editor (v.24).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.10.30.466586
  12. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.10.28.465226
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.10.28.465226: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Pseudotyped-virus neutralization assay: Mice were divided into seven groups with 8 female mice in each group and alhydrogel adjuvant (1.25 mg/ml, InvivoGen) was used for the animal study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In this study, the final protein concentration was diluted into 0.1 mg/ml after mixed with the adjuvant and administrated at 10 μL per mice (BALB/c).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein expression and purification: The constructs of RBD (319-550) and fusion proteins were synthesized and sub-cloned into pZD vector between EcoRI and HindIII.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pZD</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bright-Lumi™ kit was used for fluorescence detection and the final IC50 (50% neutralization) was calculated on GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.10.28.465226
  13. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.10.21.465386
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.10.21.465386: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Cell lines were checked regularly for any mycoplasma contamination and were tested negative for the presence of mycoplasma contamination using Universal Mycoplasma Detection Kit (ATCC® 30-1012K™)</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All Thy1.1 antibodies (unlabeled, and FITC conjugated) were from eBiosciences and APC-coupled anti-ACE2 antibody was from Abeomics.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Surface expression of hACE2 was confirmed by flow cytometry using anti-hACE2 antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, cells were harvested and washed in specific sorting buffer, incubated with anti-Thy1.1 antibody for 30 min at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Thy1.1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the generation of ACE2 expressing BHK-21 cells, human ACE2 cDNA (kindly provided by Sonja Best, NIH/NIAID) was used as a PCR template.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-21</div><div>suggested: ATCC Cat# CRL-6281, RRID:CVCL_1914)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, BHK-21 and 293FT cells were plated together in 6-well plates and infected with recombinant T7-expressing vaccinia virus (vTF7-3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293FT</div><div>suggested: ATCC Cat# PTA-5077, RRID:CVCL_6911)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus was tittered on BHK-21/hACE2-BFP cells and counting visible plaques 72 hours post infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-21/hACE2-BFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For infection studies, HRT-18G cells and their derivatives were plated in 24 well plates, 24 hours prior to infection to achieve confluency.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HRT-18G</div><div>suggested: ATCC Cat# CRL-11663, RRID:CVCL_2515)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The pSBbi-BH plasmid was a kind gift from Eric Kowarz (Addgene #60515).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSBbi-BH</div><div>suggested: RRID:Addgene_60515)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2 orthologs were cloned into the plasmid pCAGGS-IRES-Thy1.1, as described previously [53].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS-IRES-Thy1.1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell transfection and stable cell line generation: For the generation of BHK-21 cells stably expressing human ACE2, the pCMV(CAT)T7-SB100 plasmid (encoding transposase required to generate stable transgene-expressing cell lines) was co-transfected with pSBbi-BH hACE2 using TransIT-LT1 Transfection Reagent (Mirus Bio). pCMV(CAT)T7-SB100 was a kind gift from Zsuzsanna Izsvak (Addgene #34879).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSBbi-BH hACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCMV(CAT)T7-SB100</div><div>suggested: RRID:Addgene_34879)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The backbone vector pVSV-eGFP-dG (Addgene # 31842) was linearized by PCR with primers AGTGTCAAGGAAACAGATCGATCTC and CCAAATCAACTTGTGATATCATGC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pVSV-eGFP-dG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting pVSV-eGFP-deltaG_SARS-CoV-2 Spike vector was verified by sanger sequencing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pVSV-eGFP-deltaG_SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: All statistical analyses were performed using GraphPad Prism Software version 9.0 (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GraphPad Software Inc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.10.21.465386
  14. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.10.22.465399
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.10.22.465399: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.10.22.465399
  15. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.10.22.465411
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.10.22.465411: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Full length Spike gene sequences were retrieved through BLAST search by aligning with a reference spike gene sequence (GenBank accession number: NC_045512.2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.10.22.465411
  16. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.10.26.465865
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.10.26.465865: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All patients or patient representatives signed a patient informed consent.<br>IRB: The study was approved by local ethics committees (EKOS 20/058 for the three Swiss sites and The Clinical Research Ethics Committee of the Cork Teaching Hospitals for Cork University Hospital).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mediators measured included IL-1α, IL-1β, IL-1RA, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12/23p40, IL-12p70, IL-13, IL-15, IL-16, IL-17A, IL-17A/F, IL-17B, IL-17C, IL-21, IL-22, IL-23, IL-27, IL-31, TNF-α, TNF-β, IFN-γ, IP-10, MIP-1α, MIP-1β, MIP-3α, MCP-1, MCP-4, Eotaxin, Eotaxin-3, TARC, MDC, TSLP, CRP, SAA, VEGF-A, VEGF-C, VEGF-D, sTie-2, Flt-1, sICAM-1, sVCAM-1, bFGF, PIGF and GM-CSF. Metabolomics: Untargeted metabolomics on patient sera was performed by MetabolonTM using the HD4 platform.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MCP-1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pairwise differential abundance analysis was performed between conditions using R package LIMMA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>LIMMA</div><div>suggested: (LIMMA, RRID:SCR_010943)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Python 3 gseapy package was used to perform a hypergeometric test between list of significant metabolites and reference.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Importance plots, dot plots, bar plots, pca plots were produced with R package ggplot2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Heatmaps were designed with the R package ComplexeHeatmap.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ComplexeHeatmap</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Networks were represented using Cytoscape 3.6.1 and metabolites of interest highlighted.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cytoscape</div><div>suggested: (Cytoscape, RRID:SCR_003032)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the microbiome analysis, the raw Illumina reads obtained for each sample were quality-filtered using the trimmomatic program, using the default parameters47.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>trimmomatic</div><div>suggested: (Trimmomatic, RRID:SCR_011848)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Estimates of alpha diversity were computed using the diversity function of the vegan package of R.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>vegan</div><div>suggested: (vegan, RRID:SCR_011950)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.10.26.465865
  17. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.10.24.465080
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.10.24.465080: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Experimental procedures with human blood were done according to the European Union guidelines and the Declaration of Helsinki and informed consent was obtained from all donors (healthy and patients).<br>Field Sample Permit: Biological collection and informed consent were approved by the Direction de la Recherche Clinique et Innovation (DRCI) and the French Ministry of Research (N°2019-3677).<br>IRB: The study conforms to the principles outlined in the Declaration of Helsinki and received approval by the appropriate Institutional Review Board (Cochin-Port Royal Hospital, Paris<br>IACUC: The WBI Animal Care and Use Committee reviewed and approved all mouse experiments (IACUC NO. 17-006).<br>Euthanasia Agents: The mice were anesthetized and exsanguinated into pre-chilled EDTA tubes.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mice: Animal experiments were performed blindly by Washington Biotechnology, INC.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After fixation, cells were incubated in Perm-S solution containing the anti-cytokine antibodies and isotopes Ir for 30 min at RT (Maxpar Perm-S buffer;Fluidigm).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-cytokine</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the cells were fixed for 20 min at RT with 250 μL of the Inside Fix solution then washed and stained in 100 μL of the Inside Perm solution containing PE anti-TNF (clone cA2, Miltenyi Biotec) and APC anti-IL-1β (clone REA1172, Miltenyi Biotec) antibody at 1/50 for 30 min at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-TNF</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IL-1β</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Simoa digital ELISA specific for TNF-α was developed using a Quanterix Homebrew Assay and two commercially available antibodies[38].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibodies[38</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were acquired using a CyTOF2 instrument (Fluidigm) and analyzed using both FlowJo software for cleaning data and the viSNE algorithm in Cytobank to perform main analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div><div style="margin-bottom:8px"><div>Cytobank</div><div>suggested: (Cytobank, RRID:SCR_014043)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pathway analysis was performed using DAVID bioinformatics databank (https://david.ncifcrf.gov).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DAVID</div><div>suggested: (DAVID, RRID:SCR_001881)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      To overcome these limitations, novel strategies such as Janus kinases (JAK) inhibitors, which are small molecules inhibiting the activity of JAK, showed reasonable success in adult form of arthritis[30][31][32]. As for strategies targeting JAK, we demonstrate that CB treatment exhibits wide-ranging cytokine inhibition in vitro, ex vivo and in vivo. CB acts, however, one step upstream of JAK inhibitors, by blocking the production of inflammatory cytokines rather than blocking cytokine-mediated signaling, which may confer some advantages in terms of therapies efficacies. This is in fact supported by the strong inhibition of disease progression in CB-treated RA mice, validating the concept of targeting CXCR4 with CB-like molecules to treat arthritic diseases. CB indeed holds all the required hallmarks for a promising new drug to treat RA: CB is a small molecule, which does not show any side effects in preclinical models in vivo, targets the widely expressed receptor CXCR4 on immune cells, and acts on cytokine production with a broad anti-inflammatory spectrum. To illustrate the potential benefit of CB in another inflammatory disease context, we studied samples from COVID-19 patients. Hypersecretion of inflammatory cytokines by monocytes and macrophages in lung seems to be central in COVID-19 pathology. Studies of SARS-CoV2 infection have revealed highly inflammatory monocyte/macrophage[9,10],[33] population in the bronchoalveolar lavage of patients with severe but not mild COVID...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 27. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.10.24.465080
  18. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.10.23.465542
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.10.23.465542: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Rhesus Macaque Model, Immunizations, and Delta Challenge: All experiments conducted according to NIH regulations and standards on the humane care and use of laboratory animals as well as the Animal Care and Use Committees of the NIH Vaccine Research Center and Bioqual, Inc. (Rockville, Maryland).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">6-week-old male Syrian hamsters (Envigo) were housed at Bioqual, Inc.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Total IgG and IgA antigen-specific antibodies to variant SARS-CoV-2 RBD-derived antigens were determined by enzyme-linked immunosorbent assay (ELISA) using MULTI-ARRAY 384-well streptavidin-coated plates (Meso Scale Discovery, MSD).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Total IgG antibody titers in the BAL were quantitated by using the Human/NHP IgG Kit (MSD) and antibody titers to measles were quantitated by using the Monkey Anti-Measles IgG ELISA Kit (Alpha Diagnostics International) according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Total IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-Measles IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were incubated with an anti-SARS-CoV S primary antibody directly conjugated to biotin (CR3022-biotin) for 1 hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CR3022-biotin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, anti-histidine antibody was immobilized on Series S Sensor Chip CM5 (Cytiva) through primary amine coupling using a His capture kit (Cytiva), allowing His-tagged SARS-CoV-2 S protein containing 2 proline stabilization mutations (S-2P) to be captured on active sensor surface.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-histidine</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following antibodies were used (monoclonal unless indicated): IgD FITC (goat polyclonal, Southern Biotech), IgM PerCP-Cy5.5 (clone G20-127, BD Biosciences), IgA Dylight 405 (goat polyclonal, Jackson Immunoresearch Inc), CD20 BV570 (clone 2H7, Biolegend), CD27 BV650 (clone O323, Biolegend), CD14 BV785 (clone M5E2, Biolegend), CD16 BUV496 (clone 3G8, BD Biosciences), IgG Alexa 700 (clone G18-145, BD Biosciences), CD3 APC-Cy7 (clone SP34.2, BD Biosciences), CD38 PE (clone OKT10, Caprico Biotechnologies), CD21 PE-Cy5 (clone B-ly4, BD Biosciences), and CXCR5 PE-Cy7 (clone MU5UBEE, Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD20</div><div>suggested: (BioLegend Cat# 348805, RRID:AB_2889063)</div></div><div style="margin-bottom:8px"><div>CD27</div><div>suggested: (BioLegend Cat# 124241, RRID:AB_2800595)</div></div><div style="margin-bottom:8px"><div>CD14</div><div>suggested: (BD Biosciences Cat# 750381, RRID:AB_2874552)</div></div><div style="margin-bottom:8px"><div>CD16</div><div>suggested: (BD Biosciences Cat# 564653, RRID:AB_2744294)</div></div><div style="margin-bottom:8px"><div>CD21</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CXCR5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following monoclonal antibodies were used: CD3 APC-Cy7 (clone SP34.2, BD Biosciences), CD4 PE-Cy5.5 (clone S3.5, Invitrogen), CD8 BV570 (clone RPA-T8, BioLegend), CD45RA PE-Cy5 (clone 5H9, BD Biosciences), CCR7 BV650 (clone G043H7, BioLegend), CXCR5 PE (clone MU5UBEE, Thermo Fisher), CXCR3 BV711 (clone 1C6/CXCR3, BD Biosciences), PD-1 BUV737 (clone EH12.1, BD Biosciences), ICOS Pe-Cy7 (clone C398.4A, BioLegend), CD69 ECD (cloneTP1.55.3, Beckman Coulter), IFN-g Ax700 (clone B27, BioLegend), IL-2 BV750 (clone MQ1-17H12, BD Biosciences), IL-4 BB700 (clone MP4-25D2, BD Biosciences), TNF-FITC (clone Mab11, BD Biosciences), IL-13 BV421 (clone JES10-5A2, BD Biosciences), IL-17 BV605 (clone BL168, BioLegend), IL-21 Ax647 (clone 3A3-N2.1, BD Biosciences), and CD154 BV785 (clone 24-31, BioLegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD4</div><div>suggested: (Thermo Fisher Scientific Cat# 8822-6853-41, RRID:AB_2575278)</div></div><div style="margin-bottom:8px"><div>CCR7</div><div>suggested: (GenWay Biotech Inc. Cat# GWB-EA1DA7, RRID:AB_10269678)</div></div><div style="margin-bottom:8px"><div>CXCR3</div><div>suggested: (BD Biosciences Cat# 741866, RRID:AB_2871195)</div></div><div style="margin-bottom:8px"><div>PD-1 BUV737</div><div>suggested: (BD Biosciences Cat# 565299, RRID:AB_2739167)</div></div><div style="margin-bottom:8px"><div>CD69</div><div>suggested: (BD Biosciences Cat# 747520, RRID:AB_2744097)</div></div><div style="margin-bottom:8px"><div>IL-2</div><div>suggested: (BioLegend Cat# 500347, RRID:AB_2566470)</div></div><div style="margin-bottom:8px"><div>IL-4</div><div>suggested: (BD Biosciences Cat# 745925, RRID:AB_2871637)</div></div><div style="margin-bottom:8px"><div>IL-13 BV421</div><div>suggested: (BioLegend Cat# 501916, RRID:AB_2616748)</div></div><div style="margin-bottom:8px"><div>IL-17</div><div>suggested: (BioLegend Cat# 512326, RRID:AB_2563887)</div></div><div style="margin-bottom:8px"><div>CD154</div><div>suggested: (BioLegend Cat# 310842, RRID:AB_2572187)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A rabbit polyclonal anti-SARS-CoV-2 antibody (GeneTex, GTX135357) at a dilution of 1:2000 was used for IHC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and Viruses: VeroE6 cells were obtained from ATCC (clone E6, ATCC, #CRL-1586) and cultured in complete DMEM medium consisting of 1x DMEM (VWR, #45000-304), 10% FBS, 25mM HEPES Buffer (Corning Cellgro), 2mM L-glutamine, 1mM sodium pyruvate, 1x Non-essential Amino Acids, and 1x antibiotics.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VeroE6-TMPRSS2 cells were generated at Vaccine Research Center, NIH, Bethesda, MD.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibody-virus mixture was then added to Vero cells and incubated at 37°C for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293T/17 cells (ATCC CRL-11268) were transfected with the following: plasmids encoding S proteins from Wuhan-Hu-1 strain (GenBank no. MN908947.3) with a p.Asp614Gly mutation, a luciferase reporter, lentivirus backbone, and the human transmembrane protease serine 2 (TMPRSS2) genes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T/17</div><div>suggested: ATCC Cat# CRL-11268, RRID:CVCL_1926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">TCID50 Assay: Vero-TMPRSS2 cells (obtained from Adrian Creanga, Vaccine Research Center-NIAID) were plated at 25,000 cells/well in DMEM with 10% FBS and gentamicin, and the cultures were incubated at 37°C, 5.0% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IC50 titers were calculated using a log(agonist) versus normalized-response (variable slope) nonlinear regression model in Prism v9.0.2 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following antibodies were used (monoclonal unless indicated): IgD FITC (goat polyclonal, Southern Biotech), IgM PerCP-Cy5.5 (clone G20-127, BD Biosciences), IgA Dylight 405 (goat polyclonal, Jackson Immunoresearch Inc), CD20 BV570 (clone 2H7, Biolegend), CD27 BV650 (clone O323, Biolegend), CD14 BV785 (clone M5E2, Biolegend), CD16 BUV496 (clone 3G8, BD Biosciences), IgG Alexa 700 (clone G18-145, BD Biosciences), CD3 APC-Cy7 (clone SP34.2, BD Biosciences), CD38 PE (clone OKT10, Caprico Biotechnologies), CD21 PE-Cy5 (clone B-ly4, BD Biosciences), and CXCR5 PE-Cy7 (clone MU5UBEE, Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Biosciences</div><div>suggested: (BD Biosciences, RRID:SCR_013311)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were acquired on an BD FACSymphony cytometer and analyzed using FlowJo version 10.7.2 (BD, Ashland, OR).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses are conducted using R version 4.0.2 and GraphPad Prism version 8.2.0 unless otherwise specified.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A potential limitation relates to the extent of viral replication following B.1.617.2 challenge. The challenge stock used here was passaged once and fully matched the canonical B.1.617.2 S sequences obtained from humans. However, we did not observe greater sgRNA copy numbers in the upper airway than in previous challenges with B.1.351 or WA1 (Corbett et al., 2021b; Corbett et al., 2021c). Clinical reports have described substantially higher viral titers in the upper respiratory tract from B.1.617.2 infections compared to ancestral strains (Ong et al., 2021; Williams et al., 2021). It is possible that the NHP model does not precisely recapitulate human infection. We and others have previously shown that antibodies are a correlate of protection (Corbett et al., 2021b; Gilbert et al., 2021). These studies are based on a short interval between vaccination and virus exposure or challenge. Here, we did not find a clear immune correlate of protection between binding or neutralizing antibody responses in the blood at the peak of the response or the time of challenge one year later. Additional analysis from human clinical trials with much larger numbers of vaccinated individuals than the 8 NHP in this study will be important for determining whether serum antibody titers remain as a correlate of protection in the long term. Indeed, the data presented here raise the possibility that the correlate of protection may lie in the ability of tissue-resident memory B cells to expand after infe...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.10.23.465542
  19. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.11.09.467862
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.11.09.467862: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Mice: All mice were treated in accordance with OSU Institutional Animal Care and Use Committee (IACUC) guidelines and approved protocols.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Statistical analysis: All experiments were performed using randomly assigned mice without investigator blinding.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Statistical analysis: All experiments were performed using randomly assigned mice without investigator blinding.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Virus was cultured, prepared and authenticated as we recently reported [25].</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Namely, to establish the viral stocks used in our studies, a virus aliquot was thawed, diluted 1:10,000 in incomplete DMEM (Gibco; supplemented with 4.5 g/L D-glucose, 110 mg/L sodium pyruvate) and added to confluent VeroE6 cells (ATCC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">C57BL/6 and hemizygous K18-hACE C57BL/6J mice (strain: 2B6.Cg-Tg(K18-ACE2)2Prlmn/J) were purchased from Jackson Laboratory (Bar Harbor, ME) and housed at OSU within an AALAC-accredited facility (University Laboratory Animal Resources, ULAR).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: RRID:MGI:3589388)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were processed using FIJI [31] and compiled using BioRender.com ELISA: CoV2 N protein levels in lung homogenates were determined using a commercially available ELISA kit (ADS Biotec), as were protein levels of the cytokines IL1β, IL6 and IFNγ (Biolegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FIJI</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div><div style="margin-bottom:8px"><div>BioRender</div><div>suggested: (Biorender, RRID:SCR_018361)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was performed using GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The only exception to this were the t-distributed stochastic neighbor embedding (t-SNE), annotation and graphing associated with our scRNA analysis, which was performed with Cell Ranger and RStudio.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RStudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The limitations of our study include its being performed in mice, which of course do not recapitulate all aspects of TB or COVID in humans, nor have we examined the long term impact of CoV2 on the host response to Mtb as we terminated our study fourteen days after CoV2 challenge. That said, we believe animal models of TB and COVID are ideal for studies of this nature because—if studies of COVID in individuals with other chronic lung diseases are any guide [22, 23]—it will likely be difficult to tease apart the impact of TB on COVID outcomes in humans given that individuals with TB often have numerous other comorbidities (e.g. malnourishment, HIV) that confound interpretation. Translated to human COVID susceptibility, our results suggest that individuals infected with Mtb generate an immune response that offers a degree of protection from subsequent or secondary infection with CoV2.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.11.09.467862
  20. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.10.27.466067
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.10.27.466067: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.10.27.466067
  21. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.10.29.466401
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.10.29.466401: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies against the His-tag (1:2000, Invitrogen) were followed by secondary HRP conjugated antibodies (1:2000, Dako, Denmark), for detection of both proteins.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>His-tag</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sf9 cells transfected by following were used to express the S protein by following bac-to-bac baculovirus expression system (Thermo Fisher, SG).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sf9</div><div>suggested: CLS Cat# 604328/p700_Sf9, RRID:CVCL_0549)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 S, SARS-CoV-2 S1 and two variants of SARS-CoV-2 S2 proteins, produced by ACROBiosystems (USA), were used for BN-PAGE, MST and to stimulate THP-1 cells and for in vivo experiments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>THP-1</div><div>suggested: CLS Cat# 300356/p804_THP-1, RRID:CVCL_0006)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse inflammation model and in vivo imaging: BALB/c tg (NF-B-RE-Luc)-Xen reporter mice (Taconic Biosciences, Albany, NY, USA, 10– 12 weeks old) were used to study the immunomodulatory effects of SARS-CoV-2 S protein subunits alone or in combination with LPS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The image was obtained using a Gel Doc Imager (Bio-Rad Laboratories,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bio-Rad Laboratories</div><div>suggested: (Bio-Rad Laboratories, RRID:SCR_008426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The initial coordinates of E. coli lipid A and LPS were obtained from CHARMM-GUI LPS modeller,62 while the initial coordinates of the S protein were extracted from the cryo-EM structure of S ECD in the closed state (PDB: 6XR8)23 with missing loops constructed using Modeller version 9.21.63 Protein and lipid were parameterized using the CHARMM36 forcefield.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Modeller</div><div>suggested: (MODELLER, RRID:SCR_008395)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">70 All simulations were performed using GROMACS 201871 and the trajectories visualised in VMD.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GROMACS</div><div>suggested: (GROMACS, RRID:SCR_014565)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 31. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.10.29.466401
  22. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.11.16.468802
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.11.16.468802: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Michaelis-Menten equation was fitted to the data points and kinetic parameters of NUDT18 were determined using GraphPad Prism 8.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The panel included the triphosphate of Sofosbuvir used for the treatment of hepatitis C (Sofosbuvir-TP, (2R)-(2’-deoxy-2’-fluoro-2-methyl-uridine-5’-TP, Sierra bioresearch), the triphosphate of Ganciclovir used to treat cytomegalovirus infection treatment (Ganciclovir-TP, Sierra bioresearch) and the triphosphate of Aciclovir used for Herpes simplex virus infection therapy, (Aciclovir-TP, Sierra bioresearch).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sierra</div><div>suggested: (Sierra, RRID:SCR_011831)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Hydrogen bonding networks were optimized automatically by optimization of hydroxyls, Asn, Gln, and His residue states using ProtAssign.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ProtAssign</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Binding site analysis: SiteMap was used to probe the prepared NUDT18 structure for possible ligand binding sites.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SiteMap</div><div>suggested: (Biositemaps, RRID:SCR_001976)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Ligand structure preparation: The structure of Remdesivir-TP was copied as isomeric smiles from PubChem (CID: 56832906) and pasted as 3D structure into Maestro.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PubChem</div><div>suggested: (PubChem, RRID:SCR_004284)</div></div><div style="margin-bottom:8px"><div>Maestro</div><div>suggested: (Maestro, RRID:SCR_016748)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.11.16.468802
  23. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.17.21265440
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.11.17.21265440: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the ethics committee of the Terrassa Health Consortium (THC) on April 8 (ref 02-20-161-021) and the observational clinical trial was posted on April 29 (NCT 04367883).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The types of chronic treatments were classified according to the Anatomical Therapeutic Chemical (ATC) classification system [12].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ATC</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations: One limitation of the study is the lack of a gold standard technique for confirming COVID-19. False-negative rates of 38% on the day of symptom onset and 20% three days later have been reported [30] during 2020. Consequently, other than when analyzing the relationship with vaccination and comorbidity, we only included PCR-positive cases (Table 2). In 2021, all cases had positive antigen or PCR tests, suggesting that the diagnostic techniques have improved this year in real-world setting. Another limitation is that a second private hospital services the same health region as the THC, meaning that hospitalization rates could be underestimated. Nevertheless, it is feasible that the patients diagnosed in the other facility were comparable to our own.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04367883</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Influenza Vaccination, ACEI and ARB in the Evolution of SARS…</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.17.21265440
  24. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.11.11.468228
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.11.11.468228: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Enzymatic assays: NEMO peptide expression and purification: The constructs of Human NEMO (residues 215-247) and mouse NEMO (residues 221-250) cloned into pGEX-6p-1 vector were transformed into BL21 (DE3) cells and selected using ampicillin-enriched LB media.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pGEX-6p-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">3CLpro expression and purification: 3CLpro WT enzyme for assays was prepared independently from a clone of the SARS-CoV-2 NSP5 gene in pD451-SR (Atum, Newark, CA) according to published procedure 6.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pD451-SR</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bands were visualized with BullDog Bio Acquastain. 5.2. Crystallography: 3CLpro WT expression and purification: BL21(DE3) cells were transformed with pMCSG53 pDNA containing a 3CLpro WT insert with an autoprocessing-sensitive N-terminal Maltose Binding Protein (MBP) tag and a PreScission protease-sensitive C-terminal His6 tag (provided by Andrzej Joachimiak).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMCSG53 pDNA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Iterative refinement was performed manually in Coot 51 and REFMAC 52.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All bonds of the peptide were kept rigid as the goal was to preserve the initial conformation and compute the binding free energy using the AutoDock Vina scoring function.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AutoDock</div><div>suggested: (AutoDock, RRID:SCR_012746)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.11.11.468228
  25. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.11.10.468147
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.11.10.468147: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animal use ethics statement: Hamsters were used according to protocols approved by the Institutional Animal Care and Use Committees of Colorado State University (CSU)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animal experimental procedures: Male Syrian hamsters (Mesocricetus auratus) were purchased from Charles River Laboratories and used at 12 weeks of age.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">The assays were performed blinded using the diluent as a negative control.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">The sample size was based on the number of available animals and resources of the collaborating investigator and not determined by a formal power calculation.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The assay plate was washed and 100 µL peroxidase conjugated goat anti-alpaca VHH domain-specific antibody (#128-035-232, Jackson ImmunoResearch), diluted to 0.8 µg/mL, transferred into each well and incubated for 1 hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-alpaca VHH domain-specific antibody (#128-035-232</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, lentiviruses were propagated in HEK293T/17 cells (ATCC # CRL-11268) following published Current Protocols in Neuroscience.43 Plasmids for SARS-CoV-2 variants were synthesized using the prototype sequence (GenScript MC_0101081, human codon optimized, ER retention signal removed) as the reference sequence.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T/17</div><div>suggested: ATCC Cat# CRL-11268, RRID:CVCL_1926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monolayer cultures of 293T cells were transiently transfected with plasmids expressing SARS-CoV-2 spike protein variants, psPAX2 (Addgene #12260), and a lentiviral transfer vector CD512-EF1a-RFP (System Biosciences CD512B-1) using Lipofectamine 2000.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantification of SARS-CoV-2 in procedure samples: Virus titration was performed on oropharyngeal swabs obtained at 1, 2, and 3 days post infection and on cranial lung tissue samples obtained at 7 days post infection by double-overlay plaque assay on Vero E6 cells as previously described.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monolayer cultures of 293T cells were transiently transfected with plasmids expressing SARS-CoV-2 spike protein variants, psPAX2 (Addgene #12260), and a lentiviral transfer vector CD512-EF1a-RFP (System Biosciences CD512B-1) using Lipofectamine 2000.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>psPAX2</div><div>suggested: RRID:Addgene_12260)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">X-ray diffraction data was collected at the SSRL beamline 9-2 and was processed with HKL3000.36 The structure was solved by molecular replacement in PHASER from the CCP4 suite37 using 7LDJ as a template in which the RBD moiety and nanobody were treated as independent searching models.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CCP4</div><div>suggested: (CCP4, RRID:SCR_007255)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Iterative cycles of model building and refinement were done in Coot38 and Phenix.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phenix</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structure validation and analysis: Ramachandran statistics were calculated with MolProbity40 and illustrations were prepared with PyMOL Molecular graphics (http://pymol.org).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations of the study: While the current results provide strength for using nanobodies as potential inhaled therapeutics, there are several limitations to this current study. First, the use of bio-layer interferometry and pseudovirus assays to measure in vitro binding and neutralization provide evidence that NIH-CoVnb-112 has broad potency, yet these assays must be interpreted with caution. In the setting of authentic SARS-CoV-2 infection, and particularly the highly transmissible Delta variant, it is vital to assess the actual virus to ensure parity between in vitro and in vivo findings. The constellation of mutations in variants outside of the RBD may provide competitive fitness, which outstrips the ability of NIH-CoVnb-112 to effectively neutralize infection. Second, while acute weight loss and lung pathology provide metrics for assessing the early phase of infection, the natural course of disease in the Syrian hamster resolves with rare mortality.27 Thus, the hamster model should be considered just one of several relevant in vivo models. Third, the hamster experiments should be extended for future studies; the experiments presented here serve primarily as proof-of-concept for prophylactic and therapeutic potential. Given resource limitations, our studies had limitations on sample size and thus we have reported our findings without statistical analysis. We observed a robust viral load reduction and clear impact on lung pathology, which is encouraging but should not be c...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 27. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.11.10.468147
  26. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.11.09.467827
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.11.09.467827: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The first antibodies include rabbit anti-Iba1 (Wako), mouse anti-GFAP (Sigma) and rabbit anti-Ki67 (Abcam).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Iba1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-GFAP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Ki67</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pathological stimulation: For SARS-CoV-2 pseudovirus generation, the plasmid carrying spike protein sequence (Miaoling Plasmid Sharing Platform plasmid #P18156) was co-transfected with psPAX2 (Addgene plasmid #12260) into HEK293T cell line using Lipofectamine 2000 (Invitrogen) according to manufactor’s instruction for 6 hours and cells were replaced with fresh media containing DMEM supplemented with 10% fetal bovine serum.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pathological stimulation: For SARS-CoV-2 pseudovirus generation, the plasmid carrying spike protein sequence (Miaoling Plasmid Sharing Platform plasmid #P18156) was co-transfected with psPAX2 (Addgene plasmid #12260) into HEK293T cell line using Lipofectamine 2000 (Invitrogen) according to manufactor’s instruction for 6 hours and cells were replaced with fresh media containing DMEM supplemented with 10% fetal bovine serum.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>psPAX2</div><div>suggested: RRID:Addgene_12260)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 19 and 20. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.11.09.467827
  27. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.10.21265988
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.11.10.21265988: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the Mass General Brigham Human Research Committee (2021P000746).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For this analysis we randomly selected participants without prior SARS CoV-2 infection (confirmed by anti-nucleocapsid antibody testing) who had received each of the three FDA EUA vaccines (by allocating random numbers to each participant and selecting the first 60).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-nucleocapsid</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-receptor binding domain antibodies were measured with an enzyme-linked immunosorbent assay (ELISA) that we have previously described.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-receptor binding domain</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, pseudovirus neutralization titer 50 (pNT50) was calculated by taking the inverse of the serum concentration that achieved 50% neutralization of SARS-CoV-2 pseudotyped lentivirus particles entry into ACE2 expressing 293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Figures were rendered in GraphPad Prism v9.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This may be a helpful threshold in counselling patients regarding need for boosters, notwithstanding limitations of inferring clinical protection from immunologic measures. A key limitation of this study is the focus on in vitro immunogenicity. Effectiveness of vaccines against variants is likely to be more complex involving differences in viral infectivity, exposure rates, transmissibility and possibly virulence in combination with largely humoral immune responses and cellular responses. This is illustrated by the exceptional success of the delta variant in transmission, but its relatively modest escape of neutralization. The number of individuals evaluated after booster doses is modest, but these represent the extra tail of the curve of patients who failed to make adequate responses after initial vaccination. In conclusion, while current wildtype-based SARS CoV-2 vaccines induce lower magnitude responses in patients with cancer that show impaired neutralization of viral variants, boosting these responses can safely restore breadth against current viral variants.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.10.21265988
  28. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.10.21265651
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.11.10.21265651: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.10.21265651
  29. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.14.21266318
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.11.14.21266318: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We collected the total direct medical costs from hospitalisation for each COVID-19 clinical stage based on the Projected Economic Impact Report of the US Healthcare System and Health System Tracker 26,27.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>US Healthcare</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our study has several limitations. First, our study used a decision-analytic Markov model and did not account for the dynamic changes of population incidence of COVID-19. Second, we estimated the efficacy of the BNT162b2 booster against the Delta variant based on a synthesis of evidence from real-world data rather than randomised controlled trials. We conducted various sensitivity analyses to account for uncertainty in real-world data and parameter biases. Third, we did not consider the other COVID-19 vaccines (e.g., Moderna or J&J/Janssen) in the US. While the other vaccines, particularly the Moderna vaccine, represents a substantial proportion of COVID-19 vaccines administered in the US, they differ from the BNT162b2 vaccines in efficacy and price. It may not be reasonable to combine different vaccines together. Nevertheless, the BNT162b2 vaccine comprises the largest proportion of all COVID-19 vaccines in the US; thus, the cost-effectiveness result of the BNT162b2 vaccines and boosters would be most policy-relevant. As the latest data showed that the Moderna vaccine could be more effective than the BNT162b2 vaccine in preventing hospitalisations 31, the cost-effectiveness of a booster strategy, in reality, is likely to be more favourable than what we estimated. Fourth, we assumed that the efficacy of COVID-19 vaccines begins to wane in 6 months after full vaccination. In reality, the efficacy of vaccines is more likely to gradually decline without a clear cut-off. This ass...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.14.21266318
  30. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.12.21266273
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.11.12.21266273: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Participant recruitment and study design: Pregnant individuals at two tertiary care centers were approached for enrollment in the COVID-19 pregnancy biorepository study between January 2021 and September 2021, Protocol #2020P003538, approved by Mass General Brigham Institutional Review Board (IRB).<br>Consent: Eligible participants were pregnant, greater than or equal to 18 years old, able to provide informed consent, and receiving the Ad26.COV2.S, mRNA-1273, or BNT162b2 COVID-19 vaccine during pregnancy.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bead-based functional assays: For antibody-dependent cellular phagocytosis (ADCP), antibody-dependent neutrophil phagocytosis (ADNP) and antibody-dependent complement deposition (ADCD), D614G Spike was biotinylated using Sulfo-NHS-LC-LC biotin (Thermo Fisher Scientific) and desalted using Zeba Columns (Thermo Fisher Scientific)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-dependent neutrophil phagocytosis ( ADNP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antibody-dependent complement deposition ( ADCD)</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Sulfo-NHS-LC-LC biotin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Multiplexed Luminex Assay: A multiplexed Luminex assay was used to determine the relative concentration of antigen-specific antibody isotype and subclass titer and Fc receptor binding.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific antibody isotype and subclass titer and Fc receptor binding .</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antigen-specific antibody isotypes were measured using PE-coupled mouse anti-human antibodies (Southern Biotech) specific for each specific isotype.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antigen-specific</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human antibodies</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed, and a horseradish peroxidase (HRP)-conjugated goat anti-human IgG antibody (Bethyl Laboratories) was added for detection of Spike-specific IgG.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For ADCP, THP-1 cells (ATCC) were added to plates at a concentration of 2.5×104 cells/mL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>THP-1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: For univariate analysis, statistics were calculated using GraphPad Prism version 8.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.12.21266273
  31. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.10.21266174
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.11.10.21266174: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Two thirds of the panel were recruited randomly by telephone, with the remainder recruited via publicity and social media.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Further research is needed to determine the extent to which this reflects a lack of motivation or desire to get vaccinated, or a perceived inability to get vaccinated due to practical barriers or limitations (e.g., lack of access to paid leave to get vaccinated). Limitations and strengths: This study should be interpreted in light of some methodological limitations. First, although we included large, national samples of Canadians with representation across age, sex, and province, the absolute number of participants in certain provinces (e.g., Atlantic) was lower, making inter-provincial comparisons difficult. Second, the survey was only available in English and French, which may have led to an underrepresentation of certain non-native English or French speaking groups. Further, our surveys included fewer people of color, which may reflect participation on online panels, so results might not generalize as well to non-Whites. Third, since the surveys were voluntary and participants were drawn from a polling firm’s subject pool, participation may have been subject to some degree of selection bias. Fourth, though this study presents data depicting vaccine intentions over time, it was drawn from three separate cohorts of online panels, so data reflect trends in vaccine intentions over time but not in the same individuals. Finally, data were self-reported, which may have been subject to social desirability bias.64 However, the fact that the surveys were anonymous likely mitigated t...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.10.21266174
  32. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.16.21266391
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.11.16.21266391: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the institutional review board (approval numbers 2020-076) and conducted in accordance with the ethical principles stated by the Declaration of Helsinki.<br>Consent: Informed written consent was obtained from all participants or legal representatives.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 antibody profiling: Antibodies against the S1 domain of the spike (S) protein and the nucleocapsid protein (NCP) of SARS-CoV-2 were determined by Anti-SARS-CoV-2-ELISA IgA/IgG and Anti-SARS-CoV-2-NCP-ELISA kits from Euroimmun (Lübeck, Germany).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2-ELISA IgA/IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2-NCP-ELISA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: We used logistic regression to assess acute COVID-19 symptoms associated with PASC by fitting a generalized linear model with R function glm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PASC</div><div>suggested: (PASC , RRID:SCR_016642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Barplots, plasma level heatmap and all statistical analyses were performed using GraphPad Prism 8.3.1 (GraphPad Software, La Jolla, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      In addition to the inherently restricted follow-up of these studies, their major limitation is the lack of bioimmunological data acquired in subjects with PASC. The wealth of studies dissecting the biology of the acute COVID-19 infection dramatically contrasts with the paucity of biological data currently available for patients with persistent symptoms. As a consequence, current concepts of the natural history of PASC and its pathophysiological drivers remain hypothetical. Yet, this data is urgently needed to develop rational therapeutic strategies. In the work presented here, we aimed to address these questions by analyzing the first 318 participants from the DigiHero cohort that follows an ambidirectional digital epidemiology approach with a survey focusing on the COVID-19 and vaccination history and a prospective part including an invitation to donate blood for (auto-)antibody and cytokine profiling. We found that approximately 70% of previously infected participants experienced prolonged symptoms independent of age and were therefore categorized as affected by PASC. Approximately 40% of the initially infected subjects even showed ongoing symptoms at the time of blood sampling which was on average eight months after positive SARS-CoV-2 testing including three individuals with persistent symptoms 16-17 months post-COVID-19 which is substantially longer than the durations reported so far by others[8]. Notably, after other SARS-CoV or MERS infections, long-lasting post-acute ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.16.21266391
  33. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.15.21266255
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.11.15.21266255: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations include that the survey is based on self-reported behaviours. Individuals tend to underreport socially undesirable/stigmatizing behaviours22, e.g. having many contacts during periods of strict lockdown, which could translate to reported vaccination behaviours. However, respondents were advised that their answers would be confidential and that the results from the survey would influence the government’s response to the pandemic, the survey was administered by the national statistics agency in the UK, and individuals were paid to participate. These factors lessen underreporting incentives23-25. Underreporting would lead to downward bias on estimates; for example, if individuals reported fewer physical contacts than they actually had, then our estimated probability of having these contacts would be lower than the true probability. The fact that only 36% reported having a physical contact in the week they received the vaccination – an increase of 10% compared to the week before the vaccination - suggests that some respondents either thought a vaccination appointment should not be counted as a physical contact or that they perhaps generally underreported contacts. Given this, we consider these results to be lower bounds of risk-compensatory behaviour. There are other behaviours that were not captured in these outcomes. For example, we did not capture non-work travel (e.g. trips made inter-/intra-regionally). Moreover, we did not account for the risk of the types of int...

