- May 2021
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.12.21256975: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.11.21256147: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Results of a multiplex polymerase chain reaction respiratory pathogen panel (RPP) assay (FilmArray RP2, Biofire Diagnostics) were extracted from the Zuckerberg San Francisco General Hospital (ZSFG) clinical laboratory information system from January 2019 to December 2020; a period spanning approximately one year before and during the COVID-19 pandemic.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were performed in Prism 9.0.0 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This project was approved by UCSF Human Research Protections Program (IRB# 20-32769) and ZSFG protocol approval board.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UCSF Human Research Protections Program</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Our study contains certain limitations. We employed a cross-sectional design comparing two years of data from a single healthcare system. As such, we cannot control for year-to-year variations in viral respiratory illnesses or demographic confounders in our study population. Our data may also be affected by reduction of health services or avoidance of medical care directly from COVID-19 and evolving local policies regarding allowable indoor businesses and personal gathering (6, 7). Despite this, our focus on inpatients tested for respiratory infections, rather than the larger population of outpatients, should decrease variation in testing practices that may occur from workup of mild and undifferentiated illness. While our findings add to the evidence regarding effective disease mitigation strategies (8–10), it is also notable that the low rate of respiratory virus detection remained low during intermittent months of increased public interaction and movement in the Bay Area, including periods when businesses were allowed to partially reopen, times at which civil protests occurred, and periods of increased summer outdoor recreational activities. This suggests a central role for masking and reduction of enclosed space gathering for the disruption of respiratory viral transmission. Since our study population focuses on prospective inpatient admissions, these results primarily represent moderate and severe infections requiring high-level care. As such, these findings also suggest ...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.12.21257107: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.11.21257021: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Confirmation of replication-competent SARS-CoV-2 was achieved by inoculation of VeroE6 cells with the respective pools.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Results obtained by visual examination of the test device by different laboratories were categorized as “positive” or “negative” and subjected to statistical analysis by using the GraphPad Prism software as indicated in the results section.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.13.443734: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animals: Female and male rats (Wistar, 7-8 weeks of age) were provided and handled by Preclinics Gesellschaft für präklinische Forschung mbH, (Potsdam, Germany).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Specific S protein expression was assessed via staining with Human anti SARS CoV S antibody (CR3022) (Creative Biolabs, Cat.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti SARS CoV S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MRO-1214LC) followed by goat anti-human IgG F(ab’)2 fragment PE antibody (Immuno Research, Cat. 109-116-097) in a BD FACS Canto II cell analyzer and the FlowJo 10 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 109-116-097, RRID:AB_2337677)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody analysis: SARS-CoV-2 Spike RBD protein specific IgG1 and IgG2a binding antibodies were detected via ELISA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 Spike RBD protein specific IgG1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In vitro protein expression: For detection of mRNA expression in cell culture, HeLa cells were seeded in 6-well plates at a density of 400.000 cells/well. 24h later, cells were transfected with 2μg of mRNA per well via Lipofection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lastly, 100 μl of trypsinated VeroE6 cells (cells of one confluent TC175 flask per 100 ml) in DMEM with 2 % penicillin/streptomycin supplementation was added to each well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animals: Female and male rats (Wistar, 7-8 weeks of age) were provided and handled by Preclinics Gesellschaft für präklinische Forschung mbH, (Potsdam, Germany).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Wistar</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MRO-1214LC) followed by goat anti-human IgG F(ab’)2 fragment PE antibody (Immuno Research, Cat. 109-116-097) in a BD FACS Canto II cell analyzer and the FlowJo 10 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.06.21256751: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.06.21256766: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants received oral and written information about the study and written consent was obtained.<br>IRB: All protocols performed in the study were in accordance with the ethical standards approved by the Ethical Committee of the Hospital Clínico Universitario of Valencia (Ref. 2020/133) and by the rest of the Ethical and Research’s Committees.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Participants were pregnant with intended breastfeeding and nursing women with positive PCR for SARS-CoV-2 in nasopharynge or presence of SARS-CoV-2 antibodies in serum determined in hospitals.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Those women were randomly selected from the MAMI birth cohort in Spain [15] (ClinicalTrials.gov Identifier: NCT03552939).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Women were excluded when COVID-19 symptomatology required specific treatment and/or hospitalization in intensive care units.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Breast milk SARS-CoV-2-specific antibody detection: Levels of antibodies directed to structural proteins as RBD of the SARS-CoV-2 spike protein and to non-structural viral proteins as cysteine-like protease, also known as the main protease (Mpro) or 3CLpro, were analyzed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 spike protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For detection of the different antibody isotypes, anti-human IgA (α-chain-specific) HRP antibody (Thermo-Fisher Scientific; A18781; 1:6.000), anti-human IgM (μ-chain-specific) HRP antibody (Sigma-Aldrich; A0420; 1:4.000), and anti-human IgG (Fc specific) HRP antibody (Sigma-Aldrich; A0170; 1:4.000) were used and incubated for 1 h in 1 % (w/v) milk powder in PBS-T.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HRP</div><div>suggested: (Sigma-Aldrich Cat# A0420, RRID:AB_257886)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, an anti-human IgA antibody pre-adsorbed to the plate allowed to capture the IgA, which was later detected by the addition of a biotinylated detection antibody and streptavidin-conjugated horseradish peroxidase that catalyzed the colorimetric reaction with the chromogenic substrate TMB.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RBD protein was produced under HHSN272201400008C and obtained through BEI Resources, NIAID, NIH: Spike Glycoprotein RBD from SARS-CoV-2, Wuhan-Hu-1 with C-Terminal Histidine Tag, Recombinant from HEK293T Cells, NR-52946.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For detection of the different antibody isotypes, anti-human IgA (α-chain-specific) HRP antibody (Thermo-Fisher Scientific; A18781; 1:6.000), anti-human IgM (μ-chain-specific) HRP antibody (Sigma-Aldrich; A0420; 1:4.000), and anti-human IgG (Fc specific) HRP antibody (Sigma-Aldrich; A0170; 1:4.000) were used and incubated for 1 h in 1 % (w/v) milk powder in PBS-T.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo-Fisher Scientific</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For detection of MPro-reactive antibodies, a commercial ELISA Kit (ImmunoStep, Salamanca, Spain) was used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImmunoStep</div><div>suggested: (IMMUNOSTEP, S.L., RRID:SCR_013411)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Endpoint titers were calculated from log-transformed titration curves using 4-parameter non-linear regression function in GraphPad Prism 8.0 and the positive cut-off values obtained from the prepandemic control group for each antigen and isotype.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Regarding the potential limitations, we did not collect skin swabs to control for the potential presence of SARS-CoV-2 in the skin [7,33]. However, all milk samples as well as the infants were negative for SARS-CoV-2 presence. Thus, although there are still limited data, it is accepted that breastfeeding does not represent a vehicle for vertical transmission of SARS-CoV-2 [9]. There are still many open questions: when are SARS-CoV-2 antibodies produced after maternal infection, when can they be detected in breast milk, and how long do they persist. To cover some of these questions, we aimed to determine the presence of antibodies in breast milk samples from COVID-19 women and to compare these with milk samples collected prior to the pandemic as reference controls. While different studies have reported presence of specific IgA antibodies against SARS-CoV-2 [7,12,13,36], limited information is available on IgG and IgM. Our results showed presence of anti-SARS-CoV-2 antibodies in milk, primarily IgA but also IgG and IgM targeting RBD. Furthermore, IgA- and IgG against non-structural MPro were analyzed for the first time in human milk samples. High intra- and inter-individual variability was observed in antibody presence and significant differences were observed for all three antibody classes when compared to prepandemic samples in agreement with previous data [26]. In our dataset we found that 82·9 % of the milk samples tested positive for the RBD antigen at least in one of the ...
Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04768244</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Impact of Maternal COVID-19 Disease on Breast Milk and Infan…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT03552939</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">The Impact of Maternal Microbes on Infant Health Programming</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.06.21256732: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:However limitations in vaccine supply and rate of delivery are a reality for every country, hence the available doses should be deployed in space and time following a fair and effective strategy. In stockpile-limited settings, like most current vaccination campaigns worldwide, careful allocation may significantly increase the number of averted infections and deaths. The goal is to distribute the vaccines where they have the strongest beneficial impact on the dynamics of the epidemic. However, deriving an algorithm capable of computing spatially optimal allocation strategies in real, heterogeneous settings is far from trivial and our approach is, to the best of our knowledge, the first attempt in this direction. We developed an novel optimal control framework that delivers the best vaccination strategy under constraints on supply and logistics. This allows us to compute the allocation strategy that maximizes the number of averted infections during a projection of the COVID-19 epidemic in Italy from January 11, 2021 to April 11, 2021. Our results show that the optimal strategy has a complex structure that mainly reflects the projected incidence of each province, but also takes into account the spatial connectivity provided by the mobility network and the landscape of acquired population immunity. Although the reason why this strategy is optimal is not immediately intuitive, our simulations clearly outline its better overall performances over other, more straightforward strategi...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.06.21256769: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The de-identified data used in this study were granted a waiver of authorization by the institutional review board of the UnitedHealth Group Office of Human Research Affairs.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.12.21256874: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: 22 Ethics approval was received from the CUNY School of Public Health and Health Policy institutional review board.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were conducted in SAS 9.4 (SAS Institute Inc., Cary, NC, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:There are several limitations to our analysis. Our survey focused on children 12 years of age and younger to collect information about younger children but we therefore do not have data on adolescents. The survey data are self-reported and thus subject to recall, response and social desirability bias. In addition, while our survey was weighted to reflect the US population of parents based on 2019 census estimates, it was conducted online therefore excluded parents without access to the internet and thus may not accurately reflect the US population by income and educational attainment. Finally, our survey was conducted prior to the pause of the Johnson & Johnson vaccine distribution due to safety concerns which may be contributing to increased vaccine hesitancy.27 Overall, our findings suggest that targeted efforts will be needed to ensure high uptake and coverage of COVID-19 vaccination in US children.14 They also show that providing evidence of the safety of vaccines and educating parents about the importance of vaccinating children may help in efforts to reach the levels of coverage that will be needed to reach herd immunity.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.12.21257080: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenetic reconstruction: The African sequences were aligned against the reference panel using MAFFT v7.471 (23).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Prior to phylogeographic reconstruction each cluster/lineage was assessed for molecular clock signal in TempEst v1.5.3 (30) following the removal of potential outliers that may violate the molecular clock assumption.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TempEst</div><div>suggested: (TempEst, RRID:SCR_017304)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Markov Chain Monte Carlo (MCMC) analyses were set up in BEAST v1.10.4 in duplicate for 100 million interactions and sampling every 10,000 steps in the chain.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BEAST</div><div>suggested: (BEAST, RRID:SCR_010228)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Convergence for each run was assessed in Tracer v1.7.1 (ESS for all relevant model parameters >200).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Tracer</div><div>suggested: (Tracer, RRID:SCR_019121)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Country level maps of each variable were created using ArcGIS® by ESRI version 10.5 (http://www.esri.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ArcGIS®</div><div>suggested: (ArcGIS for Desktop Basic, RRID:SCR_011081)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a protocol registration statement.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.02.09.21250610: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The primary studies under which the samples were collected received ethical clearance from PATH Institutional Review Board (IRB) (approval number 00004244).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Image Analysis: Rapid antigen test result images were captured via the iPhone E25Bio Passport application (currently only available via TestFlight) and analyzed using image processing software, Image J (NIH), to machine-read and quantify test results.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Image J</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:However, performing individual antigen testing on a single nasal swab specimen can present further cost and logistical limitations when the frequency of antigen testing is increased, especially for wide-scale surveillance. For pooled sample testing, nasal swabs are collected from up to 20 individuals, each of the nasal swabs are then resuspended into 0.3-0.5 ml solution, and 50 μl from each nasal swab specimen is pooled into a mixture before applying 100 μl to a rapid antigen test (Fig. 2). If a pool tests negative by an antigen test, then all of the constituent nasal swab specimens are assumed negative. If a pool tests positive by the antigen test, then the constituent nasal swab specimens are putatively positive and should be re-tested in mini pools. If a mini pool remains positive, then antigen testing on individual nasal swab specimens can be performed. Pooled testing using rapid antigen tests is a cost-effective and public health conscious approach to expanding SARS-CoV-2 surveillance, thus further enabling societal reopening, especially in instances where capacity and resources are constrained. Our results show that the rapid antigen test can detect SARS-CoV-2 positive nasal swab specimens up to Ct value 30.1, even when the positive specimen is combined with 19 negative nasal swab specimens. While our experiments suggest that a pooling strategy for antigen testing may be beneficial for SARS-CoV-2 surveillance and identification of individuals during the infectious phase...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.11.443708: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The remaining 574,324 were imported to CryoSPARC and non-uniform refinement was used to get the orientation of each particle.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 14. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.10.21256933: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was conducted in compliance with the Declaration of Helsinki and approved by the COVID-19 scientific and ethics committee of the Leiden University Medical Center with number coco 2020-033.<br>Consent: Furthermore a waiver for the requirement for informed consent was granted.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Statistical analysis and model development: The sample size calculation was based the sample size of the registration study of the cytokine release syndrome indication for tocilizumab approved by the FDA for.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tocilizumab concentrations were determined with a validated ELISA-method using rabbit anti-tocilizumab antibodies to capture tocilizumab, and rabbit anti-tocilizumab F(ab’)2 fragments for detection as described earlier.10, 11 The lower limit of quantification (LLOQ) in plasma was 0·2 ug/mL; the overall precision and accuracy were 8% and 93%, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-tocilizumab</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-tocilizumab F(ab’)2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the development of alternative dosing schedules Monte Carlo simulations in NONMEM using the final model were performed to assess whether the bodyweight dosing or fixed dosing was more appropriate to reduce variability in tocilizumab exposure.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NONMEM</div><div>suggested: (NONMEM, RRID:SCR_016986)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Our study has some limitations. Due to the observational study design and unpredictable course of COVID-19 patients during ICU admission sampling could be not performed in an equal manner for all patients. Nevertheless the population approach used in the analysis allows to draw solid conclusions from unevenly distributed datasets. Furthermore a total of no less than 139 samples resulted in reliable pharmacokinetic parameter estimates. The sample size is relatively low, but similar to the dataset that was required (30 patients 140 samples) to obtain a FDA registration for CRS of tocilizumab, and model performance was good.9 In conclusion, our findings strongly support fixed dosing of tocilizumab in ICU admitted COVID-19 patients with a dose of 600 mg, as it leads to less variability in exposure compared to the currently applied bodyweight dosing. In patients with low bodyweight the fixed dose will avoid relative under-exposure, while in patients with high bodyweight the fixed dosing strategy will avoid unnecessary overexposure and excessive costs. Our findings also suggest that alternative cost saving regimens with even lower doses than 600 mg are likely to be as effective.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.10.21256978: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: No ethics board approval was needed for this research paper, as this information was available in the public domain.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.07.21256852: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:These results should be interpreted within the context of several limitations. We assumed that vaccine effectiveness was constant starting 14 days after administration and continuing throughout the 360-day simulation. Early data suggest that post-vaccination immunity lasts at least for months, with additional data accruing as the studies continue their prolonged observation periods.1–3,45,46 There may be economies of scale such that the cost per person vaccinated decreases as the vaccine supply or vaccination pace increase and vaccination program resources are used more efficiently. Our modeled vaccination prioritization was based exclusively on age and not on employment type, comorbidity presence, or urban/rural heterogeneity in epidemiology or vaccination delivery. We did not include lifetime costs of health care beyond COVID-19 nor of sequelae among those who recover. We did not consider the impact of COVID-19 or vaccination on other health care programs (e.g., HIV and tuberculosis care) or on other economic sectors. As with all modeling exercises, our results are contingent on assumptions and input parameters. We selected COVID-19 clinical parameters based on the published literature. Where data were limited, lacking, or uncertain, we conducted sensitivity analyses. In summary, we found that a COVID-19 vaccination program would reduce infections and deaths and likely reduce overall health care costs in South Africa across a range of possible scenarios, even with conservat...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.12.443357: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.12.443228: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics statement: All mice involved in the experiments were approved by the Biomedical Research Ethics Committee of the Institute of Biophysics of the Chinese Academy of Sciences and were performed in compliance with the Guidelines for the Care and Use of Laboratory Animals of the Institute of Biophysics.<br>IACUC: Non-human primates, Rhesus macaques immunogenicity studies were performed in the animal facility of Guangxi Fangchenggang Biotechnology Development Co., Ltd. (GFBDCL), according to the guidelines of the Committee on Animals of GFBDCL (approval No.: SYXK2018-0004/200005).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animals: Female (6-8-week-old) BALB/c mice and C57BL/6J mice were obtained from Vital River (Beijing) and bred under specific pathogen-free (SPF) conditions in the animal facility of the Institute of Biophysics and the Institute of Microbiology, Chinese Academy of Science.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Immunogenicity of I-P-R-F in rhesus macaques: To evaluate the immunogenicity of I-P-R-F in non-human primates, a total of 10 rhesus macaques (5 male and 5 female, weighing 3∼5 kg) purchased from Guangxi Fangchenggang Biotechnology Development Co., Ltd. were randomly assigned into four groups with one male and one female in each group and intramuscularly immunized with high does(50 μg) or low dose(10 μg) of I-P-R-F with or without alum as adjuvant two times at a 14-day interval.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The ploy-histidine tagged hACE2, rabbit anti-SARS-CoV-2 nucleocapsid, and HRP-conjugated goat anti-rabbit IgG (H+L) antibody antibodies were purchased from Sino Biological lnc. (Beijing, China).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 nucleocapsid,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were then washed with PBST (PBS containing 0.05% Tween 20) and incubated with goat anti-mouse IgG-HRP (1:5000, Cwbiotech) or goat anti-monkey IgG-HRP (1:10000, Invitrogen) at 37°C for 30 minutes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2×106 cells were blocked with anti-CD16/32 (anti-FcγIII/II receptor, clone 2.4G2) and stained with specific fluorescence-labeled antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD16/32 (anti-FcγIII/II receptor,</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blood was collected at indicated time points, and the SARS-CoV-2 specific IgG and neutralization antibody titers in serum were determined.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 specific IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, human immunodeficiency virus backbones expressing firefly luciferase (pNL43R-E-luciferase) and pcDNA3.1 (Invitrogen) expression vectors encoding the SARS-VoV-2 S protein were co-transfected into 293T cells (ATCC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus was stock and amplified in Vero-E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 RBD protein (rRBD) was also expressed in 293F cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293F</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The anti-viral activity of IFNα: The IFNα bioactivity was determined by the anti-viral infection assay using the L929 fibroblast cell line sensitive to VSV infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>L929</div><div>suggested: ECACC Cat# 86032004, RRID:CVCL_4238)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To evaluate the neutralization of vaccinated mice serum, 293-hACE2 cells were seeded into 96-well plates (2×104 per well) and 3-fold serially diluted heat-inactivated serum samples were incubated with 100 TCID50 of pseudovirus for 1 hour at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mixture was incubated for 1 hour at 37°C and then transferred to the 96-well plates seeded with Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animals: Female (6-8-week-old) BALB/c mice and C57BL/6J mice were obtained from Vital River (Beijing) and bred under specific pathogen-free (SPF) conditions in the animal facility of the Institute of Biophysics and the Institute of Microbiology, Chinese Academy of Science.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: RRID:IMSR_JAX:000664)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Female (6-8-week-old) BALB/c or C57BL/6 mice were immunized intramuscularly or subcutaneously with different immunogens in 100μL using insulin syringes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, human immunodeficiency virus backbones expressing firefly luciferase (pNL43R-E-luciferase) and pcDNA3.1 (Invitrogen) expression vectors encoding the SARS-VoV-2 S protein were co-transfected into 293T cells (ATCC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNL43R-E-luciferase</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, the coding sequence for RBD with a 6 x his tag on C terminus was cloned into the pEE12.4 vector without a human IgG1 Fc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pEE12.4</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, the pseudovirus was produced by co-transfection of the plasmid expressing firefly luciferase (pNL43R-E-luciferase) and pcDNA3.1 expressing the SARS-CoV-2 spike protein into 293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The coding sequence for SARS-CoV-2 RBD spanning S protein 319-541 (GenBank: YP_009724390) was codon-optimized for mammalian cells and synthesized by GENEWIZ, China.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GENEWIZ</div><div>suggested: (GENEWIZ, RRID:SCR_003177)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The fluorescence imaging data were analyzed by Living Image software (PerkinElmer).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Living Image</div><div>suggested: (Living Image software, RRID:SCR_014247)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All the samples were acquired by BD LSRFortessa flow cytometer (BD Bioscience), and the data were analyzed with Flowjo software (TreeStar).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Bioscience</div><div>suggested: (BD Biosciences, RRID:SCR_013311)</div></div><div style="margin-bottom:8px"><div>Flowjo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantification and statistical analysis: All statistical analyses were performed using Graphpad Prism 8.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 33, 37 and 38. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.10.21256423: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used bedtools merge 56 to identify 24 genome-wide-significant unique loci.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>bedtools</div><div>suggested: (BEDTools, RRID:SCR_006646)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We obtained a token from https://ldlink.nci.nih.gov/?tab=apiaccess and interrogated the 1000 Genomes LD structure using the LDproxy function.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://ldlink.nci.nih.gov/</div><div>suggested: (LDMatrix, RRID:SCR_017391)</div></div><div style="margin-bottom:8px"><div>1000 Genomes</div><div>suggested: (1000 Genomes Project and AWS, RRID:SCR_008801)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.08.21256891: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression and purification of M-MLV and BstLF: The M-MLV gene was synthesized as a Gblock from IDT and cloned into at pET-19b vector with N-terminal 10x His-tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-19b</div><div>suggested: RRID:Addgene_153312)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BstLF DNA sequence from the OpenEnzyme collection was cloned into pET15b with a 6x His-tag at its N-terminus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET15b</div><div>suggested: RRID:Addgene_129689)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Both DNAs can be obtained from the Open Bioeconomy Lab and/or FreeGenes collection32.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FreeGenes</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:A potential limitation of our proof of concept method is that the use of intercalating dyes can make target-specific real-time detection challenging44, and could pose as a barrier for use in resource limited areas. Future lower resource implementations of our method could substitute EvaGreen for 100-200 µM halochromic dyes, like Cresol Red, in pH 8.8 buffered reaction mix to cause detectable colorimetric change when amplification products have been produced47. Alternatively more advanced detection methods utilizing sequence specific methods based on the use of probes (e.g. LAMP-BEAC23, OSD48, DARQ49 and QUASR50) could also be utilized as end-point detection methods, and remain to be tested in future work. Such methods would be advantageous as they could be multiplexed for different targets in the same reaction. QUASR, for instance, has been shown to allow single step and close-tube multiplexing50. The versions of both M-MLV and BstLF enzymes used in this paper are in the public domain in Chile but some of the M-MLV mutations are still subject to protection in other jurisdictions e.g. in the US (patent no. US7056716B251) with anticipated expiration date of 15 March 2021. Future work will, therefore, explore the use of off-patent enzymes Open-MMLV or HIV RT15 from the E. coli expression toolkit from ReClone initiative52 in order to have freedom-to-operate in any country. The use of public domain enzymes would also permit commercial partnerships seeking to scale-up production lo...