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">ISRCTN21086382</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.15.21266255
  34. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.05.21265890
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.11.05.21265890: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Excess oligonucleotides were removed using Amicon® ultra 0.5 mL centrifugal filters with 100 kilodalton (kDa) cutoff with the washing buffer (10 mM Tris-HCl pH 8.0, 0.5 mM MgCl2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Amicon®</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Image visualization and analysis were performed using Gwyddion.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gwyddion</div><div>suggested: (Gwyddion, RRID:SCR_015583)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.05.21265890
  35. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.10.21266147
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.11.10.21266147: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethical approval: Ethical permission for nasopharyngeal microbiome study and the biorepository was obtained from the Institutional Ethical Committee (IEC)/Institutional Review Board (IRB) of the Institute of Life Sciences [(102/HEC/2020) and (100/HEC/2020)].<br>IRB: Ethical approval: Ethical permission for nasopharyngeal microbiome study and the biorepository was obtained from the Institutional Ethical Committee (IEC)/Institutional Review Board (IRB) of the Institute of Life Sciences [(102/HEC/2020) and (100/HEC/2020)].<br>Field Sample Permit: Sample collection and reverse transcription-polymerase chain reaction (RT-PCR): In total, 60 NP samples were collected for 16S rDNA amplicon sequencing from the Institute of Life Science (ILS) COVID-19 sample biorepository unit.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The quality and quantity of DNA were determined using the Multiskan™GO spectrophotometer (Thermo Scientific)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Multiskan™GO</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Equimolar amounts of amplicon libraries were pooled and sequenced using the MinION OXFORD NANOPORE™ device at the ILS DNA sequencing facility.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MinION</div><div>suggested: (MinION, RRID:SCR_017985)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Microbiome data processing: RAW fast5 files were generated using the MinKNOW™ tool for individual samples.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MinKNOW™</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Operational taxonomic units (OTUs) were generated using Kraken2 (https://ccb.jhu.edu/software/kraken2/index.shtml) (21) and the unclassified reads were filtered for downstream analysis using the ‘phyloseq’ ‘R” package to generate combined OTUs for all the samples and metadata (Supplemental Table 1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Kraken2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Normalization and differential OTU abundance were determined between control, and symptomatic and asymptomatic subjects using the DESeq2 function (cutoff of p-value ≤ 0.05).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The accession ID in NCBI is PRJNA774098.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NCBI</div><div>suggested: (NCBI, RRID:SCR_006472)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Linear discriminant analysis (LDA) effect size (LEfSe) analysis: The LEfSe was calculated using the online Galaxy web application with the Huttenhower lab’s tool (https://huttenhower.sph.harvard.edu/galaxy/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Galaxy</div><div>suggested: (Galaxy, RRID:SCR_006281)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, pairwise Spearman correlation between OTUs (which was generated from LefSe analysis) was calculated using the WGCNA function.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>LefSe</div><div>suggested: (LEfSe, RRID:SCR_014609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Network metrics such as betweenness, closeness, Eigen centrality, and PageRank centrality of the resulting network were calculated and visualized using ‘Gephi’, (https://gephi.org/) (23).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://gephi.org/</div><div>suggested: (Gephi, RRID:SCR_004293)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our study has certain limitations. The subject size is limited and a larger cohort would have strengthened our findings. The clinical manifestations are limited, and therefore, the larger picture is difficult to interpret. Future studies should include NP samples of vaccinated, asymptomatic, and hospitalized COVID-19 patients with detailed pathophysiology. Furthermore, blood biochemistry and metabolite studies from the serum would boost conclusions regarding functional aspects of the NP microbiome.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.10.21266147
  36. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.12.21266254
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.11.12.21266254: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      There are a couple of limitations to our study. First, we have assumed throughout that error rates for tests are known a priori. If this is not the case, then at least under the random sampling situation, prevalence can still be estimated using a Bayesian approach described by Diggle.[12] This naturally results in increased variability of the prevalence estimate and relies on a reasonable prior distribution being elicited for the prevalence. This approach has not been extended to our situation here where sampling bias is also an issue. Second, we assumed that the symptomatic without the disease group is negligible and size of sampled symptomatic individuals is at least half the population value. As for the former, we expect this to not be violated for COVID-19. Our correction proves to be very effective in many situations that would be encountered in practice. As we argued in the Introduction, this re-opens the debate about the utility of widespread rapid testing as a surveillance tool particularly in third world countries where PCR testing may be too expensive to implement widely. The scenario(s) where the correction does not improve upon the naïve estimate are those where the error rates are so large relative to the information in the sample that the correction is blurred and appears negligible. Sample pooling has also been proposed as an efficient way to estimate population prevalence because if the disease prevalence is low, then little information is accrued from individ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.12.21266254
  37. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.16.21266383
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.11.16.21266383: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.16.21266383
  38. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.15.21266333
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.11.15.21266333: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethical clearance was provided by the Institutional Ethical Committee, Maulana Azad Institute of Dental Sciences, Central Delhi, Delhi (India) (File No. EC/NEW/INST/2020/1207, dated 23/12/2020).<br>IRB: The Institutional Ethical Committee approved the study.<br>Consent: An informed consent was obtained from all participants prior to the distribution of questionnaires.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The descriptive (frequency distribution) and inferential (chi-square test) analysis was conducted using SPSS v23.0 (IBM, New York, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.15.21266333
  39. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.15.21266343
    1
    1. sciscore 19 Nov 2021

      SciScore for 10.1101/2021.11.15.21266343: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the Institutional Review Board of the Research Ethics Committee of the University of Tübingen (899/2018AMG1) and the corresponding ethical review boards of all participating centers.<br>Consent: The trial was also approved by the Federal Institute for Drugs and Medical Devices (BfArM, EudraCT No. 2016-003168-37) and registered at clinicaltrials.gov (NCT03111212) For further details, please see Supplemental Data. Patients: Before the inclusion of patients into the study, the trial coordinators obtained consent for participation in the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study design, Ethics and Oversight: We conducted a prospective randomized controlled, single-blind multicenter trial administering prostacyclin to critically ill patients with ARDS for 5 days.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Sample size: In our study, we assumed an effect size of 0.525, leading to 116 error degrees of freedom to achieve a power of 80% using a level of significance of 0.05 in the two-sided t-test.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Of course, our trial also has several limitations. First, the trial was started before the COVID-19 pandemic to evaluate the effects of prostacyclin on oxygenation and outcomes of critically ill patients with ARDS. Then, shortly after the start of the trial, the first wave of patients with COVID-19-induced ARDS were treated in Germany and German ICUs, including ours. Given the potential differences in the pathologies of ARDS and COVID-19-induced ARDS, this factor might have significant implications for therapy with prostacyclin. However, we decided to include all patient groups with ARDS and not exclude patients with COVID-19, since our trial should also take advantage of the opportunity to compare patients with different ARDS etiologies and their responses to prostacyclin treatment. Second, our sample size was moderate, and our study was probably underpowered. This interpretation seems justified, as we obtained the expected effect, i.e., a superiority of 21mmHg in PaO2/FiO2, but the standard deviations were much larger, as expected (80mmHg in the controls, 91mmHg in the prostacyclin group vs. 40 mmHg assumed). Third, the intervention group and the control group differed significantly in age, which could have a potential effect on the overall outcome in this patient group. The average age was older in the intervention group, and therefore, one would expect this factor to have a potential negative effect if any effect at all, based on the literature (21, 22). However, in our s...

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT03111212</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Iloprost in Acute Respiratory Distress Syndrome</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.15.21266343
  40. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.15.21265526
    1
    1. sciscore 18 Nov 2021

      SciScore for 10.1101/2021.11.15.21265526: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.15.21265526
  41. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.16.21266324
    1
    1. sciscore 18 Nov 2021

      SciScore for 10.1101/2021.11.16.21266324: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Biostatistical analysis: Statistical analysis was carried out using the Statistical Package for the social sciences (SPSS) version 21.0 (IBM, Armonk, NY, USA) software program.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Statistical Package for the social sciences</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.16.21266324
  42. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.15.21265753
    1
    1. sciscore 18 Nov 2021

      SciScore for 10.1101/2021.11.15.21265753: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.15.21265753
  43. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.15.21266264
    1
    1. sciscore 18 Nov 2021

      SciScore for 10.1101/2021.11.15.21266264: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      There are other limitations that should also be considered. First, we were not able to achieve full harmonisation of measures across studies, for example, a range of different psychological distress scales were used and questions on social contact differed considerably (which may explain some of the between study differences in prevalence). Second, all cohorts and studies could not contribute to every analysis as the number of cases and available data varied between studies. Third, participation in the furlough scheme was more common during the initial stages of the pandemic than being no longer employed or in stable unemployment, which meant that estimates for the latter groups were based on small numbers with considerable heterogeneity and imprecision in estimates, especially in sub-group analyses. Finally, it is important to recognise that stable employment itself may have changed during the pandemic with potential effects of home working and changes in working practices on mental health and wellbeing, which is an area for future research. The UK CJRS furlough scheme officially ended on the 30th of September 2021. It might be expected that the economic downturn caused by the COVID-19 pandemic will last beyond the end of the furlough scheme, and potentially beyond the end of the pandemic (Whitehead et al., 2021). With potentially damaging effects on mental health and wellbeing for those who stopped working (via furlough or otherwise), one pertinent question is whether the m...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.15.21266264
  44. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.15.21265879
    1
    1. sciscore 18 Nov 2021

      SciScore for 10.1101/2021.11.15.21265879: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Prior to the collection of samples, authorization for the entry of field personnel was coordinated with those responsible for markets, supermarkets, banking agencies and transport units in each district.<br>IRB: Ethical aspects: The study protocol was reviewed and approved by the INS Institutional Research Ethics Committee with the code OI-034-20.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero-E6 cells were cultured in DMEM (Dulbecco’s Modified Eagles Medium) culture medium supplemented with streptomycin 100 mg/L, ampicillin 25 mg/L, 20% inactivated fetal bovine serum (SFB) and kept at 37 °C in a humid atmosphere of 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis of data: The information registered in data collection sheets, as well as the results of the molecular tests were entered into an Excel database.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The analysis was carried out in the statistical program SPSS V25.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The study also has limitations, such as that the collection of samples was carried out in the months of November and December, a period in which the number of new cases was less than 1,000 in Lima, Peru, according to the National Center for Epidemiology, Prevention and Control of Diseases. It is important to indicate that the World Health Organization mentions that the biological basis for the possibility of infection through contact with surfaces and food is related to fomites, which is still considered a concept with contradictory evidence (27). Furthermore, the study was carried out only in districts of Lima, Peru, and not in other regions of the country; however, it should be considered that these districts were the ones that showed the highest number of infections in the most critical period of the pandemic in Peru. Another limitation, is the lower isolation of virus from samples with higher Ct value, Ct > 31 by RT-PCR method. The rt-PCR Ct value correlate strongly with cultivable virus and likelihood of infectiosness, In this sense, a higher number of positive samples, will offer us the probability of a greater number of virus isolation (11). An additional aspect to consider is that, in the study period, frequent cleaning of the surfaces to be studied was observed, which could have had an impact triggering lower possibilities of obtaining positive results, but not on the elimination of their detection as has been described in previous experiences (23). Peru has been one...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.15.21265879
  45. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.15.21266315
    1
    1. sciscore 18 Nov 2021

      SciScore for 10.1101/2021.11.15.21266315: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Individuals who volunteered to participate in the study were asked to perform self-sampling according to the instructions and return the filled sampling card, questionnaire, and consent form by regular mail.<br>IRB: The study was approved by the regional ethical board (EPN Stockholm, Dnr 2015/867-31/1) and the Swedish Ethical Review Authority (EPM, Dnr 2020-01500).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Population study: Capillary blood samples from the general population were obtained by cold-mailing home-sampling kits (MM20-009-01, Capitainer AB, Sweden) to 2000 randomly selected individuals (20-74 years old) in metropolitan Stockholm (Tables 1. and 2.) during April 2020 together with a questionnaire, as described previously (16).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Capillary blood samples were obtained by finger-pricking and applying blood droplets onto a quantitative DBS sampling card (qDBS, Capitainer AB, Stockholm, Sweden) according to the supplier’s instructions.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Correlations between the determine protein levels and IgG or IgM antibody levels detected against S, RBD, and N antigens in population samples (separately per set, N = 78 and N = 66) were computed using the “corr.test” function of the “psych” R package (version 1.9.12.31).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The observed increase in levels of circulating CHRDL2 may support recent findings of an active role of bone marrow as immune regulatory organ and indicate active proliferation of cells involved in adaptive immune response (38) An inherent limitation of studying DBS samples is the need for very sensitive methods for quantification. (9). In this study we chose to focus on stable proteins occurring at medium to high abundance levels in the circulation. Indeed, the recommended dilution for plasma for the three assay panels used is 1:100, 1:20, or 1:2025. Such dilutions could be easily coupled to the blood dilution implicit in the procedure of protein elution from DBS (see Material and Methods). Consequently, next efforts aim to establish procedures to quantify proteins of lower abundance, such as IL6 or TNF, as well as other inflammatory biomarkers discussed in the literature. Moreover, since the chosen method build on pre-selected panels of proteins, we could have missed some relevant markers described covered in current COVID-19 literature (39). As population samples were collected in an anonymous manner from a set of random households, no follow-up of the participating donors will be possible and new studies must be designed where additional samples and clinical information can be collected over a longer period. Even though we observed associations between serostatus and proteins, there could be unknown factors, such as BMI, medication, travel, or socio-economic factors as wel...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.15.21266315
  46. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.12.21266257
    1
    1. sciscore 18 Nov 2021

      SciScore for 10.1101/2021.11.12.21266257: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.12.21266257
  47. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.15.21266157
    1
    1. sciscore 18 Nov 2021

      SciScore for 10.1101/2021.11.15.21266157: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.15.21266157
  48. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.12.21266256
    1
    1. sciscore 18 Nov 2021

      SciScore for 10.1101/2021.11.12.21266256: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Power calculation: The sample size was chosen pragmatically based on several different approaches[39], obtaining a minimum sample size between 271 and 1,067 participants, depending on the assumptions.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations: One of the limitations of our study is that participants were recruited from the online survey platform Prolific. Since Prolific surveys are completed digitally (mobile, PC, tablet etc.) our sample was comprised of people who had the means and capacity to use digital technologies. Another limitation of our study is the relatively low explanatory power of our model with and adjusted R-squared of 22.76%, suggesting that the independent variables chosen by our stepwise linear regression model only explain 22.76% of the observed variation in the index Certificate Severity. Considering that research on immunity certificates is still in its early stages, we do not yet have a large body of literature to draw from in order to identify more predictors of Certificate Severity. More research is needed to explore what the factors that we do not capture could be.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.12.21266256
  49. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.10.21265889
    1
    1. sciscore 18 Nov 2021

      SciScore for 10.1101/2021.11.10.21265889: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Subjects: Eligible subjects were uninfected adult volunteers, aged 18–90 years, who were healthy or had chronic but stable medical conditions, without signs/symptoms suggestive of COVID-19, and who were confirmed to be SARS-CoV-2 negative by central lab reverse transcription polymerase chain reaction (RT-PCR) of nasopharyngeal swab ≤72 hours of randomization.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary endpoints included: the proportion of subjects with treatment-emergent AEs (TEAEs), the proportion of subjects who achieved or exceeded the target concentration of REGEN-COV in serum (20 µg/mL) at the end of each 4-week dosing interval, and immunogenicity (measured by anti-drug antibodies [ADAs]) to REGEN-COV.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-drug</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Exploratory efficacy endpoints assessed the incidence and severity of symptomatic SARS-CoV-2 infection (ie, COVID-19) during the treatment and follow-up periods and the proportion of baseline anti-SARS-CoV-2 seronegative subjects who converted to seropositive for SARS-COV-2 anti-nucleocapsid IgG antibodies post-baseline; seroconversion from negative to positive for SARS-COV-2 anti-nucleocapsid IgG antibodies was considered indicative of an incident SARS-CoV-2 infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-nucleocapsid IgG</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A potential limitation of this study was that regular RT-PCR testing was not performed in all participants who presented with a clinical syndrome compatible with COVID-19. However, when only considering laboratory confirmed SARS-CoV-2 infection, REGEN-COV showed a 100% RRR in the development of COVID-19. The discrepancy could imply that these subjects had illnesses that were not due to SARS-CoV-2, or that sample collection was not close enough to symptom onset. An additional limitation of this study is that it was conducted before the emergence of several SARS-CoV-2 variants. However, extensive non-clinical testing has demonstrated that REGEN-COV retains its neutralization capacity against all clinically relevant viral variants tested to date, including beta, gamma, epsilon, and delta variants.10,13 Although it should not be deemed an appropriate substitute for vaccination in immunocompetent individuals, the efficacy and safety profile of REGEN-COV demonstrated in this study strongly support that REGEN-COV should be used for chronic prevention of COVID-19 in individuals not expected to mount a sufficient immune response to vaccination.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04519437</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Study Assessing the Safety, Tolerability, Pharmacokinetics, …</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.10.21265889
  50. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.15.21266377
    1
    1. sciscore 18 Nov 2021