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.11.21257008: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The Mass General Brigham institutional review board deemed the analysis of de-identified data did not constitute human subjects’ research (2020P003530).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were conducted using STATA 15.1 (StataCorp, College Station, TX).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Our study had several limitations. First, we analyzed laboratory-based testing data and could not account for individuals with repeat testing. Second, we were unable to collect detailed socioeconomic data like household size in order to control for confounding factors. Data collection was also incomplete for some fields making further statistical analyses and modeling not possible. However, the strengths of our study were the very large sample size, thus improving precision of our results, the unbiased collection of exposure data prior to receiving testing results, and the inclusion of numerous testing sites across California, improving the generalizability of our results.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.11.443686: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant sfGFP-ACE2 was transiently expressed in Expi293 cell and secreted into the culture medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus neutralization assay: The pseudovirus neutralization assays were performed using 293T cells overexpressing ACE2 and pseudoviruses expressing full-length S protein provided by RNAi Core of Academic Sinica</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The DNA sequence corresponding the residues 1-1208 of S-UK was subcloned into the mammalian expression vector pcDNA3.4-TOPO (Invitrogen), which contains a foldon trimerization domain based on phage T4 fibritin followed by a c-myc epitope and a hexa-repeat histidine tag as described previously28.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.4-TOPO</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression and purification of sfGFP-ACE2: The sfGFP-ACE2 construct was obtained from Addgene (Plasmid #145171), which was deposited by Erik Proco (University of Illinois,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>sfGFP-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After motion correction, all corrected micrographs then were transferred to cryoSPARC v2.1432.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cumulated epitope counts were mapped onto the crystal structure of RBD in complex with ACE2 (PDB accession code 6M0J) and rendered by using Pymol (Schrodinger Inc. U. S. A.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pymol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IC50 was determined by a four-parameter logistic regression using GraphPad Prism (GraphPad Software Inc.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.09.21256929: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We did an extensive search on databases namely PubMed central, Google Scholar, Cochrane, Science Direct and EMBASE for open access studies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div><div style="margin-bottom:8px"><div>Google Scholar</div><div>suggested: (Google Scholar, RRID:SCR_008878)</div></div><div style="margin-bottom:8px"><div>EMBASE</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:The major limitation for this systematic review is the presence of confounder factors as the majority of the Parkinson’s diseases patients are elderly with other comorbidities. Also the duration of the diseases and the severity of the symptoms may influence the clinical outcome of covid-19 infection. Important information including patients medication compliance which might affect the coveted 19 infection outcome were lacking as well.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.10.21256966: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study oversight and design: The ELISA (Lübeck Longitudinal Investigation of SARS-CoV-2 Infection) study was approved by the ethics committee of the University of Lübeck (Az. 20-150) and sponsored by the Federal Ministry for Education and Research (BMBF), the State of Schleswig-Holstein, the University of Lübeck, and by a crowd-funding campaign organized by the University of Lübeck.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">, 2145 individuals matched by age and sex distribution of the study region were randomly drawn to comprise a population-based group.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: , Lübeck, using validated PCR platforms.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All participants were tested for current or previous SARS-CoV-2 infection using nucleic-acid and anti-spike protein (extracellular S1 part) IgG antibody testing with support of a mobile app-based questionnaire, electronic scheduling and result reporting system.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-spike protein ( extracellular S1 part ) IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The EUROIMMUN SARS-CoV-2 S1 IgG (#EI 2606-9601-2 G) ELISA was performed according to the manufacturer’s instructions for examination time-points 1, 6, and 7 and partially for time-points 3 and 5 for participants with increased anti-S1 IgG antibody titers at time-point 1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S1 IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Participants with an antibody titer against the S1 antigen of >1.1 (compared to an anti-S1 IgG-positive reference serum provided by the manufacturer in the ELISA detection system) were defined as anti-S1 IgG antibody-positive.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S1 IgG-positive</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-S1 IgG antibody-positive.</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These numbers were supported by mobility data from Google, which noted a significant increase in the use of public transportation relative to all of Germany (p-value <10^-30, moderated F-test) including other German touristic hotspots, particularly Bavaria (Figure 2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Google</div><div>suggested: (Google, RRID:SCR_017097)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Limitations are the relatively wide-spread examination time-points in the fall/winter 2020/2021 and overrepresentation of highly motivated study participants with a slightly above-average education level. In conclusion, we i) provide a model for effective, regional surveillance of the pandemic; ii) underscore the role of vaccination especially in low-prevalence regions remaining far from herd immunity; iii) identify plausible infection risk factors informing public health measures; iv) demonstrate that easing of lockdown measures appears safe even over several months at times of very low prevalence rates; v) underline that continuous monitoring of infections and immediate and consequent imposition of appropriate measures are mandatory to contain virus spread in case of an incipient rise in infection rates.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.08.21256881: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Week 2 (14/10/2020) and Week 3 (21/10/2020) samples were not collected due to the occurrence of multiple rainfall events. 2.2. Sample Fractionation: After collection, samples were packed in a disposable pack to avoid leakage during the transportation.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Long term surveillance (weekly and monthly) was performed for UL-1 with two samples (lake and lake outlet) for four weeks (Week-1 (7/10/2020); Week-4 (28/10/2020); Week-5 (04/11/2020)); Week-6 (18/11/2020)) and monthly monitoring for 7 months (October 2020 to April 2021) were collected.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Week-5</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.07.21256745: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.11.443609: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Patient cohort and clinical data collection: Luminex: SARS-CoV-2 and eCoV-specific antibody subclass/isotype and Fcγ-receptor (FcγR) binding levels were assessed using a 384-well based customized multiplexed Luminex assay, as previously described (59).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>eCoV-specific</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Unbound antibodies were washed away, and antigen-bound antibodies were detected by using a PE-coupled detection antibody for each subclass and isotype (IgG1, IgG2, IgG3, IgG4, IgA1, and IgM; Southern Biotech), and Fcγ-receptors were fluorescently labeled with PE before addition to immune complexes (FcγR2A, FcγR2B, FcγR3A, FcγR3B; Duke Protein Production facility).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-bound</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PE median fluorescent intensity (MFI) is reported as a readout for antigen-specific antibody titers.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.10.21256996: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.10.443532: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">After 24 h incubation, five fields were randomly selected in each well to count the number of nuclei in fused and unfused cells.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells, antibodies and reagents: HEK 293T cells (ATCC CRL-3216 from American Type Culture Collection, Rockville, MD) and HEK 293T Lenti-X (Clontech/Takara Bio) were cultured at 37°C in 5% CO2 in Dulbecco’s modified Eagle’s medium (DMEM; Life Technologies) supplemented with 10% fetal bovine serum (FBS; Gibco), 2 mM L-glutamine (Life Technologies), and antibiotics (100 U/ml penicillin and 100 μg/ml streptomycin; Life Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibiotics</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike protein S2 monoclonal antibody (1A9), PDI mouse antibody (Clone: RL90), Alexa 594- and Alexa 488-conjugated antibodies against mouse and rabbit IgG, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PDI</div><div>suggested: (Thermo Fisher Scientific Cat# MA3019A488, RRID:AB_2633336)</div></div><div style="margin-bottom:8px"><div>rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">rabbit monoclonal antibody, the Calnexin (C5C9) rabbit monoclonal antibody and the FLAG-tag (D6W5B)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FLAG-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The eluted samples were separated by SDS-PAGE and analyzed by Western blotting using anti-FLAG M2 monoclonal antibody or SARS-CoV/SARS-CoV-2 Spike protein S2 monoclonal antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-FLAG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV/SARS-CoV-2 Spike protein S2</div><div>suggested: (Thermo Fisher Scientific Cat# MA5-35946, RRID:AB_2866558)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Input lysates and pulldown proteins were analyzed by western blotting with the anti-FLAG M2 monoclonal antibody (Sigma) and anti-GAPDH monoclonal antibody (Cell Signaling) as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-GAPDH</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Digested proteins were analyzed by Western blotting with anti-M2 FLAG monoclonal antibody (Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-M2 FLAG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells, antibodies and reagents: HEK 293T cells (ATCC CRL-3216 from American Type Culture Collection, Rockville, MD) and HEK 293T Lenti-X (Clontech/Takara Bio) were cultured at 37°C in 5% CO2 in Dulbecco’s modified Eagle’s medium (DMEM; Life Technologies) supplemented with 10% fetal bovine serum (FBS; Gibco), 2 mM L-glutamine (Life Technologies), and antibiotics (100 U/ml penicillin and 100 μg/ml streptomycin; Life Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: ATCC Cat# CRL-3216, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In order to transduce cells with pseudovirions, virus was added either to mock transfected 293T or ACE2-transfected 293T cell lines at 24 hr post-transfection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Treatment with N-glycosylation processing inhibitors and glycosidases: Tunicamycin (TM) and Kifunensine (KIF) at a concentration of 1 μg/ml and 5 μg/ml, respectively, were used to inhibit N-glycosylation in transfected HEK-293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids: The plasmids, pCDNA3.1-hACE2-FLAG and pCDNA3.1-pACE2-FLAG, which express human ACE2 (GenBank accession number NM_021804.3) and pig ACE2 (GenBank accession number NM_001123070.1) fused to a FLAG epitope, respectively, were purchased from GenScript, as well as the pCDNA3.1-TMPRSS2-FLAG expressing TMPRSS2 ( GenBank accession number NM_005656.4) fused to a FLAG epitope.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA3.1-hACE2-FLAG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCDNA3.1-pACE2-FLAG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCDNA3.1-TMPRSS2-FLAG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pCDNA3.1-SARS2-Spike expressing full-lengh Spike (S) protein from SARS-CoV-2 (GenBank accession number QHD43416.1) was purchased from Addgene.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA3.1-SARS2-Spike</div><div>suggested: RRID:Addgene_145032)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell surface biotinylation assay: Human 293T cells were transiently transfected with plasmids encoding FLAG-tagged hACE2 variants or FLAG-tagged pACE2 protein for 24h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate these viruses, Lenti-X 293 T cells (Takara Bio) grown in 10 cm dish were transiently transfected with the following plasmids: 5 µg of pLenti-GFP (Cell Biolabs), 6 µg of psPAX2 and 0.9 µg of pCMV-VSVG (Cell Biolabs), or 0.9 µg of pCDNA3.1-SARS2-SpikeΔ19, or 0.9 µg of pCDNA3.1-SARS-Spike using the TransIT®-LT1 Transfection Reagent (Mirus) according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLenti-GFP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>psPAX2</div><div>suggested: RRID:Addgene_12260)</div></div><div style="margin-bottom:8px"><div>pCMV-VSVG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCDNA3.1-SARS2-SpikeΔ19</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCDNA3.1-SARS-Spike</div><div>suggested: RRID:Addgene_145031)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following antibodies were purchased from Thermo Fischer: SARS-CoV/SARS-CoV-2</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo Fischer</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The images were processed with NIS-elements software (Nikon).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NIS-elements</div><div>suggested: (NIS-Elements, RRID:SCR_014329)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 56 and 54. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.12.443888: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Limitations: As this study was aimed at using in-depth phenotypic characterization as a discovery tool, it focused on deeply interrogating many different conditions (e.g., spike variants, longitudinal sampling) rather than many donors. Therefore, although a total of 120 CyTOF specimens were run, only 8 donors were analyzed. The findings reported here should be confirmed in larger cohorts. A second limitation of the study was the need to stimulate the specimens in order to identify and characterize the vaccine-elicited T cells. We limited peptide exposure to 6 hours to minimize phenotypic changes caused by the stimulation. We note that at this time, stimulation with peptides is the only way to identify SARS-CoV-2-specific CD4+ T cells as robust MHC class II multimer reagents for SARS-CoV-2 are not available currently. Finally, the analysis focused on CD4+ T cells because the overall numbers of detectable spike-specific CD8+ T cells were low. Nonetheless, the main findings we made with the CD4+ T cells – that they recognize variants equivalently, and that the phenotypes of the responding cells differ by prior SARS-CoV- 2 natural infection status – were recapitulated among CD8+ T cells. Additional studies in a larger number of participants testing more cells, and implementing the use of MHC class I tetramers, would increase the ability to characterize in greater depth the vaccine-elicited CD8+ T cell response.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.11.443693: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: All work with infectious SARS-CoV-2 was carried out in a biosafety level 3 (BSL3) facility following approved protocols.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral Propagation: Vero E6 cells were obtained from the American Type Culture Collection (ATCC CRL-1586) and cultured at 37°C, 5% CO2 in DMEM with 10% fetal bovine serum (FBS), 1% penicillin/streptomycin, and 1% L-Glutamine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation with the primary MAb, cells were washed three times with PBS, and developed with the Vectastain ABC kit and DAB Peroxidase Substrate kit (Vector Laboratory, Inc., CA, USA) according to the manufacturers’ instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vector Laboratory</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All plates were imaged on the InCell2200 and FFU quantified using Columbus Analysis software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Columbus Analysis</div><div>suggested: (CalR, RRID:SCR_015849)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Acquired data were analyzed using Millipore Sigma Belysa™ v1.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Millipore Sigma Belysa™</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses: Statistical significance was determined using Prism v9.0.1 software (GraphPad Software, San Diego, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:A major limitation of these models is that we were only able to study the local epithelial-driven response by itself, without the contribution of myeloid cells or lymphocytes, which are important in mounting an appropriate innate immune response against viral infections. In general, we observed that both tracheobronchial and alveolar ALI tissues are capable of mounting a local epithelial-driven response to IAV and SARS-CoV-2 virus infection. Overall, IAV infected tissues had a stronger and earlier inflammatory response than SARS-CoV-2 infected ALI tissues, including inflammatory as well as anti-inflammatory immune modulators. And although myeloid cells were not included in this model, we hypothesize that the addition of the myeloid compartment in both tissues will show a more pronounced immune response that may reflect more accurately the different stages of human COVID-19 and severe influenza disease progression. Future studies will address the contribution of the lung epithelium and its role in recruiting additional inflammatory immune cells. While there has been intense high-throughput screening efforts to discover potential antivirals for SARS-CoV-2, relatively few compounds have proven to be effective in clinical settings. Most of the studies published have relied on traditional mono-cellular tissue culture models, which do not allow crosstalk among different cell populations. In some cases, relying on in vitro activity profiles may prove detrimental. This is the case fo...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.12.443645: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.11.443286: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Ethics: All animal work was approved by the Animal Care Committees of The University of Toronto.<br>IACUC: Ethics: All animal work was approved by the Animal Care Committees of The University of Toronto.<br>Consent: For studies involving human samples, written informed consent was obtained from convalescent COVID-19 patients, and samples were obtained and used according to a research ethics board (REB) approved protocol (St.<br>IRB: For studies involving human samples, written informed consent was obtained from convalescent COVID-19 patients, and samples were obtained and used according to a research ethics board (REB) approved protocol (St.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mouse vaccination: Female C57BL/6 mice of 6-to 8-week old were vaccinated intramuscularly twice with a 3-week interval.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">All animals were randomly assigned to different treatment groups.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">The performers measuring SARS-CoV-2 neutralization by mice sera and SARS-CoV-2 virus in mouse tissues and the pathologist examining animal pathology were blinded to the sample groupings.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">The sample size of mice was determined by power analysis assuming 60% protection efficacy.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Wells were then washed 3 times with 200µL PBST before incubation for 1 hour with secondary antibodies (HRP-labeled Goat anti-mouse IgG1/IgG2b/IgG2c purchased from SouthernBiotech or HRP-labeled Goat anti-mouse IgG Fcγ purchased from Jackson ImmunoResearch, West Grove, PA) in 1% w/v milk powder in PBS-T.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG1/IgG2b/IgG2c</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following a 0.2 µm filtration process, the LNPs were subjected to quality tests including RNA concentration, encapsulation efficiency, particle size, pH and osmolality. mRNA transfection of HEK293T cells and detection of the expressed immunogens: S mRNA, Sfurinmut mRNA, and RBD mRNA were transfected into HEK293T cells using Lipofectamine® MessengerMAX™ transfection reagent (Thermo Fisher Scientific, Mississauga, ON, Canada) according to the manufacturer’s protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serial dilutions of the sera were mixed with 100 TCID50 SARS-CoV-2 virus (isolate SARS-CoV-2-SB2-P3 PB Clone 1, passage 3(40)) in serum free DMEM, incubated at 37°C for 1 hour, and then added onto the VeroE6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the neutralization assay, diluted mouse sera (1:40 from stock sera) were serially diluted (from 2.5 to 4-fold dilutions over 7 dilutions to encompass a complete neutralization curve per sample) and incubated with diluted pseudovirus at a 1:1 ratio for 1 hour at 37°C before being transferred to plated HEK293T-ACE2/TMPRSS2 cells and incubated for an additional 48 hours at 37°C and 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2/TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse vaccination: Female C57BL/6 mice of 6-to 8-week old were vaccinated intramuscularly twice with a 3-week interval.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In some experiments, both male and female BALB/c mice of 6-to 8-week old were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An E gene DNA standard (pUC57-2019-nCoV-PC:E, GenScript, Piscataway, NJ) was also run at the same time for conversion of Ct value to genomic copies, by using the Rotor-Gene Q software (QIAGEN).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pUC57-2019-nCoV-PC:E</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FlowJo (BD) was used to analyze the flow cytometry data.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">OD values of each PTX-COVID19-B vaccinated mouse serum minus average of OD values of 4 tdTomato control mouse sera at the same dilution were used to calculate EC50 titer using the 4-parameter logistic regression analysis in GraphPad Prism 8 (GraphPad Software, La Jolla, CA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analysis was performed by using GraphPad Prism 8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04765436</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">PTX-COVID19-B, an mRNA Humoral Vaccine, is Intended for Prev…</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a protocol registration statement.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.11.21257016: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Furthermore, presence of infectious virus detectable by propagation in Vero cell culture was determined for the individual pools.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:A limitation of the study is its spot check nature since it cannot address variations between different batches of the same product, or variations between different test locations (see also the tandem publication of Puyskens et al). In conclusion, by using the same panel for a large number of different SARS-CoV-2 Ag RDT we were able to evaluate the comparative performance of the different tests under the same conditions. The evaluation panel proved to be accurate for sensitivity differentiation of SARS-CoV-2 Ag RDTs, distinguishing better performing from less suitable tests. The continuation of the comparative evaluation is needed cope with the rapidly growing market of SARS-CoV-2 Ag RDT. Since the panel has now been exhausted, we will continue the evaluation with a new set of samples with similar features, accurately calibrated against its predecessor.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.10.21256999: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.10.21256644: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a protocol registration statement.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.10.21256855: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.08.21256879: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Also, unlike semi-public and private data, our data did not require informed consent (13).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For data preparation and analysis, we used Microsoft Excel 2019 and IBM SPSS Statistics 25.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.07.21256856: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.07.21256803: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Participants provided written informed consent, and the study was approved by the Japan National Hospital Organization Central Ethics Review Board for Clinical Research (Meguro, Tokyo, Japan).<br>IRB: Participants provided written informed consent, and the study was approved by the Japan National Hospital Organization Central Ethics Review Board for Clinical Research (Meguro, Tokyo, Japan).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In participants with or without a prior history of COVID-19, we compared RT-PCR test or IgG/IgM antibody levels against SARS-CoV-2 proteins S and N by using two-sided Wilcoxon Mann-Whitney tests.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG/IgM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantitative measurement of SARS-CoV-2 neutralizing antibodies: Participants were randomly contacted based on stratification into two groups: RT-PCR-positive or anti-SARS-CoV-2 IgG/IgM-positive with history of symptomatic COVID-19 (Group I) and asymptomatic COVID-19 and RT-PCR or anti-SARS-CoV-2 IgG/IgM-negative people (Group II).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 IgG/IgM-positive</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 IgG/IgM-negative</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We investigated the binding of the spike glycoprotein Y453F mutant of SARS-CoV-2 to human ACE2 and determined the affinity of Y453F, N501Y, and E484K mutants of the spike glycoprotein of SARS-CoV-2 to six neutralizing monoclonal antibodies using the MOE program (three-dimensional protein structure modeling, protein-protein docking analysis: MOLSIS Inc., Tokyo, Japan) and Cn3D macromolecular structure viewer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>N501Y</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were performed using XLSTAT version 2021.2 (Addinsoft &Vose Software, NY, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>XLSTAT</div><div>suggested: (XLSTAT, RRID:SCR_016299)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.08.21256893: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethical approvals: This study was approved by the ethical committee and institutional review board of San Raffaele Research Hospital in Milan, Italy.<br>IRB: Ethical approvals: This study was approved by the ethical committee and institutional review board of San Raffaele Research Hospital in Milan, Italy.<br>Consent: All patients and healthy controls agreed to the study by signing the informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">They were all adults, females and males were equally represented.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.07.21256865: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Another limitation of the study is that a quarter of the households surveyed in January 2020 could not be reached over the phone by November 2020. We cannot exclude that households with a member who recently died is less likely to pick up the phone or less willing to participate in the survey. Our approach to calculate aggregate mortality using demographic group-level mortality corrects for it, to the extent that mortality estimated for a particular age, sex and education group is not biased by attrition. The repeated census approach may also not have entirely eliminated a tendency not to report a recent death, especially if it was associated with COVID-19 symptoms because of widely reported stigma, especially at the beginning of the pandemic (21). We have separate evidence from our survey that COVID-19-like symptoms were under-reported by affected households on the basis of responses from neighboring households integrated at the village and para level. Various hypotheses have been proposed to explain the apparently lower impact of COVID-19 in some low-income countries (22). The effect of a relatively young population cannot be a factor in our study given that we are comparing the same population over two years. Spending more time outside or in well-ventilated houses has been invoked as an explanation, but another possibility is that previous infections in regions like rural Bangladesh could have dampened the symptoms of COVID-19 (23). Mobility data and our economic impact da...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.09.21256922: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Numerical attributes for the analysis of potential cofactors include Social Capital index (State-Level, Using County-Level Methods, and County-Population-Weighted Index, as well as various sub-indexes which are listed and briefly explained at the end of this subsection), pre-pandemic population, pre-pandemic GDP (per capita and total), age distribution (with brackets of 0-18, 18-25, 26-34, 35-54, 55-64, and 65+), pre-pandemic (January 2020) number of unemployed persons and unemployment rate, homelessness, shelter beds, incarceration number and rate, population density (people per square mile in 2015), urban overcrowding (number of houses having >1 person per room), severe urban overcrowding (number of houses having >1.5 people per room), percent population by ethnicity (White, Black, Hispanic, American Indian/Alaska Native, and Native Hawaiian/Other Pacific Islander categories), %population with obesity, health insurance status (divided into categories of Ensured by Employer, Ensured by Non-Group, Ensured by Medicaid, Ensured by Medicare, Ensured by Military, and Uninsured), number of hospital beds per thousand individuals (divided into categories of Government, Non-Profit Hospital, and For-Profit Hospital, as well as total beds per thousand), portion of adults who report not seeing a doctor due to cost (male, female, and all adults), adults who reported asthma (male, female, and all adults), adults told they Have COPD/Emphysema/Chronic Bronchitis, adults who reported having diabetes (with pregnancy related cases being counted separately, as well as those with borderline or pre-diabetes), and adults who reported cardiovascular disease (male, female, and all adults).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.06.21256768: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The Institutional Review Board at Stanford University reviewed and approved the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">From among the 17,390 seronegative patients in January 2021, we used systematic sampling with fraction intervals stratified by age to randomly select 4,346 persons to follow with monthly SARS-CoV-2 serology assays, in association with type and date of vaccination(s) (Figure 1).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: This assay is reported by the manufacture to have 100% sensitivity and 99.8% specificity for tests performed ≥14 days after a positive reverse transcriptase polymerase chain reaction test17; it has been validated independently with similar performance characteristics18,19.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Ascend Clinical tested remainder plasma of patients for SARS-CoV-2 antibody, and anonymized all patient demographic, comorbidity, and laboratory data prior to transfer to Stanford University.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Assay Characteristics: We tested remainder samples using the Siemens’ total RBD Ig assay, which measures IgG and IgM antibodies, in January 2021 and monthly thereafter in the seronegative prior to vaccination cohort.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Limitations of the study include the modest sample size. Our assessment was performed during the early phase of vaccine roll out, a time period during which elderly or persons with comorbidities were prioritized. Estimates for vaccine response may improve over time as a broader patient population receives vaccination, although 40% of our cohort was < 65 years of age indicating reasonable representativeness by age of patients receiving dialysis. Antibody titers are only one way to assess immunologic response to vaccination. We do not yet know whether the strength or duration of a measurable antibody response correlates with protection from infection. In summary, in a well-characterized cohort of patients receiving dialysis with and without prior evidence of infection with SARS-CoV-2, more than one in five demonstrated an attenuated immune response after vaccination with one of three vaccines granted emergency use authorization by FDA. These findings may inform subsequent vaccination strategies in the ESKD population and in other persons with chronic illness.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.08.21256892: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.11.21256992: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The Research Ethics Board of the Canadian Blood Services and Lunenfeld-Tanenbaum Research Institute (LTRI) (REB study #20-0194-E) approved this study and exempted study-specific consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Each month 1500 deidentified samples were randomly selected by collection site.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Each sample was tested for SARS-CoV-2 IgG antibodies using four assays.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Abbott Architect SARS-Cov-2 IgG assay which targets the nucleocapsid antigen (Abbott-NP), (Abbott, Chicago IL) and three in-house IgG ELISA chemiluminescent assays recognizing distinct recombinant viral antigens: full length spike glycoprotein (Spike), spike glycoprotein receptor binding domain (RBD), and nucleocapsid (NP), were tested at the CBS laboratory in Ottawa and the Gingras laboratory [11,12] at the LTRI in Toronto, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott Architect</div><div>suggested: (Abbott ARCHITECT i1000sr System, RRID:SCR_019328)</div></div><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Our study also has weaknesses. This study was conducted among blood donors, based on selection criteria to be allowed to donate blood donors may be healthy than the general population [32]. However, a recent study compared seroprevalence estimates from European blood donors to household surveys targeting the general population and found seroprevalence rates to be very similar [33]. Both CRS and LCA assume each of the assays is conditionally independent. It is possible this assumption may not hold, potentially biasing results. Assay performance is based on predefined thresholds. For the Abbott assay we used the manufacturer’s ≥1.4 cut off, but recent reports do suggest reducing the threshold to >0.8 to increase sensitivity and to account for waning antibody signals. However, the sensitivity and specificity was not available by the manufacture for us to evaluate this alternative threshold. All four assays only probed for IgG meaning that we did not measure IgM and IgA, which may provide some neutralizing capacity in some individuals as anti-SARS-CoV-2 IgG titers begin to rise. In other donors, different profiles of anti-SARS-COV-2 IgM, IgA and IgG may also provide different profiles of humoral protection. Finally, we did not assess for the SARS-CoV-2 neutralizing capacity of donor specimens nor the avidity of the IgG antibody responses in those donors. In conclusion, regardless of the analytical method we found at the end of the first COVID-19 wave, SARS-CoV-2 seroprevalence am...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.11.21256917: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were done using R v3.6.0 software (R Foundation for Statistical Computing) and GraphPad Prism v9 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.07.21256860: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Similar cases can be found in the literature, and therefore, it is important to consider that the compartmental model usually presents limitations for long-term prediction (even more than two months). Despite it, parameter estimation with the data is needed to validate this model, even when further considerations will be added to improve the quality of the fittings. COVID-19 motivates the generalization of the VSIR model with multiple vaccines, but instead of only focusing on this disease, we provided a more general preliminary model, but excluding the compartments of the extended models such as SEIR and SIRD. In this manner, our model attempts to use only the necessary compartments to extend the SIR model with multiple types of vaccines. However, the addition of E, D and other compartments, time-dependent parameters, and specific compartments for one and two doses would improve the model for the sole study of the COVID-19 pandemic. Theoretical analysis showed two important results. Could the vaccination itself manage to eliminate the outbreak? Proposition 4 and its general version 5 provide a negative answer for this question: if the reproduction number and the leakiness of the vaccine are high enough it is impossible to reach ℛc < 1, even with a very high vaccination rate. At the beginning of the pandemic, Billah, Mamun Mian, and Nuruzzaman Khan [5] estimated a summary for the reproductive number, which was 2.87. In this manner, vaccines with εL higher than 0.34843 might re...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.10.443519: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Modeling of fully glycosylated SARS-CoV-2 S protein–antibody complex structures: As reported in our previous work16-17, we have modeled a fully glycosylated full-length SARS-CoV-2 S protein structure by using a combination of computational modeling tools including GALAXY protein modeling suite18-20 for building missing residues and domains, ISOLDE21 for model refinement against experimental density maps, and CHARMM-GUI Glycan Reader & Modeler22-24 and Membrane Builder25-28 for building glycans and a viral membrane.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GALAXY</div><div>suggested: (Galaxy, RRID:SCR_006281)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All simulations were performed using the input files generated by CHARMM-GUI38-40, and we used GROMACS 2018.641 for both equilibration and production with the LINCS algorithm42.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GROMACS</div><div>suggested: (GROMACS, RRID:SCR_014565)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 6. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.11.443592: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All animal treatments and procedures were performed at Acculab, and animal testing and research complied with all relevant ethical regulations and studies received ethical approval by the Acculab Institutional Animal Care and Use Committees (IACUC)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Seven donors were male, and thirteen were female.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Proteins were separated on a 4–12% BIS-TRIS gel (ThermoFisher Scientific), then following transfer, blots were incubated with an anti-SARS-CoV spike protein polyclonal antibodies (S1, Sino Biological #40591-T62; S2, Invitrogen #PA1-41165; RBD, Sino Biological #40592-MP01) then visualized with horseradish peroxidase (HRP)-conjugated anti-mouse or anti-rabbit IgG (Bethyl) (GE Amersham).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV spike protein</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed off, and the plates were developed via a biotinylated anti-IFN-γ detection antibody followed by a streptavidin-enzyme conjugate resulting in visible spots.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IFN-γ</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Whole blood was directly stained using the same viability dye and fluorescently-conjugated antibodies described above for CD3, CD4, and CD8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD8</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibody cocktail also included the canonical Tfh markers CXCR5-biotin (BD Biosciences), PD-1 PE-CF594 (BD Biosciences), and ICOS BV650 (BD Biosciences) in the presence of Fc block (BD Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CXCR5-biotin</div><div>suggested: (Leinco Technologies Cat# C1567, RRID:AB_2828639)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines and In-vitro plasmid expression: HEK-293T (ATCC® CRL-3216™) and African Green monkey kidney COS-7 (ATCC® CRL-1651™) cell lines were obtained from ATCC (Old Town Manassas, VA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: ATCC Cat# CRL-3216, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For in vitro protein expression by Western blot, human embryonic kidney cells, 5.5×105 293T were transfected with 2.5μg pDNA in 6-well plates using Lipofectamine 3000 (Invitrogen #L3000015</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">β-actin Reverse – CAGGGCAGTAATCTCCTTCTG; β-actin Probe – TACCCTGGCATTGCTGACAGGATG) for COS-7 cell line β-actin sequences.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COS-7</div><div>suggested: CLS Cat# 605470/p532_COS-7, RRID:CVCL_0224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pseudotyped stocks encoding for the WT, B.1.1.7, P.1, or B.1.351 Spike protein (Table 2) were produced using HEK 293T cells transfected with Lipofectamine 3000 (ThermoFisher) using IgE-SARS-CoV-2 S plasmid variants (Genscript) co-transfected with pNL4-3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudotyped neutralization: CHO cells stably expressing ACE2 (ACE2-CHOs) to allow permissiveness to SARS-CoV-2, were seeded at 10,000 cells/well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In-vivo immunogenicity: BALB/c mice (6 weeks old, Jackson Laboratory, Bar Harbor, ME) and Syrian Golden Hamsters (8 weeks old, Envigo, Indianapolis, IN) were housed at Acculab (San Diego, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibody cocktail also included the canonical Tfh markers CXCR5-biotin (BD Biosciences), PD-1 PE-CF594 (BD Biosciences), and ICOS BV650 (BD Biosciences) in the presence of Fc block (BD Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PD-1 PE-CF594</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Strain-matched spike sequences (pWT, pB.1.351) were similarly optimized and cloned into identical restriction site locations into the pGX0001 backbone.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pB.1.351</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pGX0001</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines and In-vitro plasmid expression: HEK-293T (ATCC® CRL-3216™) and African Green monkey kidney COS-7 (ATCC® CRL-1651™) cell lines were obtained from ATCC (Old Town Manassas, VA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>In-vitro</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PCR was performed using a single set of primers and probes recognizing the RNA products of all three plasmids (pS-spike forward ATGATCGCCCAGTACACATC, pS-spike reverse CACGCCGATGCCATTAAATC, pS-spike probe AT CACCAGTGGCTGGACATTTGGA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pS-spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pseudotyped stocks encoding for the WT, B.1.1.7, P.1, or B.1.351 Spike protein (Table 2) were produced using HEK 293T cells transfected with Lipofectamine 3000 (ThermoFisher) using IgE-SARS-CoV-2 S plasmid variants (Genscript) co-transfected with pNL4-3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNL4-3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence analysis was performed using custom Python scripts (Python Software Foundation,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">https://www.python.org/) and assembly was performed using Geneious Prime® 2020.2.3 (Build 2020-08-25, Biomatters Ltd., Auckland</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.python.org/</div><div>suggested: (CVXOPT - Python Software for Convex Optimization, RRID:SCR_002918)</div></div><div style="margin-bottom:8px"><div>Geneious</div><div>suggested: (Geneious, RRID:SCR_010519)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization titers (ID50) were calculated using GraphPad Prism 8 and defined as the reciprocal serum dilution at which RLU were reduced by 50% compared to RLU in virus control wells after subtraction of background RLU in cell control wells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed using FlowJo software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(GraphPad Software, San Diego, USA) was used for graphical and statistical analysis of data sets.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Some limitations of the current study include the lack of efficacy testing in a challenge model. Challenge studies to assess efficacy in appropriate animal models are currently in planning for INO-4802. Importantly, it is encouraging that pseudotyped virus nAb titers measured here exceed levels reported to correlate with protection in relevant animal models (Fig. 2b & [45]). The pseudotyped virus testing panel used in this study consisted of currently known VOCs. Over time, additional novel VOCs are expected to emerge or to rise in importance through changing epidemiology. As they emerge, these new variants will be interrogated similarly in our assay platform as a continuous screening read-out. We have reported on the design and testing of a pan-SARS-CoV-2 vaccine, INO-4802. High levels of cross-reactive neutralizing activity against multiple VOCs was demonstrated by pseudotyped virus neutralization, superior to that shown by strain-matched vaccines. Additionally, INO-4802 has shown utility in both prime and heterologous boost immunization scenarios. Vaccination with INO-4802 led to cross-reactive T cell immune responses as well as circulating populations of Tfh cells correlative of both memory and neutralizing antibody responses. In summary, INO-4802 represents a potentially useful pan-SARS-CoV-2 vaccine approach against multiple variants of concern and the data presented in this report supports its further development.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.11.443477: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All animal work was conducted under an approved Yale Animal Use and Care Committee protocol.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animals and housing: Seven-week old female and male SAS outbred Sprague-Dawley rats (150-250g) were purchased from Charles River Laboratories (Wilmington, MA).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Remaining animals were randomly assigned direct contact, fomite contact-cohabitation, and fomite contact-singly housed groups for their second exposure.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound rat antibodies were detected with FITC-conjugated goat anti-rat IgG (Jackson ImmunoResearch).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rat IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Stocks of SDAV were generated in L2p176 cells [34,35].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>L2p176</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animals and housing: Seven-week old female and male SAS outbred Sprague-Dawley rats (150-250g) were purchased from Charles River Laboratories (Wilmington, MA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sprague-Dawley</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.11.443384: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cryo-EM data processing: The dose-fractionated movies were gain-normalized, aligned, and dose-weighted using MotionCor2 (45).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MotionCor2</div><div>suggested: (MotionCor2, RRID:SCR_016499)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Local resolution maps were generated using Relion 3.1 (fig.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Relion</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Namdinator (51) and Coot were used to improve the fit and N-linked glycans were built into the density for both models where visible.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The model for C1 and C3-symmetrized closed conformation was real space refined with Phenix (53), and the quality was additionally analyzed using MolProbity (54) and EMRinger (55), to validate the stereochemistry of the components.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phenix</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div><div style="margin-bottom:8px"><div>MolProbity</div><div>suggested: (MolProbity, RRID:SCR_014226)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Figures were prepared using UCSF chimera and PyMOL (Schrodinger, Inc)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data was plotted using Microsoft excel.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.11.443659: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The results were graphically compiled using ggplot2 package version 3.3.2 in R16.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A categorical Venn diagram of the variant calls was made using the VennDiagram package in R, version 1.6.2017.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VennDiagram</div><div>suggested: (VennDiagram, RRID:SCR_002414)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.10.443524: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nsp2 Expression: SARS-CoV-2 Nsp2, codon optimized for Escherichia coli expression, was cloned in a pET-29b(+) vector backbone with N-terminus 10XHis-tag and SUMO-tag (Ep156).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-29b(+)</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Each collection was performed with semi-automated scripts in SerialEM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SerialEM</div><div>suggested: (SerialEM, RRID:SCR_017293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cys/His residues were manually identified for Zn coordination sites and Zn was placed in COOT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Local resolution was determined by running ResMap program45.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ResMap</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">First three were individually aligned with matchmaker in ChimeraX to the experimental model to assess the similarity and report RMSDs in the main text.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ChimeraX</div><div>suggested: (UCSF ChimeraX, RRID:SCR_015872)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence alignment and sequence conservation analysis: Nsp2 sequences were manually downloaded from UniProt and aligned in Jalview using MAFFT49,50.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UniProt</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div><div style="margin-bottom:8px"><div>Jalview</div><div>suggested: (Jalview, RRID:SCR_006459)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Conservation was mapped on the Nsp2 structure using a combination of Chimera and ChimeraX and the supplementary alignment figure was prepared with MView server47,51,52.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Conservation</div><div>suggested: (Conservation, RRID:SCR_016064)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.11.21257037: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: All statistical tests were conducted with α < 0.05. Approval: The SchoolCoviDD19 study was approved by the Ethics Committee of the Technische Universität (TU) Dresden (BO-EK-156042020) and has been assigned clinical trial number DRKS00022455.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Laboratory Analysis: We assessed anti-SARS-CoV-2 IgG antibodies in all samples using a commercially available chemiluminescence immunoassay (CLIA) technology for the quantitative determination of anti-S1 and anti-S2 specific IgG antibodies to SARS-CoV-2 (Diasorin LIAISON® SARS-CoV-2 S1/S2 IgG Assay).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-S1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-S2 specific IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These were a chemiluminescent microparticle immunoassay (CMIA) intended for the qualitative detection of IgG antibodies to the nucleocapsid protein of SARS-CoV-2 (Abbott Diagnostics® ARCHITECT SARS-CoV-2 IgG) (an index (S/C) of < 1·4 was considered negative whereas one >/= 1·4 was considered positive) and an ELISA detecting IgG against the S1 domain of the SARS-CoV-2 spike protein (Euroimmun® Anti-SARS-CoV-2 ELISA) (a ratio < 0·8 was considered negative, 0·8–1·1 equivocal, > 1·1 positive).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 ELISA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These were a chemiluminescent microparticle immunoassay (CMIA) intended for the qualitative detection of IgG antibodies to the nucleocapsid protein of SARS-CoV-2 (Abbott Diagnostics® ARCHITECT SARS-CoV-2 IgG) (an index (S/C) of < 1·4 was considered negative whereas one >/= 1·4 was considered positive) and an ELISA detecting IgG against the S1 domain of the SARS-CoV-2 spike protein (Euroimmun® Anti-SARS-CoV-2 ELISA) (a ratio < 0·8 was considered negative, 0·8–1·1 equivocal, > 1·1 positive).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were performed using IBM SPSS 27.0 or Microsoft Excel 2010.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:There are several limitations to our study. The sample size of around 180 infected individuals is not large enough to detect rare symptoms and a screening questionnaire cannot reliably compare the severity of symptoms in affected individuals. Furthermore, our questionnaire concentrated on neurocognitive, general pain and mood symptoms. Symptoms like a persistent sore throat, persistent cough or chest tightness and an altered sense of smell/ taste were not included. However, our survey covers a variety of symptoms reported in the context of Long-COVID19 and having a control group of age-matched peers who never had a SARS-CoV-2 infection adds valuable information to the Long-COVID19 discussion that is urgently needed.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.10.21256995: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Clinical sample testing: Clinical swab and saliva specimens were previously collected under Johns Hopkins IRB #00246027.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Specimens were de-identified and blinded before testing.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sample well heat block was custom machined out of 6061 aluminum and mounted onto a power resistor (Riedon PF1262-5RF1) with a steel M3 screw, while the PCR heat block was machined from 145 copper and mounted onto a thermoelectric element (Peltier Mini Module, Custom Thermoelectric) and heatsink using thermally conductive epoxy (Arctic Alumina Thermal Adhesive, Arctic Silver).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Arctic</div><div>suggested: (ARCTIC, RRID:SCR_005989)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:For realistic deployment, there are a few limitations to the current platform that must be addressed. In particular, the current cartridges are not shelf-stable for prolonged storage at room-temperature and are refrigerated or frozen prior to use. We are currently investigating techniques for built-in storage of dry reagents to allow stability at ambient conditions. To include testing for additional variants or respiratory pathogens, the cartridge would need to be expanded from the current 2-well design with additional PCR wells for higher multiplexing. Given the limited clinical sample volume available in this study, the assay design used a maximum 50 µL input per sample, though further improvement to sensitivity to prevent false-negatives may be achieved by adapting the cartridge and binding buffer to be compatible with larger volumes of sample.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a protocol registration statement.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.11.21257042: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Procedure: Permission was taken from college authorities and informed consent was taken from the participants of the Structured Questionnaire Survey.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Study Instrument: A structured questionnaire consisted of 08 Likert scale (five-point) questions was used for data collection and questionnaire was validated before survey.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Data was compiled, presented and analyzed using SPSS version 22, and was expressed as percentage and mean values.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.11.21256930: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Informed written consent was obtained from every patient or from legal guardian by reading out according the revised Declaration of Helsinki.<br>IACUC: The protocol was approved by the Ethical and Scientific Committee of the Chattogram Maa O Shishu Hospital Medical College (CMOSHMC).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The statistical analysis was carried out using the Statistical Package for Social Sciences version 20.0 for Windows (IBM SPSS Armonk, NY, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.11.21257033: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Food and Drug Administration (FDA), International Conference for Harmonization (ICH), Good Clinical Practice (GCP), Declaration of Helsinki and current local Ethics guidelines (reference 200923584).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were conducted using IBM SPSS version 27.0.1.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:There are limitations in our study. This was a single centre study and thus the results cannot be generalised to other regions in South Africa, nor to other countries. Patient numbers were, however, adequate. Furthermore, being a single centre study, it also excluded our need to have to evaluate the impact that different skill sets and resource availability at different hospitals may have had on the outcomes. We could not perform genotyping for all patients included in the study and thus relied on screening results performed by the Kwazulu-Natal Research Innovation and Sequencing Platform (KRISP), which indicated that all the patients genotyped in the second wave in the ECP had the variant. As most data were extracted from our billing platform, certain clinical data were missing. Obesity, which is known to be an important risk factor for COVID-19 severity, was not evaluated as the body mass indices were not recorded [22]. Data on alternative non-invasive oxygen strategies, such as high frequency nasal oxygen delivery devices were also not available. Patients in the second wave did have higher IL-6 and D-dimer levels on admission but the date of symptom onset was not recorded and although admission delays could not be excluded, all patients presenting via the emergency department were admitted promptly.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.05.21256710: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The RECoVERED study was approved by the medical ethical review board of the Amsterdam University Medical Centre (NL73759.018.20).<br>Consent: All participants provided written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using Stata (StataCorp LLC, v.15.1) and R (RStudio, v.1.2.5033).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div><div style="margin-bottom:8px"><div>RStudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Several limitations must be recognised. Survival bias among the retrospectively-enrolled hospitalised participants may have caused an underestimation of time to complete recovery in those with severe/critical disease, although results were comparable when restricting our analyses to prospectively identified participants. Questionnaires in languages other than Dutch and English were not offered, therefore individuals with a migration background, who have been disproportionally affected by COVID-19, also in Amsterdam[25, 26], were underrepresented in this cohort. Furthermore, misclassification bias may have resulted from using ICU admission as a proxy for critical disease; suitability for ICU admission is also judged by the patient’s chance of survival; indeed, those with critical disease tended to be younger and have a lower BMI than those in the severe group. Finally, the natural progression of disease may differ between SARS-CoV-2 variants[27] and treatments received. Therefore, our results may not be representative for future patients infected with SARS-CoV-2, especially as the treatment landscape for COVID-19 changes and new variants continue to arise. We demonstrated that post-COVID syndrome is common, even after mild disease. Symptoms persisted for nine months after illness onset in one-fifth of participants with mild disease and in more than half of participants with moderate and severe/critical disease. Obesity was the most important predictor of slow recovery and thus...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.11.21256578: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04341142</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Assessment of Serological Techniques for Screening Patients …</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.08.21256866: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: The study was approved by the Swedish Ethical Review Authority, and informed written consent was obtained from all participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Of these, 149 participants received two doses of BNT162b2 vaccine (36 previously infected participants with median age 52 (IQR 41-62), 86% female, and 113 SARS-CoV-2-naïve participants with median age 53 (IQR 42-58), 86 % women), and 83 participants received a single-dose ChAdOx1 nCoV-19 vaccine (46 participants ≥ 11 months post SARS-CoV-2 infection with median age 49 (IQR 41-60), 83% female, and 37 participants < 11 months post SARS-CoV-2 infection with median age 48 (IQR 40-54), 95 % women).