      SciScore for 10.1101/2021.11.15.21266377: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Screeners 1 and 2 performed both phases of the screening independently (i.e., were blinded).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">22 The literature databases, PubMed and Embase for published articles, as well as iSearch for preprint articles from bioRxiv, medRxiv, SSRN, Research Square, and preprints.org, were searched on July 5, 2021, and search verification was extended through August 12, 2021.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div><div style="margin-bottom:8px"><div>Embase</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div><div style="margin-bottom:8px"><div>bioRxiv</div><div>suggested: (bioRxiv, RRID:SCR_003933)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We defined PASC as having any symptoms, or at least one new or persisting symptom during the follow-up time.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PASC</div><div>suggested: (PASC , RRID:SCR_016642)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This leads to the several limitations of this systematic review and meta- analysis.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.15.21266377
  51. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.14.21266294
    1
    1. sciscore 17 Nov 2021

      SciScore for 10.1101/2021.11.14.21266294: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics Statement: The study protocols were approved by the Human Research Ethics Committees of National Institute of Immunology and the partnering institutions.<br>Consent: All participants provided written informed consent before enrolment for the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sample absorbance was inversely proportional to the titre of the anti-SARS-CoV-2 neutralizing antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 neutralizing antibodies .</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For detection of antibody secreting cell (ASC) spots corresponding to IgG+, IgM+ and IgA+ isotype, the plate was developed using detection monoclonal anti-human antibodies; IgG-550 (MT78/145), IgM-640 (MT22) and IgA-490 (MT20), diluted 1:500 in PBS containing 0.5% FBS for 2 hours in dark at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG+ , IgM+ and IgA+</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human antibodies; IgG-550</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgM-640 ( MT22</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA-490</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>MT20</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the stimulation period, cells were washed with FACS buffer (2% FBS in PBS) and surface stained with monoclonal antibody cocktail for 1 hour at 4 C in the dark; CD20, CD14, CD16, CD8a and fixable-viability dye coupled with APC eflour 780 in the dump channel, CD4-AlexaFluor 700 (RPA-T4), OX40-FITC (Ber-ACT35)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD20</div><div>suggested: (BioLegend Cat# 348805, RRID:AB_2889063)</div></div><div style="margin-bottom:8px"><div>CD14</div><div>suggested: (BioLegend Cat# 348805, RRID:AB_2889063)</div></div><div style="margin-bottom:8px"><div>CD16</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, cryopreserved PBMCs were revived as mentioned previously with ≥90% cellular viability and surface stained with following monoclonal antibodies for 15 minutes at 4 °C: fixable viability dye efluor 506, anti-CD4 AF700 (RPA-T4)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD4</div><div>suggested: (SouthernBiotech Cat# 1540-27, RRID:AB_2794844)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation, IFN-γ spots were detected using BAM conjugated monoclonal antibody against IFN-γ (7-B6-1-BAM, Mabtech, Sweden).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody against IFN-γ (7-B6-1-BAM, Mabtech, Sweden).</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sequence verified plasmid DNA representing mutant as well as wild type RBD sequences was further transfected to Expi293 cells using ExpiFectamine 293 Transfection Kit (ThermoFisher), and the secreted protein was purified from the supernatant.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For all analyses, after staining, cells were washed and fixed with freshly prepared 1% Paraformaldehyde (Sigma Aldrich) followed by acquiring using BD LSRFortessa X-20 flow cytometer (BD Biosciences) and subsequent data analysis by FlowJo 10.7.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses and data visualization were performed with the GraphPad Prism software version v8.4.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations of this study includes a modest sample size and limited blood volume to perform simultaneous analyses of multiple cellular responses to SARS-CoV-2 and VOCs. Although, the analyses from 4 weeks post-2nd dose up to 6 months suffice for key information on the persistence of immune memory, the durability of immune memory cannot be defined in the absence of analyses at the baseline and the longitudinal follow up. The detailed immunological investigation in the larger prospective cohort of vaccine effectiveness is required for identifying the immune correlates-of-protection and understanding the mechanism of protective immunity conferred by BBV152. BBV152-induced protective immunity seems to comprise of a low magnitude of neutralizing antibodies with potent T-cell response and a larger breadth of cellular reactivity against variants. The effective presence of memory T cells and antibodies in the respiratory tract will be ideal to control not only the SARS-CoV-2 infection but also the disease transmission. Thus, it’ll be worth investigating if BBV152 booster immunization via intranasal route can mediate localization of the protective immune memory in the local sites of infection or upper respiratory tract. With the encouraging demonstration of the potential of BBV152 in generating immune memory and its effectiveness against the recent virus variants, our study provides an assuring foundation for the future application of BBV152, an adjuvanted inactivated virus vaccine, i...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.14.21266294
  52. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.15.21266187
    1
    1. sciscore 17 Nov 2021

      SciScore for 10.1101/2021.11.15.21266187: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.15.21266187
  53. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.14.21266322
    1
    1. sciscore 17 Nov 2021

      SciScore for 10.1101/2021.11.14.21266322: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We solved the 2-point boundary value problems in R using the bvpSolve package.[</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>bvpSolve</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.14.21266322
  54. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.14.21266330
    1
    1. sciscore 17 Nov 2021

      SciScore for 10.1101/2021.11.14.21266330: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were performed using STATA version 14.0</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(Stata Corp., College Station, TX, USA) and Microsoft Excel 2016 (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This study was subject to several limitations. We utilized data that were available from routine SARS-CoV-2 testing of persons BID and many persons BID were not tested for SARS-CoV-2, including no one during the month of August 2020 which was during the first peak of the epidemic in Zambia. During August 2020, case counts, and percent test positivity remained elevated, but when BID testing resumed in September 2020, test positivity had substantially reduced. Next, excess all-cause mortality does not necessarily reflect the impact of COVID-19, although there was an absence of other large-scale health events in Lusaka that could explain the peaks observed in the data. However, it is possible that patients with other underlying health conditions did not access health services because of fear of COVID-19 and some of them may have died as a result. Although the UTH mortuary is the largest in Zambia, and the majority of SARS-CoV-2 testing among persons BID have been reported from this facility, the findings from this study might not be representative of other mortuaries in Zambia or Africa. Lastly, as an observational study, associations reported in this study do not necessarily reflect a causal relationship. Mortality surveillance at UTH mortuary in Lusaka correlated with SARS-CoV-2 transmission in the general population. Mortality surveillance should be implemented to ensure timely detection and management of COVID-19 cases in resource-limited settings where testing rates are low...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.14.21266330
  55. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.12.21266286
    1
    1. sciscore 17 Nov 2021

      SciScore for 10.1101/2021.11.12.21266286: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      5.1 Limitations: The main limitation of this study is that it is applied only to the data from a single area. This is justified by the fact that the dataset required for training had to avoid any trace of data that could lead the algorithm to distinguish data from other data. In fact, as mentioned above, this reduced the size of our dataset since we had to discard many tests due to the use of a different set of target genes. The purpose of this work is to show that a distinguishable signature on the Ct pattern seems to exist, but until proven using different labs, test conditions, etc., no further generalization should be made than the mere existence of this pattern. 5.2 Assessment of the potential interest of the proven concept: The ML tool proposed in this work represents an additional tool that can improve the relevance of rRT-PCR results. The classical interpretation of a qualitative, Boolean result (positive or negative) can be completed with additional information regarding the estimation of probable virus variants (if recognized by an ML algorithm). This can be useful for many purposes, such as the following: pandemic control (quick detection of the arrival of new variants), as a screening tool for virus sequencing, as a quality check of the tests and/or reagents, etc. In addition, this work is just the initial step toward a completely new methodology applied to rRT-PCR not only in the case of SARS-CoV-2 but also in many other diseases.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.12.21266286
  56. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.13.21266289
    1
    1. sciscore 17 Nov 2021

      SciScore for 10.1101/2021.11.13.21266289: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">EndNote 2020 was the designated reference manager and PubMed was searched via this software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EndNote</div><div>suggested: (EndNote, RRID:SCR_014001)</div></div><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serial searches of “Any Field” in PubMed, “Full Text and Metadata” in the IEEE Xplore digital library of the Institute of Electrical and Electronics Engineers, (ieeexplore.ieee.org), “All Fields” in the arXiv open-access archive (arxiv.org), and “Full Text or Abstract or Title” in bioRxiv and medRxiv (medrxiv.org) were performed using the identical search terms as listed below: The results from these serial searches were combined and systematically filtered to achieve a final article pool from which all references would be evaluated for contribution to the stated objectives.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Metadata”</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>arXiv</div><div>suggested: (arXiv, RRID:SCR_006500)</div></div><div style="margin-bottom:8px"><div>bioRxiv</div><div>suggested: (bioRxiv, RRID:SCR_003933)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.13.21266289
  57. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.14.21266295
    1
    1. sciscore 17 Nov 2021

      SciScore for 10.1101/2021.11.14.21266295: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mobility data was taken from the Apple™ website 15.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Apple™</div><div>suggested: (Apple - iWork, RRID:SCR_008412)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.14.21266295
  58. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.12.21266249
    1
    1. sciscore 17 Nov 2021

      SciScore for 10.1101/2021.11.12.21266249: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Study cohorts and data collection: Patients were recruited and data and sample collection was performed within one of four prospective observational studies conducted at Charité - Universitätsmedizin Berlin, Germany (Cohort A, (Kurth et al. 2020)), Inselspital Universitätsspital Bern, Switzerland (Cohort B), Universitätsklinikum Freiburg, Germany (Cohort C) and Universitätsklinikum Heidelberg, Germany (Cohort D).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cytokine AABs were detected using a monoclonal mouse antibody to human IgG (D20JL-6, MSD).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus infection-based neutralization assays: Calu-3 cells were pre-incubated with 1% human serum in the presence or absence of 200-400 IU/ml IFN-α2a (Roferon®-A, Roche) or 20-50 ng/ml IFN-ω (PeproTech).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: BCRJ Cat# 0264, RRID:CVCL_0609)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04510012</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Characterizing the Immune Response and Neuronal Damage in CO…</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.12.21266249
  59. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.14.21265758
    1
    1. sciscore 17 Nov 2021

      SciScore for 10.1101/2021.11.14.21265758: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the Directorate of Public Health and Preventive Medicine, Government of Tamil Nadu, and the Institutional Ethics Committee of Madras Medical College, Chennai, India.<br>Consent: The exclusion criteria were refusal to consent and contraindication to venipuncture.<br>Field Sample Permit: We focus on individuals with just 1 dose because they are more in number and have greater variation in the number of days since vaccination; this variation exists because many people who received 1 dose had not got a second dose at the time of sample collection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">First, within each HUD, the study randomly selected clusters.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum was analyzed for IgG antibodies to the SARS-CoV-2 spike protein using either the iFlash-SARS-CoV-2 IgG (Shenzhen YHLO Biotech; sensitivity of 95.9% and specificity of 95.7% per manufacturer)4 or the Vitros anti-SARS-CoV-2 IgG CLIA kit (Ortho-Clinical Diagnostics; sensitivity of 90% and specificity of 100% per manufacturer)5.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>iFlash-SARS-CoV-2 IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were conducted with Microsoft Excel 365 (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(Microsoft, USA) and Stata 16 (StataCorp, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our study has several limitations. First, because antibody concentrations in infected persons decline over time8, our estimate of seroprevalence in round 1 may underestimate the level of prior infection and perhaps natural immunity. Our estimate of 31.6% seroprevalence in round 2 after adjusting for infections between rounds 1 and 2 may be incorrect if our adjusted reported case rate does not accurately estimate of those infections. The fact that a 1 percentage point increase in that adjusted rate is associated with a 1 percentage point higher seropositivity rate suggests, however, that rate is a reasonable measure of infections. Second, we may not accurately untangle seropositivity in round 3 that is due to infection versus due to vaccination. Seroprevalence among the unvaccinated during round 3 may not be a reasonable measure of seropositivity if people were not to be vaccinated if age or self-selection affects vaccination status. Our estimate of seroprevalence due to vaccination may be off if our adjusted reported case rate (over 30 days prior to vaccination) does not accurately estimate infection risk.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.14.21265758
  60. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.15.21266338
    1
    1. sciscore 17 Nov 2021

      SciScore for 10.1101/2021.11.15.21266338: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study protocol was reviewed and approved by the Institutional Review Committee of the Sheikh Hasina National Institute of Burnand Plastic Surgery, Dhaka<br>Consent: Informed written consent was taken from each participant.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies to the RBD of the S1 subunit of the viral spike protein (IgG) were performed from the plasma samples using a commercially available Anti-SARS-CoV-2 ELISA kit(DiaSino</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>viral spike protein (IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 ELISA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The analysis was performed in Graphpad Prism 9.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations and Future Suggestions: This small sample size cannot produce generalizability. Therefore, subsequent clinical studies with larger sample sizes with different age group should be enclosed to confirm our findings. Moreover, only antibody response could not evaluate the efficacy of any vaccine, cellular response should be evaluated.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.15.21266338
  61. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.15.21266317
    1
    1. sciscore 17 Nov 2021

      SciScore for 10.1101/2021.11.15.21266317: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Respondents who did not have a period after the vaccine, but the reason is specified (eg. became pregnant in the same cycle that they were vaccinated, opted not to have a withdrawal bleed if taking a contraceptive pill; n = 28). 8.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The study has a number of limitations. First, because the participants were recruited retrospectively, the data is likely to be enriched for those who noticed a change, who might be more motivated to participate in the study. Therefore, we cannot use this data to determine the frequency with which people experience menstrual changes following COVID-19 vaccination or, directly, to confirm or disprove any link between vaccination and menstrual changes. Approaches in which participants are recruited prospectively or using menstrual cycle data collected for other reasons, for example, datasets from menstrual cycle tracking apps with linked data about dates of vaccination, are better equipped to answer these questions. Approaches using menstrual cycle tracking apps are likely to be particularly powerful because the large number of cycles logged and the granularity of the data will allow detection of small and rare changes to post-vaccination menstrual cycles. Further, where the app uses user data to predict the day of ovulation, the date of vaccination relative to ovulation can be determined with greater accuracy than the crude estimate used here. It is also important to note that the majority of the participants in this study were from the UK, so our findings here might not be applicable to other countries. In particular, we did not examine any potential associations with vaccines that are not approved for use in the UK, such as Sinovac, Sinopharm or Sputnik V. In the UK, we use ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.15.21266317
  62. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.12.21266178
    1
    1. sciscore 17 Nov 2021

      SciScore for 10.1101/2021.11.12.21266178: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: All surfaces sampled were wiped down with 75% ethanol wipes (Zhejiang Youquan Care Products Technology Co., Ltd., China) after sample collection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.12.21266178
  63. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.14.21266309
    1
    1. sciscore 17 Nov 2021

      SciScore for 10.1101/2021.11.14.21266309: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Both trials are published in the Cuban Public Registry of Clinical Trials, included in WHO International Clinical Registry Trials Platform with codes RPCEC00000340 and RPCEC00000347. [21, 22] Ethical considerations: Phase I clinical trial was approved by the Ethical Committee at the Cuban National Centre for Toxicology; phase IIa was approved by a Research Ethic Committee from the Medical Sciences University, Faculty of Medicine “Manuel Fajardo”, Havana, designed by the Health Innovation Committee from the Cuban Ministry of Health (MINSAP).<br>Consent: Written informed consent was obtained from all participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Participants and study design: Eligible participants were healthy persons according to clinical and laboratory criteria, aged 19–59 years (phase I) or 19–80 years (phase IIa) of both sexes, recruited through public advertisement at community or professional environment close to the clinical site (Clinic #1, La Lisa Municipality in Havana).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Forty volunteers were enrolled, randomly and sequentially assigned to two groups of 20, for receiving 28 days apart two doses of 15 µg or 25 µg of SOBERANA 02.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Phase IIb included 810 volunteers in a double blind, randomized, placebo controlled trial and will be published separately.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Statistical analysis: Sample size calculation was done considering a serious AE rate < 5% (for phase I) and <1% (for phase IIa).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Other secondary outcomes were vaccine immunogenicity, seroconversion (≥ 4-fold increase to pre-vaccination value), kinetics of anti-RBD IgG production (on days 0, 14, 28, 42, 56, 70 and 84), neutralizing antibody titres (on days 0, 56 and 84) and inhibition of RBD-ACE2 interaction (on days 0, 14, 28, 42, 56, 70 and 84).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Seroconversion rates for IgG antibodies anti-RBD (≥4-fold increase in antibody concentration over baseline) were calculated.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">It is colorimetric assays based on the of the virus neutralization by antibodies, avoiding the cytopathic effect on VeroE6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Both trials were conducted according to Helsinki’s Declaration, Good Clinical Practice and the Cuban National Immunization Program.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>National Immunization Program</div><div>suggested: (Centers for Disease Control and Prevention, RRID:SCR_012976)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were done using SPSS version 25·0; R version 3·2·4; EPIDAT version 4·1 and Prism GraphPad version 6·0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The main limitation of our study is its open label design; the lack of a control-placebo group precludes the comparison with unvaccinated subjects. In conclusion, SOBERANA 02 is safe, well tolerated and immunogenic in adult aged 19-80 years. Application of a heterologous scheme with SOBERANA Plus increased the immune response with excellent safety profile, reinforcing the induction of memory cells. These results pave the way for further evaluation of the heterologous scheme in phase IIb and phase III clinical trials.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.14.21266309
  64. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.14.21266325
    1
    1. sciscore 17 Nov 2021

      SciScore for 10.1101/2021.11.14.21266325: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.14.21266325
  65. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.14.21265797
    1
    1. sciscore 17 Nov 2021

      SciScore for 10.1101/2021.11.14.21265797: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Using this clinical trial identifier tagger, we have searched in the CORD19 corpus and Medline 2020.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Medline</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In parallel to the collection of studies with any of the above-mentioned keywords, we also searched for publications in PubMed applying the search paradigms ‘serology’ and ‘serological profiling’ to specifically identify COVID-19 related articles with serological information.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The web application was implemented in Python using Flask and several JavaScript libraries for visualization purposes including D3.js, DataTables, and DataMaps.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04299152</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Not yet recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Stem Cell Educator Therapy Treat the Viral Inflammation in C…</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.14.21265797
  66. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.14.21266214
    1
    1. sciscore 17 Nov 2021

      SciScore for 10.1101/2021.11.14.21266214: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Data Collection: We obtained ethical approval from the Institutional Review Board (IRB) and Department of Health (DOH), Abu Dhabi, United Arab Emirates (UAE).<br>Consent: Waiver of informed consent was allowed by the ethics committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sagittal, and Coronal reformats were also obtained with additional maximum intensity projection images. 2.3. CTPA Image Analysis: The images were evaluated and reviewed by two radiologists with more than 8 years of experience to judge the presence of typical COVID-19 pneumonia findings (bilateral, multilobed, posterior peripheral ground-glass opacities) and judge upon the severity of the infection radiologically. 2.4. Statistical Analysis: Data was analyzed using SPSS 21.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.14.21266214
  67. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.15.21266341
    1
    1. sciscore 17 Nov 2021

      SciScore for 10.1101/2021.11.15.21266341: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Participants contributed a maximum of four randomly chosen negative test results in the follow-up period.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      (9, 14, 15)Even greater protection has been reported in Israel against severe disease.(16)(13) Limitations: This is an observational study with a number of possible biases and should be interpreted with caution. The imperfect sensitivity PCR testing could cause misclassification of both cases and controls, which could attenuate vaccine effectiveness estimates. Many individuals will also have been previously infected so the VE measured is in the context of a population where many have already had natural exposure. We adjust for measured confounders, however, there may be residual confounding that we could not account for. Nevertheless, the similarity of the VE estimates using those with two doses and no booster as the baseline and using the 2-6 day period post booster as the baseline suggests that residual confounding is small. Use of the unvaccinated as a comparator to obtain absolute effectiveness is most susceptible to residual confounding as the totally unvaccinated population may differ in many ways to those who have had vaccine doses, many of which may lead to underestimation of VE (8). Despite this potential underestimation, using the unvaccinated comparator the absolute VE estimates were over 93%. Due to small numbers at this early stage of the booster roll out this study only assesses symptomatic disease, there is currently insufficient follow-up to estimate the effects on severe disease which leads to hospitalisation and death. For the same reason we are only able to...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.15.21266341
  68. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.12.21266292
    1
    1. sciscore 17 Nov 2021

      SciScore for 10.1101/2021.11.12.21266292: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The study was authorized by Kuwait’s Ministry of Health’s Ethical Research Committee.<br>Consent: The participants gave their consent to participate in the survey by filling the questionnaire.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: STATA 14 IC was used to analyze the data.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations of the study: The survey’s voluntary structure may have resulted in a selection bias, and the participants may not accurately reflect the actual population. A self-report questionnaire was employed to assess psychological symptoms, which did not concentrate on diagnostic evaluation by mental health specialists, in order to contact as many people as possible during this emergency situation and to reduce face-to-face interviews. We solely looked into the depression, anxiety, and stress levels of junior residents in this study. More research incorporating social support and post-traumatic stress disorder assessment among healthcare workers, on the other hand, would undoubtedly add to the literature.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.12.21266292
  69. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.11.21266212
    1
    1. sciscore 17 Nov 2021

      SciScore for 10.1101/2021.11.11.21266212: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      We also recognise the limitations inherent in modelling a complex situation. First, we represent the NHS in England as a single entity. As such, we implicitly assume that population and capacity are distributed evenly throughout the country by treating centre capacity. If the distribution of waiting list patients deviates significantly from the distribution of treatment centres weighted by capacity, the time it would take to clear the waiting list, and thus the mortality rate would be higher. Second, we have not attempted to calculate how many AS patients may have died in the COVID-19 pandemic. Third, our assumed mortality rate may differ at a centre-level due to prioritising clinically more vulnerable patients on the waiting list. Fourth, a centre-level analysis could account for the different practices in each treatment centre and identify strategies that work best for each centre. Fifth, our estimates from converting cases from SAVR to TAVI does not include post-procedural factors such as the requirement for intensive care capacity, hospital stay and further procedures because these rely on multiple centre-specific factors. Finally, it has been shown that rapid growth in the demand for TAVI can overwhelm current capacity,[22] which may lead to prolonged wait times and subsequent adverse outcomes while patients are on the waitlist. Therefore, a demand model that captures the changes of demand for TAVI and SAVR would be a helpful future direction of analysis. A previous stud...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.11.21266212
  70. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.12.21266291
    1
    1. sciscore 17 Nov 2021

      SciScore for 10.1101/2021.11.12.21266291: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Verbal informed consent was obtained from all the parents who participated in the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Pregnant women who tested positive by reverse transcription-polymerase chain reaction (RT-PCR) for SARS-CoV-2 (Cobas 6800 Systems, Roche, Switzerland)/(TaqPath, Thermo-Fisher Scientific, USA) were identified from the Kuwait National COVID-19 registry.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.3 Statistical analysis: All data were entered into a Microsoft Excel database.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was performed with STATA 14 software (Stata Corporation, College Station, TX).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.12.21266291
  71. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.12.21266271
    1
    1. sciscore 17 Nov 2021

      SciScore for 10.1101/2021.11.12.21266271: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">EndNote 2020 was the designated reference manager and PubMed was searched via this software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EndNote</div><div>suggested: (EndNote, RRID:SCR_014001)</div></div><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serial searches of “Any Field” in PubMed, “Full Text and Metadata” in the IEEE Xplore digital library of the Institute of Electrical and Electronics Engineers,(ieeexplore.ieee.org), “All Fields” in the arXiv open-access archive (arxiv.org), and “Full Text or Abstract or Title” in bioRxiv and medRxiv (medrxiv.org) were performed using the identical search terms as listed below: The results from these serial searches were combined and systematically filtered to achieve a final article pool from which all references would be evaluated for contribution to the stated objectives.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Metadata”</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>arXiv</div><div>suggested: (arXiv, RRID:SCR_006500)</div></div><div style="margin-bottom:8px"><div>bioRxiv</div><div>suggested: (bioRxiv, RRID:SCR_003933)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.12.21266271
  72. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.12.21266183
    1
    1. sciscore 17 Nov 2021

      SciScore for 10.1101/2021.11.12.21266183: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      One limitation to our study was that we did not model contact tracing around detected cases. While cruise lines are trained to trace and quarantine close contacts as part of the pilot reopening, as the ease of rapid testing increases with fast turnaround time, this could serve as a replacement for slower and resource intensive contact tracing in such settings. With pre-symptomatic transmission of SARS-CoV-2 and high levels of transmissibility of the Delta variant, the effectiveness of contact tracing is approaching a point of saturation in many countries (30). Furthermore, even if the threshold for close contact to be traced is lowered, the corresponding exponential increase in contacts fulfilling this criteria would make it logistically challenging to trace all individuals in a reasonable amount of time. Fully asymptomatic infections – as opposed to presymptomatic infections – were also not considered in the analysis. Should these infections exhibit lowered viral load, the testing interventions would be less likely to detect asymptomatic individuals but any potential for increase in outbreak size would be counteracted by their lowered infectiousness. Currently, there is no strong evidence to suggest that asymptomatic SARS-CoV-2 Delta infections are less infectious than symptomatic individuals (31, 32). Lastly, the accuracy of the data collected is largely dependent on the usage behaviour. Passengers are required to carry the contact tracing devices at all times except when e...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.12.21266183
  73. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.10.21265739
    1
    1. sciscore 17 Nov 2021

      SciScore for 10.1101/2021.11.10.21265739: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Further limitations of the model are that alters are not connected, and the assumption is made that social networks are isolated from each other, where in reality population level connections do exist. More extensive data collection such as that done by the SCS, where respondents reported which of their contacts had met each other, would provide information on transitive links. In the absence of these data, algorithms such as preferential attachment, an observed social phenomenon [5, 26], could be used. With regards to population-level networks, more targeted data collection could be conducted on schools or departments within universities [6, 9, 33], collecting information on whole cohort interactions. Data collection on this scale can be expensive and at times impractical, so synthetic social networks can be construct via algorithms. Previous research [16] has modelled COVID-19 transmission assuming a scale-free degree distribution exists at a population level, and investigated how different population-level social restrictions can reduce the critical levels for herd immunity. However, both the SCS and CON-QUEST data suggest that the degree distribution of a university population is power-law distributed only in the tail. Better population-level networks could be constructed through data-driven algorithms, such as exponential random graph models.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.10.21265739
  74. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.11.21266241
    1
    1. sciscore 17 Nov 2021

      SciScore for 10.1101/2021.11.11.21266241: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: 4.1 Study participants: Heathy adults age between 21-65 years old scheduled for Singapore national vaccination program were enrolled to the study in compliance with all relevant ethical regulations and was approved by Institutional Review Board of Nanyang Technological University (IRB-2021-04-020).<br>Consent: All participants provided informed consent before participation under voluntary basis and reported with no prior SARS-CoV-2 infection at point of recruitment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, to produce SARS-CoV-2 pseudovirus, HEK293T cells at 36 ×106 cell density were transfected with 27 µg pMDLg/pRRE (Addgene, #12251), 13.5 µg pRSV-Rev (Addgene, #12253), 27 µg pTT5LnX-WHCoV-St19 (SARS-CoV2 Spike) and 54 µg pHIV-Luc-ZsGreen (Addgene, #39196) using Lipofectamine 3000 (Invitrogen, #L3000-150).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The neutralization assay was performed by transferring the plasma-pseudovirus mixture to monolayered CHO-ACE2 cells (5×104 cells) in 100µL of complete medium containing DMEM/high glucose with sodium pyruvate (Gibco, #10569010), 10% FBS (Hyclone, # SV301160.03), 10% MEM Non-essential amino acids (Gibco, #1110050), 10% geneticin (Gibco, #10131035) and 10% penicillin/streptomycin (Gibco, #15400054).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, to produce SARS-CoV-2 pseudovirus, HEK293T cells at 36 ×106 cell density were transfected with 27 µg pMDLg/pRRE (Addgene, #12251), 13.5 µg pRSV-Rev (Addgene, #12253), 27 µg pTT5LnX-WHCoV-St19 (SARS-CoV2 Spike) and 54 µg pHIV-Luc-ZsGreen (Addgene, #39196) using Lipofectamine 3000 (Invitrogen, #L3000-150).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMDLg/pRRE</div><div>suggested: RRID:Addgene_12251)</div></div><div style="margin-bottom:8px"><div>pRSV-Rev</div><div>suggested: RRID:Addgene_12253)</div></div><div style="margin-bottom:8px"><div>pHIV-Luc-ZsGreen</div><div>suggested: RRID:Addgene_39196)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.11.21266241
  75. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.10.21266063
    1
    1. sciscore 17 Nov 2021

      SciScore for 10.1101/2021.11.10.21266063: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tier 2 cases had new-onset thrombocytopenia, thrombosis in an extremity vein or pulmonary artery in the absence of thrombosis at a Tier 1 location, and a positive anti-PF4 antibody ELISA test or functional HIT platelet test occurring any time after receipt of COVID-19 vaccine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-PF4</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">REDCap is a secure, web-based software platform designed to support data entry and management [22,23].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analyses were conducted with SAS 9.4 (SAS Institute, Cary, NC)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This report is subject to limitations. VAERS is a passive surveillance system, so the TTS reporting rates described likely underestimate true rates of occurrence. In addition, lack of anti-PF4 antibody ELISA testing could lead to both underreporting and underrepresentation of Tier 2 cases, compared to Tier 1 TTS cases. However, a strength of the current analysis is that because the COVID-19 immunization program was federally coordinated, all U.S. public health jurisdictions reported the number of COVID-19 vaccines that were administered, allowing a better estimate of reporting rates than usually possible when using VAERS data. We estimate reporting rates of TTS following COVID-19 vaccination and describe the epidemiology of this emerging syndrome through a systematic surveillance effort. The epidemiology and hypothesized pathogenesis of TTS support a causal association with receipt of the Ad26.COV2.S COVID-19 vaccine. However, the much lower reported rates and difference in demographics for TTS cases following mRNA-based COVID-19 vaccines suggest that reports occurring after mRNA-based vaccine likely represents a background rate of cases of autoimmune HIT. Continued vigilance for TTS cases following Ad26.COV2.S vaccination is needed; the reporting rates and epidemiologic data about TTS following Ad26.COV2.S vaccination will be useful in formulating benefit-risk assessments for COVID-19 immunization programs in the United States and other countries [33-34].