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For validation, spike-specific IgG antibodies against SARS-CoV-2 wild type were measured in the same samples using the multiplex antigen bead array (FlexMap3D, Luminex Corp) (10).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>spike-specific IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were performed using GraphPad Prism 9.1.0 (GraphPad Software, Inc, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.11.21256479: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Between 11th June and 28th August 2020, the study team assessed suspected or confirmed SARS-CoV-2 (by nasopharyngeal or oropharyngeal aspirate) participants and expedited written electronic consent for inclusion was provided.<br>IRB: The WHO ordinal severity score was used to categorize participants on admission according to the following categories: The study was conducted according to the declaration of Helsinki, conformed to South African Good Clinical Practice guidelines, and was approved by the University of Cape Town’s Health Sciences Research Ethical Committee (HREC 207/2020).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Radiographic evaluation: Chest radiographs were reported blind to clinical status by an experienced radiologist (QS-H).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Switzerland) Anti-SARS-CoV-2 immunoassay which detects antibodies (including IgG) to SARS-CoV-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 immunoassay which detects antibodies ( including IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then stained with an antibody cocktail containing among others anti-CD3, -CD4 and -CD8 antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>-CD8</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were entered directly into an electronic REDCap data entry system, hosted by the University of Cape Town 34.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were acquired on a BD LSR-II and analyzed using FlowJo (v9.9.6, FlowJo LCC, Ashland, OR, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analytical methods: Analyses were conducted in Prism 8 (GraphPad Software, San Diego, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.10.21256935: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The UK Biobank project was approved by North West Multicenter Research Ethics Committee and the National Information Governance Board for Health and Social Care (11/NW/0382).<br>Consent: Informed consent was obtained at the time of enrolment from all participants [9].<br>Field Sample Permit: This study was conducted under application number 20175 to the UK Biobank.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.11.21256886: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Human subjects: This study has been approved by the ethics committee of the Instituto de Investigación Sanitaria La Fe (Valencia, Spain) to use patient samples, including urine and feces.<br>Consent: Informed consent was obtained from each patient.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 cells were inoculated at 70% confluence with diluted and undiluted fecal or wastewater samples.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RT-qPCR on nasopharyngeal swabs was performed at the hospital following internal guidelines using different commercial available kits (BioFire® Respiratory Panel 2.1 (BioFire Defense LLC and BioFire Diagnostics LLC), Alinity m SARS-CoV-2 assay (Abbott Molecular), and Simplexa™ COVID-19 Direct (DiaSorin Molecular LLC)).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.06.21256773: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethical Considerations: The study complied with the Declaration of Helsinki and was approved by the Ethical Review Committee, Department of Public Health, Northern University Bangladesh, Dhaka, Bangladesh (memo no. NUB/DPH/EC/2020/05).<br>Consent: Informed consent was sought from the respondents at the beginning point of the survey.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis: Data were entered, checked for quality, and analyzed utilizing the Statistical Package for the Social Sciences (SPSS) software, v.22.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Statistical Package for the Social Sciences</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.07.21256844: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.07.21249238: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A codon-optimized His tagged SARS-CoV-2 Nucleocapsid (N) gene (43) was synthesized and cloned into a pET-28 vector by Twist Bioscience (San Francisco, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-28</div><div>suggested: RRID:Addgene_141289)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04362150</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Long-term Impact of Infection With Novel Coronavirus (COVID-…</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.04.27.21256096: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.11.443555: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nsp12 protein was expressed from pFastBac vector 438C (Addgene #154759) in Hi5 insect cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pFastBac</div><div>suggested: RRID:Addgene_1925)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, both proteins were expressed in E. coli BL21(DE3) RIL from the pET-derived vector 14-B (a gift from S. Gradia; Addgene 48308) in LB medium individually.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-derived</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The refined particles were then exported to RELION 3.156 and focus-refined in 3D with an initial local angular sampling of 3.7° and a mask around RdRp that omitted the nsp8 sliding poles and the upstream, second RNA turn.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RELION</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Model quality was assessed using MolProbity within Phenix60 which revealed excellent stereochemistry for both structural models (Table 1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MolProbity</div><div>suggested: (MolProbity, RRID:SCR_014226)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Figures were prepared with PyMol (Schrödinger) and ChimeraX61.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 16. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.11.21256876: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">We did not use any targeting feature except for gender, where we used separate budgets to balance the numbers of male and female respondents.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Given the limitations of manual contact tracing, various countries deployed digital contact tracing tools via a mobile app to complement the manual contact tracing efforts. Kretzschmar et al. [45] claim that digital contact tracing on its own would be more effective than conventional manual contact tracing alone even with only 20% of app adoption, due to its inherent speed. In the best-case scenario, digital contact tracing alone could reduce the reproduction number by 17%. More recently, several studies have shown the potential effectiveness of digital contact tracing using real-world contact patterns [43, 46] and in pilot studies in Switzerland, the United Kingdom (the Isle of Wight), and Spain (Gomera island) [47–49]. However, our data reveal the very limited role played by contact tracing apps. Despite having significant adoption figures in our sample (31% in Italy and 19% in Spain), only 1% of respondents who reported having had a close contact with an infected individual discovered it via the app. In addition, a small fraction of those got tested. This limited role played by digital contact tracing could result from a conjunction of factors, including technological limitations, low integration with local health policies, and delayed notifications. Thus, more detailed analyses on the real-world epidemiological effectiveness of the digital contact tracing apps would be needed [50]. Finally, we observe significant discrepancies between officially reported and our survey da...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.11.21257011: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The study was conducted in compliance with institutional guidelines, approved by the Ethics Committee of São Paulo Federal University (CEP/UNIFESP n. 29407720.4.0000.5505).<br>IRB: The study was conducted in compliance with institutional guidelines, approved by the Ethics Committee of São Paulo Federal University (CEP/UNIFESP n. 29407720.4.0000.5505).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Molecular detection was performed by reverse transcription, real-time polymerase chain reaction (RT-qPCR) assay, using the GeneFinder COVID-19 Plus RealAmp Kit (OSANG Healthcare, Korea), which targets the E (envelope), N (nucleocapsid), RdRp (RNA-dependent RNA Polymerase) genes of SARS-CoV-2, and human ribonuclease P (RNase P) as an internal control.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GeneFinder</div><div>suggested: (GENEFINDER, RRID:SCR_009190)</div></div><div style="margin-bottom:8px"><div>OSANG Healthcare</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were performed using the software GraphPad Prism v.6.01.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2021.05.11.21256877: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.06.21256289: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Nearly all swab specimens in our laboratory were tested within 24 hours of collection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Life expectancy at birth is 81.2 years (78.9 for men and 83.5 for women) as of 2017, figures almost identical to those of Germany as a whole.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were performed using SAS for windows, 9.4. (SAS Institute Inc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.05.21256686: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The research was approved and reviewed by the Institutional Review Board (IRB, protocol #20200504, PI Dr. Reidy) at the University of Miami, which reviews all human research conducted under the auspices of the University of Miami.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA to measure Spike-specific IgG antibodies: Serum IgG antibodies against SARS-CoV-2 Spike protein were measured by an ELISA developed and standardized in our laboratory.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Spike-specific IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2 Spike protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA to measure autoimmune antibodies: To measure MDA-specific IgG antibodies, ELISA plates were coated with MDA-modified Bovine Serum Albumin protein (MDA-BSA, MyBioSource MBS390120), at the concentration of 10 µg/mL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDA-specific IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To measure AD-specific IgG antibodies, we isolated the adipocytes from the subcutaneous adipose tissue of patients undergoing weight reduction surgeries (bilateral breast reduction), as previously described (28).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AD-specific IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GraphPad Prism version 8.4.3 software was used to construct all graphs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.11.21257027: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Procedure: Ethical approval was taken from the Institutional Review Board (IRB) of BGC Trust Medical College, Chittagong.<br>Consent: Permission was taken from college authorities and informed consent was taken from the participants of the Structured Questionnaire Survey.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Study Instrument: A structured questionnaire was used for data collection and questionnaire was validated before survey.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Data was compiled, presented and and analyzed using Microsoft Excel 2007, and was expressed as percentage.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.10.21256920: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Two independent reviewers evaluated titles and abstracts in random order.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We searched MEDLINE (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEDLINE</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Ovid), PsycINFO (Ovid), CINAHL (EBSCO), EMBASE (Ovid), Web of Science Core Collection: Citation Indexes, China National Knowledge Infrastructure, Wanfang, medRxiv (preprints), and Open Science Framework Preprints</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PsycINFO</div><div>suggested: (PsycINFO, RRID:SCR_014799)</div></div><div style="margin-bottom:8px"><div>EMBASE</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, RStudio Version 1.2.5042), using the rma.uni function in the metafor package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RStudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Strengths and Limitations: Strengths of our systematic review include using rigorous best-practice methods; searching 9 databases, including 2 Chinese databases; not restricting inclusion by language; and the ability to update rapidly as evidence emerges via our living systematic review approach. There are also limitations that suggest some level of caution in interpreting results. First, aside from several population-level randomly sampled surveys, most of the studies included in our systematic review had limitations related to study sampling frames and recruitment methods, response and follow-up rates, and management of missing follow-up data. Second, heterogeneity was high in most of the meta-analyses that we conducted. Third, only a handful of studies reported results from the fall months of 2020, and, although the few studies that did suggested that symptoms were stable or reduced from earlier in the pandemic, more data are needed. Fourth, although we were able to synthesize results from several vulnerable groups, including older adults and people with pre-existing medical conditions, there were few studies with results for other vulnerable groups. It is possible that some groups may be experiencing important negative mental health effects of the pandemic and were not included in the studies we identified. Fifth, some potentially important outcomes, such as loneliness, were infrequently studied and not included in the present report. Sixth, the evidence base is rapidly e...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.10.21256912: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Covariates: Our analysis strategy was informed by conceptual models17,18 that have previously described the possible pathways between ethnicity and socio-economic status, overcrowding and risk of SARS-CoV-2 infection and we developed a Directed Acyclic Graph to inform covariate selection (Supplementary Appendix Figure S1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Covariates</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:An important additional limitation is that only households of up to six people were eligible for inclusion. By not including households of over six people we are likely underestimating the risk associated with overcrowding. Conversely, we cannot rule out residual confounding as a possible alternative explanation for some of the excess risk in the associations we describe. Access to SARS-CoV-2 antigen testing is socio-economically patterned, with those in more deprived areas having less ability to access tests and less likely to be contact traced.20 Our data may therefore under-estimate the true infection risk associated with overcrowded housing. To mitigate this bias in access to antigen testing, we analysed antibody data from the laboratory cohort where home test kits were provided to all adult participants. Our findings highlight the importance of public health interventions to prevent and stop the spread of SARS-CoV-2 considering the much greater risk of being infected for people living in overcrowded households. The pathways between overcrowding and increased risk of infection are not fully understood.10 Overcrowded households are more likely to be found in socioeconomically deprived and urban areas, and higher levels of COVID-19 in these communities include higher likelihood of working in public-facing and essential occupations, lower likelihood of working from home during lockdowns, constraints to self-isolation when ill or in contact with a case (both financial and due...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.11.21256719: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Samples were collected either at the collection centre (dedicates sample collection room) or hospitals (for admitted cases) or at homes by the trained collection personnel.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Comparability of groups was analyzed by Chi-square test, Student’s t-test, or Mann-Whitney test as appropriate using the statistical software MedCalc statistical software version 10.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MedCalc</div><div>suggested: (MedCalc, RRID:SCR_015044)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.10.21256927: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:There are several limitations in our study. First, we used a case report from public health authorities that is not free from under-reporting of cases and could bias our results. Therefore, our result of the possible risk of SSE is likely to be a lower bound estimate. Second, we have not included cases from the Daegu-Gyeongsangbuk region, which originated primarily from the Shincheonji religious group. A previous report demonstrated that there was a delay of several days in detecting cases that could affect the size of the cluster. Therefore, this group may not reflect the typical characteristics of the transmission. Third, we have not included the latter period of COVID-19 pandemic which the number of COVID-19 case was larger than previous two period in the present study. However, this outbreak was mainly originated anti-governmental rallies related with religious groups which avoiding contact tracing were reported [12]; hence, did not reflect characteristics of typical community transmission in South Korea. Fourth, we had not included the genetic sequencing data of the cases, as genetic sequencing was not conducted in most cases. Therefore, we could not rule out a pseudo-outbreak of COVID-19 in which the PCR results were false-positive [13] or infection was acquired from outside the cluster. In conclusion, our study suggests that there were temporal changes in the possible risk of SSE in South Korea. Ongoing monitoring of the risk of SSE would help to assess the impact of p...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.10.21256529: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Individual samples were collected in separate collection tubes containing viral transport media (VTM) maintaining the WHO guidelines (WHO, 2020).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All data was sorted and coded in Microsoft Excel 2016® excel sheet for further summary and analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.10.443377: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The primary antibodies used in the research were as following: anti-ACE2 (1:3000 dilution, Cat. ab15348, Abcam, Cambridge, UK)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: (Abcam Cat# ab15348, RRID:AB_301861)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Public datasets retrieval: The Cancer Genome Atlas (TCGA) data: The pan-cancer normalized RNA-seq datasets, copy number variant (CNV) data processed by GISTIC algorithm, 450K methylation data, mutation profiles, the activities of transcription factor (TF) calculated by RABIT, and clinical information were obtained from UCSC Xena data portal (https://xenabrowser.net/datapages/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GISTIC</div><div>suggested: (GISTIC, RRID:SCR_000151)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The somatic mutation data were obtained from TCGA (http://cancergenome.nih.gov/) and then used to calculate the tumor mutation burden (TMB) by R package “maftools”.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>http://cancergenome.nih.gov/</div><div>suggested: (The Cancer Genome Atlas, RRID:SCR_003193)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Prognostic analysis using PrognoScan: PrognoScan database (http://dna00.bio.kyutech.ac.jp/PrognoScan/) was applied to assess the prognostic value of ACE2 in BRCA across a large cohort of public microarray datasets [17].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PrognoScan: PrognoScan</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The functional roles of ACE2 in BRCA was predicted using the Linked Omics tool in term of Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways by the gene set enrichment analysis (GSEA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Moreover, in order to avoid calculation errors resulted from various algorithms which were developed to explore the relative abundance of TIICs in TME, we comprehensively estimated the infiltration levels of TIICs using the following independent algorithms: TIMER [21], EPIC [22], MCP-counter [23], quanTIseq [24] and TISIDB [25].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TIMER</div><div>suggested: (TIMER, RRID:SCR_018737)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">First, BRCA-related drug-target genes were screened using the Drugbank database (https://go.drugbank.com/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Drugbank</div><div>suggested: (DrugBank, RRID:SCR_002700)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.09.443299: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.09.442808: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">AMBRA (antigen-specific memory B cell repertoire analysis) of IgG antibodies: Replicate cultures of total unfractionated PBMC from SARS-CoV-2 infected or vaccinated individuals were seeded in 96 U-bottom plates (Corning) in RPMI1640 supplemented with 10% Hyclone, sodium pyruvate, MEM non-essential amino acid, stable glutamine and PenicillinStreptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific memory B cell repertoire analysis) of IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody discovery and expression: Antigen specific IgG+ memory B cells were isolated and cloned from total PBMCs of convalescent individuals.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antigen specific IgG+</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry of antibody on S Protein expressing ExpiCHO-S cells: For Expi-CHO cell transient transfection, S plasmids (21, 58) were diluted in cold OptiPRO SFM, mixed with ExpiFectamine CHO Reagent (Life Technologies, A29130) and added to the cells seeded at 6×106 cells/ml in a volume of 5 ml in a 50 ml bioreactor.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A29130</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Twelve-point 3-fold serial dilutions of S2P6 were prepared in DMEM and OC43 S VSV pseudoviruses were added 1:1 (v/v) to each dilution in the presence of anti-VSV-G antibody from I1-mouse hybridoma supernatant diluted 50 times (final volume: 50 μl).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-VSV-G</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: Cell lines used in this study were obtained from ATCC (HEK293T and Vero-E6) or ThermoFisher Scientific (ExpiCHO cells, FreeStyle™ 293-F cells and Expi293F™ cells).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>293-F</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In a BSL3 facility, serial dilutions of mAbs (1:4) were incubated with 200 PFU (plaque forming units, corresponding to a multiplicity of infection of 0.01) of authentic SARS-CoV-2 (isolate USA-WA1/2020, passage 3, passaged in Vero-E6 cells) for 30 minutes at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To perform pseudotype neutralization assays, VeroE6-TMPRSS2 cells were used for VSV-SARS-CoV-2, VSV-SARS-CoV-1, and VSV-GD19 and Huh7 cells were used for VSV-MERS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: CLS Cat# 300156/p7178_HuH7, RRID:CVCL_0336)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK-293T cells at 70~80% confluency were transfected with the pCDNA3.1 expression vectors encoding full-length OC43 S harboring a truncation of the 17 C-terminal residues along with a fusion to Ha-tag and the bovine coronavirus hemagglutinin esterase protein Fc-tagged at molar ratios of 7:1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 S D614G, used for production of SARS-CoV-2 postfusion, contains a mu-phosphatase signal peptide beginning at 14Q, a mutated S1/S2 cleavage site (SGAR), and ends at residue K1211 followed by a TEV cleavage, foldon trimerization motif, and an 8X his tag in a pCMV vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV</div><div>suggested: RRID:Addgene_20783)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VSV pseudotype virus production and neutralization: Sarbecovirus spike cassettes with a C-terminal deletion of 19 amino acids (D19) were synthesized and cloned into mammalian expression constructs (pcDNA3.1(+) or pTwist-CMV) for the following Sarbecoviruses: SARS-CoV-2 (Accession QOU99296.1), SARS-CoV-1 (Accession AAP13441.1), hCoV-19/pangolin/Guangdong/1/2019 (GD19, Accession QLR06867.1), and Middle East respiratory syndrome-related coronavirus (MERS, Accession YP_009047204).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pTwist-CMV</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK-293T cells at 70~80% confluency were transfected with the pCDNA3.1 expression vectors encoding full-length OC43 S harboring a truncation of the 17 C-terminal residues along with a fusion to Ha-tag and the bovine coronavirus hemagglutinin esterase protein Fc-tagged at molar ratios of 7:1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">UCA sequences of the VH and VL were constructed using IMGT/V-QUEST.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IMGT/V-QUEST</div><div>suggested: (IMGT/V-QUEST, RRID:SCR_010749)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Conservation analysis: Conservation analysis was performed as described previously (Pinto et al 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Conservation</div><div>suggested: (Conservation, RRID:SCR_016064)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The multiple sequences alignment was performed using MAFFT (https://mafft.cbrc.jp/alignment/software/) with the spike amino acid sequences as input.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were imaged with an automated microscope (Cytation5, Biotek), and nuclei and cells positive for the SARS-CoV-2 Nucleoprotein were quantified using the supplied Gen5 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gen5</div><div>suggested: (Gen5, RRID:SCR_017317)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Percent neutralization data were analyzed using GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Several subsequent rounds of model building and refinement were performed using Coot (71), ISOLDE (72), Refmac5 (73), and MOE, to arrive at a final model for the complex.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Two rounds of reference-free 2D classification were performed using cryoSPARC (76) to select well-defined particle images.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 34 and 31. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.10.443480: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.09.443238: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Mouse immunizations: Mouse immunogenicity studies were performed under the guidelines and approval of the Institutional Animal Care and Use Committee (IACUC) at the National Institutes of Health.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralizing epitopes were probed using an Ace2-Fc(IgG1) fusion (0.2 ug/well) or a human IgG1 antibody containing the CR3022 variable domain (0.05 ug/well).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human IgG1</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">100 μl primary antibody was added to each well at the indicated concentration: Ace2 – 3.1 ng/mL, REGN10933, CR3022, and S309 – 1.5 ng/mL, and P2B-2F6 – 7.5 ng/mL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ace2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S309</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>P2B-2F6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibody was incubated 1 hour at room temperature then plates were washed three times with PBST and 200 μl 1:5000 peroxidase-conjugated anti-human IgG was added (Jackson ImmunoResearch Laboratories, Inc. Cat.# 109-035-098).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 109-035-098, RRID:AB_2337586)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">100 μl primary antibody was added to each well at the indicated concentration: Ace2 – 3.1 ng/mL, REGN10933, CR3022, and S309 – 1.5 ng/mL, and P2B-2F6 – 7.5 ng/mL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ace2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S309</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>P2B-2F6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 1 hour incubation at room temperature, 20,000 HEK293 cells overexpressing Ace2 were added to each well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Five 5-6 week old female CD-1 mice (Charles River Laboratories) per group were immunized with 10 μg antigen each.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD-1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RRID:Addgene_99845)45.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_99845)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Ace2-Fc fusion was expressed from pcDNA3: pcDNA3-sACE2(WT)-Fc(IgG1) was a gift from Erik Procko (Addgene plasmid # 145163; http://n2t.net/addgene:145163; RRID:Addgene_145163)47.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3</div><div>suggested: RRID:Addgene_15475)</div></div><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_145163)</div></div><div style="margin-bottom:8px"><div>pcDNA3-sACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Ace2-Fc fusion was expressed from pcDNA3: pcDNA3-sACE2(WT)-Fc(IgG1) was a gift from Erik Procko (Addgene plasmid # 145163; http://n2t.net/addgene:145163; RRID:Addgene_145163)47.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3</div><div>suggested: RRID:Addgene_15475)</div></div><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_145163)</div></div><div style="margin-bottom:8px"><div>pcDNA3-sACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Extinction coefficients were calculated using the ExPASy ProtParam tool46.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ExPASy ProtParam</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This model was then edited in COOT to incorporate the amino acid changes present in immunogen 3 and subsequent rounds of refinement and model building were performed with COOT and PHENIX Refine53.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The final model was evaluated with MolProbity, which showed good geometry, with 96.0% of the residues as Ramachandran favored and 0% outlier residues (Extended Data Table 2)54.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MolProbity</div><div>suggested: (MolProbity, RRID:SCR_014226)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">% inhibition values were measured for each serum dilution in triplicate and average values were plotted in GraphPad Prism 8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.07.443114: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Unique haplotypes were obtained with custom Perl scripts based on the BioPerl package (Stajich et al. 2002).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioPerl</div><div>suggested: (BioPerl, RRID:SCR_002989)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A custom Python script sampled viral genomes (e.g., n=100) by month and at three spatial scales (continent, country, and state).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Evolutionary statistics, including variant frequencies, linkage disequilibrium (r2), haplotypes, and base substitution frequencies were generated with programs BCFTools and VCFTools (Danecek et al. 2011).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VCFTools</div><div>suggested: (VCFtools, RRID:SCR_001235)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used Haploview (version 4.2) to calculate LD scores (D’ and r2) as well as their statistical significance between pairs of SNVs (Barrett 2009).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Haploview</div><div>suggested: (Haploview, RRID:SCR_003076)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used the DNAPARS program of the PHYLIP (version 3.696) package to search for a maximum parsimony tree of unique haplotypes, obtaining the homoplasy index (HI) and the number of base substitutions at each SNV site (Felsenstein 1989).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PHYLIP</div><div>suggested: (PHYLIP, RRID:SCR_006244)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To ensure that all genomic sites were mutated at least once, we ran CovSimulator ten times such that the chance of a site not undergoing any mutation was small p = 0.51210 = 1.25e-3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CovSimulator</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The R package pheatmap was used to generate heatmaps.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pheatmap</div><div>suggested: (pheatmap, RRID:SCR_016418)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.10.443404: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK-293T cells adapted to grow in suspension in Freestyle F-17 medium were transfected with the resulting genetic constructs, using linear polyethyleneimine as the transfection agent.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentiviral particles containing the gene of interest were produced and used for stable transduction of CHO-K1 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO-K1</div><div>suggested: CLS Cat# 603480/p693_CHO-K1, RRID:CVCL_0214)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The optimized nucleotide sequence was assembled and amplified by PCR using gene fragments synthesized by Eurofins and oligonucleotides synthesized at CIGB (Cuba), and cloned into pCMX/His vector through BssHII and NotI restriction sites.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMX/His</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(RBD(319-541)-CHO)2 from transduced CHO-K1 cells: The whole expression cassette including the gene coding for RBD319-541 (from CMV promoter to His6 tag and stop codon) was amplified by PCR from pCMX/His (see the previous section) and re-cloned into the lentiviral vector pL6WBlast (CIGB, Cuba) with the restriction enzymes XhoI and EcoRV.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pL6WBlast</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting amplicon, after digestion with these enzymes, was cloned in-frame into Nhe I/Sal I-digested pET28a+ (Novagen, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET28a+</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After digestion with these enzymes, the fragment was cloned in-frame with the S. cerevisiae alpha factor pre-pro peptide into EcoR I/Xba I-digested pPICK-αA (a pPICZ-αA derivative bearing a G418 resistant selection marker).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pPICK-αA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pPICZ-αA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Argon was used as a collision gas and the mass spectra were processed by using MassLynx v4.1 (Micromass, UK).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MassLynx</div><div>suggested: (MassLynx , RRID:SCR_014271)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.10.443474: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the simulations, the Gromacs 2018.8 pull code28 was used to move the C-terminal carbon atom, away from the membrane center of mass at a constant velocity of 0.03 ms-1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gromacs</div><div>suggested: (GROMACS, RRID:SCR_014565)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.10.443494: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data were first analyzed by MultiQC implemented in the Master of Pores tool,33 to yield read statistics similar to those described in the literature (Figures S2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MultiQC</div><div>suggested: (MultiQC, RRID:SCR_014982)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">35 The bam files were indexed with Samtools and then visualized in IGV to obtain the base call frequency at the modification sites.36,37 The Eligos2 tool was used as described in the online manual on GitLab,27 and the Nanocompore and Tombo tools were used as described on their Github sites.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">29,38 The current and dwell time data were extracted, indexed to the reference, and analyzed using Nanopolish as described in the user manual.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Nanopolish</div><div>suggested: (Nanopolish, RRID:SCR_016157)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">39 The data were plotted and analyzed in either python, Origin, or Excel for visualization.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:At present, the signatures for all modifications are not known and studies are needed to address what the signals are, as well as what the biases and limitations are to the data analysis. In the present work, Ψ was synthetically incorporated by IVT in RNA at known locations in 18 different humanrelevant sequence contexts found in rRNA, mRNA, and tRNA (Figure S1). The Ψ sites were spaced >25 nt apart to study them one at a time as they pass from the helicase to the nanopore sensor, an overall distance that spans ~17 nt from the entry of the helicase to the exit of the k-mer sensing zone in the protein nanopore. Pseudouridine is base called by Guppy predominantly as U or C, consistent with other studies,26 and the present work found the ratio is dependent on the local sequence context (Figure 2). The base-calling error for Ψ was greater than U permitting detection of the modification (Figure 3); however, the base-calling errors were sequence context dependent, similar to the base-calling differences. Two extreme examples found in the data illustrate the challenges in using base-calling data for RNA modification sequence; in the 5’-ACXCA (X = U or Ψ) context, the U:C ratio is 7:88 with a base-calling error analysis giving an oddR value of 233, while the 5’-CAXCG context had a U:C ratio of 90:10 and an oddR value of 4, both when 100% Ψ is present at position X (Figures 2 and 3). In real samples, this approach will systematically favor observation of high error and high C calling ...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.10.443422: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Despite the significant inactivating effects of DUV-LED reported here, this study has some limitations. First, these effects may be limited to the test conditions applied in this study, including the irradiation distance and output (work distance of 20 mm; irradiation at 3.75 mW/cm2 for continuous irradiation and 7.5 mW/cm2 for pulsed irradiation (duty rate: 50%; frequency: 1 KHz)). In addition, it is necessary to also evaluate multiple parameters, such as the frequency and duty ratio, to clarify the effectiveness of pulse irradiation. The influence of the material and the power consumption for the high amplitude were also not evaluated. In the future, we will examine in more detail whether various conditions of DUV-LED irradiation may affect the degree of the inactivation of microorganisms. In addition to community settings, healthcare settings are also vulnerable to the invasion and spread of SARS-CoV-2 and its variants, and the stability of SARS-CoV-2 in aerosols and on surfaces [19] likely contributes to the transmission of the virus in medical environments. It is important to create an environment that minimizes virus exposure to suppress the spread of SARS-CoV-2 in a sustainable and efficient manner. It was confirmed in our study that SARS-CoV-2, including its variants, is highly susceptible to DUV-LED irradiation. By devising appropriate and optimized irradiation methods, it is conceivable that DUV-LED irradiation can be adapted and applied in various settings. This st...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.01.442286: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The repositories also contain BEAST XML scripts used to perform the phylodynamic analyses, R scripts used to perform simulations and post processing, and a modified version of the BEAST program used for some of the analyses in this study.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BEAST</div><div>suggested: (BEAST, RRID:SCR_010228)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.07.443053: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your code.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.07.443055: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 positive RNA samples were sequenced as described (2) and SARS-CoV-2 sequences were aligned using MAFFT (24).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.07.443115: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethics and biosafety statement: All animal experiments were approved by the Institutional Animal Care and Use Committee of Rocky Mountain Laboratories, NIH and carried out in an Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC) International accredited facility, according to the institution’s guidelines for animal use, following the guidelines and basic principles in the NIH Guide for the Care and Use of Laboratory Animals, the Animal Welfare Act, United States Department of Agriculture and the United States Public Health Service Policy on Humane Care and Use of Laboratory Animals.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">All but one of the older animals were male.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Samples from animals inoculated with different variants were randomized across plates to mitigate batch effects.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">The animals were observed and scored daily according to a standardized scoring sheet (23); the same person, blinded to the isolate the animals received, assessed the animals throughout the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The inocula were titered on Vero E6 cells to confirm the correct dose was administered.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Remaining reads were mapped to the the respective hCOV_19/England/204820464/2020, hCoV-19/USA/MD-HP01542/2021, and SARS-CoV-2/human/USA/RML-7/2020 genomes using Bowtie2 version 2.2.9 with parameters --local --no-mixed -X 1500.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bowtie2</div><div>suggested: (Bowtie 2, RRID:SCR_016368)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PCR duplicates were removed using picard MarkDuplicates (Broad Institute) and variants were called using GATK HaplotypeCaller version 4.1.2.0 (27) with parameter-ploidy 2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GATK</div><div>suggested: (GATK, RRID:SCR_001876)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed using Python (version 3.8.5) and GraphPad Prism (version 8.2.1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Unsupervised hierarchical clustering (Ward’s) was performed on Euclidean pairwise distance matrices calculated from the mean of the log2 fold change or concentration of analytes from animals in each group at each available timepoint using SciPy (version 1.6.0) and Seaborn (version 0.11.1) packages in Python.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SciPy</div><div>suggested: (SciPy, RRID:SCR_008058)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequences have been deposited in NCBI under BioProject Accession number PRJNA727012.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioProject</div><div>suggested: (NCBI BioProject, RRID:SCR_004801)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:One limitation of our study is the lack of comorbidities and severe disease manifestations in the rhesus macaque model. However, the age range of the animals used in this study (age range 2-16 years old) is probably a fair reflection of the population currently exhibiting the highest prevalence of SARS-CoV-2 infections, which appears to be younger than early during the COVID-19 pandemic (37). Despite the lower pathogenicity of B.1.351 overall, severe disease is still expected to occur in individuals with comorbidities. More targeted epidemiological studies are needed to clarify the impact of variants of concern on the disease burden in various subpopulations with and without comorbidities, while excluding the effect of confounding factors such as the overall number of cases and changes in human behavior. The B.1.351 lineage has been associated with reduced neutralization by convalescent sera of humans previously infected with SARS-CoV-2 and in people vaccinated against SARS-CoV-2 (38). In addition, reduced vaccine efficacy against mild-to-moderate COVID-19 was observed with the B.1.351 variant for vaccines tested in multi-center clinical trials in South Africa and Qatar (39, 40). Rechallenge studies in hamsters suggest that prior exposure with SARS-CoV-2 protects against disease but not re-infection of the upper respiratory tract (41). These studies, together with our side-by-side comparison of three SARS-CoV-2 variants in the most relevant animal model for preclinical develo...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.06.442903: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We applied HomoplasyFinder v0.0.0.969 to this alignment and the GISAID Audacity tree to quantify the number of independent emergences of all mutations and deletions considered and to identify the parental node of every recurrent mutation/deletion in the dataset.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HomoplasyFinder</div><div>suggested: (HomoplasyFinder, RRID:SCR_017300)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Influence of phylogenetic misplacement and sample representation on CEGA estimates: Given recurrent mutations may be observed due to poor phylogenetic placement of accessions, we assessed the influence of phylogenetic uncertainty on the CEGA scores recovered.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CEGA</div><div>suggested: (Geom-matching SRC, RRID:SCR_018424)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.07.443177: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.08.443207: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Cells were continuously passaged at 70-80% confluency and mycoplasma contamination was monitored periodically.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies and inhibitors: All primary antibodies were purchased from Cell Signaling Technologies except the anti-SARS Spike antibody (Novus Biologicals; NB100-56578) and anti-SARS-CoV-2 Nucleocapsid (Thermo Fisher;</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HRP-conjugated anti-rabbit and anti-mouse secondary antibodies were purchased from Jackson ImmunoResearch.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HRP-conjugated</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Colorectal adenocarcinoma Caco2 cells, were grown in DMEM supplemented with 20% FBS and 1× antibiotic.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All the viral cultures were propagated in Vero (CCL-81) cells in serum and antibiotics free conditions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Caco2, Huh7 or Calu-3 cells were infected at 1 MOI for 2 hours in serum-free conditions after which the media was replaced with complete media and further incubated until the time of harvesting.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: CLS Cat# 300156/p7178_HuH7, RRID:CVCL_0336)</div></div><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: KCLB Cat# 30055, RRID:CVCL_0609)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Polysome profiles of mock and infected cells for each time point were digitized and overlaid on Inkscape.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Inkscape</div><div>suggested: (Inkscape, RRID:SCR_014479)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.08.443244: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The animal protocol of these studies was reviewed and approved by the institutional animal care and use committee of Northern Arizona University (protocol #20-005).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mouse infection: Female and Male of six-to-eight-week-old K18-hACE2 transgenic mice under the C57BL/6J background were anesthetized and intranasally (i.n.) infected with SARS-COV-2 virus at a dosage of 2 × 101 PFU/mouse, 2 × 102 PFU/mouse, 2 × 103 PFU/mouse or 2 × 104 PFU/mouse.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For single IHC stain, the primary antibodies were incubated with DISCOVERY anti-Rabbit HQ following by DISCOVERY anti-HQ-HRP incubation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Rabbit</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following each primary antibody incubation, DISCOVERY anti-Rabbit HQ or NP or DISCOVERY anti-Mouse HQ or NP and DISCOVERY anti-HQ-HRP or anti-NP-AP were incubated.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Mouse HQ</div><div>suggested: (Roche Cat# 760-700, RRID:AB_2833075)</div></div><div style="margin-bottom:8px"><div>DISCOVERY</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-HQ-HRP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-NP-AP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following primary Antibody information were listed: SPIKE (40150-T62, Sino Biological, at 1:2000), NP (NB100-56576, NOVUS, 1/100), hACE2 (AMAB91262, SIGMA, at 1:1000), CC10 (SC-365992#, Santa Cruz at 1/5000), Pro-SPC (AB37386, Millipore at 1/500), CD68 (ab125212, abcam, at 1/100) and NeuN (24307, cell signaling, at 1/100).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AMAB91262</div><div>suggested: (Atlas Antibodies Cat# AMAb91262, RRID:AB_2665871)</div></div><div style="margin-bottom:8px"><div>CC10</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-365992, RRID:AB_10915481)</div></div><div style="margin-bottom:8px"><div>CD68</div><div>suggested: (Abcam Cat# ab125212, RRID:AB_10975465)</div></div><div style="margin-bottom:8px"><div>NeuN</div><div>suggested: (Cell Signaling Technology Cat# 24307, RRID:AB_2651140)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The viruses were amplified using Vero-E6 cells (ATCC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The K18-hACE2 transgenic mice, which use the human keratin 18 (KRT18) promoter to direct human ACE2 expression, were purchased from the Jackson Laboratory.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse infection: Female and Male of six-to-eight-week-old K18-hACE2 transgenic mice under the C57BL/6J background were anesthetized and intranasally (i.n.) infected with SARS-COV-2 virus at a dosage of 2 × 101 PFU/mouse, 2 × 102 PFU/mouse, 2 × 103 PFU/mouse or 2 × 104 PFU/mouse.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following primary Antibody information were listed: SPIKE (40150-T62, Sino Biological, at 1:2000), NP (NB100-56576, NOVUS, 1/100), hACE2 (AMAB91262, SIGMA, at 1:1000), CC10 (SC-365992#, Santa Cruz at 1/5000), Pro-SPC (AB37386, Millipore at 1/500), CD68 (ab125212, abcam, at 1/100) and NeuN (24307, cell signaling, at 1/100).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPIKE</div><div>suggested: (SPIKE, RRID:SCR_010466)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.08.443267: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The protocols were approved by the Institutional Animal Care and Use Committee at the Washington University School of Medicine (Assurance number A3381-01).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Female BALB/c (catalog 000651) and K18-hACE2 C57BL/6 (catalog 034860) mice were purchased from The Jackson Laboratory.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed then sequentially incubated with an oligoclonal pool of SARS2-2, SARS2-11, SARS2-16, SARS2-31, SARS2-38, SARS2-57, and SARS2-71 62 anti-S antibodies and HRP-conjugated goat anti-mouse IgG (Sigma, 12-349) in PBS supplemented with 0.1% saponin and 0.1% bovine serum albumin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS2-57</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS2-71</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>62</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Isotype analysis was perfomed by incubating the immune complexes with secondary goat anti-mouse-PE antibody (IgG1 1070-09, IgG2a 1080-09S, IgG2b 1090-09S, IgG3 1100-09, IgM 1020-09, IgA 1040-09 Southern Biotech) for each isotype.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse-PE</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody-dependent neutrophil or cellular phagocytosis: Antibody-dependent neutrophil phagocytosis (ADNP) and cellular phagocytosis (ADCP) assays were conducted as described previously 66, 67, 68.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antibody-dependent neutrophil phagocytosis ( ADNP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viruses and cells: Vero E6 (CRL-1586, American Type Culture Collection (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero-TMPRSS2 cells also were supplemented with 5 μg/mL of blasticidin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus was passaged once in Vero CCL-81 cells and titrated by focus-forming assay (FFA) on Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero CCL-81</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The rescued replication-incompetent ChAd-SARS-CoV-2-S and ChAd-Control vectors were scaled up in HEK293 cells and purified by CsCl density-gradient ultracentrifugation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus-serum mixtures were added to Vero cell monolayers in 96-well plates and incubated for 1 h at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Female BALB/c (catalog 000651) and K18-hACE2 C57BL/6 (catalog 034860) mice were purchased from The Jackson Laboratory.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_JAX:000651)</div></div><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">K18-hACE2 mice were challenged on indicated days after immunization with 104 FFU of SARS-CoV-2 (WA1/2020, Wash-B.1.351, or Wash-B.1.1.28) via IN route.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, prefusion-stabilized S 64 and RBD were cloned into a pCAGGS mammalian expression vector with a hexahistidine tag and transiently transfected into Expi293F cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_18926)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were incubated at room temperature for 1 h, washed thrice in PBST, and then 100 µL of 1-Step Ultra TMB-ELISA was added (ThermoFisher Cat. #34028).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher Cat.</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical significance was assigned when P values were < 0.05 using Prism Version 8 (GraphPad) or Jupyter Notebook 6.1.4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Limitations of study: Although a single intranasal administration of ChAd-SARS-CoV-2-S durably protected against SARS-CoV-2 variant replication in the upper and lower respiratory tract even ∼9 months after immunization, we note several limitations in our study. (1) We performed challenge studies in BALB/c mice transduced with hACE2 or C57BL/6 mice expressing an hACE2 transgene. Durability and protection studies will need to be corroborated in hamsters, non-human primates, and ultimately in humans. (2) Although our studies suggest that the mucosal immunity induced by intranasal vaccination could limit SARS-CoV-2 transmission, the use of mice precluded formal respiratory transmission analysis, which is better studied in hamsters and ferrets 46. (3) We observed robust protection in vivo against viruses displaying B.1.351 and B.1.1.28 spike proteins likely due to the high serum neutralizing antibody titers. Even though neutralizing antibody levels were lower with the variant strains due to mutations at sites in the receptor binding motif, the high starting level against the historical SARS-CoV-2 likely provided a sufficient cushion to overcome this loss in potency. Studies in other animals or with even lower doses of vaccine where neutralizing titers might be lower are needed to determine if the protective phenotype against variants of concern is maintained. (4) Finally, we did not establish the correlate of protection in these studies, as passive antibody transfer or T cell depl...
Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04751682</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Safety and Immunogenicity of an Intranasal SARS-CoV-2 Vaccin…</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.08.443275: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The Institutional Animal Care and Use Committee of Tulane University reviewed and approved all procedures for sample handling, inactivation, and removal from a BSL3 containment (permit number 3430 (#5)).<br>Euthanasia Agents: After 3 days post infection (dpi), the mice were euthanized by CO2 asphyxiation followed by cervical dislocation and lungs were harvested for histology, immunofluorescence and qRT-PCR analysis.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mice and Ethics Statement: Male heterozygous K18-hACE c57BL/6J mice (strain: 2B6.Cg-Tg(K18-ACE2)2Prlmn/J, 10-weeks-old) were obtained from The Jackson Laboratory.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibody (Polyclonal Anti-SARS Coronavirus (antiserum, Guinea Pig) 1:1000, NR-10361) incubation was achieved at room temperature for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS Coronavirus ( antiserum , Guinea Pig )</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice and Ethics Statement: Male heterozygous K18-hACE c57BL/6J mice (strain: 2B6.Cg-Tg(K18-ACE2)2Prlmn/J, 10-weeks-old) were obtained from The Jackson Laboratory.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE c57BL/6J</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: Statistical tests were performed with GraphPad Prism, 8.4.3 version (GraphPad Software, San Diego, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:A limitation of this study is that it employed a limited number of K18 hACE2 mice, a function of the logistical difficulty of doing live virus BSL-3 studies. We also dichotomized ATN-161-treated animals into ‘responder’ and ‘non-responder’ groups such that mice were considered non-responders if they displayed Genomic N values > 2×109, Sgm-N values > 1×105 and viral immunohistology staining counts >0.7 values observed in the SARS-CoV-2 group in the SARS-CoV-2 + saline group. ATN-161 responders had significantly lower genomic lung viral loads than SARS-CoV-2-infected animals. Accordingly, this bimodal distribution of responders may be due to our use of heterozygous (HT) K18-hACE2 mice, as the K18-hACE2 homozygous mouse model completely replaces mACE2 expression with hACE2 under the mAce2 promoter [49]. Thus, it might be possible that our use of HT K18-hACE2 mice in this study produced variable expression patterns of mACE2 vs hACE2, reducing the efficacy of ATN-161 in mice that expressed higher levels of mACE2 relative to hACE2. ATN-161 interference with mACE2-α5β1 interactions would presumably have minimal to no effect on SARS-CoV-2 infection as compared to impacting hACE2-α5β1 interactions. ATN-161 reduced Sgm-N viral load among pooled ATN-161-treated mice. When we re-analyzed the data by comparing lung viral load in the responder/non-responder groups to that of the SARS-CoV-2 + Saline-treated mice, we found that ATN-161 responders had significantly lower Sgm-N lung viral load...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.06.442916: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies: For Western Blot, we used mouse anti-DAXX (diluted 1:1000, Abnova #7A11),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-DAXX</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies were goat anti-mouse and anti-rabbit HRP-conjugates (diluted 1:5000, GE Healthcare #NA931V and #NA934V).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (GE Healthcare Cat# NA931, RRID:AB_772210)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies were goat anti-rabbit AF555 and anti-mouse AF488 (diluted 1:1000, ThermoFisher #A-21428 and #A-28175).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (Molecular Probes Cat# A-21428, RRID:AB_141784)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For flow sorting of infected cells, we used the anti-S2 H2 162 antibody (diluted 1:150), a kind gift from Dr. Hugo Mouquet, (Institut Pasteur, Paris, France).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S2 H2 162</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibody was donkey anti-mouse AF647 (diluted 1:1000, Invitrogen #A31571).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse AF647</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies were goat anti-rat AF647 and anti-mouse AF488 (diluted 1:1000, ThermoFisher #A-21247 #A-28175).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rat AF647</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells, viruses & plasmids: HEK 293T (ATCC #CRL-11268) were cultured in MEM (Gibco #11095080) complemented with 10% FBS (Gibco #A3160801) and 2 mM L-Glutamine (Gibco # 25030081).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: ATCC Cat# CRL-11268G-1, RRID:CVCL_UE07)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VeroE6 (ATCC #CRL-1586), A549 (ATCC #CCL-185) and HEK 293T, both overexpressing the ACE2 receptor (A549-ACE2 and HEK 293T-ACE2, respectively), were grown in DMEM (Gibco #31966021) supplemented with 10% FBS (Gibco #A3160801), and penicillin/streptomycin (100 U/mL and 100 µg/mL, Gibco # 15140122).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HEK 293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral stocks were generated by infecting VeroE6 cells (MOI 0.01, harvesting at 3 dpi) using DMEM supplemented with 2% FBS and 1 μg/mL TPCK-trypsin (Sigma-Aldrich #1426-100MG).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CRISPR/Cas9 screen: 4×107 A549-ACE2 cells were treated with IFNα (200U/mL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Overexpression assay: 2×105 293T-ACE2 cells were seeded in a 24-well plate 18h before experiment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plentiCRISPRv.2 backbone was ordered through Addgene (Plasmid #52961). pMD2.G and psPAX2 were gifts from Didier Trono (Addgene #12259; #12260).