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.10.21266063
  76. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.13.21266305
    1
    1. sciscore 16 Nov 2021

      SciScore for 10.1101/2021.11.13.21266305: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: CMC) Institutional Review Board approval 0420EP.<br>Consent: All patients agreed to participate and provided verbal consent prior to specimen collection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Cell cultures with no CPE were frozen, thawed, and subjected to two additional blind passages/inoculations in Vero E6/TMPRSS2 cell cultures.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For this, twenty-four well plates were seeded with ∼75,000 Vero E6/TMPRSS2 cells per well 24 h prior to sample inoculation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6/TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Thermo Fisher TaqPath COVID-19</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo Fisher TaqPath</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Diagnostic sensitivity and result concordance across specimens and platforms were calculated with Microsoft Excel (Microsoft Office Professional Plus 2019)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GraphPad Prism (version 9.0.2 for Windows, GraphPad Software, San Diego, CA, USA, www.graphpad.com) was used to perform testing for normal distribution of cycle threshold (Ct) values with Shapiro-Wilk tests, comparison of Ct values using Wilcoxon matched-pairs signed rank tests or Mann-Whitney tests for unpaired comparisons, and to generate plots.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.13.21266305
  77. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.13.21266310
    1
    1. sciscore 16 Nov 2021

      SciScore for 10.1101/2021.11.13.21266310: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Informed consent forms signed online by the participants were collected from the start of the study.<br>IRB: Ethical considerations: The University of the Philippines Manila Research Ethics Board (UPMREB) has approved the ethical clearance of this study with UPMREB CODE: 2019-474-01.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">On the other hand, individuals taking Pre-exposure Prophylaxis for HIV (PrEP), on ART, and/or female sex at birth were excluded.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were carried out using STATA 17 (www.stata.com) software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Mobility limitations due to the COVID-19 pandemic decreased the number of HIVST kits that can be delivered primarily in cities in Metro Manila that were inaccessible due to enhanced community quarantines and lockdowns. Due to the high demand for the HIVST kits, the research team faced difficulty to follow-up participants who did not report their results. In addition, participants were not required to answer all questions if they felt uncomfortable. Thus, decreasing the data available for analysis. Since the study was conducted online, participants who did not have access to the internet were not reached. Our study, to our knowledge, is the first in the Philippines that look at the feasibility and acceptability of HIVST kits on a larger scale. Furthermore, our study findings cannot be generalizable to other high-risk and at-risk populations. Future studies are needed to explore the feasibility and acceptability of HIVST in the general population, including other key populations such as female and male sex workers, people who inject drugs, and young key populations. Additional items on demographic questionnaires and questions on condom use and sexual behaviors can be included to characterize further those who want to use the HIVST kit. Moreover, barriers and facilitators considered in accessing HIV testing and treatment must also be ascertained among participants since these could potentially help design HIVST programs effectively and efficiently in the future. Finally, in dist...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.13.21266310
  78. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.12.21266250
    1
    1. sciscore 15 Nov 2021

      SciScore for 10.1101/2021.11.12.21266250: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Hamad Medical Corporation and Weill Cornell Medicine-Qatar Institutional Review Boards approved this retrospective study with waiver of informed consent, since analysis was done on routinely collected data.<br>Consent: Hamad Medical Corporation and Weill Cornell Medicine-Qatar Institutional Review Boards approved this retrospective study with waiver of informed consent, since analysis was done on routinely collected data.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Methods for classification of infections by variant type using RT-qPCR variant screening29 of random positive clinical samples23,25 are included in Section 3 in Supplementary Appendix.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Hazard ratios and corresponding 95% CIs were calculated using Cox regression adjusted for the matching factors with the STATA 17.032 stcox command.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were conducted in STATA/SE version 17.0.32 STROBE checklist is in Table S1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA/SE</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This study has the following limitations. Vaccinated cohorts in Qatar predominantly included young and working-age adults; thus, these findings may not generalize to children or older persons. As an observational study, the vaccinated cohorts were neither blinded nor randomized, so the potential for unmeasured or uncontrolled confounding cannot be excluded. While matching was done for age, sex, nationality, and calendar week of the first (or second) vaccine dose, it was not possible for other factors, such as comorbidities or occupation, as these data were not available to study investigators. However, matching was done to control for major factors known to affect risk of exposure to the infection in Qatar,14,17,26-28 as well as variant exposure over the course of follow-up.6,8,9,19,23-25 Matching by age may have (partially) reduced the potential for bias due to co-morbidities. The number of individuals with severe chronic conditions is also small in Qatar’s young population.14,34 Matching by nationality may have (partially) controlled the differences in occupational risk, in consideration of the association between nationality and occupation in Qatar.14,17,26-28 Both vaccines were broadly distributed across Qatar’s neighborhoods/areas and population social substrata. Individuals were vaccinated by the vaccine that was available at the time of the vaccination appointment. Cohorts were matched by calendar week of the first (or second) dose; thus, vaccination eligibility criter...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.12.21266250
  79. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.11.21266237
    1
    1. sciscore 15 Nov 2021

      SciScore for 10.1101/2021.11.11.21266237: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed both with OpenEpi and SPSS Statistics v27.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Graphs were generated using Microsoft Excel 365.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.11.21266237
  80. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.11.21265536
    1
    1. sciscore 15 Nov 2021

      SciScore for 10.1101/2021.11.11.21265536: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was based on data collected in the Moderna global safety database, mostly from adverse event reports submitted voluntarily, as part of routine ongoing post-authorization safety surveillance efforts by Moderna, Inc., as required by regulatory authorities; accordingly, a central institutional review board (IRB; Advarra) confirmed this study met criteria for an exemption from IRB oversight under 45 CFR 46.104(d)(4).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Although the reference rate was not stratified by age and sex in the published reference, the expected rate of 2.12 cases per 100,000 vaccine recipients was adjusted for lower prevalence among females aged 12–39 years relative to males by factor of 1.7326 as presented by the CDC.27 The observed reporting rate was divided by the expected rate and presented with an associated 95% confidence interval (CI) calculated as e(log(IRR)±1.96*SE(log(IRR)))).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A key limitation of this analysis is that the information from the Moderna global safety database is primarily derived from passive, spontaneous adverse event reporting, which lack a denominator (to clearly define the number of individuals who have received the vaccine) and often provide limited details on the clinical features and outcomes of reported myocarditis cases. As such, chart reviews and follow-ups on case resolutions were precluded. In conclusion, our findings demonstrate that myocarditis in individuals receiving mRNA 1273 is a rare event; previous reports suggest these cases are likely generally mild and self-limiting.13-15, 17, 44 As noted in a recent update based on data presented to the ACIP, the benefits of mRNA COVID-19 vaccination (ie, prevention of COVID-19, hospitalization, intensive care unit admissions, and death) clearly outweigh the potential harm of vaccine-related myocarditis.15 In safely and effectively preventing COVID-19 disease and its complications (including myocarditis, a natural complication of SARS-CoV-2 infection), mRNA COVID-19 vaccines thus remain essential for controlling the COVID-19 pandemic.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.11.21265536
  81. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.12.21266222
    1
    1. sciscore 15 Nov 2021

      SciScore for 10.1101/2021.11.12.21266222: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      However, some limitations of register-based data should be considered when interpreting the results. Data in these registries are not gathered for the purpose of this study, and therefore the focus on level of detail, error checking and precision in the available data is not guided by the current study, as would be the case for independent data gathering. Also, for the combined registries there can be errors for specific individuals, missing individuals, old data and problems when linking individual data from different registries. For example, we adjusted the model for crowded living conditions, which is data collected in 2019 and will be slightly outdated, especially for the younger age groups. And while vaccines administered as part of the Norwegian vaccination program should be in our dataset, it is not unlikely that some individuals (especially those with close ties to other countries) have received vaccines outside Norway and not reported them to SYSVAK. While changing aspect of disease dynamics leading to bias and limitations in register-based data are important caveats – our cohort study encompassing the whole Norwegian adult population indicates that vaccine effectiveness against severe disease is high among both partially and fully vaccinated individuals. Confounders that could affect our estimates have the highest potential for introducing bias when studying large heterogenous groups. Our estimates remain qualitatively the same for protection against infection and s...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.12.21266222
  82. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.11.21266048
    1
    1. sciscore 15 Nov 2021

      SciScore for 10.1101/2021.11.11.21266048: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.11.21266048
  83. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.11.21266219
    1
    1. sciscore 15 Nov 2021

      SciScore for 10.1101/2021.11.11.21266219: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The investigation was approved by Vilnius Regional Bioethics Committee (approval number 2021/5-1342-818).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Influenza A/WSN/33 (H1N1) virus was produced by transfecting a 12-plasmid rescue system into HEK 293T cells (16).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 Bavpat-1 was grown on Vero-E6 cells in Dulbecco’s Minimal Essential Medium (DMEM; Gibco) containing 0.5% FBS at 37 °C and 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After virus adsorption to the MDCK cells, the inoculum was removed and replaced with 2 ml MEM/agarose overlay (MEM, 0.5% FBS, 1% agarose).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDCK</div><div>suggested: CLS Cat# 602280/p823_MDCK_(NBL-2, RRID:CVCL_0422)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical testing was performed using GraphPad Prism 9.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.11.21266219
  84. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.11.21266220
    1
    1. sciscore 15 Nov 2021

      SciScore for 10.1101/2021.11.11.21266220: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: In the email confirming payment, students were also directed to our guide to surviving and thriving at CUNY during the pandemic.10 The study was approved by the CUNY SPH’s institutional review board (protocol number 695980) and all participants provided informed consent prior to the IDI.<br>Consent: In the email confirming payment, students were also directed to our guide to surviving and thriving at CUNY during the pandemic.10 The study was approved by the CUNY SPH’s institutional review board (protocol number 695980) and all participants provided informed consent prior to the IDI.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      To meet students’ essential needs, institutions can: To meet students’ academic needs, institutions can: The study findings should be interpreted within its limitations. At the time of the interviews, the COVID-19 vaccine was widely available, and the delta variant was not prominent in the U.S. Thus, students’ perspective on the pandemic and its effects may have changed as the fall semester approached and school policies were changing to accommodate the increase in COVID-19 cases. Additionally, students were asked to recall experiences from a year prior, at the height of the pandemic. Their current situation may have influenced how they remembered these early pandemic experiences. While we expected that students from the “low” impact group might identify factors that mitigated the impact of the pandemic, our qualitative analysis did not find any noteworthy differences in barriers and facilitators across these groups. A possible explanation for this finding is that by the end of the first year of the pandemic, most students had developed strategies to find needed resources. By helping to address students’ essential needs and creating a culture of supportive faculty, institutions of higher education can improve the lives of students and increase academic persistence, achievement, and degree completion.14 By approaching policy and intervention development from a perspective that considers students’ holistic lives, during and post-pandemic, leaders of public universities serving ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.11.21266220
  85. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.11.21266119
    1
    1. sciscore 15 Nov 2021

      SciScore for 10.1101/2021.11.11.21266119: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: The study was explained to all volunteers in detail, and all gave written informed consent prior to participating.<br>IRB: The Sant Joan de Déu Research Foundation ethics committee approved this study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">The primary end-point was to determine SARS-CoV-2 vaccine induced antibody levels in the breast milk of lactating women 4 weeks after mRNA BNT162b2 Pfizer-BioNTech COVID-19 complete vaccination.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">When blood samples were obtained, they were centrifuged for 15 minutes at 3,500 rpm and processed to determine levels of immunoglobulin (Ig) G antibodies against the spike protein S1 subunit (IgG-S1) and against the nucleocapsid (IgG-NC) of SARS-CoV-2 (Architect, Abbott®).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S1 subunit (IgG-S1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed with R version 4.0.3 (R Project for Statistical Computing), and figures created using ggplot2 R package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>R Project for Statistical</div><div>suggested: (R Project for Statistical Computing, RRID:SCR_001905)</div></div><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The main limitation of this study is its small sample size. In our sample, there was only one infant of exclusive breastfeeding age (<6 months) so it was not possible to analyze whether there is a greater passage of antibodies to milk in this period compared to a longer postpartum period. Moreover, with a larger sample, we could confirm the correlation between antibody levels in serum and breast milk that we found and predict the levels in milk from a serum sample determination. Furthermore, the use of different techniques for the analysis of the two types of antibodies, IgG-NC and IgG-S1, can lead to a bias in the interpretation of the data. Most of the studies in pregnant and lactating women to date have been conducted after vaccination with mRNA vaccines. More studies with other vaccines are needed to be able to extrapolate these data to other types of vaccine. Finally, larger prospective studies are needed to confirm the safety of SARS-CoV-2 vaccination in individuals who are breastfeeding and further assess the association between vaccination and infants’ health and SARS-CoV-2 specific immunity.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.11.21266119
  86. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.10.21266141
    1
    1. sciscore 14 Nov 2021

      SciScore for 10.1101/2021.11.10.21266141: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A whole body PBPK model constructed using Simbiology v. 5.8.2, a product of MATLAB® R2019a v. 9.6.0 (MathWorks, Natick, MA, USA 2013), was used to generate a cohort of 100 individuals aged 18-60 years (50% female and 50% male).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MATLAB®</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Though the PK of DEX in LD was successfully predicted, the model is characterized by some limitations. Although a direct and proportional relationship between CP score and increase in the plasma drug exposure was assume in the model, as demonstrated before by Johnson et al.,3 and also a linear correlation between portal vein shunt index and serum total bile acid concentrations in the peripheral vein,27 outliers individuals will not be represented by this assumption as demonstrated in supplementary table S2. Furthermore, the prevalence of spontaneous portosystemic shunt (SPS) increases as liver function injures, probably as an effect of damaging portal hypertension.26 However, large-SPS can be present in CP-A individuals as no SPS or small-SPS can be present in CP-C individuals.26 For this reason, the varying levels of portacaval-shunting associated with LD considered in the simulations was an aleatory linearly spaced range between 0.1 and 0.7. Other factors such as inter-individual variability, polymorphism, age (e.g., propranolol showed greater plasma level in elderly compared to young individuals),48 and unknown LD physiopathology mechanisms not represented in the model corroborate the challenge of qualifying the LD PBPK model against specific CP classifications.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.10.21266141
  87. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.10.21266134
    1
    1. sciscore 14 Nov 2021

      SciScore for 10.1101/2021.11.10.21266134: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was reviewed and approved under the category of Public Health practice by the University of Florida Institutional Review Board (IRB) and the Florida Department of Health IRB.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Relationship between VL, vaccination status and SARS-CoV-2 lineage: We performed a linear regression on the VL as dependent variable, with vaccination status (yes/no), Delta lineage (yes/no, age (<21, 21-28, 28-44, >44 years old or unknown), gender (male, female, unknown), and days from January 2021 as covariates.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Illumina’s DRAGEN pipeline was used to derive sample consensus sequences, which were filtered based on a minimum of 70% coverage of the genome and 20X sequencing depth.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DRAGEN</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenetic tree reconstruction and optimization: Following the first in-house sequencing run and first round of BLAST protocol described above, the multiple sequence alignment for all sequences up to November 25, 2020, was used in the reconstruction of an initial maximum likelihood tree in IQ-TREE2 using the best-fit evolutionary model according to Bayesian Information Criterion 36.36.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/content/10.1101/2021.11.10.21266134v1
  88. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.09.21266105
    1
    1. sciscore 14 Nov 2021

      SciScore for 10.1101/2021.11.09.21266105: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.1 Data research strategy: This study was conducted following PRISMA (Preferred Reporting Items for Systematic Reviews and Meta-analysis) guidelines using suitable keywords such as [Mental disorders OR Depression OR Anxiety OR Bipolar disorder OR Cognitive impairment OR Neurodegenerative disorders] AND [Healthcare workers OR Medical professional OR Doctors OR Nurses] AND [COVID-19] in PubMed, Embase/Elsevier, Cochrane, Science direct and Google scholar from inception till April 2021.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div><div style="margin-bottom:8px"><div>Google scholar</div><div>suggested: (Google Scholar, RRID:SCR_008878)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.09.21266105
  89. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.10.21266168
    1
    1. sciscore 14 Nov 2021

      SciScore for 10.1101/2021.11.10.21266168: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">We calculated that a sample of 6970 patients would provide 80% power to detect differences in the seroprevalence of SARS-CoV-2 antibodies in infliximab-compared with vedolizumab-treated patients, whilst controlling for immunomodulator status at the 0.05 significance level.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Outcome measures: Our primary outcome was anti-S RBD antibodies 2 to 10 weeks after second dose of the BNT162b2 or ChAdOx1 nCoV-19 vaccines.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Laboratory methods: To determine antibody responses specific to vaccination we used the Roche Elecsys Anti-SARS-CoV-2 spike (S) immunoassay34 alongside the nucleocapsid (N) immunoassay35.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We have previously reported that anti-N antibody responses following SARS-CoV-2 natural infection are impaired in patients treated with infliximab or vedolizumab11.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-N</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were entered electronically into a purpose-designed REDCap database hosted at the Royal Devon and Exeter NHS Foundation Trust33.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">ISRCTN45176516</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.10.21266168
  90. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.06.21266002
    1
    1. sciscore 14 Nov 2021

      SciScore for 10.1101/2021.11.06.21266002: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A limitation of our model is that it is age-homogeneous. For example, we assume that θ, the target vaccination coverage, is the same for all ages, whereas in fact it has been larger for elderly and vulnerable people who have higher infection fatality rates. This would bias death rates to high values. In practice, one might eventually hope for a uniformly high rate of θ throughout the age and vulnerability spectrum. Meanwhile, waning rates (ω) and vaccination rate (γ) in the real world are likely to be age-dependent. Additionally, we have assumed that transmissibility is the same for vaccinated and unvaccinated infectives. To overcome such limitations, one might develop an agent-based simulation model which could also include a more nuanced treatment of continuous waning of immunity, rather than the implicit binary waning of our compartmental model. One might expect such an approach to yield different results to ours in the short-term, but it remains to be seen whether the same is true in estimating equilibrium behaviour.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.06.21266002
  91. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.11.21266223
    1
    1. sciscore 14 Nov 2021

      SciScore for 10.1101/2021.11.11.21266223: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants provided informed consent according to the local ethics committee approval<br>IRB: All participants provided informed consent according to the local ethics committee approval</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Convalescent COVID-19 and Healthy Donors: Forty donors were randomly selected from a previously published cohort (2) to create four sex- and age-matched groups according to PCR and antibody status.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody tests: The presence of anti-Nucleocapsid protein (NP) IgG and IgM in serum samples was determined using the Panbio™ COVID-19 IgG/IgM Rapid Test Device (Fingerstick Whole Blood/Venous Whole Blood/Serum/Plasma) (Panbio™; Abbott Rapid Diagnostics Jena GmbH, Jena, Germany) according to the manufacturer’s instructions and as previously described (2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Nucleocapsid protein ( NP ) IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Each well was incubated for 20 min at 4°C in the dark, with saturating concentrations (100 µl) of a mix of the following antibodies: anti-PD1 PE-Cy7 (BioLegend, clone EH12.2H7)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-PD1 PE-Cy7</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VeroE6 cells were seeded in 96-well plates 24h prior to infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-NPIgG leves in serum samples were quantified using the Abbott Architect i2000 chemiluminescent microparticle immunoassay (Architect) was for SARS-CoV-2 IgG (Abbott Diagnostics, IL, USA; Architect) according to the manufacturer’s instructions and as previously described (2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott Architect</div><div>suggested: (Abbott ARCHITECT i1000sr System, RRID:SCR_019328)</div></div><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were acquired on a BD-LSR II FACS Scan, and data were analysed using FlowJo (Tree Star Inc.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analysis was performed using GraphPad Prism 9.1.2,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GraphPad Software, San Diego, California USA, (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Binary logistic regression was performed using IBM SPSS Statistics for Windows, Version 27.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      We acknowledge the limitations of our study, in part linked to the difficulties in diagnosis during the early phase of the pandemic, when PCR testing was not widely available. For this reason, we were not able to determine the exact timeframe between symptom onset, PCR test and sample collection for most of our subjects. Moreover, our sample size was limited, especially the group of PCR positive anti-NP negative subjects; this could be considered an intrinsic limitation of this research field, since only 1-10% of PCR confirmed cases are estimated to have undetectable antibodies. In addition, we acknowledge the fact that only four out of seven anti-NP negative, PCR positive subjects in our cohort had given their consent for PBMC isolation from venous blood. The ex-vivo assays were not performed using overlapping peptides covering the entire sequence of the SARS-CoV-2 proteins, but only selected peptides were used; however, since they were found to be immunogenic (17,27) we are confident that the results we obtained are representative, and are in line with other studies reviewed by Bertoletti et al.(30). We describe for the first time the β-NGF/TrkA signalling pathway as a host factor reflecting different levels of inflammation within mild COVID-19 cases, with effects on the virus-specific humoral and T cell response. The mechanistic regulation of this pathway in COVID-19 disease deserves further investigation, and larger studies are required to determine whether the effects of...

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">ISRCTN60400862</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.11.21266223
  92. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.11.21266216
    1
    1. sciscore 14 Nov 2021

      SciScore for 10.1101/2021.11.11.21266216: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study designs included peer-reviewed studies including but not limited to: Simulation studies using mathematical models or transmission models, cluster and parallel randomised controlled trials (RCTs), cluster and parallel non-RCTs, quasi-experimental studies (including controlled before-after studies, uncontrolled before-after studies, time series, and interrupted time series) that assess the effectiveness of community non-pharmaceutical measures.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Search Results and PICO: Relevant peer-reviewed studies were identified through systematic electronic searches using OVID Medline, EMBASE and the Cochrane and Campbell Databases for Systematic Reviews.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Medline</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div><div style="margin-bottom:8px"><div>EMBASE</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div><div style="margin-bottom:8px"><div>Cochrane</div><div>suggested: (Cochrane Library, RRID:SCR_013000)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Strengths and limitations: Our systematic review has several strengths, including the systematic approach during study identification, data extraction and quality appraisal that was applied. Some limitations should also be acknowledged. We assessed peer-reviewed and published evidence available until April 2021, much of which included the period before December 2020, and hence the information provided does not adequately cover NPIs in place during the circulation of all variants of concern. As per our inclusion criteria, only studies based in EU/EEA and UK were assessed, and accordingly, the results may not reflect the effectiveness of NPI implementation in other contexts globally – although other systematic reviews of a broader scope indicate similar findings (66, 67). Furthermore, a significant percentage of identified studies were based on mathematical modelling studies that require many assumptions related to the model design, which may lead to variability in model predictions and uncertainty for decision-makers. There was, furthermore, significant heterogeneity in study designs and studied interventions/combination of interventions, which only allowed for a narrative presentation of the results. Also, given that NPI effectiveness depends on the implementation, the personal protective measures that are probably implemented in parallel, demographic characteristics, and compliance levels, direct comparisons across countries and across NPIs were not possible.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.11.21266216
  93. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.11.21266107
    1
    1. sciscore 14 Nov 2021

      SciScore for 10.1101/2021.11.11.21266107: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RNA extraction was done with either the Abbott m2000sp or Seegene</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Both centers used the ARCTIC v3 primer scheme (27,28) to generate tiled, approximately 400bp-long amplicons.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ARCTIC</div><div>suggested: (ARCTIC, RRID:SCR_005989)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bioinformatics was done using V-pipe (29), including read trimming and filtering with PRINSEQ (30), alignment to GenBank accession MN908947 (31) with bwa (32), and consensus base calling.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PRINSEQ</div><div>suggested: (PRINSEQ, RRID:SCR_005454)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We aligned the sequences to the reference genome MN908947.3 using MAFFT (35).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Timetree generation: We estimated the maximum likelihood phylogeny for each lineage alignment using IQ-TREE (39) under an HKY substitution model (40) with empirical base frequencies and four gamma rate categories.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IQ-TREE</div><div>suggested: (IQ-TREE, RRID:SCR_017254)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylodynamic analysis: After identifying introductions, we performed phylodynamic inference on them using the BDSKY (birth-death skyline) method (44) in BEAST2 (45).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BEAST2</div><div>suggested: (BEAST2, RRID:SCR_017307)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.11.21266107
  94. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.08.21265055
    1
    1. sciscore 14 Nov 2021

      SciScore for 10.1101/2021.11.08.21265055: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.08.21265055
  95. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.11.21266068
    1
    1. sciscore 14 Nov 2021

      SciScore for 10.1101/2021.11.11.21266068: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The reinfection hazard coefficient (λ) and the inverse of the negative binomial dispersion parameter (κ) are fitted to the data using a Metropolis-Hastings Monte Carlo Markov Chain (MCMC) estimation procedure implemented in the R Statistical Programming Language.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>R Statistical Programming</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations of this study: The primary limitation of this study is that changes in testing practices, health-seeking behavior, or access to care have not been accounted for in these analyses. Estimates based on serological data from blood donors suggests substantial geographic variability in detection rates (14), which may contribute to the observed differences in reinfection patterns by province. Detection rates likely also vary through time and by other factors affecting access to testing, which may include occupation, age, and socioeconomic status. In particular, rapid antigen tests, which were introduced in South Africa in late 2020, may be under-reported despite mandatory reporting requirements. If under-reporting of antigen tests was substantial and time-varying it could influence our findings. However, comparing temporal trends in infection risk among those eligible for reinfection with the rest of the population, as in approach 2, mitigates against potential failure to detect a substantial increase in risk. Reinfections were not confirmed by sequencing or by requiring a negative test between putative infections. Nevertheless, the 90-day window period between consecutive positive tests reduces the possibility that suspected reinfections were predominantly the result of prolonged viral shedding. Furthermore, due to data limitations, we were unable to examine whether symptoms and severity in primary episodes correlate with protection against subsequent reinfection. Lastl...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.11.21266068
  96. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.10.21266138
    1
    1. sciscore 14 Nov 2021

      SciScore for 10.1101/2021.11.10.21266138: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Each bootstrap replicate was sampled randomly from a uniform distribution between the upper and lower bounds on the measurement.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Results were processed using QuantaSoft and QuantaSoft Analysis Pro (BioRad, CA) to manually threshold and export data.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>QuantaSoft</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>QuantaSoft Analysis Pro</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistics were computed using RStudio (version 1.4.1106).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RStudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.10.21266138
  97. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.10.21266185
    1
    1. sciscore 14 Nov 2021

      SciScore for 10.1101/2021.11.10.21266185: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Informed consent was provided by the patients or the surrogates and blood was drawn.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plasma concentrations of each biomarker were determined using a standard curve, constructed and fit using a 4P logistic regression equation, and the assay values were corrected by the appropriate dilution factor in each case. 2.3. Statistics: All statistical analyses were performed using Prism 8 (GraphPad Software, Inc).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our study has some limitations, such as the modest sample size and the use of a single time point for measurement of the biomarkers. In addition, we suspect that the incidence of thrombosis might be underestimated due to the difficulties in the diagnosis of certain thrombotic events such as microthrombosis [36]. There have been some changes in medication regimens given to patients between the initial and subsequent waves of COVID-19. These might have some effect in the plasma levels of the biomarkers measured in this study and will be the subject of a later report. Nevertheless, the reproducible nature of our findings, and those of others, especially on PAI-1 [16,21] and vWF [26,27] supports the idea that high plasma levels of these biomarkers are a consistent feature of severe COVID-19. Our study provides strong evidence that elevated levels of certain biomarkers such as t-PA, ST2, and vWF, as well as abnormal coagulation [8], may be related to the incidence of thrombosis, renal failure, and might contribute to other longer-term complications in COVID-19 patients. These biomarkers show robust and consistent increases in COVID-19 and can be assessed at the time of admission to non-ICU and ICU settings; they may prove useful as additional predictors of those patients at elevated risk for thrombosis or severe clinical outcomes. In a subsequent report, we will describe effects on these biomarkers and clinical outcomes of a number of medications used in COVID19.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.10.21266185
  98. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.09.21265517
    1
    1. sciscore 14 Nov 2021