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>plentiCRISPRv.2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pMD2 . G</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>psPAX2</div><div>suggested: RRID:Addgene_12260)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were transfected with 500 ng of plasmids expressing HA-DAXX WT, HA-DAXX 15KR and HA-DAXXΔSIM plasmids, using Fugene 6 (Promega # E2691), following the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HA-DAXXΔSIM</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The reference library was built using bowtie2 v2.2.9 (59).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>bowtie2</div><div>suggested: (Bowtie 2, RRID:SCR_016368)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Read mapping was performed with bowtie2 allowing 1 seed mismatch in --local mode and samtools v1.9 (60)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mapping analysis and gene selection were performed using MAGeCK v0.5.6, normalizing the data with default parameters.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAGeCK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">10 pmol of NLS-Sp.Cas9-NLS (SpCas9) nuclease (Aldevron #9212) was combined with 30 pmol total synthetic sgRNA (10 pmol for each sgRNA) (Synthego) to form RNPs in 20 µL total volume with SE Buffer (Lonza #V5SC-1002).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Aldevron</div><div>suggested: (Aldevron, RRID:SCR_011017)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were acquired on a BD LSR Fortessa and analyzed using FlowJo.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Image analysis was performed using ImageJ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: GraphPad Prism was used for statistical analyses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Linear models were computed using Rstudio.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Rstudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 13. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.06.441046: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04561076</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Not yet recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Evaluate Safety and Pharmacokinetics of HLX70 in Healthy Adu…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04583228</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Not yet recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Evaluate the Safety, Tolerability, Pharmacodynamics, Pharmac…</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.06.442935: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.05.442875: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All procedures were approved by the Institutional Animal Care and Use Committee (protocol number 20-005) of Northern Arizona University. 4.2 Virus and Media: This study used coronavirus SARS-CoV-2 isolate USA-WA1/2020 (NR-52281; BEI Resources, Manassas, VA, USA).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">hACE2 male and female mice (6-8 weeks) were used for these studies according to NIH guidelines for housing and care in a biosafety level 3 animal laboratory.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, a t175 flask that was ~50% confluent was infected with SARS-CoV-2 virus, whereby 10 mL of fresh 2% FBS growth media containing 100μL of the BEI viral stock was added to VeroE6 cells and gentle rocked on a rocking platform for 1 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">4.1 Mice: The K18-hACE2 COVID-19 transgenic mouse model (B6.Cg-Tg (K18-ACE2)2Primm/J, Stock No. 034860, Jackson Laboratory, Bar Harbor, ME, USA) was used in the current study.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B6.Cg-Tg (K18-ACE2)2Primm/J</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sections were then processed for H&E staining and submitted to pathologist for analysis. 4.7 Statistical Analysis: Differences in data were tested for significance using either GraphPad Prism for Windows (GraphPad, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.05.442760: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethics statement: The animal experiments were performed with the approval of the Institutional Animal Ethics committee and all the experiments were performed as per the guidelines of CPSCEA (NIV/IAEC/2021/MCL/01).<br>Euthanasia Agents: ) (GISAID number: EPI_ISL_420545) and B.1.617.1 (GISAID number: EPI_ISL_1669767) lineages propagated at ICMR-NIV, Pune as described earlier under isoflurane anesthesia [9,13].</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus titration: The lungs and nasal turbinate samples were used for virus titration in Vero CCL-81 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero CCL-81</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Real-time RT-PCR: Nasal wash and TS collected in 1ml viral transport medium and weighed organ samples (lungs, nasal turbinate and trachea) triturated in 1 ml media were used for RNA extraction using MagMAX™</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MagMAX™</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Graphpad Prism version 8.4.3 software was used to assess the statistical significance.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.05.442780: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethics statement: Approval of animal experiments was obtained from the Institutional Animal Care and Use Committee of the Rocky Mountain Laboratories.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animal exposure and inoculation: Four to six-week-old female Syrian hamsters (ENVIGO) were exposed either via the intranasal, aerosol or fomite route as previously described by Port et al. 2020 [2].</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: No mycoplasma was detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Using GenScript U864YFA140-4/CB2093 NP-1 (1:1000) specific anti-CoV immunoreactivity was detected using the Vector Laboratories ImPress VR anti-rabbit IgG polymer (# MP-6401) as secondary antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NP-1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: (Biorbyt Cat# orb14385, RRID:AB_10735740)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike-specific antibodies were detected with goat anti-hamster IgG Fc (horseradish peroxidase (HRP)-conjugated, Abcam) for 1 h at RT and visualized with KPL TMB 2-component peroxidase substrate kit (SeraCare, 5120-0047).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-hamster IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Both variants were propagated in VeroE6 cells in DMEM supplemented with 2% fetal bovine serum (FBS), 2 mM L-glutamine, 100 U/ml penicillin and 100 μg/ml streptomycin (DMEM2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.04.442686: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.05.442742: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The image was subsequently analyzed using a gel analysis tool ImageJ software [9].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quality control was performed using FastQC and Multi-FastQC tools.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FastQC</div><div>suggested: (FastQC, RRID:SCR_014583)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, reads were mapped onto the SARS-CoV-2 reference genome (accession number: MN908947.3) using the Burrows Wheeler aligner (BWA) version 0.7.17 [10] with default parameters.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA</div><div>suggested: (BWA, RRID:SCR_010910)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Post-mapping file generated as bam file was processed with samtools [11] and the vcfR package to determine the percent of aligned reads, the depth of coverage and mapping quality.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Library estimation was performed using the CollectInsertSizeMetrics tool version 2.8.1 implemented in Picard.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CollectInsertSizeMetrics</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Picard</div><div>suggested: (Picard, RRID:SCR_006525)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vcftools was used to generate a variant call file (vcf).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vcftools</div><div>suggested: (VCFtools, RRID:SCR_001235)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SnpEff implemented on Galaxy server as well as Nextclade were used to annotate variants.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SnpEff</div><div>suggested: (SnpEff, RRID:SCR_005191)</div></div><div style="margin-bottom:8px"><div>Galaxy</div><div>suggested: (Galaxy, RRID:SCR_006281)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We performed de novo assembly of the reads using MEGAHIT software [14].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGAHIT</div><div>suggested: (MEGAHIT, RRID:SCR_018551)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Shorter contigs (<2000bp) were filtered out and the remaining contigs were queried with BLASTN on the NCBI database to recover the SARS-CoV-2 genome.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLASTN</div><div>suggested: (BLASTN, RRID:SCR_001598)</div></div><div style="margin-bottom:8px"><div>NCBI</div><div>suggested: (NCBI, RRID:SCR_006472)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Our study has some limitations. One of these was the lack of quality control of total RNA before library preparation. For instance, we could not check the quality of the total RNA and did not know if the RNA was degraded or not because we did not have all the reagents required to do so. Decision to sequence the sample was solely based on the quantification of total RNA. Nonetheless, during this pandemic period, access to reagents remains a real challenge, quality control of the total RNA may be bypassed. Another issue was the library size estimation accuracy. Even though, an agarose gel analysis represents an alternative solution to overcome fragment size determination with expensive equipment it may overestimate the fragment size. In summary, we provide the first genome of SARS-CoV-2 sequenced locally in Mali. Our result set a precedent for genomic surveillance of strains circulating in the country. We also offer the sequencing platform that can be used by scientists from neighboring countries. The platform could be used to provide insights in tracking the SAR-CoV-2 transmission dynamics, presence and evolution of variants and data generated could inform health authorities with local data for a better control of the disease.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.04.442634: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.04.441029: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All animal experiments were performed with the approval of the Academia Sinica Institutional Animal Care and Utilization Committee (IACUC Protocol No. 12-08-391) and in strict accordance with its guidelines and those of the Council of Agriculture Guidebook for the Care and Use of Laboratory Animals.<br>Euthanasia Agents: Surviving mice after viral challenge were euthanized using carbon dioxide.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Plasmid constructions: Generation of hACE2 transgenic mice: For mice production, we super-ovulated 3-4 week-old C57BL/6J female mice with 3.75-5 i.u. of pregnant mare serum gonadotropin (PMSG, Sigma-Aldrich G4877), followed 46-h later by 3.75-5 i.u. of human chorionic gonadotropin (hCG, Sigma-Aldrich CG1063).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">All recordings and analyses were conducted blind to the experiential conditions (i.e., HA tag or Spike protein expression).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies and respective dilutions are as follows: hACE2 (Abcam ab108209, 1:2500); HA (Cell Signaling #3725, 1:1000); and HSP90 (provided by Dr. Chung Wang, 1:5000) [16].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HSP90</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following commercial antibodies were used as primary antibodies for immunostaining: rabbit anti-ACE2 (Abcam, ab108209); mouse anti-HA (Abcam, ab130275); and rabbit anti-HA (Cell Signaling, 3742).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neuronal cultures were then fixed for immunofluorescence staining as described previously [18, 19] using the following primary antibodies: rabbit anti-ACE2 (Abcam, ab108209); mouse anti-HA (Abcam, ab130275); rabbit anti-HA (Cell Signaling, 3742); mouse anti-MAP2 (Sigma,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-MAP2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">M4403); mouse anti-GFAP (Millipore, MAB3402); and rabbit anti-GFP (Invitrogen, A6455).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-GFP</div><div>suggested: (Molecular Probes Cat# A-6455, RRID:AB_221570)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production of pseudotyped SARS-CoV-2 lentivirus: The pseudotyped SARS-CoV-2 lentivirus, which carries SARS-CoV-2 Spike protein as viral envelope protein, was generated by transiently transfecting HEK-293T cells with pCMV-ΔR8.91, pLAS2w.EGFP.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmid constructions: Generation of hACE2 transgenic mice: For mice production, we super-ovulated 3-4 week-old C57BL/6J female mice with 3.75-5 i.u. of pregnant mare serum gonadotropin (PMSG, Sigma-Aldrich G4877), followed 46-h later by 3.75-5 i.u. of human chorionic gonadotropin (hCG, Sigma-Aldrich CG1063).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 infection: CAG-hACE2 transgenic or wild-type (WT) mice were anesthetized and intranasally challenged with SARS-CoV-2 TCDC#4 (hCoV-19/Taiwan/4/2020 obtained from Taiwan Centers of Disease Control; lot: IBMS20200819) in a volume of 100 μL of sterile PBS at the indicated plaque-forming units (PFU).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 infection: CAG-hACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production of pseudotyped SARS-CoV-2 lentivirus: The pseudotyped SARS-CoV-2 lentivirus, which carries SARS-CoV-2 Spike protein as viral envelope protein, was generated by transiently transfecting HEK-293T cells with pCMV-ΔR8.91, pLAS2w.EGFP.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV-ΔR8.91</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pLAS2w.EGFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Puro and pcDNA3.1-nCoV-SΔ18.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1-nCoV-SΔ18</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting products were scanned on a QX200 Droplet Reader (Bio-Rad Laboratories), and the data was analyzed using QuantaSoft™ software (Bio-Rad Laboratories).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bio-Rad Laboratories</div><div>suggested: (Bio-Rad Laboratories, RRID:SCR_008426)</div></div><div style="margin-bottom:8px"><div>QuantaSoft™</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The images were processed using Photoshop (Adobe) with minimal adjustment of brightness or contrast applied to the entire images.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Photoshop</div><div>suggested: (Adobe Photoshop, RRID:SCR_014199)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analyses were carried out in Excel or GraphPad Prism 8.0 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 20, 21 and 22. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.03.442538: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All experiments adhered to the guidelines approved by the Emory University Institutional Animal Care and Committee.<br>Euthanasia Agents: Quantification of infectious virus: At the indicated day post infection, mice were euthanized via isoflurane overdose and lung tissue was collected in Omni-Bead ruptor tubes filled with 1% FBS-HBSS.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">All mice used in these experiments were females between 8-12 weeks of age.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following antibodies were used in this study: CD45:PE (Biolegend, Clone: 30-F11), CD45.2:BV605 (Biolegend, Clone: 104), CD11b:BUV395 BD Biosciences, 440c), I-A/I-E:AF700 (Biolegend, M5/114.15.2), CD11c:BUV737 (Biolegend, N418), CD26: PE-Cy7 (Biolegend, H194-112), CD172a:BV510 (Biolegend, P84), XCR1:AF647 (Biolegend, Zet), CD64: PerCpCy5.5 (Biolegend, X54-5/7.1), F4/80:FITC (Biolegend, BM8), H2kb:BUV805 (BD Biosciences, AF6-88.5), CD86:PE-Dazzle594 (Biolegend, GL1), Live/Dead Ghost Dye:R780 (Tonbo), CD3:APC-Cy7 (Biolegend, 145-2C11), CD19:APC-Cy7 (BD Biosciences, 1D3), NK1.1 (Biolegend, PK136), Ly6C:BV785 (Biolegend, Hk1.4), Ly6G:BV650 (Biolegend, 1A8), SiglecF:BV421 (BD Biosciences, E50-2440).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD45.2:BV605</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>I-A/I-E:AF700</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD26</div><div>suggested: (BD Biosciences Cat# 749316, RRID:AB_2873690)</div></div><div style="margin-bottom:8px"><div>PE-Cy7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD172a:BV510</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD64</div><div>suggested: (BD Biosciences Cat# 742023, RRID:AB_2871319)</div></div><div style="margin-bottom:8px"><div>PerCpCy5.5</div><div>suggested: (BD Biosciences Cat# 565364, RRID:AB_2869666)</div></div><div style="margin-bottom:8px"><div>F4/80:FITC</div><div>suggested: (Bio-Rad Cat# MCA497FA, RRID:AB_567113)</div></div><div style="margin-bottom:8px"><div>CD86:PE-Dazzle594</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD3:APC-Cy7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD19:APC-Cy7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>NK1.1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viruses and cells: VeroE6 cells were obtained from ATCC (clone E6, ATCC, #CRL-1586) and cultured in complete DMEM medium consisting of 1x DMEM (VWR, #45000-304), 10% FBS, 25mM HEPES Buffer (Corning Cellgro), 2mM L-glutamine, 1mM sodium pyruvate, 1x Non-essential Amino Acids, and 1x antibiotics.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VeroE6-TMPRSS2 cells and VeroE6-TMPRSS2-hACE2 cells were cultured in complete DMEM in the presence of Gibco Puromycin 10mg/mL (#A11138-03).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To perform plaque assays, 10-fold dilutions of viral supernatant in serum free DMEM (VWR, #45000-304) were overlaid on VeroE6-TMPRSS2-hACE2 cells monolayers and adsorbed for 1 hour at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-TMPRSS2-hACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This virus was then passaged 20 times in Balb/c mice followed by deep sequencing which identified 3 additional acquired mutations (S T417N, S H655Y, and E E8V).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Balb/c</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infection of mice with MA-SARS-CoV-2: C57BL/6J and Ccr2-/- mice were purchased from Jackson Laboratories or bred in-house at the Yerkes National Primate Research Center rodent facility at Emory University.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Ccr2-/-</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VERO E6 cells (ATCC CRL-1586) were transfected with pCAGGS plasmid in which chicken actin gene promoter drives the expression of an open reading frame comprising Puromycin N-acetyl transferase, GSG linker, 2A self-cleaving peptide of thosea asigna virus (T2A), human transmembrane serine protease 2 (TMPRSS2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_18926)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infection of mice with MA-SARS-CoV-2: C57BL/6J and Ccr2-/- mice were purchased from Jackson Laboratories or bred in-house at the Yerkes National Primate Research Center rodent facility at Emory University.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Jackson Laboratories</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene set enrichment analysis (GSEA) was conducted using ranked gene list produced with Seurat FindMarkers function (comparing CoV2 samples with mock samples) and Genelist were obtained from: MsigDB (hallmarks) and https://www.nature.com/articles/s41422-020-00455-9#MOESM1 (macrophage suppressive and hyperinflammatory).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene set enrichment analysis</div><div>suggested: (Gene Set Enrichment Analysis, RRID:SCR_003199)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.04.442699: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 neutralization assay: Vero cells were plated one day prior to infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.10.443438: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Immunization of mice and serum samples: Female CB6F1 mice (Charles River Laboratories, Montreal, QC, Canada) (</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Rabbit anti-SARS-CoV-2 Spike (RBD) antibody was commercially sourced (SinoBiological, Cat# 40592-T62).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RBD-specific antibodies from mouse antisera were detected by a horseradish peroxidase-conjugated goat anti-mouse secondary antibody (1:10,000; Cedarlane Laboratories, Burlington, ON, Canada) and peroxidase substrate (KPL, Gaithersburg, Md, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed (3X) with PBS +0.05% Tween20 and bound FLAG-ACE-2 was detected with HRP-conjugated anti-FLAG antibody (1:20,000, Sigma cat# A8592) and peroxidase substrate (KPL, Gaithersburg, Md, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-FLAG</div><div>suggested: (Sigma-Aldrich Cat# A8592, RRID:AB_439702)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T cells and Vero E6 cells (ATCC CRL-1586) were propagated in Dulbecco’s modified Eagle’s medium (Thermo Fisher Scientific) containing 10% heat-inactivated fetal bovine serum (Omega Scientific, Tarzana, CA), and Pen/Strep (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T cells overexpressing ACE-2 (293T ACE-2) were generously provided by Dr. Paul Bieniasz (The Rockefeller University) 31 and cultured in 293T cells media supplemented with 5ug/ml blasticidin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For neutralization assays, 293T ACE-2 cells were plated on poly-lysine-coated 96-well plates one day prior to infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunization of mice and serum samples: Female CB6F1 mice (Charles River Laboratories, Montreal, QC, Canada) (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CB6F1</div><div>suggested: RRID:MGI:5649749)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">protease cleavable C-terminal human monomeric IgG1 Fc tag (mFc) was inserted into the SpeI/ XhoI site of the pTRIP lentiviral vector bearing an IRES-AcGFP reporter 32.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pTRIP</div><div>suggested: RRID:Addgene_127663)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE-2 Expression and Purification: Full length human ACE-2-MycDDK in pCMV-6 entry vector (Origene, cat #RC208442) was expressed in Expi293™ cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV-6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The synthetic DNA fragment (Integrated DNA technologies Inc., Coralville, Iowa) containing corresponding mutations were used to replace the BamHI and AgeI fragment of pSARS-CoV-2Δ19 and confirmed by DNA sequencing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSARS-CoV-2Δ19</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.08.443212: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Two different systems (different glycan types) were generated by adding glycans using the Glycam web server Glycoprotein Builder tool[47], the insect-like system (DManpa1-3[DManpa1-6]DManpb1-4DGlcpNAcb1-4 DGlcpNAcb1-OH) and high mannose (DManpa1-6[DManpa1-3]DManpa1-6[DManpa1-3] DManpb1-4DGlcpNAcb1-4DGlcpNAcb1-OH).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DManpa1-6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All simulations were performed with Gromacs v2019.2 [50] with a 2fs integration step.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gromacs</div><div>suggested: (GROMACS, RRID:SCR_014565)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.07.442971: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study participants and ethics board approval: Study volunteers (n=29) included staff enrolled at the Cadham Provincial Laboratory in Winnipeg, with ethics approval from the University of Manitoba Health Research Ethics Board (HREB) and the Public Health Agency of Canada (PHAC).<br>Consent: Informed consent was obtained and a comprehensive socio-demographic and health assessment questionnaire administered to all study participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FlowSOM algorithm (Version 2.6) was used to create cluster populations from the dimensionally reduced data based on their similarity and subsequently segregated based on relative abundance and phenotype using ClusterExplorer (Version 1.5.9).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowSOM</div><div>suggested: (FlowSOM, RRID:SCR_016899)</div></div><div style="margin-bottom:8px"><div>ClusterExplorer</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Freshly isolated nasal cells from (n=11) were stimulated for six hours at 37 °C / 5% CO2 with SARS–CoV-2 spike peptide pools S, S1 and S+ containing 15-mer sequences overlapping by11 amino acids (PepTivator®, Miltenyi Biotec), encompassing the complete spike protein sequence (GenBank MN908947.3) at a final concentration of 1µg/mL per peptide, in the presence of Golgi-Plug (BD Biosciences), Golgi-Stop (BD Biosciences) and anti–CD107a (clone H4A3, BD Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Biosciences</div><div>suggested: (BD Biosciences, RRID:SCR_013311)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then washed, acquired using a BDLSR Fortessa (BD Biosciences) and analyzed using FlowJo™ version 10.7.1 (Becton Dickinson Life Sciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo™</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using SPSS v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">27.0 while all the graphing and was performed using Prism version 9 (GraphPad Software, LLC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 10. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.05.442725: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Preparation of 15N, 13C labeled SARS-CoV-2 nsp1 proteins: Nucleotide sequence of full length wt nsp1 was amplified by PCR from recombinant cDNA of SARS-CoV-2 Wuhan-Hu-1 strain (NC_045512.2) using primers: The PCR product was cloned into pE-SUMOpro-3 plasmid (LifeSensors Inc) between Bsa I and Xho I restriction sites.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pE-SUMOpro-3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein concentrations were determined on 280 nm using extinction coefficients, which were determined by ProteinCalculator v3.4 (http://protcalc.sourceforge.net/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ProteinCalculator</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were processed by Topspin 4.0.6 (Bruker) and assigned using CcpNmr Analysis 2.4.2 (40).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Topspin</div><div>suggested: (TopSpin, RRID:SCR_014227)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.04.442701: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study was approved by the Local ethic committee of the Moscow First Infectious Disease Hospital (Protocol #2 dated</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: The cells have been tested negative for mycoplasma contamination.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry: To measure S protein expression on the surface of 293T pseudovirus producing cells, 3×105 live cells were incubated with the serum from a convalescent donor at the 1:100 dilution in PSB for 30 min followed by the incubation with secondary anti-human IgG antibodies conjugated with PE (1:250, # H10104, ThermoFisher Scientific) for 30 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Thermo Fisher Scientific Cat# H10104, RRID:AB_2536546)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2 expression was assessed by staining cells with polyclonal rabbit antibodies against human ACE2 (PAB886Hu01, Cloud-Clone Corp.) followed by secondary anti-rabbit antibodies conjugated with PE (1:250, # P-2771MP, ThermoFisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (Molecular Probes Cat# P2771MP, RRID:AB_221651)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: The human embryonic kidney 293T cells were obtained through NIH AIDS Research and Reference Reagent Program.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The next day, the transfected cells and 293T/ACE2 cells were detached with 1mM EDTA, mixed at the ratio of 1:1 and plated in wells of a 24-well plate with the total number of 105 cells per well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T/ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mixture was then combined with 5.4×104 uninfected Vero E6 cells in 96-well plates in the total volume of 200 µl and incubated for 5 days at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The HIV-1 (strain NL4-3) packaging plasmids pCMV-dR8-2 (# 12263), vector pCMV-VSV-G for expression of the protein G from vesicular stomatitis virus (# 8454) were obtained from Addgene; reporter plasmids pUCHR-inLuc-mR and pUCHR-IR-GFP were described previously 37,38.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV-VSV-G</div><div>suggested: RRID:Addgene_8454)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plasmid pUCHR-hACE2 was generated by subcloning the ACE2 coding sequence from the pCG1-hACE2 plasmid obtained from Prof. Dr. Stefan Pöhlmann</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pUCHR-hACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCG1-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infection biology unit of the German Primate Center, Leibniz Institute for Primate Research) into lentiviral vector pUCHR.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pUCHR</div><div>suggested: RRID:Addgene_58955)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The next day, the cells were transfected with 0.66 µg of pCMV-dR8-2, 0.88 µg of pUCHR-hACE2, and 0.22 µg pCMV-VSVG using Lipofectamine 2000 (ThermoFisher Scientific) according to the manufacturer’s instruction.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV-VSVG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The next day, the cells were transfected with 5 µg pCMV-dR8-2, 6.67 µg pUCHR-inLuc-mR or pUCHR-IR-GFP, and 3.33 µg of the S-protein coding plasmid using Lipofectamine 2000 (ThermoFisher Scientific) accordinhg to the manufacturer’s instruction.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pUCHR-inLuc-mR</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pUCHR-IR-GFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 24 h, the cells were transfected with 0,5 µg pCMV-GFPt and 0,3 µg pCG1-SARS-2-S, pCG1-SARS-2-SdC19 or pCG1-SARS-2-SdC19-H2 using Lipofectamine 2000 (ThermoFisher Scientific) according to the manufacturer’s instruction.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV-GFPt</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCG1-SARS-2-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCG1-SARS-2-SdC19</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCG1-SARS-2-SdC19-H2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The next day, the cells were transfected with 1.67 µg pCMV-dR8-2, 2.22 µg pUCHR-inLuc-mR, and 1.11 µg pCG1-SARS-2-SdFdC19 using Lipofectamine 2000 (ThermoFisher Scientific) according to the manufacturer’s instruction.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV-dR8-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCG1-SARS-2-SdFdC19</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The HIV-1 (strain NL4-3) packaging plasmids pCMV-dR8-2 (# 12263), vector pCMV-VSV-G for expression of the protein G from vesicular stomatitis virus (# 8454) were obtained from Addgene; reporter plasmids pUCHR-inLuc-mR and pUCHR-IR-GFP were described previously 37,38.