      SciScore for 10.1101/2021.11.09.21265517: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.09.21265517
  99. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.11.21266207
    1
    1. sciscore 14 Nov 2021

      SciScore for 10.1101/2021.11.11.21266207: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We mined PubMed (which also indexes the bioRxiv and medrXiv preprint servers) for keywords related to COVID19 (“COVID19”, “SARS-CoV-2”), immune escape (“immune escape”, “treatment-emergent resistance”) and nAb-based therapeutics (“convalescent plasma”, “casirivimab”, “imdevimab”, “bamlanivimab”, etesevimab”, “sotrovimab, “regdanvimab”) both in vitro and in vivo.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div><div style="margin-bottom:8px"><div>bioRxiv</div><div>suggested: (bioRxiv, RRID:SCR_003933)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mutations identified in each condition of in vivo or in vitro selection were tabulated and highlighted on the structures using color coding with PyMOL [18].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.11.21266207
  100. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.10.21266188
    1
    1. sciscore 14 Nov 2021

      SciScore for 10.1101/2021.11.10.21266188: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We searched MEDLINE, MEDLINE In-Process, Embase, and Global Health from the date of their inception to October 29, 2021, with no language restrictions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEDLINE</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div><div style="margin-bottom:8px"><div>Embase</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We identified additional reports by searching the reference lists and using Google Scholar’s cited-by function of the included studies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Google Scholar’s</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our study has some limitations. Our estimates derive from studies during a period of the pandemic when physical distancing, lockdowns, and universal masking were in place, which contained infection rates. We have tried to address this by modelling how the NNE and NNP change with increased baseline infections. We were unable to answer how much VMVP will increase vaccination levels, which requires controlled trials and cohort studies. There were too few transmission studies to perform a meta-regression/subgroup analysis or examine the moderating effects of variants and vaccines. Not all SARS-CoV-2 vaccines were included in our meta-analysis and BNT162b2 and ChAdOx1 nCoV-19 were by far the most studied. Our conclusions do not generalize to child/adolescent populations. We were unable to analyse the impact of natural immunity on reducing transmission risk. In addition to more studies of vaccines on transmission, future research should focus on health economic analyses of the costs vs. benefits of exclusion, natural immunity and transmission, the impact of variants, and quantifying what is an acceptable baseline risk of infection and transmission in terms of health and economic outcomes. Notwithstanding these limitations, our study has strengths. Our estimates of the effect of SARS-CoV-2 vaccines on transmission, infection, and severe illness/hospitalization in the general population are robust because they are based on hundreds of thousands of participants. Using a recent meta-an...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.10.21266188
  101. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.07.21266018
    1
    1. sciscore 14 Nov 2021

      SciScore for 10.1101/2021.11.07.21266018: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This increase was based on the report published by Pfizer and BioNTech stating that their vaccine is 90 percent efficacious.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioNTech</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.07.21266018
  102. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.10.21266195
    1
    1. sciscore 14 Nov 2021

      SciScore for 10.1101/2021.11.10.21266195: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical Considerations: The California Health and Human Services Agency’s Committee for the Protection of Human Subjects exempted the study from institutional review board review.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were conducted using SAS software V.9.4 (SAS Institute, Inc, Cary, North Carolina, USA) and R Studio Version 4.0.2</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS</div><div>suggested: (SASqPCR, RRID:SCR_003056)</div></div><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This study has several limitations. Our definition of COVID-19 fatality required a positive polymerase chain reaction (PCR) test result for SARS-CoV-2. Thus, COVID-19 decedents in California who did not undergo PCR testing were excluded, potentially underestimating the occupational burden of COVID-19 deaths. The working status of some decedents may have been misclassified, such as unemployed decedents classified as likely working. Our use of “usual occupation” listed on the death certificate may have misclassified the occupation of some decedents who were working in a different occupation at the time of infection. In addition, we used ACS data from 2019, as 2020 data were not yet available. Pandemic-related changes in employment that occurred in California in 2020 may mean that denominators were overestimated (47). As a result, we may have underestimated the COVID-19 mortality rates for some occupations. Finally, by focusing on working-age decedents, we did not address the potential burden of COVID-19 on workers 65 years of age and older. Our findings have implications for prevention. Given the likelihood that COVID-19 fatalities among working Californians included work-related cases, the occupations with elevated mortality rates should be prioritized by public health and regulatory authorities to ensure that non-pharmaceutical interventions, such as physical distancing, use of respiratory protection or face coverings, and adequate ventilation, are implemented in the workplac...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.10.21266195
  103. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.10.21266139
    1
    1. sciscore 14 Nov 2021

      SciScore for 10.1101/2021.11.10.21266139: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our model, like all mathematical models, is subject to several limitations. We did not consider the development of antiviral resistance, yet it is possible that if antiviral treatments are widely used, resistance could rapidly develop. We analyzed the use of antiviral treatment in symptomatic individuals, and did not explore its use in asymptomatic infections or as a prophylaxis. Further, we assumed that an antiviral effect reducing viral load was independent of when treatment was started (as long as it started within the first five days of treatment). In reality, it is possible that antiviral treatments might different effects in reducing viral load at different times, e.g. reducing peak viral load early on but having only a modest effect as time goes by. For simplicity, we did not include waning immunity, but there are increasing reports that both vaccine-induced and infection-induced immunity might wane in a few months. We assumed that the vaccine had no effect in reducing infectiousness, but if vaccination does reduce infectiousness then the synergy between antiviral and vaccine might be less than reported here. We assumed no further vaccination during the period of our analysis, which corresponds to the current situation in most middle- and high-vaccinated countries, where the adult population who are willing to be vaccinated has already been immunized. Nevertheless, the recent approval of the Pfizer vaccine for children aged 5 to 11 years old will change that, immediate...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.10.21266139
  104. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.10.21266124
    1
    1. sciscore 14 Nov 2021

      SciScore for 10.1101/2021.11.10.21266124: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">We adjusted for sex (Male, Female), age (five-year age band), region, ethnicity (White British, Bangladeshi, Black African, Black Caribbean, Chinese, Indian, Mixed, Other, Pakistani, White other), disability status (non-disabled, disabled and limited a little, disabled and limited a lot), highest level of qualification (Level 4+, Level 3, Apprenticeship, Level 2, Level 1, other, no qualification) and pre-existing conditions (1+) based on the QCovid risk model (See Table S2 for more detail).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Strengths and limitations: A major strength of this study is the use of nationwide linked popula1tion-level data from clinical records and the 2011 Census. This study is the first to examine how vaccination rates vary by occupation using population-level data. Because information on occupation is not collected in electronic health records, we used data from the Census to assess people’s occupation. Some surveys collect data on both occupations and vaccination but face the issue that non-response is likely correlated with the propensity to be vaccinated. Having population level data based on electronic health records and the Census, which is mandatory and has a high response rate, we were able to accurately estimate vaccination rates for detailed occupational groups. The main limitation of our study is that the information on occupation is nine years out of date. Our exposure is therefore likely to be misclassified for a proportion of people, because they have left the labour force or changed occupation since 2011, especially during the pandemic. To mitigate measurement error, we restricted our analysis to people aged 40-64 years, who have a relatively high occupational stability, as shown in an analysis of a large longitudinal household survey [7]. Exposure misclassification is nonetheless likely result in underestimating the differences in vaccination rates between occupations, especially if the exposure misclassification is random. Turnout rate may be greater in some occupa...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.10.21266124
  105. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.11.21266189
    1
    1. sciscore 14 Nov 2021

      SciScore for 10.1101/2021.11.11.21266189: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the institutional review board at University Hospital Ramón y Cajal, Madrid, Spain.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">To estimate the denominator of the weights we fit a multinomial logistic model for the four NRTI combinations with covariates: age (in years, linear and quadratic terms), sex (male, female), transmission category (heterosexual, homo/bisexual, injecting drug use, other), country of origin (Spain, other), CD4 (<350, 350-500, >500 cells/mm3), and indicators for hypertension, diabetes, chronic renal disease, cardiovascular disease, and treatment with immunosuppressants or corticosteroids.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The goal was to emulate a (hypothetical) target trial in which individuals are randomly assigned to a particular nucleos(t)ide reverse transcriptase inhibitor (NRTI) combination before the start of SARS-CoV-2 transmission in their communities.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were conducted with Stata, version 15.0 (StataCorp).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our study has some limitations. First, residual confounding by yet to be identified factors cannot be excluded. However, such residual confounding seems unlikely because we adjusted for known factors that affect both antiretroviral treatment choice and COVID-19 severity. Therefore, the lowest risk of hospitalization in those receiving TDF/FTC cannot be easily explained by residual confounding. Second, we could not collect SARS-CoV-2 testing frequency for all individuals. Testing patterns, however, are expected to affect the detection of mild (and asymptomatic) disease but not that of more severe outcomes like hospitalization, ICU admissions, and death. Third, missing data on comorbidities led to the exclusion of 22% of otherwise eligible individuals. However, estimates did not materially change in unadjusted analyses that included individuals with missing data on comorbidities. Fourth, even a large cohort like this one cannot provide precise estimates for the risks of infrequent events such as ICU admissions and deaths. In summary, our findings suggest that treatment with TDF/FTC results in a lower severity of COVID-19 than treatment with other antiretrovirals among HIV-positive individuals with adequate virological control. This protective effect may be largely restricted to individuals aged 50 years and older. Confirmatory randomized trials of TDF/FTC for the prophylaxis and early treatment of COVID-19 are warranted.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.11.21266189
  106. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.08.21265944
    1
    1. sciscore 14 Nov 2021

      SciScore for 10.1101/2021.11.08.21265944: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.08.21265944
  107. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.09.21266060
    1
    1. sciscore 14 Nov 2021

      SciScore for 10.1101/2021.11.09.21266060: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: CIMS), containing data on COVID-19 vaccination of all Dutch citizens who provided consent; it is estimated that 93% of vaccinated persons give informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our findings are subject to a few limitations. First, we were not able to take into account immune status before hospitalization because serology was not consistently performed at admission, and prior SARS-CoV-2 infection was not consistently reported. This might have underestimated our VE-estimates. Second, our results are not representative for the VE against the delta variant, affecting the generalizability in the current epidemiologic situation. However, recent studies suggest that the VE against hospitalization is also very high in settings with dominance of the delta variant (10, 20). Third, most patients were only partially vaccinated. Therefore, our study was underpowered to measure the effect of full vaccination in many subgroups. Fourth, it was not feasible to only include patients admitted because of suspected COVID-19 because SARS-CoV-2 PCR at admission is not reserved for patients suspected of a respiratory infection. Residual bias due to health-seeking behavior otherwise mitigated by the test negative design might therefore still exist. Based on the patient characteristics we suspect the control group to consist partially of chronically ill patients admitted for an acute deterioration of their respiratory or cardiac condition. This might have underestimated the VE since the sensitivity analysis showed higher VE estimates in a more infection-specific subgroup. Fifth, residual confounding due to unmeasured factors such as ethnicity might have biased our estimates....

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.09.21266060
  108. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.08.21266035
    1
    1. sciscore 14 Nov 2021

      SciScore for 10.1101/2021.11.08.21266035: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study protocols were approved by the Central Adelaide Clinical Human Research Ethics Committee (#13050) and the Women’s and Children’s Health Network Human research ethics (protocol HREC/19/WCHN/65), Adelaide, Australia.<br>Consent: All participants provided written informed consent in accordance with the Declaration of Helsinki and procedures were carried out following the approved guidelines.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">In this study, whole blood specimens from 43 participants (19 male, 24 female) of (95% CI, 44.8-55.4) years of age (figure S1) who presented mild COVID-19 symptoms according to NIH guidelines (https://www.covid19treatmentguidelines.nih.gov/overview/clinical-spectrum/) were sampled and processed at two time points 6 months apart after PCR positive test.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Randomisation: Since all samples that were available in South Australia were used in the study, no randomisation was performed in the experiments.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Blinding: No experiments were blinded in this study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Statistics, replicates and sample-size estimation: All mild-COVID-19 patient samples available at the time points reported in the study from the South Australian cohort (n=43) were used in this study and, therefore, no pre hoc power calculations were carried out to determine the sample size.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies were diluted in 5% skim milk in PBST as follows: Goat anti-Human IgG (H+L) Secondary Antibody, HRP (1:30,000;</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Goat anti-human IgA HRP antibody (1:5,000; Sigma) and incubated for 1 hour at room temperature, followed by four washes with PBS-T.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were pre-treated with 0.555 µg/mL of anti-CD40 blocking antibody (HB14, Miltenyi Biotec) for 15 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD40</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant proteins were overexpressed in Expi293 cells (Thermo Fisher) and 72 hrs later purified by Ni-NTA affinity and size-exclusion chromatography.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">36 In brief, SARS-CoV-2 pseudo-particles were generated by co-transfecting expression plasmids containing SARS-CoV-2 Spike (kindly provided by Dr Markus Hoffmann)37 and the MLV gag/pol and luciferase vectors (kindly provided by Prof. Francois-Loic Cosset)38,39 in CD81KO 293T cells (kindly provided by Dr Joe Grove),40 using mammalian Calphos transfection kit (Takara Bio)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">41 293T-ACE2 cells were seeded 24 h earlier at 1.5 × 104 cells per well in 96-well white flat-bottom plates (Sigma-Aldrich).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed, resuspended in FACS wash buffer and the data acquired on BD FACSAria™ III.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD FACSAria™</div><div>suggested: (BD FACSAria II Cell Sorter, RRID:SCR_018934)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis was performed using FlowJo version 10.7.1 (TreeStar).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">36 ID50 for serum was calculated using a non-linear regression model (GraphPad Prism).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were performed using GraphPad Prism 9.0.0 (San Diego, CA, US).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      One caveat of these studies is that high rates of transmission of SARS-CoV-2 in the communities where the studies were conducted (e.g. Italy, UK or USA) increased the likelihood of virus re-exposure in that cohort, precluding the ability to draw firm conclusions on the duration and protective effects of primary SARS-CoV-2 immunity. Controlled, in-depth studies in convalescents have also been conducted, but vaccination and almost ubiquitous high SARS-CoV-2 infection rates have reduced the opportunities to recruit convalescents long after COVID-19 disease, and importantly, in the absence of re-infection. Conversely, vaccination programs allow for more controlled studies and deeper immune analysis and facilitate conducting experimental procedures to test immune fitness against VoC. However, to date, the majority of vaccinees have received Spike-based vaccines, which are not well-suited as a proxy for what SARS-CoV-2 immunity may look like in the long-term, or its adaptability to VoC. Here, we have taken advantage of the relatively unique situation in South Australia, where local transmission of SARS-CoV-2 was eliminated early on in the pandemic in 2020, enabling us to conduct a 12-month longitudinal study of SARS-CoV-2 immunity in mild-COVID-19 convalescents and test their immune fitness against the current VoC. Total RBD IgG titers and other circulating Ig isotypes against SARS-CoV-2 Spike and RBD antigens decrease over the months following COVID-19 disease, with the strongest ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.08.21266035
  109. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.06.21265955
    1
    1. sciscore 14 Nov 2021

      SciScore for 10.1101/2021.11.06.21265955: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.06.21265955
  110. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.11.21266209
    1
    1. sciscore 14 Nov 2021

      SciScore for 10.1101/2021.11.11.21266209: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed using instrument software, graph pad prism 5.0, Microsoft excel.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.11.21266209
  111. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.08.21266047
    1
    1. sciscore 13 Nov 2021

      SciScore for 10.1101/2021.11.08.21266047: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The Cantonal Ethics Committee of Bern approved the study (Study ID: 2020-00830).<br>Consent: Informed consent to participate is provided online at the time of registration into the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All data were entered in a Research Electronic Data Capture (REDCap) database developed at Vanderbilt University (www.project-redcap.org) (29), which is securely hosted by the Swiss medical registries and data linkage centre (SwissRDL) at the University of Bern, Switzerland. Information about COVID-19 vaccinations: The special questionnaire on COVID-19 vaccinations asked whether participants had already been vaccinated and if yes which vaccine they received (supplementary table 1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used STATA version 15 for statistical analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Strengths and limitations: A major strength of this study is the large sample size of people with PCD from all over the world. PCD is a rare disease, and it can be difficult to recruit participants for research studies. COVID-PCD is a participatory study that was initiated, designed, and tested in collaboration with people who have PCD. This helped to boost study participation. The PCD support groups advertised the special questionnaire on COVID-19 vaccinations via social media and email networks before it was sent out, which may have positively affected the response rate. The questionnaire was completed in five languages which ensured that few people were restricted by language barriers. A limitation is that the study population may not be representative for all people with PCD but mainly those who are in contact with a patient support group. It is difficult to ascertain representativeness of the study population as we have no information about people with PCD who do not participate in the COVID-PCD study. When we compare those who completed the special questionnaire on vaccinations (61%) to those who did not (41%), we see that non-responders were slightly younger than those who responded and more often came from non-European countries (supplementary table 2). It is possible that respondents were more vaccine-willing than non-responders, which would have led to an overestimate of the vaccine uptake. Another limitation is that the sample size, although large for a rare diseas...

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04602481</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">COVID-19 in People With Primary Ciliary Dyskinesia</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.08.21266047
  112. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.09.21264627
    1
    1. sciscore 13 Nov 2021

      SciScore for 10.1101/2021.11.09.21264627: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This anonymous data was then solicited through the North Central Regional Health Authority via the Ethics Committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.09.21264627
  113. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.09.21266140
    1
    1. sciscore 13 Nov 2021

      SciScore for 10.1101/2021.11.09.21266140: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Similar findings were recently reported by Zimmerman and colleagues, who found a higher number of COVID-19 clusters among students attending private schools, compared to those in public schools.(14) Limitations: There are several limitations of this study to consider. First, the data were retrospectively reviewed for this report. Although detailed data were collected at each school throughout the school year, the final data were not adjudicated until the time of this analysis. Some cases may have gone undiagnosed or unreported during the study period, particularly if they were asymptomatic or only mildly symptomatic and not tested for SARS-CoV-2, which is more common among younger children.(1) Second, data from Davidson County, which were used as a comparator group may not reflect the current distribution of school-aged children in Tennessee, given their reliance on 2019 census data, and may underestimate the rate of COVID-19 among school-aged children given their reliance on passive surveillance. Surveillance data commonly underreports disease activity, given reliance on passive data collection, which may explain why we see a slightly higher rate of COVID-19 reported to the two independent schools, where active case finding occurred. Finally, data for this study were collected through early February 2021, prior to widespread rollout of COVID-19 vaccinations and when there were limited local data on variants of concern. It is not yet clear what impact household and teacher va...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.09.21266140
  114. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.08.21266075
    1
    1. sciscore 13 Nov 2021

      SciScore for 10.1101/2021.11.08.21266075: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.08.21266075
  115. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.09.21265912
    1
    1. sciscore 13 Nov 2021

      SciScore for 10.1101/2021.11.09.21265912: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Trial design: This phase 2, randomised, double-blind, placebo-controlled, parallel-group, dose-ranging study (NCT04666441) was conducted at 47 sites across the USA (see appendix 1 for a full list of the study sites and investigators and appendix 2 for the Regeneron study team).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Healthcare providers, patients and their caregivers were blinded to placebo and the doses of REGEN-COV drug but not to the route of administration.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Statistical analysis: It was estimated that a sample size of 57 patients per treatment group would provide 98% power to detect a difference of –0·73 log10 copies/mL (assuming a standard deviation [SD] of 0·948) between any active treatment group and pooled placebo (IV and SC).</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04425629</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Safety, Tolerability, and Efficacy of Anti-Spike (S) SARS-Co…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04452318</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">COVID-19 Study Assessing the Efficacy and Safety of Anti-Spi…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04666441</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">COVID-19 Study Assessing the Virologic Efficacy of REGN10933…</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.09.21265912
  116. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.05.21265656
    1
    1. sciscore 13 Nov 2021

      SciScore for 10.1101/2021.11.05.21265656: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Patients were randomized 1:1:1 to 2.4 g REGEN-COV (1.2 g casirivimab and 1.2 g imdevimab), 8.0 g REGEN-COV (4.0 g casirivimab and 4.0 g imdevimab), or placebo as a single intravenous dose.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The absence of full representation across the spectrum of hospitalized patients on varying degrees of oxygen support is a limitation of this study. Additionally, this study was prematurely terminated due to slow recruitment prior to the current surge associated with the emergence of the Delta variant. As a result of the smaller sample size, key analyses pooled the two patient cohorts as well as the two doses. Sensitivity analyses did not reveal major efficacy differences across the cohorts or doses; minor variability in the magnitude of risk reductions, with greater effects for the 2.4 g dose compared to the 8.0 g dose, was likely due to small numbers within each group suggesting that either dose can be utilized in hospitalized individuals requiring low-flow or no supplemental oxygen. Overall, trends for treatment benefit on mortality and other efficacy endpoints extend the observations in the larger RECOVERY trial, where benefit was seen in all patients regardless of respiratory status. Authorized options for intervention with a monoclonal antibody anti-viral treatment have been restricted to outpatients with Covid-19 or as post-exposure prophylaxis.5-7 Taken together with reports from the RECOVERY trial, these data support REGEN-COV representing a well-tolerated and compelling treatment option to reduce the risk of mortality in hospitalized Covid-19 patients and across the disease continuum of SARS-CoV-2, from prevention to hospitalization.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04426695</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Safety, Tolerability, and Efficacy of Anti-Spike (S) SARS-Co…</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.05.21265656
  117. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.10.21266084
    1
    1. sciscore 13 Nov 2021

      SciScore for 10.1101/2021.11.10.21266084: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.3.8 2021-04-20); b) principal analysis (release 609, PANGO v3.0.5 2021-06-04); and c) final update (release 829, PANGO v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PANGO</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The R version of SWeeP tool, used for the proteome vectorization, is available in the Bioconductor Platform4 for R version 3.12 (25).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bioconductor</div><div>suggested: (Bioconductor, RRID:SCR_006442)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The same orthonormal base, with the SWeeP default parameters (length 600 and mask [1 1 0 1 1]), was employed to project all sequences into compacted vectors.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SWeeP</div><div>suggested: (SWEEP, RRID:SCR_009418)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cluster analysis and visualization: Brazilian proteomes were clustered using the ConsensusClusterPlus package version 1.54.0 from Bioconductor (26) and the kmedoids method (Partitioning Around Medoids, PAM), in procedures with 1,000 replicates for each cycle, testing 2-20 as the number of clusters.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ConsensusClusterPlus</div><div>suggested: (ConsensusClusterPlus, RRID:SCR_016954)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The t-SNE diagrams were constructed in the Rtsne package5, with its default parameters.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Rtsne</div><div>suggested: (Rtsne, RRID:SCR_016342)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.10.21266084
  118. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.09.21266110
    1
    1. sciscore 13 Nov 2021

      SciScore for 10.1101/2021.11.09.21266110: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants were informed about the aim of the study, and written informed consent was obtained from either the study participants themselves or from the legal guardian in case one had been appointed.<br>IRB: The study protocol has been approved by the ethics board of the University Hospital Frankfurt (No. 20-864) and has been registered on the German Clinical Trial Register (DRKS00025813).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All participants with a known and confirmed SARS-CoV-2 infection in the past or a positive anti-SARS-CoV-2 nucleocapsid antibody test were excluded from the main analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 nucleocapsid</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HCWs with a known SARS-CoV-2 infection in the past or a positive anti-SARS-CoV-2 nucleocapsid antibody titer were excluded.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Markers of the humoral immune response: Anti-SARS-CoV-2 Nucleocapsid Antibody Assay: To determine whether a previous infection with SARS-CoV-2 had occurred, serum samples were tested for the presence of anti-SARS-CoV-2 nucleocapsid antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 nucleocapsid antibodies.</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-SARS-CoV-2 Spike IgG Antibody Assay: Serum samples were tested for the presence of anti-SARS-CoV-2 Spike IgG antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 Spike IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">16 In brief, serum samples were serially diluted (1:2) and incubated with 4000 TCID50/mL of the Delta variant of SARS-CoV-2 (B.1.617.2) for one hour prior to infection of CaCo-2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CaCo-2</div><div>suggested: CLS Cat# 300137/p1665_CaCo-2, RRID:CVCL_0025)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Markers of the humoral immune response: Anti-SARS-CoV-2 Nucleocapsid Antibody Assay: To determine whether a previous infection with SARS-CoV-2 had occurred, serum samples were tested for the presence of anti-SARS-CoV-2 nucleocapsid antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: (BioLegend Cat# 946101, RRID:AB_2892515)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For this, we used the AdviseDx SARS-CoV-2 IgG II assay on the Abbott Alinity i® platform (Abbott Laboratories, Abbott Park, Illinois, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott Laboratories</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Data analysis was performed using RStudio Version 1.4.1717.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RStudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Additional limitations of our study include that break-through infections in group 3 occurred at diverse time points before blood samples were taken. In addition to age, immunogenicity and efficacy of vaccines may be influenced and suppressed by several factors, including other medical conditions, and body composition with a very low or high BMI.18 Analyses of these factors in our study cohort will be provided in a subsequent publication.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.09.21266110
  119. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.05.21265977
    1
    1. sciscore 13 Nov 2021

      SciScore for 10.1101/2021.11.05.21265977: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.05.21265977
  120. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.07.21266001
    1
    1. sciscore 12 Nov 2021

      SciScore for 10.1101/2021.11.07.21266001: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was conducted with the approval of the Ethics Committee of the University of Occupational and Environmental Health (approval number R2-079).<br>Consent: Informed consent was obtained through a form on the survey website.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations of this study: First, because this study was conducted on Internet users, the degree to which the results are generalizable is unclear. To reduce bias, we sampled based on region, job type and prefecture according to the rate of infection. Second, whether or not participants felt lonely was determined using one question: “During the last 30 days, how often did you feel the following emotions?” Further studies using less subjective assessments of loneliness are needed to confirm our findings. Third, we were unable to assess the severity of sleep problems as we did not use the insomnia rating scale. Finally, because this was a cross-sectional study, we could not determine the temporal link between loneliness and sleep-related problems.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.07.21266001
  121. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.08.21266033
    1
    1. sciscore 12 Nov 2021

      SciScore for 10.1101/2021.11.08.21266033: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.08.21266033
  122. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.09.21266145
    1
    1. sciscore 12 Nov 2021

      SciScore for 10.1101/2021.11.09.21266145: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">AB and ERR were analyzed with a paired t-test/ANOVA with α level set at .05.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AB</div><div>suggested: RRID:BDSC_203)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      As a limitation of the chosen approach, feedback from the patient scale back to the population scale (e.g. how immunomodulation can reduce viral shedding and thus transmission) is more challenging to implement. Additionally, no data are available to calibrate the OM-85 effect on viral shedding or the efficacy under lockdown. Therefore, we needed to assume that both treatment effect and transmission are independent factors. The central aspect of this work is to determine, rationalize and interpret the possible changes induced by lockdown and other NPIs for pandemic containment on respiratory disease trials with emphasis on RTI prophylaxis. A clinical trial has two general objectives: first, to demonstrate non-zero efficacy of the interventional strategy, a binary question with a binary answer given by a statistical test; second, to estimate the size of the clinical benefit for benefit-risk assessment. Well-designed trials fulfil both objectives through characterizing the efficacy with a quantitative measure. Not always, however, are common efficacy measures equally suitable for statistical testing and estimation of the clinical effect size. In recurrent RTIs, the event rates ratio (ERR) is often used for statistical hypothesis testing as this measure applies to negative binomially distributed count data39,40. Nevertheless, a measured treatment efficacy that is relative to the control group event rate, is at-risk of incompletely representing the clinical benefit, in case of low...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.09.21266145
  123. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.08.21265884
    1
    1. sciscore 12 Nov 2021