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Addgene</div><div>suggested: (Addgene, RRID:SCR_002037)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FlowJo LLC software was used for histogram visualization.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.04.442663: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Convalescent plasma samples were collected from COVID-19 patients treated at the intensive care unit of the University Medicine Göttingen under approval given by the ethic committee of the University Medicine Göttingen (SeptImmun Study 25/4/19 Ü).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Cell culture: 293T (human, female, kidney; ACC-635, DSMZ, RRID: CVCL_0063), Huh-7 (human, male, liver; JCRB0403, JCRB; RRID: CVCL_0336, kindly provided by Thomas Pietschmann, TWINCORE, Centre for Experimental and Clinical Infection Research, Hannover, Germany)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Authentication of cell lines was performed by STR-typing, amplification and sequencing of a fragment of the cytochrome c oxidase gene, microscopic examination and/or according to their growth characteristics.<br>Contamination: In addition, cell lines were routinely tested for contamination by mycoplasma.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Thereafter, cells received culture medium containing anti-VSV-G antibody (culture supernatant from I1-hybridoma cells; ATCC no. CRL-2700; except for cells expressing VSV-G, which received only medium) and incubated for 16-18 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-VSV-G</div><div>suggested: (LSBio (LifeSpan Cat# LS-C132924-50, RRID:AB_10835621)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: 293T (human, female, kidney; ACC-635, DSMZ, RRID: CVCL_0063), Huh-7 (human, male, liver; JCRB0403, JCRB; RRID: CVCL_0336, kindly provided by Thomas Pietschmann, TWINCORE, Centre for Experimental and Clinical Infection Research, Hannover, Germany)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human , female , kidney; ACC-635 , DSMZ ,</div><div>detected: (CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div><div style="margin-bottom:8px"><div>Huh-7</div><div>detected: (KCB Cat# KCB 200970YJ, RRID:CVCL_0336)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, BHK-21 (Syrian hamster, male, kidney; ATCC Cat# CCL-10; RRID: CVCL_1915, kindly provided by Georg Herrler, University of Veterinary Medicine, Hannover, Germany) and Vero76 cells (African green monkey, female, kidney; CRL-1586, ATCC; RRID: CVCL_0574, kindly provided by Andrea Maisner, Institute of Virology, Philipps University Marburg, Marburg, Germany) were cultivated in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FCS, Biochrom or GIBCO), 100 U/ml of penicillin and 0.1 mg/ml of streptomycin (PAN-Biotech).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-21</div><div>detected: (IZSLER Cat# BS CL 8, RRID:CVCL_1915)</div></div><div style="margin-bottom:8px"><div>Vero76</div><div>detected: (IZSLER Cat# BS CL 87, RRID:CVCL_0574)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Caco-2 (human, male, intestine;</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: CLS Cat# 300137/p1665_CaCo-2, RRID:CVCL_0025)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HTB-37, ATCC, RRID:CVCL_0025), Calu-3 (human, male, lung; HTB-55, ATCC; RRID: CVCL_0609, kindly provided by Stephan Ludwig, Institute of Virology, University of Münster, Germany) and Calu-3 cells stably overexpressing ACE2, Calu-3 (ACE2) (Hoffmann et al., 2021c), were cultivated in minimum essential medium supplemented with 10% FCS, 100 U/ml of penicillin and 0.1 mg/ml of streptomycin (PAN-Biotech), 1x non-essential amino acid solution (from 100x stock, PAA) and 1 mM sodium pyruvate (Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HTB-37</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ATCC</div><div>detected: (RCB Cat# RCB0988, RRID:CVCL_0025)</div></div><div style="margin-bottom:8px"><div>Calu-3</div><div>detected: (ATCC Cat# HTB-55, RRID:CVCL_0609)</div></div><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549-ACE2 (Hoffmann et al., 2021a) and A549-ACE2/TMPRSS2 cells (Hoffmann et al., 2021a) were derived from parental A549 cells (human, male, lung; CRM-CCL-185, ATCC, RRID:CVCL_0023; kindly provided by Georg Herrler) and cultivated in DMEM/F-12 Medium (ThermoFisher Scientific) supplemented with 10% FCS, 100 U/ml of penicillin and 0.1 mg/ml of streptomycin (PAN-Biotech), 1x non-essential amino acid solution (from 100x stock, PAA), 1 mM sodium pyruvate (Thermo Fisher Scientific) and 0.5 μg/ml puromycin (Invivogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-ACE2/TMPRSS2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A549</div><div>detected: (BCRC Cat# 60074, RRID:CVCL_0023)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">First, 293T cells that expressed the respective S protein, VSV-G (or no viral protein, control) following transfection were inoculated with VSV*ΔG-FLuc at a multiplicity of infection of three and incubated for 1 h at 37 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For experiments addressing cell tropism and entry efficiency, Vero, Caco-2, Calu-3, Calu-3 (ACE2), 293T, A549 (ACE2), A549 (ACE2+TMPRSS2) and Huh-7 target cells were inoculated with identical volumes of pseudotype preparations.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: CLS Cat# 300156/p7178_HuH7, RRID:CVCL_0336)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BHK-21 cells were transfected 24 h prior to pseudotype inoculation with either empty plasmid or ACE2 expression plasmid (0.1 μg/well) using Lipofectamine LTX (Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-21</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudotype particle neutralization test: For neutralization experiments, S protein bearing pseudotype particles were pre-incubated for 30 min at 37 °C with different concentrations of monoclonal antibodies (Casirivimab, Imdevimab, Casirivimab+Imdevimab [1:1], Bamlanivimab, Esetevimab, Bamlanivimab+Etesevimab [1:1] or unrelated control IgG [2, 0.2, 0.02, 0.002, 0.0002, 0.00002 μg/ml]) or plasma samples obtained from convalescent COVID-19 patients or individuals vaccinated with the Pfizer/BioNTech vaccine BNT162b2/Comirnaty (1:25, 1:100, 1:400, 1:1,600, 1:6,400, 1:25,600), before the mixtures were inoculated onto Vero cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting open reading frame was further inserted into the pCG1 plasmid (kindly provided by Roberto Cattaneo, Mayo Clinic College of Medicine, Rochester, MN, USA), making use of the unique BamHI and XbaI restriction sites.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Preparation of vesicular stomatitis virus pseudotypes: For this study, we employed rhabdoviral pseudotype particles that are based on a replication-deficient VSV vector that lacks the genetic information for VSV-G and instead codes for two reporter proteins, enhanced green fluorescent protein and firefly luciferase (FLuc), VSV*ΔG-FLuc (kindly provided by Gert Zimmer, Institute of Virology and Immunology, Mittelhäusern, Switzerland) (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VSV*ΔG-FLuc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In order to study the antiviral activity of Camostat mesylate, Caco-2 target cells, which express endogenous TMPRSS2, were pre-incubated for 1 h with medium containing different concentrations (100, 10, 1, 0.1 or 0.01 μM) of Camostat mesylate (prepared from a 100 mM stock; Tocris) or the solvent dimethyl sulfoxide (DMSO, 1:1,000; Sigma-Aldrich) as control before being inoculated with VSV bearing S protein, VSV-G or no glycoprotein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VSV-G</div><div>suggested: RRID:Addgene_138479)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein models were generated using the YASARA software (http://www.yasara.org/index.html) and are based on PDB: 6XDG (Hansen et al., 2020),PDB: 7L3N (Jones et al., 2020) or PDB: 7C01 (Shi et al., 2020), or a template that was constructed by modelling the SARS-2-S sequence on PDB: 6XR8 (Cai et al., 2020), using the SWISS-MODEL online tool (https://swissmodel.expasy.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>YASARA</div><div>suggested: (YASARA, RRID:SCR_017591)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data ware analyzed using Microsoft Excel (as part of the Microsoft Office software package, version 2019, Microsoft Corporation) and GraphPad Prism 8 version 8.4.3 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.03.442371: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The culture medium contained fluorochrome-labeled antibody to CD154 (catalog #563886, BD Biosciences, San Jose, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD154</div><div>suggested: (BD Biosciences Cat# 563886, RRID:AB_2738466)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were acquired on the FACS-Canto II flow cytometer with blue, red and violet lasers after addition of fluorochrome labeled antibodies to CD3, CD4, CD8, and CD19 and the viability dye 7-aminoactinomycin-D (catalog #s 340662, 641407, 340692, 341103, 559925, respectively, BD Biosciences, San Jose, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD3</div><div>suggested: (Fitzgerald Industries International Cat# 61R-CD3gHUAPCC7, RRID:AB_1283251)</div></div><div style="margin-bottom:8px"><div>CD4</div><div>suggested: (BioLegend Cat# 391503, RRID:AB_2721611)</div></div><div style="margin-bottom:8px"><div>CD8</div><div>suggested: (BioLegend Cat# 391503, RRID:AB_2721611)</div></div><div style="margin-bottom:8px"><div>CD19</div><div>suggested: (BD Biosciences Cat# 341103, RRID:AB_400224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Precoated wells were incubated with diluted samples for 2 hours, followed by anti-human IgG (Fab specific) HRP labeled secondary antibody 1:3000 in PBS-T containing 1% milk for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 25. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.03.442520: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All protocols were performed under approved BSL-3 conditions and approved by the Institutional Animal Care and Use Committee at Cornell University (IACUC mouse protocol # 2017-0108 and BSL3 IBC # MUA-16371-1).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Tissue sections (4 μm) were analyzed after staining with H&E and scored blinded by an anatomic pathologist.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: A region of interest (ROI, or “circle”) is then drawn around each host cell and validated against the bright field image to correspond with host cell membranes.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV-2 nucleocapsid antibody [HL344] (GTX635679) was kindly provided by Genetex; mouse anti-dsRNA antibody (J2-1904) was purchased from Scions English and Scientific Consulting 34; Hoechst 33258 and secondary antibodies goat anti-mouse IgG Alexa Fluor 488 (A11001) and goat anti-rabbit IgG Alexa Fluor 555 (A21428) were obtained from Invitrogen.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GTX635679</div><div>suggested: (GeneTex Cat# GTX635679, RRID:AB_2888553)</div></div><div style="margin-bottom:8px"><div>anti-dsRNA</div><div>suggested: (Millipore Cat# MABE1134, RRID:AB_2819101)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The fixative was removed, and cells were washed with PBS, permeabilized with 0.1% Triton X-100 for 5 min and blocked with 1% Bovine serum albumin (BSA) for 1 hr, followed by immunostaining with the mouse primary antibody J2 (dsRNA) and rabbit primary antibody HL344 (SARS-CoV-2 nucleocapsid) at working dilutions of 1:1000 for 1 hr at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>rabbit</div><div>suggested: (Thermo Fisher Scientific Cat# MA5-36251, RRID:AB_2890565)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies were used at a 1:2000 dilution and included the goat anti-mouse IgG Alexa Fluor 488 and goat anti-rabbit IgG Alexa Fluor 555 with the nuclear stain Hoechst 33342 at 1 µg/mL and F-actin staining with Alexa Fluor 647 phalloidin at a 1:300 dilution for 1 hr at room temperature in the dark.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To detect viral antigen, sections were labeled with anti-SARS-CoV-2 nucleocapsid protein rabbit IgG monoclonal antibody (GeneTex; GTX635679) at 1:5000 dilution and processed using a Leica Bond Max automated IHC stainer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 nucleocapsid protein rabbit IgG</div><div>suggested: (Proteintech Cat# 80026-1-RR, RRID:AB_2882944)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines, antibodies, and inhibitors: Calu-3 cells (ATCC® HTB-55™) were cultivated according to ATCC recommendations.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: ATCC Cat# HTB-55, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 cells (ATCC® CRL-I1586™; used for SARS-CoV-2 plaque assay) were cultivated in MEM supplemented with 10% FBS, 1 mM sodium pyruvate, and 0.1 nM non-essential amino acids and used at passage 19-25.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">TMPRSS2 pericellular activity screening assay and IC50 determination: Vero E6 cells were transfected with mock (pcDNA3.1), TMPRSS2 (pcDNA3.1/TMPRSS2 Uniprot: O15393-1), or TMPRSS2-S441A (pcDNA3.1/TMPRSS2-S441A) using Lipofectamine 3000 in 12-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div><div style="margin-bottom:8px"><div>pcDNA3.1/TMPRSS2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pcDNA3.1/TMPRSS2-S441A</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IC50 values were determined after generating a nonlinear regression analysis from a log([Compound]) versus a proteolytic activity plot using GraphPad Prism software (version 9.0.1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GraphPad Prism was used to identify and eliminate outliers (Q = 1) and assess the goodness of the fits.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Digital image analysis was performed using QuPath software version 0.2.3 62,63.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>QuPath</div><div>suggested: (QuPath, RRID:SCR_018257)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.04.438781: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: All methods and experimental protocols of the study were approved by the Ethics Committee of Hospital Germans Trias i Pujol (PI-20-217).<br>Consent: All the study subjects provided their written informed consent to participate.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">For the present study we identified participants (N=52) (median age 47 years, 62% female, 38% male) across Non-Seroconvertors (NSC, n=16), Low-neutralizers (LN, N=16) and Convalescent (Conv, N=15) (Fig 1A).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The LN were defined as having detectable anti-SARS-CoV-2 antibodies with neutralizing titers <500 IC50 values measured by pseudovirus neutralization assay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, Nunc MaxiSorp ELISA plates were coated overnight at 4°C with 50 ml of capture antibody (anti-6xHis antibody, clone HIS.H8; ThermoFisher Scientific) at 2 mg/mL in PBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-6xHis</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following reagents were used as secondary antibodies: HRP conjugated (Fab)2 Goat anti-human IgG (Fc specific) (1/20000), Goat anti-human IgM (1/10000), and Goat anti-human IgA (alpha chain specific) (1/20000) (all from Jackson Immunoresearch).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgM</div><div>suggested: (LSBio (LifeSpan Cat# LS-C70420-10000, RRID:AB_10637387)</div></div><div style="margin-bottom:8px"><div>anti-human IgA (alpha chain specific)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The second ELISA was a commercially available IgM and IgG class antibody ELISA against the SARS-CoV-2 NP (ImmunoDiagnostics, Hongkong).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-NP antibodies were captured by immobilized NP recombinant protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-NP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, cells were labelled with a viability dye (APC-Cy7, Thermo Fisher Scientific) for 30 min at room temperature (RT) and surface stained for 30 min at RT with anti-human antibodies for CD3 (A700, clone UCHT1, BD), CD4 (FITC,clone OKT4, Biolegend), CD8 (V500, clone RPA-T8, BD), CD45RA (BV786, clone HI100, BD), CCR7 (PE-CF594, clone 150503, BD), CD27 (BV605, clone L128, BD), PD-1 (BV421, clone EH12.1, BD) and activation induced markers (AIM) CD25 (A647, clone BC96, Biolegend), OX40 (PE, clone Ber-ACT35, Biolegend) and CD137 (PeCy7 clone 41BB, Biolegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>APC-Cy7</div><div>suggested: (Cell Signaling Technology Cat# 19805, RRID:AB_2798827)</div></div><div style="margin-bottom:8px"><div>anti-human antibodies for CD3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD8</div><div>suggested: (BD Biosciences Cat# 560774, RRID:AB_1937325)</div></div><div style="margin-bottom:8px"><div>CD45RA</div><div>suggested: (Bio-Rad Cat# MCA88A647T, RRID:AB_1102080)</div></div><div style="margin-bottom:8px"><div>BV786</div><div>suggested: (BD Biosciences Cat# 563870, RRID:AB_2738459)</div></div><div style="margin-bottom:8px"><div>CCR7</div><div>suggested: (Bio-Rad Cat# MCA2367A647T, RRID:AB_2072907)</div></div><div style="margin-bottom:8px"><div>CD27</div><div>suggested: (Thermo Fisher Scientific Cat# EPX140-15803-901, RRID:AB_2576106)</div></div><div style="margin-bottom:8px"><div>PD-1</div><div>suggested: (Thermo Fisher Scientific Cat# EPX140-15803-901, RRID:AB_2576106)</div></div><div style="margin-bottom:8px"><div>BV421</div><div>suggested: (BD Biosciences Cat# 743283, RRID:AB_2741401)</div></div><div style="margin-bottom:8px"><div>CD25</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A647</div><div>suggested: (BioLegend Cat# 302617, RRID:AB_493046)</div></div><div style="margin-bottom:8px"><div>CD137</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>PeCy7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Afterwards, cells were fixed with Fix/Perm Buffer A (Thermo Fisher Scientific) for 15 min at RT and stained intracellularly with Fix/Perm Buffer B and antibodies for TNF (PE-Cy7, clone MAb11, BioLegend), IFN-γ (BV711, clone B27, BD), and IL-2 (BV650, clone MQ1-17H12, BD) for 20 min at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PE-Cy7</div><div>suggested: (BD Biosciences Cat# 560707, RRID:AB_1727542)</div></div><div style="margin-bottom:8px"><div>IFN-γ</div><div>suggested: (BD Biosciences Cat# 563416, RRID:AB_2738193)</div></div><div style="margin-bottom:8px"><div>BV711</div><div>suggested: (BD Biosciences Cat# 564039, RRID:AB_2738557)</div></div><div style="margin-bottom:8px"><div>IL-2 (BV650</div><div>suggested: (BioLegend Cat# 500334, RRID:AB_2563878)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the neutralization assay, 200 TCID50 of pseudoviral supernatant was preincubated with serial dilutions of heat-inactivated serum or plasma samples (ranging from 1/60 to 1/14580) for 1h at 37°C and then added to ACE2-overexpressing HEK293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus neutralization assay: HIV reporter pseudoviruses expressing SARS-CoV-2 S protein and Luciferase were generated. pNL4-3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNL4-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2.SctΔ19 was generated (Geneart) from the full SARS-CoV-2 S gene sequence with a deletion of the last 19 C-terminal codons (Ou et al., 2020), human-codon optimized and inserted into pcDNA3.4-TOPO.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.4-TOPO</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expi293F cells were transfected using the Expifectamine Reagent (Thermo Fisher Scientific, Waltham, MA, USA) with pNL4-3.Luc.R-.E- and SARS-CoV-2.SctΔ19 at an 8:1 ratio, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNL4-3.Luc.R-</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Study participants: The KING extension cohort is composed of 336 SARS-CoV-2 infected individuals, including 120 individuals who required hospitalization, 22% of whom with severe or critical SARS-CoV-2 infection (Fig 1A).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KING</div><div>suggested: (KING, RRID:SCR_009251)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Finally, cells were resuspended and fixed in formaldehyde 1% and acquired on LSR Fortessa cytometer using FACSDiVa software (BD).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FACSDiVa</div><div>suggested: (BD FACSDiva Software, RRID:SCR_001456)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis was performed using FlowJo software version 10.0.7 (Tree Star, Ashland, OR, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses: Descriptive and comparison tests were performed using Graph Pad Prism, version 6 (GraphPad Software, Inc., San Diego, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graph Pad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Here, we overcome some of the previous studies limitations through a detailed identification of NSC and comparative analyses of total and S and NP-specific T cells. These data are essential to strengthen our understanding of T-cell mediated immunity and answer important questions regarding the identification of distinctive immunological traits associated with immune protection against SARS-CoV-2. We identified 4.8% of Non-seroconvertors in the KING extension cohort. We used a conservative approach to identify NSC by including confirmed SARS-CoV-2 PCR positivity, double ELISA testing and sampling-time estimation to allow for seroconversion. Longitudinal follow-up in the absence of SARS-CoV-2 IgG, IgM and IgA seroconversion over time further confirm the true nature of NSC in our study. Epidemiologically, NSCs were biased towards individuals with mild to moderate SARS-CoV-2 infection and a higher frequency of females. These data contrast with the presence of severe infection in 80% of Conv and higher frequency of males. The observed sex distribution is consistent with previous findings suggesting females exhibit robust T-cell responses and are less prone to severe SARS-CoV-2 infection and death than males (Takahashi et al., 2020; Jin et al., 2020; Vahidy et al., 2021). No significant differences in age distribution between NSC and Conv were found excluding age as one of the factors accounting for the differences in disease severity observed. We performed a characterization of T-...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 41. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.03.442357: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Synthetic construction of SARS-CoV-2 mouse adapted strains were approved by the University of Texas Medical Branch Institutional Biosafety Committee.<br>IRB: For samples Emory University, collection and processing were performed under approval from the University Institutional Review Board (IRB #00001080 and #00022371).<br>Consent: Adults ≥18 years were enrolled who met eligibility criteria for SARS-CoV-2 infection (PCR or rapid antigen test confirmed by a commercially available assay) and provided informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">All patients enrolled in July 2020 and had a mean age of 57 (range: 26-85; 50% male).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">No blinding was used in any sample collections, nor were samples randomized.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">No blinding was used in any sample collections, nor were samples randomized.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Viral mutants were confirmed by sequence analysis prior to use.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IHC was conducted using rabbit polyclonal antibodies raised against the SARS-CoV nucleocapsid protein (clone NB100-56576 [1:100], Novus Biologicals, Littleton, CO) and biotinylated anti-rabbit IgG, streptavidin AP (Vector Labs, Burlingame, CA) with Permanent Red chromogen (Dako/Agilent, Santa Clara CA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV nucleocapsid protein</div><div>suggested: (Creative Diagnostics Cat# DMAB8869, RRID:AB_2392503)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The slides were incubated with anti-SARS-CoV antibody for one hour at room temperature, washed in 1X Tris-buffered saline (TBS), 0.05% Tween 20 (wash buffer), and incubated with goat biotinylated anti-rabbit IgG (H + L) antibody for 30 min at room temperature followed by rinse in wash buffer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The medium from electroporated cells as harvested at 40 hours post transfection and served as seed stocks for amplifying one passage on Vero E6 cells (P1 stock).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice and in vivo infection: Ten-week-old BALB/C mice were purchased from Charles River Laboratories and were maintained in Sealsafe™ HEPA-filtered air in/out units.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/C</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">modeling: Spike receptor binding tables were constructed from a set of representative group 2B coronaviruses by using alignment data paired with neighbor-joining phylogenetic trees built in Geneious (v.9.1.5) using the spike amino acid sequences derived the following accession numbers: QHU79204 (SARS-CoV-2 WA1), AGZ48806 (RsSHC014), ALK02457 (WIV16), and AYV99817.1(SARS-CoV Urbani).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Geneious</div><div>suggested: (Geneious, RRID:SCR_010519)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Homology models were visualized and manipulated in PyMOL (version 2.4.2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Microsoft Excel for Mac 2011 was used to analyze data.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pileup files were generated using Samtools v1.9 43 and minority variants were extracted by nucleotide voting (PHRED>=30) using a custom python3 script previously described 39.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 22. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.05.442779: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All animal protocols were approved by the Animal Care Committee of the Medical College of Wisconsin and the Zablocki Veterans Administration Medical Center, in agreement with the National Institute of Health’s guidelines for the care and use of laboratory animals.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animal Studies: Six-week-old male C57 black 6 mice (C57BL/6) were purchased from Charles River Laboratories, Inc., Wilmington, MA.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Coded slides were examined by a veterinary pathologist in a blinded fashion for evidence of inflammatory changes.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Confluent or near-confluent cell culture monolayers of Vero 76 cells were prepared in 96-well microplates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero 76</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animal Studies: Six-week-old male C57 black 6 mice (C57BL/6) were purchased from Charles River Laboratories, Inc., Wilmington, MA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57 black 6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sensitization: The C57BL/6 mice were sensitized with ovalbumin (OVA) as described in our previous studies (8).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animal Studies: Six-week-old male C57 black 6 mice (C57BL/6) were purchased from Charles River Laboratories, Inc., Wilmington, MA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Charles River Laboratories</div><div>suggested: (Charles River Laboratories, RRID:SCR_003792)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All treatment groups were compared to either Sensitized Untreated (SENS) or Untreated, Unsensitized (NORMAL)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NORMAL</div><div>suggested: (NOrMAL, RRID:SCR_010889)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data Analysis: One-way ANOVA with Tukey-Kramer multiple comparison data analysis was used for Mch responses using SigmaStat Statistical Software (Systat software Inc., San Jose, CA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SigmaStat</div><div>suggested: (SigmaStat, RRID:SCR_010285)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.09.443331: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The research protocol was approved by the Institutional Animal Care and Use Committee of WRAIR.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Each study group was composed of 10 hACE2 K18 Tg mice (5 males and 5 females).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mice were randomly assigned to experimental groups and were not pre-screened or selected based on size or other gross physical characteristics.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the antibodies, plasmids encoding heavy and light chains of antibodies (CR3022, and SR1-SR5) were co-transfected into Expi293F cells (ThermoFisher) according to the manufacturer’s instructions for expression of antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-COV-2 antibodies were immobilized onto AHC biosensors (FortéBio) for 100 seconds, followed by a brief baseline in assay buffer for 15 s.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-COV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody positive (anti-RBD mouse mAb; BEI resources) and negative controls were included on each plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The secondary antibodies were HRP-conjugated AffiniPure Goat Anti-Mouse antibodies from Jackson ImmunoResearch specific for either Fcγ subclass 1, Fcγ subclass 2a, or Fcγ subclass 2c.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Mouse</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Fcγ subclass 1 , Fcγ subclass 2a , or Fcγ subclass 2c .</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infectivity and neutralization titers were determined using ACE2-expressing HEK293 target cells (Integral Molecular) in a semi-automated assay format using robotic liquid handling (Biomek NXp Beckman Coulter).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus was passaged once in Vero CCL81 cells (ATCC) and titrated by focus-forming assay on Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero CCL81</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum-virus mixtures were then added to Vero E6 cells in 96-well plates and incubated for 1 h at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BALB/c and C57BL/6 mice were obtained from Jackson Laboratories (Bar Harbor, ME).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the passive immunization study, on day −1, K18-hACE2 mice were injected intravenously with purified IgG from C57BL/6 vaccinated mice.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The His-tagged SARS-CoV-2 RBD molecule was generated by amplifying the RBD domain from the RBD-Ferritin plasmid while encoding the 3’ purification tag and subcloned into the CMVR vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RBD-Ferritin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 pseudovirions (PSV) were produced by co-transfection of HEK293T/17 cells with a SARS-CoV-2 S plasmid (pcDNA3.4) and an HIV-1 NL4-3 luciferase reporter plasmid (The reagent was obtained through the NIH HIV Reagent Program, Division of AIDS, NIAID,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.4</div><div>suggested: RRID:Addgene_131198)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human Immunodeficiency Virus 1 (HIV-1) NL4-3 ΔEnv Vpr Luciferase Reporter Vector (pNL4-3.Luc.R-E-), ARP-3418, contributed by Dr. Nathaniel Landau and Aaron Diamond).