      SciScore for 10.1101/2021.11.08.21265884: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Participating Patients: The study included patients of either sex, aged between 21 (age of giving informed consent in Kuwait) and 80 years (both inclusive) who had tested positive for SARS-CoV-2 by real-time Reverse Transcriptase Polymerase Chain Reaction (rRT-PCR) assay on a nasopharyngeal or oropharyngeal swab, were clinically assessed to have moderate or severe COVID-19 and were hospitalized for management.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Other main exclusion criteria were patients who had allergy or contraindication to the drug, pregnant and lactating mothers, and patients with congestive cardiac failure, moderate to severe hepatic dysfunction or renal failure, alanine aminotransferase (ALT) and/or aspartate aminotransferase (AST) levels > 5 times upper limit of normal (ULN) at screening evaluation, serum uric acid higher than the ULN at screening evaluation, those with history of gout or were on current treatment for gout.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">This was a prospective, interventional, multicentre, randomised (1:1), double-blind, placebo-controlled, parallel design phase 3 trial to evaluate the efficacy, safety and tolerability of favipiravir (FPV) with supportive care (SoC) in comparison to placebo with SoC in the acute treatment of hospitalized patients who tested positive for SARS-CoV-2 and presented with moderate to severe COVID-19.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Statistical Methods: Inequality testing of the hazard ratio using the Cox proportional hazards (CPH) regression model with 371 subjects in Favipiravir group and 371 subjects in Placebo group achieved 80% power at the 0.05 significance level for an actual hazard ratio of 1.25 assuming the hazard ratio is 1 under the null hypothesis and that the total number of events achieved is 631.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SAS® package, Version 9.4, was used for statistical evaluation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS®</div><div>suggested: (SASqPCR, RRID:SCR_003056)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Despite the limitation, the present study showed trends suggesting that FPV is associated with better clinical outcomes in some subgroups of patients (younger age, lower BMI, and lower baseline clinical risk based on NEWS-2) with tolerability and safety of FPV being comparable to placebo.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04529499</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Clinical Trial Evaluating the Efficacy and Safety of Favipir…</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.08.21265884
  124. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.05.21265962
    1
    1. sciscore 12 Nov 2021

      SciScore for 10.1101/2021.11.05.21265962: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was conducted with the approval of the Ethics Committee of the University of Occupational and Environmental Health, Japan (Approval number R2-079).<br>Consent: Informed consent was obtained through the questionnaire website.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations of this study: This study had several limitations. First, because this study was conducted using Internet monitors, generalizability of the results is unclear. However, we attempted to minimize subject bias as much as possible by sampling by region, occupation, and prefecture based on the incidence of infection. Second, we used a self-reported assessment of alcohol consumption in this study. Given that research has shown that drinkers tend to underreport their alcohol consumption,28 it is possible that the same occurred in this study. However, we think that underreporting was relatively unlikely because we used an anonymous survey conducted on the Internet. Third, we determined participants’ loneliness using one question based on previous studies.29 Further studies using other assessment methods are needed to confirm our results.30,31

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.05.21265962
  125. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.05.21265961
    1
    1. sciscore 12 Nov 2021

      SciScore for 10.1101/2021.11.05.21265961: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This study has some limitations. To control for patient-specific covariates that may impact symptoms experienced after vaccination, we have only considered cohorts of patients that received exactly three doses of mRNA-based COVID-19 vaccines. No comparison between the adverse events reported in the BNT162b2 and mRNA-1273 cohorts should be made, as these cohorts differ in potentially confounding factors, including in the relative rate of immunosuppressed individuals (Table S1). The cohorts are also less likely to include individuals that had strong adverse reactions to earlier doses of mRNA-based COVID-19 vaccines, as such individuals are more likely to opt out of additional vaccination.15 Indeed, analysis of individuals that received exactly one dose of an mRNA-based COVID-19 vaccine showed a significantly greater RD of adverse events after dose one, compared with baseline, than what is observed in the 3-dose cohort (Figure S4). Additionally, a large proportion in the 3-dose cohort is immunosuppressed and of advanced age (Table 1), potentially reducing their immune reaction to vaccination and associated adverse events; and resulting in lower prevalence of adverse events that are more prevalent in younger individuals (i.e., myocarditis). This means that our conclusions on the safety of additional dose vaccination with BNT162b2 or mRNA-1273 apply specifically to individuals that are included in this cohort, opted to receive additional COVID-19 mRNA vaccine dose of the same type...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.05.21265961
  126. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.04.21265951
    1
    1. sciscore 12 Nov 2021

      SciScore for 10.1101/2021.11.04.21265951: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.04.21265951
  127. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.10.21266166
    1
    1. sciscore 12 Nov 2021

      SciScore for 10.1101/2021.11.10.21266166: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.10.21266166
  128. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.01.21260020
    1
    1. sciscore 12 Nov 2021

      SciScore for 10.1101/2021.11.01.21260020: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.01.21260020
  129. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.05.21265969
    1
    1. sciscore 12 Nov 2021

      SciScore for 10.1101/2021.11.05.21265969: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The research was approved by the Medical Bioethics Committee, Faculty of Medical Sciences, National University of La Plata, Argentina, reference N°101/21.<br>Consent: Informed consent was obtained from all individual participants included in the study, data were anonymized to preserve confidentiality.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">No power analysis was performed.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analysis was done employing SPSS Statistics, Version 24 (IBM, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The small sample of the survey may be considered as a limitation of this research. At present, COVID-19 pandemic is getting worse with a record number of incidence and deaths; about 12.7% of the total population has received at least one dose of a COVID-19 vaccine, and only 1.8% fully vaccinated (https://ourworldindata.org/coronavirus/country/argentina, accessed 23 April 2021); in addition, the authorities renewed restrictions.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.05.21265969
  130. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.05.21265992
    1
    1. sciscore 12 Nov 2021

      SciScore for 10.1101/2021.11.05.21265992: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.05.21265992
  131. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.08.21266099
    1
    1. sciscore 12 Nov 2021

      SciScore for 10.1101/2021.11.08.21266099: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.08.21266099
  132. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.08.21266091
    1
    1. sciscore 12 Nov 2021

      SciScore for 10.1101/2021.11.08.21266091: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We develop a matlab code to extract patient likelihood factors such as the percentage of patients being admitted to ICU, the percentage of patients being admitted to hospital but not to the ICU, etc. from the available database.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>matlab</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.08.21266091
  133. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.08.21265966
    1
    1. sciscore 12 Nov 2021

      SciScore for 10.1101/2021.11.08.21265966: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical Considerations: The Walter Sisulu University Ethics Committee granted approval for the implementation of the study (Reference: 087/2020), as well as the Eastern Cape Provincial Department of Health and local hospitals ethics committee.<br>Consent: Each participant provided written informed consent for the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">There was no sample size calculation performed, but rather as many staff recruited as possible within the budgeted time frame for the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Certain comorbidities (diabetes, hypertension, HIV, Tuberculosis, Chronic kidney disease, heart disease, Asthma/Chronic obstructive pulmonary disease, liver disease, cancer, pregnancy) or immunosuppressive therapy, that have been shown to increase the risk of acquiring SARS-CoV-2 were explored in the questionnaire.2,8,13,15,19 A prior SARS-CoV-2 diagnosis was self-reported by the participants and validated through the OHS personnel database in each hospital.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All blood samples were tested for the IgG antibodies against SARS-CoV-2 nucleocapsid protein by the National Health Laboratory Services in accordance with standard protocols.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 nucleocapsid protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To link the results of SARS-CoV-2 PCR tests recorded on the OHS databases with the SARS-CoV-2 IgG antibody tests, while maintaining confidentiality, a unique identifying number was used to encode the participants’ details (names, date of birth and area of work) in the research register, which was accessible only to the investigators.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The proportion of HCWs with either a SARS-CoV-2 PCR diagnosis or positive IgG antibodies, or both, were reckoned as cumulative incidence in the study.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>positive IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">e measures: Serum samples were analysed on an Abbott ARCHITECT i1000SR instrument using the Abbott SARS-CoV-2 IgG assay in accordance with the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis: Data were exported from the REDCap® online database for analysis using the IBM SPSS version 25.0 software (IBM SPSS, Chicago, Illinois) after cross-checking for completeness and accuracy.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.08.21265966
  134. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.08.21266049
    1
    1. sciscore 12 Nov 2021

      SciScore for 10.1101/2021.11.08.21266049: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics approval was obtained from the Human Research Ethics Committees of the University of the Witwatersrand (ethics reference number: M210465), University of Pretoria (ethics reference number: 247/2020) and University of Cape Town (ethics reference numbers: 190/2020 and 209/2020).<br>Consent: Written informed consent was obtained from all participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monoclonal antibodies CB6 and CA1 were used as positive controls.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CA1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody-dependent cellular cytotoxicity (ADCC) assay: The ability of plasma antibodies to cross-link spike expressing cells and signal through FcγRIIIa (CD16) was measured as a proxy for ADCC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD16</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 antigens: For ELISA, SARS-CoV-2 original variant (D614G) full spike proteins were expressed in Human Embryonic Kidney (HEK) 293F suspension cells by transfecting the cells with the respective expression plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T/17 cells (HEK293T cell line) were co-transfected with a SARS-CoV-2 spike plasmid in conjunction with a firefly luciferase encoding lentivirus backbone plasmid (pNL4-3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T/17</div><div>suggested: ATCC Cat# CRL-11268, RRID:CVCL_1926)</div></div><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Jurkat-Lucia™ NFAT-CD16 cells (Invivogen) (2×105 cells/well) were added and incubated for 24 hours at 37°C, 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NFAT-CD16</div><div>suggested: RRID:CVCL_A7ZT)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike plasmid and lentiviral pseudovirus production: The SARS-CoV-2 Wuhan-1 spike gene sequence, cloned into pcDNA3.1, was mutated using the QuikChange Lightning Site-Directed Mutagenesis kit (Agilent Technologies) and NEBuilder HiFi DNA Assembly Master Mix (New England Biosciences) to include D614G (ancestrall) or lineage defining mutations for Beta (L18F, D80A, D215G, Δ242-244, K417N, E484K, N501Y, D614G and A701V), Gamma (L18F, T20N, P26S, D138Y, R190S, K417T, E484K, N501Y, D614G, H655Y, T1027I, V1176F), Delta (T19R, Δ156-157, R158G, L452R, T478K, D614G, P681R, D950N), C1.2. (P9L, C136F, Δ144, R190S, D215G, Δ242-243, Y449H, E484K, N501Y, D614G, H655Y, N679K, T716I, T859N) and A.VOI.V2 (D80Y, Δ144, I210N, Δ211, D215G, R246M, Δ247-249, W258L, R346K, T478R, E484K, H655Y, P681H, Q957H).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T/17 cells (HEK293T cell line) were co-transfected with a SARS-CoV-2 spike plasmid in conjunction with a firefly luciferase encoding lentivirus backbone plasmid (pNL4-3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNL4-3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Analyses were performed in Prism (v9; GraphPad Software Inc, San Diego, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.08.21266049
  135. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.08.21266087
    1
    1. sciscore 12 Nov 2021

      SciScore for 10.1101/2021.11.08.21266087: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">(13) No imputations were made for 2% of hospitalisations that had missing data, which were assumed to be randomly distributed.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This observational study has the well-known limitations of non-randomised, non-blinded trials including selection biases, such as the early vaccination of older people in Costa Rica (which biased the crude VEH estimates, as shown in this study), and other confounders such as the risk-taking behaviour modification of some individuals after vaccination. The VEH estimates in this study should be interpreted as associations between vaccination status and hospitalisation rather than the true causal effects of vaccination. A more specific limitation of the method used in this study is that it requires high-quality data of the population count to obtain a valid estimation of the number of unvaccinated individuals. Errors in the population count affects the number of people who have not been vaccinated, especially as the vaccination coverage approaches 100%, as is the case for the older adults in Costa Rica. However, it must be noted that Costa Rica is considered to have accurate demographic data.(16) The lack of specific results for each brand of vaccines used in Costa Rica, as well as the lack of estimates of the vaccine effectiveness to prevent COVID-19, may also be limitations to the interpretation of these study results. Conclusions and policy implications: The Costa Rican vaccination programme, based on the Pfizer and Oxford vaccines, is highly effective to prevent COVID-19-related hospitalisations even after the Delta variant had become dominant. Completing the two-dose scheme...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.08.21266087
  136. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.09.21266054
    1
    1. sciscore 12 Nov 2021

      SciScore for 10.1101/2021.11.09.21266054: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Debiased prevalence estimates are obtained as output of the methodology developed in Nicholson et al. (10) which combines PCR Pillar 2 testing data with randomised surveillance data from the Real-time Assessment of Community Transmission (REACT)3 study (11)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A limitation of our study is that the demographic data considered may not fully represent the structure of the population at the time of analysis. For local population sizes, we used mid-year population estimates from 2020 as reference (the most up-to-date available at the time of the study), hence neglecting any changes occurring during the time of the analysis. More critically, we retrieved the proportion of BAME population from the 2011 Census (the most up to date source available at the time of the study). We work under the implicit assumption that the ethnic composition of LTLAs has not changed drastically, but we cannot verify this. Additionally, this study shows an area-level association between inequalities and SARS-CoV-2 infection burden. Given that we consider aggregated data, the analysis may suffer from ecological bias (17) (18). Our ecological framework is similar to (8) but we focus on SARS-CoV-2 infections rather than mortality and, crucially, adjusts for spatiotemporal dependence in the residuals, a necessary adjustment for obtaining correct estimates of the precision of the effect of deprivation and ethnicity (19). Additionally, while Rose et al. focus on the first wave of the pandemic (8), we consider a longer time period. Our results are consistent with other findings of higher test positivity for BAME groups, but the dynamic nature of our analysis allows us to evaluate how this effect changes during the different phases of the pandemic. Additionally, by co...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.09.21266054
  137. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.08.21266055
    1
    1. sciscore 12 Nov 2021

      SciScore for 10.1101/2021.11.08.21266055: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: & Ethical Declaration: An Institutional Review Board (IRB) on Human Subjects was constituted following the guidelines of the Indian Council for Medical Research (ICMR).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The secondary antibody (anti mouse IgG/IgM/IgA-HRP conjugated, Sigma, USA) in a 1:5000 dilution was then added to each well and incubation was done at room temperature for 45 minutes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti mouse IgG/IgM/IgA-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Since human ACE-2 is tagged with mouse Fc for its binding to anti-mouse secondary antibody, the secondary antibody (anti mouse IgG-HRP conjugated, Sigma USA) was added in 1:5000 dilution to the wells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti mouse IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were analyzed by distribution plot with Graph Pad Prism version 8.3.1 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graph Pad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.08.21266055
  138. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.05.21265998
    1
    1. sciscore 12 Nov 2021

      SciScore for 10.1101/2021.11.05.21265998: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: For those who expressed interest, further sessions were arranged at a mutually convenient time to discuss the study in more detail, explaining the aims, methods, ethical considerations, potential risks, and a recourse to withdrawal of consent at any stage.<br>IRB: The discussion topics were generated based on a pilot run and around the practical issues that mattered the most to all staff around that time Governance: This study was approved by the Central Adelaide Local Health Network, Human Research Ethics Committee (Reference number 13363).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.05.21265998
  139. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.08.21266083
    1
    1. sciscore 12 Nov 2021

      SciScore for 10.1101/2021.11.08.21266083: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Amplicons were purified using QIAquick PCR Purification Kit (Qiagen), quantified using Qubit fluorometer, and subject to library preparation using Nextera XT kit and sequencing on MiSeq.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MiSeq</div><div>suggested: (A5-miseq, RRID:SCR_012148)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.08.21266083
  140. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.05.21265958
    1
    1. sciscore 12 Nov 2021

      SciScore for 10.1101/2021.11.05.21265958: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics: Ethical approval for this study was granted by Regional Committees for Medical Research Ethics - South East Norway, reference number 249509.<br>Consent: The need for informed consent was waived by the ethics committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our study also has limitations. While we have controlled for several important confounders, the potential for residual confounding must be acknowledged, given the observational nature of the study. Also, the small number of vaccinated patients in some analyses must be considered, and we were not yet able to conduct more detailed analyses of different vaccine parameters, such as vaccine type, time since vaccination and dose intervals. However, our results were robust when we restricted our analysis to vaccinated patients with no more than 150 days between date of last dose and positive test. Another limitation is that some of our reported underlying risk factors do not distinguish potential differences within groups, for example whether risk factors are well-regulated or treated. Also, 38% of patients had unknown body mass index. Our model may therefore not fully adjust for certain underlying risk factors. We were also not able to adjust for care home residents, who may receive healthcare for severe COVID-19 partially or fully outside a hospital setting. This is particularly relevant for our cohort of patients ≥80 years. Finally, previous natural infection is associated with a high level of protection against SARS-CoV-2 reinfection (28, 29), and while we dropped one reported reinfection, we cannot rule out that there were other previously undiagnosed SARS-CoV-2 infections in our unvaccinated cohort. If present, this would bias the association between vaccination and our outcom...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.05.21265958
  141. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.06.21266016
    1
    1. sciscore 12 Nov 2021

      SciScore for 10.1101/2021.11.06.21266016: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Published literature before August 15, 2021 were searched by J.P. in PubMed, Scopus, Web of Science, Embase and the Cochrane library, using the search words “(Pfizer-BioNTech COVID-19 Vaccine) and (BNT162b2) and (Pfizer–BioNTech) and (SARS-CoV-2 or COVID-19 or 2019–nCoV) and (Vaccine) and (12 - 15 years) and (Adverse Events or Safety) and (Efficacy)”.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div><div style="margin-bottom:8px"><div>Embase</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div><div style="margin-bottom:8px"><div>Cochrane library</div><div>suggested: (Cochrane Library, RRID:SCR_013000)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our research has a few limitations: First, our findings are based on very limited studies because the EUA for the BNT162b2 Vaccine in the age group of 12 to 15 years has been extended on May 10, 2021. Second, this study includes only short-term safety data for the BNT162b2 vaccine. Long-term safety data for the BNT162b2 vaccine in the age group of 12 to 15 years are not available. Third, v-safe safety data are taken into account for post-authorization observational studies. v-safe is a voluntary self-enrolment programme promoted by vaccine administrators that requires children aged below 15 years to be enrolled by a parent or guardian. As a result, v-safe data has some limitation to be generalizable to the entire population of vaccinated adolescents.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.06.21266016
  142. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.05.21265911
    1
    1. sciscore 12 Nov 2021

      SciScore for 10.1101/2021.11.05.21265911: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The institutional review board (WCG IRB, Puyallup, WA; IRB tracking number 20212896) found that this research met the requirements for a waiver of consent under 45 CFR 46 116(f) and 45 CFR 46.116(d).<br>Consent: All patients provided written informed consent before receiving treatment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.05.21265911
  143. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.08.21266069
    1
    1. sciscore 12 Nov 2021

      SciScore for 10.1101/2021.11.08.21266069: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was also approved by Yale Human Research Protection Program Institutional Review Boards (FWA00002571, protocol ID 2000027690, 2000029277).<br>Consent: Informed consent was obtained from both the patient and healthcare workers</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: The cell line was obtained from the ATCC and has been tested negative for contamination with mycoplasma.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry: As described previously, antibody clones and vendors used for flow cytometry analysis were as follows: BB515 anti-hHLA-DR (G46-6) (1:400</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-hHLA-DR ( G46-6 )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed three times with PBS-T (PBS with 0.1% Tween-20) and 50 μl of HRP anti-Human IgG Antibody (GenScript #A00166, 1:5,000) diluted in dilution solution added to each well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Diluted NP samples were added on a monolayer of Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">15 μg of each mutant transcript was electroporated into BHK cells using the Electro Square Porator Device (BTX)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK</div><div>suggested: RRID:CVCL_HA32)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Electroporated cells were seeded into a T75 flask containing 1:2 ratio of BHK-N:Vero-E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-N:Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Replication kinetics of icSARS-CoV-2 mutants: Isolates from initial stocks were expanded and used to infect Vero-E6 cells with 0.01 MOI of each E802D and E802A mutant virus to assess their replication kinetics.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This study was also approved by Yale Human Research Protection Program Institutional Review Boards (FWA00002571, protocol ID 2000027690, 2000029277).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Yale Human Research Protection Program</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Variants were examined longitudinally with a modified Python script adapted from LAVA (https://github.com/greninger-lab/lava).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analysed using FlowJo software version 10.6 software (Tree Star).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.08.21266069
  144. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.05.21265900
    1
    1. sciscore 12 Nov 2021

      SciScore for 10.1101/2021.11.05.21265900: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Independent variables were grouped into four blocks: Statistical analyses: Data from the online questionnaires were analyzed using SPSS 26 software, where explicit identifiers were replaced by coded pseudo-identifiers.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Nevertheless, it is important to recognize this study’s limitations when interpreting the reported results. First, this study was conducted in Israel, and therefore its findings might not necessarily generalize to other countries. Nevertheless, previous studies evaluating vaccination intentions in Israel were found to have consistent trends with those of studies in other countries, and I believe that this study will not be different. Second, our participants were sampled from an online panel so it may miss, inherently, respondents who do not have regular access to the internet. Third, our sample included only the Jewish adult population in Israel, and it did not include the Arab population. Further research should be devoted to reach and include these subpopulations. Conclusions: This study provides up-to-date information on the rates of the intention of parents to vaccinate their 5-11 years old children, how soon they intend to do so, and the predictors of those intentions, which is essential for health policy makers and healthcare providers for planning vaccination campaigns. Moreover, as vaccine safety and side effects were found to be key parental concerns, it is important to release post-approval safety data regarding the vaccine to the public as soon as such becomes available. Finally, our findings underscore the important role of vaccine accessibility and receiving a ‘green pass’ over other incentives in promoting parents’ intentions to vaccinate their children.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.05.21265900
  145. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.08.21265312
    1
    1. sciscore 12 Nov 2021

      SciScore for 10.1101/2021.11.08.21265312: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: We assessed 270 previously described comorbidities14, across 16 clinical specialities / organ systems, using validated CALIBER phenotypes and data records from 1st of January 1996 until 31st December 2019 from primary care, hospitalisation and procedure data14 (Supplementary Figure 3).</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A Reporting of studies Conducted using Observational Routinely-collected Data (RECORD) statement can be found in the supplement.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RECORD</div><div>suggested: (RECORD, RRID:SCR_009097)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data cleaning, exploratory analysis, phenotype creation and cohort assembly was performed using Python (3.7) and Spark SQL (2.4.5) on Databricks Runtime 6.4 for Machine Learning.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis was performed in RStudio (Professional) Version 1.3.1093.1</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RStudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Figures were constructed using ggplot2 (3.3.3), VennDiagram (1.6.20), igraph (1.2.6), survival (3.2.7) and survminer (0.4.8) packages.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div><div style="margin-bottom:8px"><div>VennDiagram</div><div>suggested: (VennDiagram, RRID:SCR_002414)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Strengths and limitations: A key strength of this work using national-scale data is that by definition it is representative of the general population across all age groups, ethnicities, deprivation levels and demographic characteristics. To our knowledge, this is the largest population-wide research study of COVID-19 phenotypes which includes: a) multiple healthcare settings through data linkage at a population level, b) detailed identification of specific ventilatory treatments, c) classification of COVID-19 related deaths, and d) exploration of transitions between COVID-19 events. Using multiple EHR sources spanning different healthcare settings, maximised infection ascertainment and reduced the effects of variable testing and data recording patterns (especially during the first wave). As the focus of this work was to create COVID-19 related phenotypes, and describe the characteristics of individuals experiencing them, we have not conducted multivariable regression analyses to control for confounders. The findings presented are therefore not associative statements and should not be interpreted as causal relationships. However by sharing reproducible phenotype definitions we hope to facilitate further work to address the questions raised in this and other COVID-19 studies exploring national level data, as exemplified by recent research17–19. Whilst our definitions of the pandemic waves differ from others, we believe using non-contiguous dates enabled a balanced comparison ac...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.08.21265312
  146. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.08.21266079
    1
    1. sciscore 12 Nov 2021

      SciScore for 10.1101/2021.11.08.21266079: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.08.21266079
  147. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.05.21265849
    1
    1. sciscore 12 Nov 2021

      SciScore for 10.1101/2021.11.05.21265849: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: We included adults with type 1 or type 2 diabetes, aged 18-80 years, who were diagnosed with diabetes prior to receiving a COVID-19 vaccine and willing to give written informed consent.<br>IRB: The study protocol was approved by the ethics committees of the Medical University of Graz (33-366 ex 20/21) and the Bayerische Landesaerztekammer (Nr. 21031) as well as registered at the European Union Drug Regulation Authorities Clinical Trials registry (EudraCT-Number 2021-001459-15).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A CE-marked serological test was used according to the manufacturers’ protocols to determine and quantify specific antibodies against SARS-CoV-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">According to Roche’s protocol 19 no converting factor is needed to calculate binding antibody units (BAU) per milliliter, which were retrospectively established for harmonization of different assays’ results and are traceable to the WHO international standard for anti-SARS-CoV-2 Ig 20.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 Ig 20</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our study results are in contrast to a recent observational study from Italy (CAVEAT study) that demonstrated a lower antibody response to COVID-19 vaccination in people with type 2 diabetes having an HbA1c above 7.0% (53 mmol/mol). This was accompanied by a reduced CD4pos T cell response measured by tumor necrosis factor-α, interleukin-2 or interferon-γ response 21. In contrast to our study the Italian study did not prospectively prespecify their diabetes cohort and HbA1c cut-off for the analyses according to the given registration record (NCT04746521). Although we predefined a cut-off of 7.5% (58 mmol/mol) to separate well from insufficiently controlled people with diabetes, the mean HbA1c levels observed in our cohort in the two groups (well and insufficiently controlled) are comparable to those in the Italian study. Another difference between the studies is the antibody assays used; while the CAVEAT study used the GenScript SARS-CoV-2 surrogate virus neutralization test we used the Roche Elecsys anti-SARS-CoV-2 S, that was also shown to correlate with neutralizing antibodies 22. Hence, in direct comparison studies, both assays have demonstrated good correlation with each other with an agreement rate of approximately 90% 23. In contrast to our study, Marfella et al. did not include people with type 1 diabetes 21, which is however of clinical relevance as it was unclear if the immune response to COVID-19 vaccination is determined by the underlying pathophysiology of diabete...

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04746521</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cellular-Mediated Immunity in COVID-19</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.05.21265849
  148. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.01.21265445
    1
    1. sciscore 12 Nov 2021

      SciScore for 10.1101/2021.11.01.21265445: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Two cleaned Fasta files were also uploaded onto SnapGene (version 5.3.2) for multisequence alignment via the MAFFT tool, and RAxML-NG version 0.9.0 [14] was used for subsequent phylogenetic analysis as described [15].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SnapGene</div><div>suggested: (SnapGene, RRID:SCR_015052)</div></div><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PyMol structural modeling: The PyMol molecular graphics system (version 2.4.2, https://pymol.org/2/) from Schrödinger, Inc. was used for downloading structure files from the PDB database for further analysis and image generation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structural images were cropped via Adobe Photoshop for further presentation through Illustrator.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Adobe Photoshop</div><div>suggested: (Adobe Photoshop, RRID:SCR_014199)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pandemic and vaccination data: Pandemic and vaccination data were downloaded from the Our World in Data website (https://ourworldindata.org/explorers/coronavirus-data-explorer?zoomToSelection=true&time=2020-03-01..latest&facet=none&pickerSort=desc&pickerMetric=total_cases&Metric=Confirmed+cases&Interval=Cumulative&Relative+to+Population=false&Align+outbreaks=false&country=∼OWID_WRL) as a .csv file for further processing via Excel and figure generation through Prism 9.0 and Adobe Illustrator.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>Adobe Illustrator</div><div>suggested: (Adobe Illustrator, RRID:SCR_010279)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.01.21265445
  149. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.08.21266037
    1
    1. sciscore 12 Nov 2021

      SciScore for 10.1101/2021.11.08.21266037: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study protocol was reviewed and approved by the Institutional Review Committee of the Sheikh Hasina National Institute of Burnand Plastic Surgery, Dhaka (approval memo number: SHNIBPS/July-14(09)).<br>Consent: Informed written consent was taken from each participant.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serological testing for CRP was done by Invitrogen CRP Human ELISA kit by ThermoFisher Scientific and antibodies to the RBD of the S1 subunit of the viral spike protein (IgG) was performed from the plasma samples using a commercially available Anti-SARS-CoV-2 ELISA kit(Diasino, China) as per instruction supplied by the manufacturer after getting the third dose by BNT162b2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>viral spike protein (IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 ELISA kit(Diasino</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The analysis was performed in Graphpad Prism 9.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations and Future Suggestions: This short sample size cannot produce generalizability. Therefore, subsequent clinical studies with larger sample sizes with different age group should be enclosed to confirm our findings.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.08.21266037
  150. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.05.21265978
    1
    1. sciscore 12 Nov 2021

      SciScore for 10.1101/2021.11.05.21265978: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: People with temporary status include people with work permits (including Temporary Foreign Workers), study permits, refugee claimants and convention refugees whose refugee claim was accepted but who do not yet have permanent residency.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.05.21265978
  151. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.06.21266007
    1
    1. sciscore 12 Nov 2021

      SciScore for 10.1101/2021.11.06.21266007: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The forecasts were formatted for submission to the CDC Forecast Hub and then submitted to their Github repository. D. Software and Algorithms: The real-time forecasting model was implemented using Python 3.6 in Jupyter notebooks.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Python packages used include NumPy [16], Pandas [17], scikit-learn [18], and XGBoost [9].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NumPy</div><div>suggested: (NumPy, RRID:SCR_008633)</div></div><div style="margin-bottom:8px"><div>scikit-learn</div><div>suggested: (scikit-learn, RRID:SCR_002577)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">“Population in Poverty” also had a high SHAP value, as did “Total Hospitals”, which line up with findings of past studies into the levels of transmission in areas with high poverty or areas with less access to healthcare.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Poverty”</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      One major limitation of many non-mechanistic models is the lack of causal inference. Integration of causal inference methods with machine learning in non-mechanistic models could improve the overall performance of the model. A second limitation is the lack of policy data integration with forecasting models. Datasets of policies and public health guidelines issued at the state and local-level could aid in the creation and advancement of forecasting models. With these policy datasets, conditional predictions could be standardized, where forecasts are generated depending on the policies that could be implemented. This improvement could increase the accuracy of forecasts as well as expand the potential impact of the forecasts on policy decisions.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.06.21266007
  152. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.05.21265968
    1
    1. sciscore 12 Nov 2021

      SciScore for 10.1101/2021.11.05.21265968: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics: The Virus Watch study has been approved by the Hampstead NHS Health Research Authority Ethics Committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">We used the Royal Mail Post Office Address File to generate a random list of residential address lists that were sent recruitment postcards, we placed social media adverts on Facebook and Twitter and sent SMS messages and letters to participants from their General Practitioners.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We measured antibody titres targeting the spike (S) protein (anti-S) in the context of seronegativity for SARS-CoV-2 anti-Nucleocapsid (anti-N) which is associated with natural infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Nucleocapsid</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">15 Individuals were included in this analysis if they underwent antibody testing (anti-N and anti-S) and had a valid result between 1st July 2021 and 24th October 2021.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-N</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used the estimated regression coefficient r from the linear model to calculate the corresponding half-life value associated with anti-S waning, using the formula: Second, to investigate the use of anti-S levels as a correlate of protection, we undertook a survival analysis using a Kaplan-Meier descriptive analysis in addition to a Cox regression model with individuals entering at risk of SARS-CoV-2 infection 14 days after an antibody test from 1st July and exiting at the first of reported episode of SARS-CoV-2 breakthrough infection or at the end of study follow up on 24th October 2021.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.05.21265968
  153. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.05.21265970
    1
    1. sciscore 12 Nov 2021

      SciScore for 10.1101/2021.11.05.21265970: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study protocol was approved by UTMB Institutional Review Board (20-0126) and the Texas Department of Criminal Justice (</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Eighty-nine randomly selected charts underwent evaluation by the principal investigators and the data extraction personnel.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: The REDCap dataset was downloaded to a database on SAS (Version 9.4</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our study has several limitations to acknowledge. The troponin was not included in our model because all subjects with abnormal troponin met the primary outcome. Elevated troponin suggested myocardial injury which can be due to a direct effect from SARS-CoV-2 infection and/or a complication from sepsis and the inflammatory response described in COVID 19. The role of troponin as a predictor of COVID-19 associated mortality has been suggested in other studies [32, 33]. However, larger studies are necessary to evaluate their role in predicting severe COVID-19 respiratory failure. Our cohort was constructed prior to introduction of COVID-19 vaccination and therapeutic interventions such as dexamethasone or remdesivir [34]. The validation of our prediction model in the rest of our study population and in more recent cohorts after the emergence of new SARS-CoV-2 variants will be needed to assess its robustness. Our prediction model could contribute to the literature providing tools for clinicians, however none of the variables in our model are specific to SARS-CoV-2 infection and further studies including other populations will be needed for validation.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.05.21265970
  154. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.09.21266122
    1
    1. sciscore 12 Nov 2021

      SciScore for 10.1101/2021.11.09.21266122: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.09.21266122
  155. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.08.21265888
    1
    1. sciscore 11 Nov 2021

      SciScore for 10.1101/2021.11.08.21265888: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Eluted cells were stained for 30 minutes at 4° C in the dark with the following anti-human antibodies (clone): CD19 (SJ25C1), CD3 (UCHT1), CD14 (HCD14), CD16 (B73.1), CD21 (Bu32), CD27 (M-T271), IgD (IA6-2), IgM (MHM-88) and IgG (G18-145).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human antibodies ( clone): CD19</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>UCHT1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD14</div><div>suggested: (BioLegend Cat# 348805, RRID:AB_2889063)</div></div><div style="margin-bottom:8px"><div>HCD14</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD16</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD21</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD27</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spots in Vero E6 cell cultures were imaged, counted, and processed using an ImmunoSpot Counter (CTL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Concentrations derived using the Bioplex kit correlated with the reported WHO reference sample concentrations (Supplemental Figure 4).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bioplex</div><div>suggested: (BioPlex, RRID:SCR_016144)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data was analyzed using FlowJo software (TreeStar, Ashland, OR).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: Statistical analyses were performed using GraphPad Prism Software (San Diego, CA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.08.21265888
  156. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.07.21266027
    1
    1. sciscore 11 Nov 2021

      SciScore for 10.1101/2021.11.07.21266027: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Origin 2021b was used to convert graphical data to tabulated form as advised by Cochrane to avoid mistakes in the manual conversion of data [14].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cochrane</div><div>suggested: (Cochrane Library, RRID:SCR_013000)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The statistical heterogeneity was explored by calculating the I2 statistic using RevMan and by looking at the overlap of the CIs in the forest plots.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RevMan</div><div>suggested: (RevMan, RRID:SCR_003581)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      4.2 Limitations: A broad ethnic classification was used in this review. The Asian group included very diverse subgroups, each of which has now been shown to have different risk profiles. This approach was used to include a wide study base, as there were very few studies that had data on sub-categories, which resulted in an incomplete assessment of the risk faced by these subgroups [5]. The search had to be limited to the UK using search terms like ‘UK’, ‘England’, and so some studies might have been missed due to this strategy. As the research was carried out during the pandemic, there was a large amount of missing data reported which hindered the analysis. This review was limited to adults and so the results could not be generalized to children. The PCR test for COVID-19 has a high false-negative rate, which led to some cases being wrongly classified as non-COVID [23]. However, this was a limitation of the UK testing strategy, rather than of this review. As this review concentrated on UK based studies, the results were less generalizable to other countries as there might be differences in hospitalization policies, testing, ICU facilities, and other factors. It has been noted that many participants’ ethnicities have been put down as ‘Other’, and this may have created erroneous results for the MO group [21]. Again, this is an error of data collection by the original study researchers, rather than of this review. 4.3 Policy implications: These results have urgent implications f...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.07.21266027
  157. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.07.21266028
    1
    1. sciscore 11 Nov 2021

      SciScore for 10.1101/2021.11.07.21266028: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Another limitation is that the input variables (the interventions) in our optimal control problem are continuous in magnitude. It may be difficult to give practical significance to the numerical values representing the interventions. However, we stress that the optimal trajectories are used here only to compare the relative importance of different interventions. Further research can be done on discretizing the magnitude of the input variables into specific levels that correspond to scientifically-defined interpretable practical meanings.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.07.21266028
  158. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.05.21265810
    1
    1. sciscore 11 Nov 2021

      SciScore for 10.1101/2021.11.05.21265810: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.05.21265810
  159. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.05.21264700
    1
    1. sciscore 11 Nov 2021

      SciScore for 10.1101/2021.11.05.21264700: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The ethical approval of this study was approved by the ethical committee of the Department of Medical Sciences with approval number; MOPH 0625/EC060.<br>Consent: Written informed consent was obtained from all participants.<br>Field Sample Permit: Pseudotype-Based Microneutralization Assay against SARS-CoV-2: Pseudotype-Based Microneutralization Assay was carried out at the viral vaccine research center, National center for sciences and technology (NSTDA)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantification of SARS-CoV-2 anti-S RBD antibody: The level of immunoglobulin class G (IgG) antibodies to the receptor-binding domain (RBD) of S1 subunit spike protein of SARS-CoV-2 was measured and quantified in human serum or plasma by using the ARCHITECT System (Abbott, Abbott Park, Illinois, USA) chemiluminescent microparticle immunoassay (CMIA) (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>immunoglobulin class G ( IgG</div><div>suggested: (GeneTex Cat# GTX14582, RRID:AB_370592)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Based on the evaluated dilutions of the World Health Organization (WHO) International Standard (NIBSC Code 20-136) for anti-SARS-CoV-2 human immunoglobulin in WHO binding antibody unit (WHO BAU/mL) with the SARS-CoV-2 IgG II Quant assay with Abbott internal reference calibrators, the correlation between relationships of the AU/mL unit to the WHO (BAU/mL unit is at 0.142 × AU/mL) with the 0.999 correlation coefficient.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudotyped viruses (PVs) were produced in HEK293T/17 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T/17</div><div>suggested: ATCC Cat# CRL-11268, RRID:CVCL_1926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, HEK293T cells stably expressing human ACE2 and TMPRSS2 (1.5 ×104 cells/well) were mixed with the PV-serum complex before incubation in a humidified cell-culture incubator for 48 h at 37 °C in 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After removing the culture medium from Vero cell culture plates, 200 ul of the virus-serum antibody mixture were inoculated into monolayer cells and then rocked the culture plates every 15 min for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T/17 producer cells were sub-cultured in 6-well plates (Thermo Fisher Scientific, Waltham, MA, USA) and co-transfected at 80-90% confluence with the p8.91 lentiviral packaging plasmid (500 ng), the pCSFLW firefly luciferase reporter plasmid (1 µg), and the pCAGGS plasmid encoding codon-optimized SARS-CoV-2 spike (1.5µg)10.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>p8.91</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCSFLW firefly luciferase reporter</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_18926)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantification of SARS-CoV-2 anti-S RBD antibody: The level of immunoglobulin class G (IgG) antibodies to the receptor-binding domain (RBD) of S1 subunit spike protein of SARS-CoV-2 was measured and quantified in human serum or plasma by using the ARCHITECT System (Abbott, Abbott Park, Illinois, USA) chemiluminescent microparticle immunoassay (CMIA) (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis was performed by non-linear regression after normalization to 100% and 0% neutralization using GraphPad Prism Software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: All the statistical analyses were performed using R (version 4.0.2) 11 and Rstudio (version 1.3.1093)12.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Rstudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      There are several limitations to our research. First, our study did not collect comparison data on immunity levels at baseline before the study and after the first vaccine dose, hence, we could not exclude the effect of the previous infection on immunogenicity. However, the COVID-19 infection rate in Thailand was low before July 2021, there is a small possibility to include previously infected COVID-19 cases but these individuals should not affect the immunogenicity results in this study due to the immunity induced by infection were much higher in previously infected individuals compared with single-dose vaccination. A larger sample size is needed to detect uncommon adverse events such as vaccine-induced thrombotic thrombocytopenia and further studies should be done at the time of implementation of this vaccine schedule in the national vaccine program. Moreover, the PRNT50 and PVNT50 were assessed only in I/V regimen, limiting the comparability of the I/V regimen with other vaccine schedules, also the limited time for this study resulted in a smaller sample size that had neutralizing activities, however, the high level of neutralizing antibody suggested that the number of sample size is sufficient for the conclusion that I/V schedule is better than I/I schedule and comparable to V/V schedule. Finally, our research offers crucial real-world proof of the safety and immunogenicity of heterologous CoronaVac-ChAdOx1 nCoV-19 immunization. The I/V vaccination is a mixed regimen that...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.05.21264700
  160. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.06.21265632
    1
    1. sciscore 11 Nov 2021

      SciScore for 10.1101/2021.11.06.21265632: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study protocol was approved by the Ethics Committee of NCGM, Japan (approval number: NCGM-A-004175-00).<br>Consent: Written informed consent was obtained from all the participants before the baseline survey.<br>Field Sample Permit: Briefly, 5 mL of whole blood specimens were collected in a collection tube containing sodium heparin (VP-H050K, Terumo, Japan) at four time points during the vaccination regimen.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Background factors were treated as categorical variables in the models: age (<40 or ≥40 years), sex (men or women), and BMI (<25 or ≥25 kg/m2).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serological Assays: We performed three serological assays to detect the IgM and IgG antibodies against SARS-CoV-2 spike protein (IgM-S and IgG-S, respectively) and IgG antibodies against SARS-CoV-2 nucleocapsid protein (IgG-N).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 spike protein (IgM-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG-S, respectively) and IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2 nucleocapsid protein (IgG-N</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The presence of IgG-N antibodies can indicate SARS-CoV-2 infection prior to the study and during follow-up, regardless of the vaccination status.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG-N</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody-mediated inhibition of soluble human receptor protein (angiotensin-converting enzyme 2, hACE2) binding to the RBD of the viral S1 region was tested.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antibody-mediated inhibition of soluble human receptor protein ( angiotensin-converting enzyme 2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and Viruses: VeroE6TMPRSS2 cells [11] were obtained from the Japanese Collection of Research Bioresources (JCRB) Cell Bank (Osaka, Japan).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To detect IgG-S, the AdviseDx SARS-CoV-2 IgG II assay was performed using the Abbott ARCHITECT® following the manufacturer’s protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were conducted using STATA version 17.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      However, this study has several limitations. First, our study was conducted in a small-scale cohort of hospital workers in a single medical institution in Japan; thus, our findings might not be generalized to other settings. Second, the sufficient level of neutralizing activity or cellular immunities that is enough to protect against SARS-CoV-2 infection is not well known. In this study, sufficient neutralizing activity levels were defined as IH ≥35% in ELISA-based semi-quantitative neutralization assay (NeutraLISA), and the positive results evaluated by NeutraLISA spanned a wide range of values when the samples were analyzed by an in vitro virological experiment (summarized in Supplementary Figure 2). Further studies are warranted to determine sufficient levels of SARS-CoV-2 IgG antibody, neutralizing antibody, and T cell responses against SARS-CoV-2 infection and the duration of immunity induced by the vaccine. In conclusion, our study demonstrated that BNT162b2 vaccination induces SARS-CoV-2 specific IgG-S antibody and T cell responses, which were detected on day 15 following the first dose and peaked after the second dose and gradually declined over time. Sufficient levels of these responses against SARS-CoV-2 infection were maintained for over six–ten weeks following the second dose of BNT162b2 vaccination, and these responses were detected earlier than the onset of neutralizing activity. Our study contributes to a better understanding of the humoral and cellular immune ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.06.21265632
  161. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.05.21265759
    1
    1. sciscore 11 Nov 2021

      SciScore for 10.1101/2021.11.05.21265759: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">3 A combination of comprehensive literature searches and automated search and citation screening was used to search MEDLINE, EMBASE, Cochrane library, and pre-print servers (biorxiv/medrxiv).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEDLINE</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div><div style="margin-bottom:8px"><div>Cochrane library</div><div>suggested: (Cochrane Library, RRID:SCR_013000)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The search for all sources for the previous review was conducted from inception up to July 31, 2020.2 The literature search for this update, for all sources except EMBASE, was conducted on October 9, 2020.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EMBASE</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Full-text screening was completed by two reviewers using Microsoft Excel.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.05.21265759
  162. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.05.21265995
    1
    1. sciscore 11 Nov 2021

      SciScore for 10.1101/2021.11.05.21265995: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">25 Search Strategy: Using concepts related to virus, transmission, and HVAC, a research librarian (GMT) searched three electronic databases (Ovid MEDLINE, Compendex, Web of Science Core) from inception to June 2020 (see Appendix A for the Ovid MEDLINE search strategy).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEDLINE</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">References were managed in EndNote and duplicate records removed prior to screening.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EndNote</div><div>suggested: (EndNote, RRID:SCR_014001)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Covidence software was used to conduct screening.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Covidence</div><div>suggested: (Covidence, RRID:SCR_016484)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      It is understood that increasing humidification is not feasible in all types of facilities due to existing design limitations.16,46 Noti et al suggest that high risk, low humidity areas should be identified during the design and construction phase and appropriate consideration should be given to designs that minimize infection risk.16 Spena et al identified a region on the psychrometric chart that satisfies ASHRAE Standard 55’s comfort zone requirements while also providing optimal humidity conditions to decrease SARS-CoV-2 survival.42 In general, Spena et al suggest increasing humidification of supply air in the winter season and decreasing dehumidification of supply air in the summer season.42 Implications for Research: Based on the included studies, several key implications for research were found, such as the influence of medium, temperature, and exposure time; the need for statistical analysis to better understand and interpret results; and the need for standardized testing procedures. For example, for SARS-CoV-2, increased RH from low to high was associated with an increase or no change in infectivity, where the difference was attributed to differences in exposure time and/or suspending medium. Interestingly, increased RH from low to high was associated with an increase in infectivity for MERS-CoV, where one study decreased the temperature while increasing the RH. While this is one example, the complexity of other factors can be seen through the review content. While on...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.05.21265995
  163. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.04.21265780
    1
    1. sciscore 11 Nov 2021

      SciScore for 10.1101/2021.11.04.21265780: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Written informed consent of each participant was obtained prior to the booster vaccination.<br>IRB: The trial protocol was reviewed and approved by the Institutional Review Board of the Guangdong Provincial Center of Disease Control and Prevention.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Eligible participants were those who completed the initial two-dose regimens of 10μg V-01 in phase I trial25 4-5 months earlier and who did not meet the withdrawal criteria, voluntarily consented to participate in this trial, agreed to take effective contraceptive measures (women of childbearing potential) during the study, and without a history of SARS-CoV-2 infection or close contact to asymptomatic individuals.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The immunogenicity outcomes were geometric mean titer (GMT), geometric mean increases (GMI) of the RBD-binding antibody, and SARS-CoV-2 neutralizing antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 neutralizing antibody.</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The GMTs with associated Clopper-Pearson 95% CIs for the neutralizing and RBD-binding antibodies against wild-type SARS-CoV-2 were calculated.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibodies against wild-type SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were conducted using SAS 9.4 (SAS Institute Inc</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">., San Diego, CA, USA), then graphed using GraphPad Prism 8.0 (GraphPad Software Inc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The study has several limitations: (1) the administration interval between the booster dose and the second dose all ranged within 4-5 months, which might need a broader spectrum of range and further stratification for roll-out timing for booster doses. From public health perspective, the optimal timing of booster shot after prime immunization should consider multiple factors, including the current prevalence of COVID-19, supply of COVID-19 vaccine, emerging VOCs epidemiology, etc. (2) cross-neutralizing panels at day 28 after second vaccination who received a two-dose 10μg V-01 regimen in phase II was different from the cohorts receiving a booster dose. As a consequence, the comparison of cross-neutralizing activities against variants between primary two-dose series and booster vaccination should be interpreted with caution. (3) the sample size is relatively small, which is insufficient to assess rare vaccine-related AEs. (4) The long-term safety data of current cohorts in phase I trial was terminated since the application of the booster shots, and the T-cell immunity has not yet been analyzed. In conclusion, the booster dose of V-01 in participants previously primed with 21d-apart two-dose 10μg V-01 in phase I trial elicited potent humoral response against both wild-type and Delta strain of SARS-CoV-2 and exhibited a favorable and well-tolerated safety profile. Albeit a substantial decline of immunity was observed between 14 days post-second dosing and pre-booster dosing, hu...

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT05050474</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Booster Immunization Study of Recombinant SARS-CoV-2 Fusion …</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.04.21265780
  164. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.02.21265750
    1
    1. sciscore 11 Nov 2021

      SciScore for 10.1101/2021.11.02.21265750: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Human subjects: Human studies were performed according to the Declaration of Helsinki and were approved by the University of Wisconsin (UW) Institutional Review Board.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Graphing and statistical analyses were performed using Prism (GraphPad, San Diego, CA) and JMP (SAS Institute, Cary, NC)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.02.21265750
  165. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.08.21265380
    1
    1. sciscore 11 Nov 2021

      SciScore for 10.1101/2021.11.08.21265380: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Software and Reproducibility: Data management and analysis was performed using the OpenSAFELY software libraries, Python 3 and R version 4.0.2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Strengths and weaknesses: This study used large-scale, routinely-collected primary care records, linked to coronavirus testing surveillance, hospital, and death registry data. This allowed us to describe a substantial proportion of the English population in rich longitudinal detail and to detect variations in COVID-19 vaccine breakthrough cases, as early as possible. We acknowledge several important limitations of these findings. First, even though the base population consisted of over 10 million fully vaccinated individuals the numbers of COVID-19 vaccine breakthrough cases were relatively small, especially for hospitalisations and deaths. This made comparisons between outcomes, specifically at selected clinical and demographic levels difficult,meaning rates could be imprecisely estimated. Second, due to the targeted roll out of the COVID-19 vaccination programme in England, this cohort represents mostly older and vulnerable populations. In addition, follow-up time is systematically different amongst individuals included in this study and no adjustment for this has been made. Third, asymptomatic testing patterns vary between individuals. Apart from health and care workers, asymptomatic individuals without any underlying health issues or comorbidities are less likely to get tested than those with underlying health issues or comorbidities (i.e., haemodialysis patients) who will undergo asymptomatic testing regularly. Most lateral flow tests conducted at home are not included i...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.08.21265380
  166. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.03.21265533
    1
    1. sciscore 11 Nov 2021

      SciScore for 10.1101/2021.11.03.21265533: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Written informed consent was provided by all patients prior to study entry; patients did not receive a stipend.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study Design: The early treatment of mild to moderate COVID-19 with sotrovimab was assessed in this phase 3, randomized, double-blind, placebo-controlled, multicenter study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Sample Size: A sample size of 1360 patients (680 per treatment group) was determined to provide approximately 90% power to detect a 37.5% relative efficacy in reducing COVID-19 progression through day 29 at the overall 2-sided 5% significance level.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">AEs of special interest were defined as infusion-related reactions (including hypersensitivity reactions) and the potential for antibody-dependent enhancement.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-dependent enhancement.</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This trial has several limitations. Given the profound efficacy of sotrovimab, a small number of events for the primary and clinical secondary outcomes were reported in patients who were randomized to sotrovimab. As a result, it is challenging to determine the patient or disease characteristics associated with COVID-19 progression in sotrovimab-treated patients. Also notable is that the moderate size of the safety population limits the ability to detect rare AEs. However, based on the development of sotrovimab from a human antibody engineered to target a viral epitope, rare AEs are not expected. Finally, the study enrolled patients over approximately 6 months, representing a finite period of the pandemic. As a result, the complete picture of viral sequencing and clinical experience with sotrovimab for variants of concern is unknown. Despite this, sotrovimab targets a viral epitope that does not overlap with mutations observed in current variants of concern, and thus it is hypothesized that sotrovimab will remain effective against these variants.19,45

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04545060</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">VIR-7831 for the Early Treatment of COVID-19 in Outpatients</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.03.21265533
  167. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.03.21265791
    1
    1. sciscore 11 Nov 2021

      SciScore for 10.1101/2021.11.03.21265791: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.03.21265791
  168. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.07.21266036
    1
    1. sciscore 11 Nov 2021

      SciScore for 10.1101/2021.11.07.21266036: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: The purpose and procedures of the study were explained to the participants, and informed consent was obtained through an online website.<br>IRB: The Ethics Committee of Medical Research, University of Occupational and Environmental Health, Japan, reviewed and approved the study procedures (approval number: R2-079).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using IBM Statistical Package for the Social Sciences (SPSS) Statistics version 22 (SPSS Inc., Chicago, IL, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Statistical Package for the Social Sciences</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Some limitations of this study should be considered. First, this was a cross-sectional study; therefore, causality is unclear. Moreover, those with mental health issues may work longer hours because of reduced work efficiency. However, in general, in companies in Japan, occupational health staff is assigned to workplaces to ensure that those with mental health issues usually do not work long hours. Therefore, while it is unlikely that causality will be reversed, future longitudinal studies are needed. Second, since we assessed overtime work hours using self-administered questionnaires, which may have resulted in a bias. However, a previous study revealed that the correlation between self-reported and company records of working hours was quite high19; thus, the effect may not be large. Third, to assess overtime work hours, we examined overtime work hours per day; however, previous studies used the average overtime work hours per month or per week20, 21. Thus, the workload evaluation may not be accurate in the case of occupations with a greater change in daily working hours. Moreover, we adjusted for the job type, but we did not survey the details of the occupation. Fourth, we did not survey “whether the workplace compensates sick pay during absence.” Since sick pay allows employees to take time off from work without worry, a lack of sick pay could worsen mental health8. As the sick leave criteria measured in this study may include those without sick pay during absence, the amp...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.07.21266036
  169. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.06.21265967
    1
    1. sciscore 11 Nov 2021

      SciScore for 10.1101/2021.11.06.21265967: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Extracted data elements included study design (enrolment, follow up period, randomisation/allocation, laboratory analysis, predefined outcomes, adjusted analysis, funding source), participant information (inclusion criteria, number of participants, characteristics, disease, treatment), intervention (vaccine type, dose, schedule, comparator group) and outcomes (definitions, timing, adverse events).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Due to time limitations, further information was not sought from the original author/corresponding author(s).</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Search strategy Electronic searching: Literature searches were conducted by an experienced research librarian (SL) using the following databases to identify relevant articles: Ovid Medline, EMBASE and Cochrane CENTRAL from 1 January 2020 to 31 August 2021 and for articles in English only.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Medline</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div><div style="margin-bottom:8px"><div>EMBASE</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div><div style="margin-bottom:8px"><div>Cochrane CENTRAL</div><div>suggested: (Cochrane Central Register of Controlled Trials, RRID:SCR_006576)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      There are several limitations to this review. In particular the moderate quality of findings due to significant clinical and statistical heterogeneity of included studies and the proportion of poorer quality studies. In line with other established studies of vaccination in haematology patients, only immune response data was analysed as clinical efficacy data was limited. In conclusion, this systematic review and meta-analysis has comprehensively summarised the latest data on response to COVID-19 vaccination in patients with haematological malignancy. Overall, seropositive rates were reasonable at 67% following two doses of vaccination respectively. Higher risk patient groups were identified, namely patients with CLL and patients receiving active therapy including targeted and CD-20 monoclonal therapies. New approaches to high risk patients who are poor responders to vaccination are urgently required.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04625725</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Phase III Double-blind, Placebo-controlled Study of AZD7442 …</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.06.21265967
  170. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.05.21265712
    1
    1. sciscore 11 Nov 2021

      SciScore for 10.1101/2021.11.05.21265712: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Some limitations still remain in this study: 1. Although the transmission route of all cases was relatively clear and complete, data only came from local patients of Putian, so no multi-center data are accessed. 2. Although COVID-19 antibodies IgM and IgG had been detected, neutralizing antibody (RBD) was not tested and immunofunctional studies were not conducted. Further studies should be pursued to better evaluate the immune function of children age <12 in order to unravel the underlying mechanisms.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.05.21265712
  171. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.05.21264590
    1
    1. sciscore 11 Nov 2021

      SciScore for 10.1101/2021.11.05.21264590: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The trial protocol was approved by the institutional review board at each site (or by a centralized institutional review board as applicable) and was overseen by the trial’s steering committee (NCT04383613).<br>Consent: Informed consent was obtained from each patient.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">TRIAL DESIGN: We conducted an unblinded pragmatic randomized clinical trial of prone positioning of patients hospitalized with confirmed or suspected COVID-19 in 15 hospitals in Canada and the United States from May 2020 until May 2021.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">An independent data monitoring committee was established and reviewed the interim analysis results so that the trial investigators were blinded.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">We planned for 80% power and a two-sided alpha of 0.05, and assumed the risk of our composite outcome would be 45%(1,11).</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The most important limitation of our study was poor adherence to time spent prone. As described, this likely reflects the real-world challenges of lying in a prone position when sick with a respiratory and multisystem viral illness, and without high nurse-to-patient ratios. Future studies are needed to determine whether a greater amount of time spent in the prone position is associated with clinical benefit including whether specific devices or interventions (e.g., smartphone apps, pillows/padding, prone positioning teams) can increase time spent prone. Second, our expected event rate was lower than anticipated because our study was planned prior to effective treatments being available. These treatments (e.g., dexamethasone, remdesivir, tocilizumab), at least in part, resulted in a lower event rate that we anticipated and thus larger randomized trials would be needed to identify a smaller absolute risk reduction. Third, we lacked data on PPE use and the number of times a healthcare provider had to enter the room to help reposition a patient to aid with prone positioning. Both are important to evaluate when considering the potential drawbacks of prone positioning. Fourth, FiO2 for non-intubated patients depends on multiple physiologic factors and needs to be estimated for certain devices (e.g., a non-rebreather mask) based on the flow rate of oxygen delivered.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04383613</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Prone Positioning for Patients on General Medical Wards With…</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.05.21264590
  172. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.02.21265805
    1
    1. sciscore 11 Nov 2021

      SciScore for 10.1101/2021.11.02.21265805: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our results should be considered in context of at least five limitations. First, the data are limited to closures that were found in publicly available online sources and therefore may not be complete or entirely accurate. Second, while HHS Regions 2 and 9 include US territories, the data are limited to the 50 US states and DC and therefore US territories are not represented in these data. Third, the data are limited to information found in English language sources. Fourth, the data on PUSCs are limited to closures for which reopening dates could be found. Information regarding school reopening may have been sent directly to the school community via texts, emails, or phone calls, thereby bypassing the news media. Fifth, particularly in the case of disrupted infrastructures and facilities, schools and districts may not have been able to report updates on school status to the public media. These limitations could have led to an underestimation of prolonged closures, particularly for private, small, or remotely situated schools for which public news sources may be fewer. However, one notable advantage of this data collection method is that it enabled long-term evaluation of school closure trends without imposing any reporting burden on schools and school districts. We previously reported on the methods and rationale for this data collection, along with the initial two years of data on closures of any length [3]. While the previous study considered closures of ≥4 days prolonged-d...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.02.21265805
  173. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.05.21265763
    1
    1. sciscore 11 Nov 2021

      SciScore for 10.1101/2021.11.05.21265763: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: 37 Emerging Technologies: New surveillance technologies for COVID-19 are emerging and some of these have been validated, but not yet studied in a real-world setting.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Another senior information specialist peer reviewed the MEDLINE strategy prior to execution using the PRESS Checklist.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEDLINE</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">& Other Non-Indexed Citations, Embase, EBM Reviews - Cochrane Central Register of Controlled Trials, and EBM Reviews - Cochrane Database of Systematic Reviews.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Embase</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Results were downloaded and deduplicated using EndNote version 9.3.3 (Clarivate Analytics) and uploaded to Microsoft Word.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EndNote</div><div>suggested: (EndNote, RRID:SCR_014001)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A grey literature search was also conducted, including: MedRxiv, Google, McMaster Health Forum (CoVID-END), and websites of international government organizations (e.g., Center for Disease Control and Prevention [CDC], World Health Organization [WHO]).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MedRxiv</div><div>suggested: (medRxiv, RRID:SCR_018222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A grey literature search was conducted, including a thorough search of Google, websites of international government organizations (e.g., Center for Disease Control and Prevention [CDC], World Health Organization [WHO]), and McMaster Health Forum (COVID-END).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Google</div><div>suggested: (Google, RRID:SCR_017097)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.05.21265763
  174. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.08.21266058
    1
    1. sciscore 11 Nov 2021

      SciScore for 10.1101/2021.11.08.21266058: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Search strategy: MEDLINE, CINAHL and PsycINFO databases were searched for primary research in any language published between 1 January 2000 and 14 September 2021, combining free text terms and subject headings relating to (migration) AND (vaccination) AND (determinants) (see Tables S3-S4).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEDLINE</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div><div style="margin-bottom:8px"><div>PsycINFO</div><div>suggested: (PsycINFO, RRID:SCR_014799)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Records were imported into EndNote, and duplicates deleted.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EndNote</div><div>suggested: (EndNote, RRID:SCR_014001)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      (108-110) This review has some limitations. Included studies came from only 16 of the 32 review countries; therefore, this review is not fully representative of the European region and largely focuses on Western Europe, highlighting the urgent need for more data on vaccination uptake disaggregating by migrant status in European countries, which is rarely collected by national data systems. The lack of uptake data for the COVID-19 vaccine in diverse migrant populations has been previously highlighted and has undoubtedly hindered evidence-based service delivery. (97, 111) Certain sub-populations and nationalities of migrants were not well reported (e.g., undocumented migrants), and migrant status was generally not well defined or reported in the data, making it difficult to draw firm conclusions. This review has shown that access to and acceptance of vaccination are key factors influencing vaccine uptake in migrant populations in the EU/EEA. To address these barriers and ensure we meet regional and global targets for immunisation coverage and uptake, multi-level action is needed. Vaccination services should be designed to better meet patients’ social, cultural, and linguistic needs, through the translation and tailoring of information, provision of interpreters, training of HCPs in migrant health/vaccination guidelines and implementation of interventions which facilitate access to vaccination. Tailored and evidence-informed strategies should be co-designed with migrant populati...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.08.21266058
  175. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.03.21265201
    1
    1. sciscore 10 Nov 2021

      SciScore for 10.1101/2021.11.03.21265201: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.03.21265201
  176. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.04.21265908
    1
    1. sciscore 10 Nov 2021

      SciScore for 10.1101/2021.11.04.21265908: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study protocols were approved by the Institutional Review Board (IRB) of the Chulalongkorn University Faculty of Medicine (IRB numbers 192/64 and 491/64).<br>Consent: Written informed consent was obtained from all participants prior to collecting clinical data and samples.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vaccination and blood collection: CoronaVac (Sinovac Life Sciences, Beijing, China) is an inactivated virus vaccine created from African green monkey kidney cells (Vero cells) that have been inoculated with SARS-CoV-2 (CZ02 strain).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">antinucleocapsid (anti-N) IgG was tested using the commercially available automated ARCHITECT system (Abbott Diagnostics, Abbott Park, IL) by chemiluminescent microparticle immunoassay (CMIA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The graphical presentations were prepared using GraphPad Prism version 9.0 software (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The statistical analysis was performed using IBM SPSS Statistics for Windows, version 21 (IBM Corp., Armonk, NY)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.04.21265908
  177. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.05.21265569
    1
    1. sciscore 10 Nov 2021

      SciScore for 10.1101/2021.11.05.21265569: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: After receiving all information about the study, patients accepting to participate in the project signed the informed consent, and all regulatory requirements for the execution of such a research in Brazil were met.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">At this day patients were interviewed by a physician blinded to the other procedures of study just to apply the clinical improvement score.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data was recorded in a certified medical record DFMed, remotely accessed through AnyDesk platform and, posteriorly, tabulated and stored with Microsoft Excel 2003 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.05.21265569
  178. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.04.21265918
    1
    1. sciscore 09 Nov 2021

      SciScore for 10.1101/2021.11.04.21265918: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A limitation of our study is that all cardiac and aortic measurements were performed using fully automated image segmentation, although the method was validated previously using UK Biobank data16,17. The population studied also is limited to volunteers from amongst UK Biobank participants. The extent to which findings can be generalised particularly to more severe cases of COVID-19 is unknown. As noted above, the exploratory comparison between hospitalised and non-hospitalised infections is based on a small number of hospitalised cases, although the numbers are similar to those in some of the previous case series reporting abnormalities after COVID-194. Finally, the analyses have only considered structural and functional CMR measures. Additional analyses ongoing that will incorporate other cardiac functional data (e.g., ECG) and more detailed examinations of cardiac phenotypes (SEP, unpublished current investigations) could identify longitudinal case-control differences not detected here. Nonetheless, our observations suggest that persistent, clinically significant cardiac complications of SARS-CoV-2 infection are not common in the middle-aged to older UK participants in this UK Biobank pre- and post-infection imaging study.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.04.21265918
  179. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.05.21265698
    1
    1. sciscore 09 Nov 2021

      SciScore for 10.1101/2021.11.05.21265698: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.05.21265698
  180. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.05.21265853
    1
    1. sciscore 09 Nov 2021

      SciScore for 10.1101/2021.11.05.21265853: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics approval was received from the University of Pretoria, Human Research Ethics Committee (Medical) (247/2020)<br>Consent: Written informed consent was obtained from all participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">SARS-CoV-2 spike genome sequencing: For wave 2 samples, sequencing of the spike was performed as previously described 24 using swabs obtained from 28 randomly collected Groote Schuur Hospital patients of which eight were included in this study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IgG or IgA secondary antibody was diluted to 1:3000 or 1:1000 respectively in blocking buffer and added to the plates followed by TMB substrate (Thermofisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody-dependent cellular phagocytosis (ADCP) assay: SARS-CoV-2 original or Beta spike was biotinylated using EZ link Sulfo-NHS-LC-Biotin kit (ThermoFisher) and coated on to fluorescent neutravidin beads as previously described 32.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antibody-dependent cellular phagocytosis ( ADCP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody-dependent cellular cytotoxicity (ADCC) assay: The ability of plasma antibodies to cross-link and signal through FcγRIIIa (CD16) and spike expressing cells or SARS-CoV-2 protein was measured as a proxy for ADCC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD16</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody-dependent cellular trogocytosis (ADCT) assay: ADCT was performed as described in and modified from a previously described study34.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antibody-dependent cellular trogocytosis (ADCT</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, RBD original and Beta (K417N, E484K and N501Y, D614G) and NTD original and Beta (L18F, D80A, D215G and 242-244 del) proteins were expressed in Human Embryonic Kidney (HEK) 293F suspension cells by transfecting the cells with the respective expression plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudotyped lentiviruses were prepared by co-transfecting HEK293T cell line with either the SARS-CoV-2 ancestral variant spike (D614G) or the Beta spike plasmids in conjunction with a firefly luciferase encoding lentivirus backbone plasmid as previously described 24.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Opsonized beads were incubated with the monocytic THP-1 cell line overnight, fixed and interrogated on the FACSAria II.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>THP-1</div><div>suggested: CLS Cat# 300356/p804_THP-1, RRID:CVCL_0006)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Jurkat-Lucia™ NFAT-CD16 cells (Invivogen) (2×105 cells/well and 1×105 cells/well for spike and other protein respectively) were added and incubated for 24 hours at 37°C, 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NFAT-CD16</div><div>suggested: RRID:CVCL_A7ZT)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike plasmid and Lentiviral Pseudovirus Production: The SARS-CoV-2 Wuhan-1 spike, cloned into pCDNA3.1 was mutated using the QuikChange Lightning Site-Directed Mutagenesis kit (Agilent Technologies) and NEBuilder HiFi DNA Assembly Master Mix (NEB) to include D614G (original) or lineage defining mutations for Beta (L18F, D80A, D215G, 242-244del, K417N, E484K, N501Y, D614G and A701V), Gamma (L18F, T20N, P26S, D138Y, R190S, K417T, E484K, N501Y, D614G, H655Y, T1027I, V1176F) or Delta (T19R, 156-157del, R158G, L452R, T478K, D614G, P681R and D950N).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Other pcDNA plasmids were used for the ADCC assay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA</div><div>suggested: RRID:Addgene_66792)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">THP-1 cells were used for both the ADCP and ADCT assays and obtained from the AIDS Reagent Program, Division of AIDS, NIAID, NIH contributed by Dr. Li Wu and Vineet N. KewalRamani.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AIDS Reagent Program</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Analyses were performed in Prism (v9; GraphPad Software Inc, San Diego, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.05.21265853
  181. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.04.21265924
    1
    1. sciscore 09 Nov 2021

      SciScore for 10.1101/2021.11.04.21265924: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The survey asked for a student’s birth year, race (Asian American/Pacific Islander, Black/African American, Latinx/Hispanic, White/Caucasian, or a fill-in-the-blank), gender (woman, man, non-binary conforming), first generation in college status (defined as neither parent earning any level of postsecondary credential), educational level (two-year, four-year, or graduate), enrollment status (part- or full-time), and current mode of education (on-campus, online, or hybrid).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Islander</div><div>suggested: (Islander, RRID:SCR_007758)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.04.21265924
  182. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.03.21265902
    1
    1. sciscore 09 Nov 2021

      SciScore for 10.1101/2021.11.03.21265902: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: 6 The Stanford University School of Medicine institutional review board approved the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were conducted using Python, version 3.8.5.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Study limitations include reliance on EHR data from primary care settings, which did not include sub-specialist care. Our dataset lacked an indicator for telehealth visits, precluding the assessment of telehealth access as a contributor to care disparities.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.03.21265902
  183. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.04.21265886
    1
    1. sciscore 09 Nov 2021

      SciScore for 10.1101/2021.11.04.21265886: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.04.21265886
  184. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.03.21265769
    1
    1. sciscore 09 Nov 2021

      SciScore for 10.1101/2021.11.03.21265769: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Città della Salute e della Scienza di Torino, Protocol: 00282/2020); Naples, Italy (Ethics Committee of the University of Naples Federico II, Protocol: 158/20); Chile (Comité Ético Científico Facultad de Medicina Clínica Alemana Universidad del Desarrollo, Santiago, Chile, Protocol: 2020-41); and Israel (Hadassah Medical Organization Institutional Review Board (IRB) for studies involving human subjects, Protocol: HMO-235-20).<br>Consent: Additional MIS-C patients were enrolled from other sources including Stanford, California and Portland, Oregon, after written informed consent to NIH IRB-approved research protocols (NIH Protocols l1-1-0109, 18-I-0041 and 18-I-0128).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Serum samples from adults with COVID-19 (n=80) in Brescia, Italy were obtained from a higher number of male than female (48:32) patients with a median age of 55 years (interquartile range (IQR): 45-66), and a median time between blood draw and onset of symptoms of 25 days (IQR: 13-52).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In addition to testing the IVIG preparation for autoantibodies against Ro52, Ro60, La and the gastric ATPase, several additional autoantigens were tested including Jo-1 [30] and IL-1 alpha [35].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ro52</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Ro60</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IL-1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A selected panel of autoantigens representing both ubiquitous and tissue-specific antigens were first tested in adults and included: Ro52, Ro60, La, RNP-A, Sm-D3, Jo-1, gastric ATPase (ATPB4 subunit), LGI1, U170K, CENP-A, RNAP-K, BPIFB1, defensin 5A, KCNRG, glutamic acid decarboxylase (GAD65), gastric inhibitory factor (GIF), and M-type phospholipase A2 receptor (PLA2R).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GIF</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: GraphPad Prism software (San Diego, CA) was used for analyzing the antibody levels in this study.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.03.21265769
  185. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.04.21265916
    1
    1. sciscore 09 Nov 2021

      SciScore for 10.1101/2021.11.04.21265916: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the University of Cape Town Human Research Ethics Committee (HREC 285/2020).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Screening for potentially eligible cases was done on randomly selected medical records generated from lists of consecutive hospital COVID-19 admissions during each study period.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">A power calculation was done based on data collected during the first wave, where in-hospital mortality was 22% among a sample of 571 patients.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">No patients received remdesivir, IL-6 inhibitors, or monoclonal antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>remdesivir, IL-6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>monoclonal</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      However, this was not seen in smaller hospitalized cohorts with more granular clinical data [18, 19], and importantly, less confounding related to resource limitations in these higher income settings. Disentangling an isolated effect of VOC from dynamic factors that strongly influence clinical outcomes, such as health system strain, treatment practices, vaccination, and population behaviors, is challenging [20]. Laboratory data have demonstrated that variants with mutations in the receptor-binding domain including Alpha, Beta, and Gamma likely have increased transmissibility and reduced sensitivity to neutralization by natural and vaccine-induced antibodies [6, 9, 21, 22]. These characteristics have resulted in higher infection peaks, and increased hospitalization and mortality associated with these variants, including in South Africa [2, 23, 24]. High viral loads may further predict the probability of progression of disease during hospitalization [25], as shown in our study those who died had higher viral loads than survivors. Although lower RT-PCR amplification cycles have been reported with VOC, including the Beta variant [26], a causal relationship between Ct values, VOC, and mortality is not yet established. Dynamic measures of Ct values provide better insights into VOC biology. We did not have longitudinal viral testing data and similar Ct values between wave periods observed in our study may have been influenced by time course of illness or sampling differences. In lin...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.04.21265916
  186. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.04.21265937
    1
    1. sciscore 09 Nov 2021

      SciScore for 10.1101/2021.11.04.21265937: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.04.21265937
  187. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.03.21265897
    1
    1. sciscore 09 Nov 2021

      SciScore for 10.1101/2021.11.03.21265897: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All data are available on Zenodo at https://doi.org/10.5281/zenodo.1215899, and can be retrieved within R using the socialmixr package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Zenodo</div><div>suggested: (ZENODO, RRID:SCR_004129)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.03.21265897
  188. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.10.27.21265573
    1
    1. sciscore 09 Nov 2021

      SciScore for 10.1101/2021.10.27.21265573: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.10.27.21265573
  189. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.04.21265931
    1
    1. sciscore 09 Nov 2021

      SciScore for 10.1101/2021.11.04.21265931: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subjects completed daily surveys to report any COVID-19 related symptoms, symptom severity, the results for any SARS-CoV-2 nasal PCR tests, and SARS-CoV-2 antibody test results.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      There are several limitations to our study. First, HRV was collected sporadically by the Apple Watch. We employed statistical modeling to account for this. However, a denser data set using continuous data would likely further improve our predictions. Second, the model we employed used a 7-day smoothing approach. This approach observed infection-induced changes in HRV later than if HRV was estimated using a single-day method. Thus, the approach we employed is conservative. An additional limitation is that the Apple Watch provides HRV measurements only in the SDDN time domain. This limits assessments between other types of HRV measurements and COVID-19 outcomes. Additionally, other factors might impact HRV, which we were not able to capture and control for in the analysis. Furthermore, we were not routinely checking for SARs-CoV-2 infections and relied on subjects reporting a COVID-19 diagnosis. Therefore, infections could have occurred that are not accounted. Lastly, we did not externally validate our machine learning algorithm in another cohort.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.04.21265931
  190. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.04.21265910
    1
    1. sciscore 09 Nov 2021

      SciScore for 10.1101/2021.11.04.21265910: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      However, different limitations as well regarding the model as the practical application have to be considered. First of all, different influencing factors (e.g. critical dose, decay rate of sedimentation as well as inactivation, size distribution and number of emitted particles) were assumed based on current knowledge, but whereas the transmission of SARS-CoV-2 is still ongoing, further knowledge may be gained from further research. The decay rates of sedimentation as well as inactivation can be influenced by the particle size distribution as well as the air temperature and humidity in the room. Furthermore, the analysis and model base on some general assumptions like ideal mixing of all particles within the room, an initial concentration of 0 virus copies/m3 and a supply of virus free air. An ideal mixing of all particles in the room also implies, that no separation into near and far field can be performed, whereas the concentration of virus laden particles near the person is probably higher than in the rest of the room. Also, the local concentration will differ regularly from the average concentration so that the local air quality index should be considered for investigations in detail [27, 28]. As a result, even at lower viral emission rate Sv, infection can occur via aerosol, predominantly in the near field. As a third aspect the influence of VOCs is difficult to define. A higher transmission rate of new VOCs may result from different aspects, such as a change in critical...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.04.21265910
  191. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.04.21265948
    1
    1. sciscore 09 Nov 2021

      SciScore for 10.1101/2021.11.04.21265948: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The protocol was approved by the Oregon Health and Science University Institutional Review Board (OHSU IRB# 21230).<br>Consent: All participants gave written informed consent before enrolling in the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plates were washed 3 times with wash buffer and 100 μL of 1:3000 dilution of anti-human IgG (H+L) HRP (Novus, NBP1-73319) detection antibody was added and incubated at RT for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Novus Cat# NBP1-73319, RRID:AB_11029224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For subjects with low frequency of antigen-specific antibody secreting cells frequency was determined by number of positive wells divided by the total number of IgG positive secreting wells, multiplied by one million, giving a frequency per million PBMCs stimulated.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were incubated at room temperature (RT) for 1 hour, washed 4 times with wash buffer, and 50 uL of 1:3000 dilution of anti-human IgG-HRP (BD Pharmingen, 555788) detection antibody was added and incubated at RT for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data was acquired on an LSR Fortessa (Becton Dickenson) and analyzed using FlowJo software (Becton Dickenson).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Study limitations include a small sample size and lack of long-term follow up to identify long-lived humoral response. None of the 16 subjects enrolled in this study tested positive for SARS-CoV-2 prior to enrollment in the study/vaccination, however, although testing for prior infection via evaluation of RBD antibodies in the serum was performed prior to vaccination in 12 of the 16 subjects, evaluation and anti-nucleocapsid antibodies which is more specific for prior infection was not performed in any subjects. Long-term clinical outcomes to evaluate vaccine efficacy in relation to vaccine response is also needed. In conclusion, the results of this study provide a thorough evaluation of the humoral and cellular immune response to initial 2-dose mRNA COVID-19 vaccine series in CLL patients. Our results highlight the limitations of serology studies alone in defining vaccine-mediated immune responses, particularly in this immune-dysregulated patient population. Larger longitudinal studies which incorporate clinical outcomes in vaccinated CLL patients as well as study the impact of a third, booster or heterologous vaccine are needed.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.04.21265948
  192. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.04.21265945
    1
    1. sciscore 09 Nov 2021

      SciScore for 10.1101/2021.11.04.21265945: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">We used the secondary outcome result of complete resolution of symptoms by Day 14 which was conserved between all four completed and reported inhaled corticosteroid randomized controlled trials: STOIC [1], PRINCIPLE [2], CONTAIN [4], and Covis Pharma [5].</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Using STATA version 17 and the metan command, we performed a random effects meta- analysis for these outcomes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.04.21265945
  193. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.03.21265855
    1
    1. sciscore 08 Nov 2021

      SciScore for 10.1101/2021.11.03.21265855: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.03.21265855
  194. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.04.21265923
    1
    1. sciscore 07 Nov 2021

      SciScore for 10.1101/2021.11.04.21265923: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.04.21265923
  195. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.04.21265921
    1
    1. sciscore 07 Nov 2021

      SciScore for 10.1101/2021.11.04.21265921: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All staff members of both hospitals (N=9038) were invited to participate in an online self-administered consent process and online questionnaire, followed by blood sampling for SARS-CoV-2 antibody testing in April 2021, in the same manner as October 2020 (6).<br>IRB: Ethical approval: Ethical approval was obtained from the National Research Ethics Committee (NREC) for COVID-19, Study Number 20-NREC.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Laboratory Methods: All samples were tested using the Roche Elecsys anti-SARS-CoV-2 and the Roche Elecsys anti-SARS-CoV-2 S immunoassays detecting total antibodies (including IgG) to the nucleocapsid and spike proteins of the SARS-CoV-2 virus, respectively (29).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 S immunoassays detecting total antibodies (including IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Participants with detectable anti-N antibodies were presumed to have had previous natural infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-N</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Participants were deemed seropositive (i.e. assumed to have had past infection with SARS-CoV-2) if they had detectable anti-N antibodies, or if they had detectable anti-S antibodies but had not been previously vaccinated.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analysis was conducted in Stata 15.1 (StataCorp LCC. 2019. College Station, TX 77845: USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.04.21265921
  196. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.02.21265767
    1
    1. sciscore 06 Nov 2021

      SciScore for 10.1101/2021.11.02.21265767: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: COVIDENCE UK was sponsored by Queen Mary University of London and approved by Leicester South Research Ethics Committee (ref 20/EM/0117).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Both the minimally adjusted and fully adjusted models were controlled for age (<30 years, 30 to <40 years, 40 to <50 years, 50 to <60 years, 60 to <70 years, and ≥70 years), sex (male vs female), and duration of follow-up (days).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Statistical analysis: The sample size required to obtain an odds ratio (OR) of at least 1.08 for a binary exposure with maximum variability (probability 0.50 changing to 0.52) and correlated with other variables in the model (R2=0.4), using a two-sided test with 90% power and 5% significance, was estimated as 10,964, using Stata’s powerlog program.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Semi-quantitative determination of antibody titres was done using a commercially available ELISA that measures combined IgG, IgA, and IgM (IgGAM) responses to the SARS-CoV-2 trimeric spike glycoprotein (product code MK654; The Binding Site [TBS], Birmingham, UK).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgM (IgGAM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2 trimeric spike glycoprotein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Outcomes: Study outcomes were presence versus absence of antibodies against SARS-CoV-2 (binary outcome assessed in all participants who did not report having tested positive for SARS-CoV-2 infection via RT-PCR or lateral flow test before enrolment), and antibody titres (continuous outcome considered in all seropositive participants).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To produce patient-level covariates for each class of medications investigated, participant responses were mapped to drug classes listed in the British National Formulary or the DrugBank and Electronic Medicines Compendium databases if not explicitly listed in the British National Formulary, as previously described.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DrugBank</div><div>suggested: (DrugBank, RRID:SCR_002700)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were done using Stata (version 14.2; StataCorp, College Station, TX, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our study also has some limitations. First, COVIDENCE UK is a self-selected cohort, and thus several groups—such as people younger than 30 years, people of lower socioeconomic status, and non-White ethnic groups—are under-represented. This particularly affected our power to investigate outcomes for Black participants, who have been found to be at higher risk of SARS-CoV-2 infection4,5,12 and adverse outcomes22 than White people. However, insufficient representativeness in a cohort does not preclude identification of causal associations, and self-selection may result in better response to follow-up.40 Second, as we included asymptomatic infections in our titre analysis, we were not able to adjust for timing of infection onset, preventing us from capturing the effects of temporal changes in antibody responses. As 40% of our seropositive participants did not experience symptoms suggestive of COVID-19 or provide a symptom onset date, excluding them would have greatly reduced the power and generalisability of our analysis. Third, as with any observational study, we cannot exclude the possibility that some of the associations we report might be explained by residual or unmeasured confounding. For example, the finding that passive smoking but not active smoking reduces the risk of seropositivity compared with never-smokers should be treated with caution, unless a plausible protective mechanism can be found. However, we have minimised the risk of confounding by adjusting for a compre...

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04330599</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Longitudinal Population-based Observational Study of COVID-1…</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.02.21265767
  197. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.03.21260184
    1
    1. sciscore 06 Nov 2021

      SciScore for 10.1101/2021.11.03.21260184: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Additionally, sexual chromosomes, cross-reactive probes and probes with overlapping SNPs from dbSNP v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>dbSNP</div><div>suggested: (dbSNP, RRID:SCR_002338)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: Deconvolution of cell proportions: Iterative hierarchical procedure implemented in EpiDISH R package 37 was used to estimate the main blood cell type proportions from methylome information with the robust partial correlation method 38.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EpiDISH</div><div>suggested: (EpiDISH R package, RRID:SCR_018004)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">transcription factor binding site) motif enrichment analysis was performed with HOMER software 43 using a size of 200 nucleotides and including as background the CpGs interrogated with the EPIC array.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HOMER</div><div>suggested: (HOMER, RRID:SCR_010881)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HLA and Immunoglobulin genes were removed from the Reactome pathways before activity calculation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Reactome</div><div>suggested: (Reactome, RRID:SCR_003485)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.03.21260184
  198. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.03.21265863
    1
    1. sciscore 06 Nov 2021

      SciScore for 10.1101/2021.11.03.21265863: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Simulations will be performed with the dde23 solver of the software MATLAB R2018a.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MATLAB</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.03.21265863
  199. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.03.21265807
    1
    1. sciscore 06 Nov 2021

      SciScore for 10.1101/2021.11.03.21265807: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The second was surveillance, which included two settings: i) serial or repeat testing of well-defined groups, e.g. students in professional medical training programmes, professional sports franchises (players and staff), and ii) random samples of a large population, all without clinical or epidemiological suspicion of SARS-CoV-2 infection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Search strategy: Three reviewers (AA, JB, EM) searched two electronic databases of published literature (PubMed, EMBASE) and one preprint database (medRxiv).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div><div style="margin-bottom:8px"><div>EMBASE</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Some limitations of the approach are that the studies identified from the review are primarily from the USA and Europe, with fewer reports from LMICs. This limits understanding of how Ag-RDTs have been used across LMICs, but may also reflect that Ag-RDTs have been less available for widespread use in LMICs than in high-income countries. Heterogeneity in study design and setting also prevented us from undertaking a meta-analysis and limits the extent to which individual study results can be compared. The search was also restricted to English and French, and did not include the grey literature, which may have excluded certain reports. Nevertheless, the review represents the first comprehensive assessment of how Ag-RDTs have been used in the real world.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.03.21265807
  200. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.02.21265831
    1
    1. sciscore 06 Nov 2021

      SciScore for 10.1101/2021.11.02.21265831: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The visible colorimetric detection result was analyzed using ImageJ software by splitting the green channel and measuring the fluorescent intensity [26].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.02.21265831
  201. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.11.02.21265843
    1
    1. sciscore 06 Nov 2021

      SciScore for 10.1101/2021.11.02.21265843: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: 230 out of 360 in our cohort showed the sVNT results below 60% in their plasma specimens which were collected at one month after the second dose.<br>IRB: Study approval: The study was approved by the Joint Chinese University of Hong Kong-New Territories East Cluster Clinical Research Ethics Committee (Ref no: 2020.229) and all participants provided written consent.<br>Consent: Study approval: The study was approved by the Joint Chinese University of Hong Kong-New Territories East Cluster Clinical Research Ethics Committee (Ref no: 2020.229) and all participants provided written consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The participants were randomized to receive either BNT162b2 (n=40) or CoronaVac (n=40) as the third dose.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Sample size calculation: The sample size was calculated based on the results of our previous study (10).</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were performed in R (version 4.1.0; R Foundation for Statistical Computing) or Prism 9 (Graphpad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      There were some limitations in our study. Firstly, the sample size in our study was relatively small, but we have shown that the large difference of the results between the two groups and provided sufficient statistical power to draw our conclusion. A larger scale RCT will be needed especially for evaluating those rare adverse effects. Secondly, our study cohort only focused on those who had poor response to the CoronaVac that were urgently in need for the third dose. In routine practice, we will need to use booster doses without serological testing to identify poor antibody responders. Finally, T cell responses were not assessed in this study. Our previous report found that CoronaVac elicited more potent T cell responses than the BNT162b2 vaccine (10). We will further study the T cell response from this cohort together with the samples collected at their six-month time point.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04611243</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Lung Function, Exercise Capacity, and Serology Responses in …</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.11.02.21265843