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNL4-3.Luc.R-E-</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">S-domain ferritin nanoparticle fusions were modelled using Pymol and Coot (Emsley et al., 2010) and expanded using “phenix.apply_ncs” (Liebschner et al., 2019).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Visual analysis and figure generation was conducted using ChimeraX and PyMOL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ChimeraX</div><div>suggested: (UCSF ChimeraX, RRID:SCR_015872)</div></div><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Grids were imaged using a FEI T20 operating at 200 kV with an Eagle 4K CCD using SerialEM or using a Thermo Scientific Talos L120C operating at 120 kV with Thermo Scientific Ceta using EPU.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SerialEM</div><div>suggested: (SerialEM, RRID:SCR_017293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RELION 3.1.1, and/or cisTEM-1.0.0-beta.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RELION</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CTF estimation was done with CTFFIND 4.1.13 and used for 2D classification.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CTFFIND</div><div>suggested: (CTFFIND, RRID:SCR_016732)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Purified research grade nanoparticle immunogens were formulated in PBS with 5% glycerol at 1 mg/ml and subsequently diluted with dPBS (Quality Biological) to provide 10 μg or lower amount per 50 μl dose upon mixing with adjuvant.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Quality Biological</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike-Ferritin nanoparticle immunogens were formulated with ALFQ to contain 20 μg 3D-PHAD and 10 μg QS21 per 50 μl dose.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ALFQ</div><div>suggested: (aLFQ, RRID:SCR_005925)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 pseudovirions (PSV) were produced by co-transfection of HEK293T/17 cells with a SARS-CoV-2 S plasmid (pcDNA3.4) and an HIV-1 NL4-3 luciferase reporter plasmid (The reagent was obtained through the NIH HIV Reagent Program, Division of AIDS, NIAID,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HIV Reagent Program</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Assay equivalency for SARS-CoV-2 was established by participation in the SARS-CoV-2 Neutralizing Assay Concordance Survey (SNACS) run by the Virology Quality Assurance Program and External Quality Assurance Program Oversite Laboratory (EQAPOL) at the Duke Human Vaccine Institute, sponsored through programs supported by the National Institute of Allergy and Infectious Diseases, Division of AIDS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Quality Assurance Program</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Quality Assurance Program Oversite Laboratory</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization curves were generated using Prism software (GraphPad Prism 8.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT03186781</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Influenza HA Ferritin Vaccine, Alone or in Prime-Boost Regim…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT03814720</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Dose, Safety, Tolerability and Immunogenicity of an Influenz…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04579250</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Dose, Safety, Tolerability and Immunogenicity of an Influenz…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04645147</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Safety and Immunogenicity of an Epstein-Barr Virus (EBV) gp3…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04296279</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Trial For The Study of Falciparum Malaria Protein 014 Admi…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04784767</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">SARS-COV-2-Spike-Ferritin-Nanoparticle (SpFN) Vaccine With A…</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.07.443089: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">General mappings are performed with minimap2 (Li, 2018), and intermediate file transformations are performed with SAMtools and BCFtools (Danecek et al., 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAMtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Additionally, all reads for each sample are mapped back against the Wuhan reference genome (Accession: NC_045512.2) using BWA-MEM (Li, 2013) to provide visual feedback of amplicon drop-outs, which are a common issue during the multiplex PCR step of the tiled amplicon sequencing protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA-MEM</div><div>suggested: (Sniffles, RRID:SCR_017619)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.07.443175: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants at Rockefeller University provided written informed consent before participation in the study and the study was conducted in accordance with Good Clinical Practice.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed 6 times with washing buffer and then incubated with anti-human IgG, IgM or IgA secondary antibody conjugated to horseradish peroxidase (HRP) (Jackson Immuno Research</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The half-maximal neutralization titers for plasma (NT50) or half-maximal and 90% inhibitory concentrations for monoclonal antibodies (IC50 and IC90) were determined using four-parameter nonlinear regression (least squares regression method without weighting; constraints: top=1, bottom=0) (GraphPad Prism).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IC90</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The enriched B cells were incubated in FACS buffer (1× PBS, 2% FCS, 1 mM EDTA) with the following anti-human antibodies (all at 1:200 dilution): anti-CD20-PECy7 (BD Biosciences, 335793), anti-CD3-APC-eFluro 780 (Invitrogen, 47-0037-41)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human</div><div>suggested: (GenWay Biotech Inc. Cat# 18-202-335793-0.1 mg, RRID:AB_1981874)</div></div><div style="margin-bottom:8px"><div>anti-CD20-PECy7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD3-APC-eFluro 780</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For B cell phenotype analysis, in addition to above antibodies, B cells were also stained with following anti-human antibodies: anti-IgD-BV421 (Biolegend, 348226), anti-CD27-FITC (BD biosciences, 555440), anti-CD19-BV605 (Biolegend, 302244), anti-CD71-PerCP-Cy5.5 (Biolegend, 334114), anti-IgG-PECF594 (BD biosciences, 562538), anti-IgM-AF700 (Biolegend, 314538), anti-IgA-Viogreen (Miltenyi Biotec, 130-113-481)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human antibodies: anti-IgD-BV421 ( Biolegend , 348226</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD27-FITC</div><div>suggested: (Millipore Cat# FCMAB191F, RRID:AB_10807274)</div></div><div style="margin-bottom:8px"><div>anti-CD19-BV605</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD71-PerCP-Cy5.5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IgG-PECF594</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IgM-AF700 ( Biolegend , 314538) , anti-IgA-Viogreen ( Miltenyi Biotec , 130-113-481)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The frequency distributions of human V genes in anti-SARS-CoV-2 antibodies from this study was compared to 131,284,220 IgH and IgL sequences generated by 45 and downloaded from cAb-Rep46, a database of human shared BCR clonotypes available at https://cab-rep.c2b2.columbia.edu/.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells were transfected with pNL4-3ΔEnv-nanoluc and pSARS-CoV-2-SΔ19, particles were harvested 48 hpt, filtered and stored at -80°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: RRID:CVCL_H376)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells were transfected with pNL4-3ΔEnv-nanoluc and pSARS-CoV-2-SΔ19, particles were harvested 48 hpt, filtered and stored at -80°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNL4-3ΔEnv-nanoluc</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pSARS-CoV-2-SΔ19</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The average of its signal was used for normalization of all of the other values on the same plate with Excel software before calculating the area under the curve using Prism V9.1(GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For monoclonal antibodies, the EC50 was determined using four-parameter nonlinear regression (GraphPad Prism V9.1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Proteins: Mammalian expression vectors encoding the RBDs of SARS-CoV-2 (GenBank MN985325.1; S protein residues 319-539) or K417N, E484K, N501Y RBD mutants with an N-terminal human IL-2 or Mu phosphatase signal peptide were previously described 43.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Proteins</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The half-maximal neutralization titers for plasma (NT50) or half-maximal and 90% inhibitory concentrations for monoclonal antibodies (IC50 and IC90) were determined using four-parameter nonlinear regression (least squares regression method without weighting; constraints: top=1, bottom=0) (GraphPad Prism).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single CD3-CD8-CD14-CD16-CD20+Ova-RBD-PE+RBD-AF647+ B cells were sorted into individual wells of 96-well plates containing 4 μl of lysis buffer (0.5× PBS, 10 mM DTT, 3,000 units/ml RNasin Ribonuclease Inhibitors (Promega, N2615) per well using a FACS Aria III and FACSDiva software (Becton Dickinson) for acquisition and FlowJo for analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FACSDiva</div><div>suggested: (BD FACSDiva Software, RRID:SCR_001456)</div></div><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For B cell phenotype analysis, in addition to above antibodies, B cells were also stained with following anti-human antibodies: anti-IgD-BV421 (Biolegend, 348226), anti-CD27-FITC (BD biosciences, 555440), anti-CD19-BV605 (Biolegend, 302244), anti-CD71-PerCP-Cy5.5 (Biolegend, 334114), anti-IgG-PECF594 (BD biosciences, 562538), anti-IgM-AF700 (Biolegend, 314538), anti-IgA-Viogreen (Miltenyi Biotec, 130-113-481)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Biolegend , 314538) , anti-IgA-Viogreen ( Miltenyi Biotec</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Miltenyi</div><div>suggested: (Miltenyi Biotec, RRID:SCR_008984)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence analysis was performed using MacVector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MacVector</div><div>suggested: (MacVector, RRID:SCR_015700)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.08.443253: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Controls with COVID-19 were enrolled to the NIHR BioResource Centre Cambridge under ethics review board (17/EE/0025).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All cells were regularly tested and are mycoplasma free.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Membranes were blocked for 1 hour in 5% non-fat milk in PBS + 0.1% Tween-20 (PBST) at room temperature with agitation, incubated in primary antibody (anti-SARS-CoV-2 Spike, which detects the S2 subunit of SARS-CoV-2 S (Invitrogen, PA1-41165)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>PA1-41165</div><div>suggested: (Thermo Fisher Scientific Cat# PA1-41165, RRID:AB_1087210)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">anti-GAPDH (proteintech) or anti-p24 (NIBSC)) diluted in 5% non-fat milk in PBST for 2 hours at 4°C with agitation, washed four times in PBST for 5 minutes at room temperature with agitation and incubated in secondary antibodies anti-rabbit HRP (1:10000, Invitrogen 31462), anti-bactin HRP (1:5000; sc-47778) diluted in 5% non-fat milk in PBST for 1 hour with agitation at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-GAPDH</div><div>suggested: (LSBio (LifeSpan Cat# LS-C147452-10000, RRID:AB_11130690)</div></div><div style="margin-bottom:8px"><div>anti-p24</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit HRP</div><div>suggested: (Bioss Cat# bs-5000R-HRP, RRID:AB_11112914)</div></div><div style="margin-bottom:8px"><div>anti-bactin HRP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells: HEK 293T CRL-3216</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: ATCC Cat# CRL-3216, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, Vero CCL-81 were purchased from ATCC and maintained in Dulbecco”s Modified Eagle Medium (DMEM) supplemented with 10% fetal calf serum (FCS), 100 U/ml penicillin, and 100mg/ml streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero CCL-81</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">. 293T cells were transfected with a mixture of 11ul of Fugene HD, 1μg of pCDNAΔ19 spike-HA, 1ug of p8.91 HIV-1 gag-pol expression vector and 1.5μg of pCSFLW (expressing the firefly luciferase reporter gene with the HIV-1 packaging signal).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Supernatant containing virus particles was harvested after 48 and 72 hours, 0.45 μm filtered, and used to infect 293T or Vero cells to generate stable cell lines.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T-GFP1-10 and Vero-GFP11 cells were seeded at 80% confluence in a 24 multiwell plate the day before.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-GFP11</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T-GFP1-10 cells were then detached 5 hours post transfection, mixed together with the Vero-GFP11 cells, and plated in a 12 multiwell plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-GFP1-10</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">. 293T cells were transfected with a mixture of 11ul of Fugene HD, 1μg of pCDNAΔ19 spike-HA, 1ug of p8.91 HIV-1 gag-pol expression vector and 1.5μg of pCSFLW (expressing the firefly luciferase reporter gene with the HIV-1 packaging signal).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNAΔ19 spike-HA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCSFLW</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids for split GFP system to measure cell-cell fusion: pQCXIP□BSR□GFP11 and pQCXIP□GFP1□10 were from Yutaka Hata40 Addgene plasmid #68716; http://n2t.net/addgene:68716; RRID:Addgene_68716 and Addgene plasmid #68715; http://n2t.net/addgene:68715; RRID:Addgene_68715) Generation of GFP1□ 10 or GFP11 lentiviral particles: Lentiviral particles were generated by co-transfection of 293T cells with pQCXIP□BSR□GFP11 or pQCXIP□GFP1□10 as previously described 41.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_68716)</div></div><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_68715)</div></div><div style="margin-bottom:8px"><div>pQCXIP□BSR□GFP11</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pQCXIP□GFP1□10</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T cells were co-transfected with 1.5 μg of spike expression plasmids in pCDNA3 using Fugene 6 and following the manufacturer”s instructions (Promega).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA3</div><div>suggested: RRID:Addgene_15475)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenetic Analysis: All sequences excluding low-quality sequences (>5% N regions) with the L452R mutation were downloaded from https://gisaid.org33 on the 4th May 2021 and manually aligned to reference strain MN908947.3 with mafft v4.475 34 using the --keeplength --addfragments option.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>mafft</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structural Analyses: The PyMOL Molecular Graphics System v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Graphs were generated using Prism 8 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.06.442911: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: (24) Animal Studies: All animal work was performed in accordance with protocols approved by the Lawrence Livermore National Laboratory Institutional Animal Care and Use Committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Groups of male and female K18-hACE2 C57BL/6J transgenic mice (Jackson Laboratory) ranging in age from 12-16 weeks were inoculated intranasally with 2.5×104 PFU SARS-2 (USA-WA 01/2020) while under anesthesia (4-5% isoflurane in 100% oxygen).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2-huFc, ACE2-rbFc, and VHH-huFc antibodies were produced by transient expression in CHO-S cells using the ExpiCHO expression system.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VHH-huFc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A high diversity library was designed by incorporating the natural prevalence of amino acids at positions in CDR1 and CDR2 based off 670 functional VHH antibodies deposited on sdAb-DB (www.sdab-db.ca).(15) Amino acids cysteine and methionine were omitted from all CDR loops and full diversity was used for CDR3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CDR2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CDR3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibody, goat anti-human H+L IgG HRP (Thermo) was added for an additional hour before washing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human H+L IgG HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-2-NG, VSV-SARS-2-GFP, or VSV-SARS-1-GFP was added to the serially diluted VHH-huFc antibodies for a final multiplicity of infection (MOI) of 0.2 (RG 2) or 0.1 (RG 3) and allowed to incubate at 37°C for 30 minutes to 1 hour with shaking prior to transfer of virus-VHH-huFc mixture to cells seeded in 96 (RG 3) or 384 well plates (RG 2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VSV-SARS-2-GFP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Expi293 cells were subsequently infected with VSV-DG-GFP, itself pseudotyped with VSV-G, at 72 h post-transfection using a multiplicity of infection (MOI) of 3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VHH-huFc-virus complexes were incubated with Vero cells at 37°C with 5% CO2 for 12-16 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After a 30-minute incubation of VHH-huFc-virus complexes with Vero E6 cells at 37°C with 5% CO2, overlays of 2 mL per well of 0.6% microcrystalline cellulose (MCC, Sigma 435244), in 8% FBS, 1% P/S complemented 2X MEM were added.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Groups of male and female K18-hACE2 C57BL/6J transgenic mice (Jackson Laboratory) ranging in age from 12-16 weeks were inoculated intranasally with 2.5×104 PFU SARS-2 (USA-WA 01/2020) while under anesthesia (4-5% isoflurane in 100% oxygen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DNA Manipulation and Production of Proteins: pSF-CMV-SARS-2-S was constructed as follows.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSF-CMV-SARS-2-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pSF-SARS-2-RBD was produced by commercial production of double stranded DNA encoding a N-terminal Kozak, a signal peptide (MDWTWRFLFVVAAATGVQS), 319-577 of the SARS-2 S gene (GenBank:MN908947.3), a TEV site, and a C-terminal, decahistadine tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSF-SARS-2-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All DNA fragments and pSF-CMV vector restriction digested with EcoRI and BamHI were assembled using NEBuilder HiFi DNA master.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSF-CMV</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pAce2-huFc was produced by subcloning the ectodomain on human ACE2 (Sino Biological) into pCR-Fc using the NotI and BamHI restriction sites.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCR-Fc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To produce Ace2-rbFc (rabbit Fc domain), a gBlock (IDT) of this same region of Ace2 was subcloned into pFUSE rIgG-Fc2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pFUSE</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The minimum region containing all 3 CDR domains, approximately 300 bps, was excised from the pADL20c backbone by two-step restriction digests, BglI followed by DdeI/BstEII double digests on the gel-purified small fragment from the BglI restriction reaction.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pADL20c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Diversity of the nanobody library was determined by both NGS and colony PCR.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NGS</div><div>suggested: (PM4NGS, RRID:SCR_019164)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BCL files were converted to FASTQ and demutiplexed using the bcl2fastq script from MyIllumina (https://my.illumina.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>bcl2fastq</div><div>suggested: (bcl2fastq , RRID:SCR_015058)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The quality filtering and adaptor trimming were performed using fastp (https://github.com/OpenGene/fastp) with following parameters, -q 30 -l 100 -x 7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://github.com/OpenGene/fastp</div><div>suggested: (fastp, RRID:SCR_016962)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">R2read was reformatted to be reverse complemented and merged with R1 read using BBTools (BBMap, https://sourceforge.net/projects/bbmap/).(17) Three CDR domains with correct sequence lengths were extracted, concatenated and translated and counted unique amino acid sequences using a custom python script.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BBMap</div><div>suggested: (BBmap, RRID:SCR_016965)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The dose response curves and 50% effective inhibitory concentrations (EC50) were generated using Graphpad Prism 9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The filtered reads were mapped to Spike protein coding region of the SARS-2 Wuhan Hu-1 isolate (GenBank:MN908947.3) using Bowtie 2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bowtie</div><div>suggested: (Bowtie, RRID:SCR_005476)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Kaplan-Meier survival curves were generated based on two independent experiments and log rank tests were performed with Bonferroni multiple comparison correction applied (GraphPad Prism).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:While vaccines have been great successes, therapeutic biologics are emerging as a critical tool in preventing progression to severe disease in those who do become infected.(31) Several therapeutic antibody candidates with efficacy against SARS-2 have been recently identified, including three with emergency use authorization, but there are a number of caveats associated with conventional antibodies as therapeutics such as time-consuming discovery, relying on immunized or patient sera, expensive and labor-intensive production, and the large doses required to achieve clinical efficacy. (9, 22, 32-34) High stability, solubility, and the ability to be multimerized, are just some of the many reasons why single-domain heavy chain-based antibody therapeutics (VHH-Fc) represent a highly promising method for treatment.(12) One VHH-based therapeutic is already approved by the FDA for treatment of a rare blood clotting disorder and many more are in late stage clinical trials.(12, 35) The small size of VHH antibodies and the wider distribution of CDR3 loop lengths compared to human IgGs expands the type of epitope which can be effectively targeted.(12) Finally, preliminary evidence suggests that VHH-Fc antibodies are transported more efficiently into the blood and lung parenchyma following intraperitoneal administration compared to conventional IgG1 antibodies.(36, 37) Several groups have recently used in vitro screening techniques to identify VHH domains with high affinity for the SARS-2...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.05.442873: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Each pair of downsampled fastq files, along with the original, was quality and adapter trimmed using trimmomatic v0.36 with the following parameters: ILLUMINACLIP:adapters.fa:2:30:10:8:true LEADING:20 TRAILING:20 SLIDINGWINDOW:4:20 MINLEN:20 (47).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>trimmomatic</div><div>suggested: (Trimmomatic, RRID:SCR_011848)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The trimmed reads were aligned to the Wuhan-Hu-1 SARS-CoV-2 reference genome (NC_045512.2) using BWA mem v0.7.17 with the -K parameter set to 100000000 for reproducibility and -Y to use soft clipping for supplementary alignments (48).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA</div><div>suggested: (BWA, RRID:SCR_010910)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Variants were called using six separate methods: Intersections between the workflow VCF files (produced by Mutect2, Freebayes, timo, VarScan, iVar and haplotype caller) and the golden VCF file were generated using bcftools isec v1.9 (48).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Mutect2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>VarScan</div><div>suggested: (VARSCAN, RRID:SCR_006849)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Assembly of genomes and consensus sequences: Reads were base-called with Picard Tools IlluminaBasecallsToFastq v2.17.11 and demultiplexed using Pheniqs allowing for 1 mismatch in sample index sequences (49, 50).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Picard</div><div>suggested: (Picard, RRID:SCR_006525)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Duplicates were marked using GATK MarkDuplicatesSpark v4.1.3.0 (https://gatk.broadinstitute.org/hc/en-us/articles/360037224932-MarkDuplicatesSpark).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GATK</div><div>suggested: (GATK, RRID:SCR_001876)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Predicted SNV effects were called using SnpEff v4.3i (51).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SnpEff</div><div>suggested: (SnpEff, RRID:SCR_005191)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.04.442648: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(S1+S2; containing amino acids Gln14 to Trp1212), and human ACE2-His-Avi (residues Gln18 to Ser740), all expressed in HEK293 cells, were from Bioss Antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Trp1212</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Ser740</div><div>suggested: (Antibodies-Online Cat# ABIN801498, RRID:AB_11187813)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Biotechnology; mouse monoclonal anti-vimentin clone 13.2 (V5255) from Sigma; rabbit monoclonal SP20 anti-vimentin antibody from ThermoFisher Scientific; cell-surface vimentin (CSV) antibody, clone 84-1, from Abnova, and goat anti-vimentin antibody EB11207 from Everest Biotech.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>vimentin ( CSV )</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-vimentin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-ARL13B C-5 (sc-515784) was from Santa Cruz Biotechnology, anti-ACE2 rabbit antibodies were purchased from Invitrogen and Abcam, anti-human IgG-Alexa647 and anti-human IgG-Alexa568 were obtained from Invitrogen, anti-acetylated tubulin (T7451) was from Sigma and anti-SARS-CoV-2 Spike protein was a product of Sino Biological.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-ARL13B C-5</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-515784, RRID:AB_2890034)</div></div><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgG-Alexa647</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgG-Alexa568</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-acetylated tubulin</div><div>suggested: (Sigma-Aldrich Cat# T7451, RRID:AB_609894)</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 Spike protein</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(S1+S2; containing amino acids Gln14 to Trp1212), and human ACE2-His-Avi (residues Gln18 to Ser740), all expressed in HEK293 cells, were from Bioss Antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human adrenal carcinoma SW13/cl.2 cells were the generous gift of Dr. A. Sarriá (University of Zaragoza, Spain) [41].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SW13/cl.2</div><div>suggested: RRID:CVCL_WY52)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human lung adenocarcinoma A549 cells (ATCC) were cultured in RPMI1640 with 10% (v/v)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HAP1 cells were cultured in DMEM-F12 with 10% (v/v)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HAP1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For assessment of ACE2 levels, A549 and Vero cells were lysed in RIPA containing cOmplete™ Protease Inhibitor Cocktail (Sigma)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Biotechnology; mouse monoclonal anti-vimentin clone 13.2 (V5255) from Sigma; rabbit monoclonal SP20 anti-vimentin antibody from ThermoFisher Scientific; cell-surface vimentin (CSV) antibody, clone 84-1, from Abnova, and goat anti-vimentin antibody EB11207 from Everest Biotech.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher Scientific</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were analyzed using LasX or ImageJ software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analyses were performed with GraphPad Prism 5 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Antibody-based detection of cell surface antigens is widely used although it is not exempt from limitations. Many of the antibodies employed herein have been validated by various methods (see Suppl. Table 1), including the confirmation of lack of signal in vimentin-deficient or knockout cells. Nevertheless, most of them have not been validated for the specific detection of cell surface vimentin. Under our conditions, incubation of live, non-permeabilized cells with a variety of anti-vimentin antibodies gave a dotted pattern non-homogeneously distributed along the cell surface. In addition, the presence of adhered vimentin or of focal membrane permeabilization contributed to the heterogeneity of the pattern of cell surface vimentin staining. Of the antibodies used, the 84-1 clone gave the strongest signal, followed by the V9 antibody in cells subsequently fixed with 4% (w/v) PFA. Nevertheless, controls of specificity carried out in two vimentin-deficient cell lines, namely SW13/cl.2 adrenal carcinoma and HAP1 (vim −), with either the V9 or the 84-1 antibodies still yielded a non-negligible background. A putative source for this background could be vimentin present in serum, e.g., in exosomes [73]; however, it was not abolished by culturing SW13/cl.2 cells in the absence of serum. Alternatively, the possibility of a minor crossreactivity of the antibodies with other cellular structures needs to be considered. Indeed, certain anti-vimentin antibodies generated in patients show c...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 32 and 33. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.05.442782: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animal ethics statement: Noble Life Sciences performed the ferret (Musteia putorius furo) immunogenicity study (Sykesville, MD, USA).<br>Field Sample Permit: The studies were conducted in accordance with each institutes’ IACUC approved protocol. 2.5.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Briefly, female BALB/c mice were immunized with SARS-CoV-2 US-WA recombinant spike (rS) protein adjuvanted with Matrix M1 on day 0 and day 14 by intramuscular injection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">A board-certified pathologist (Experimental Pathology Laboratories, Inc. (EPI, Sterling, VA, USA) examined H&E slides in a blinded fashion. 2.15.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Hemagglutinin inhibiting antibodies (HAI): HAI responses against influenza A/Brisbane/02/2018 (H1N1), A/Kansas/14/17 (H3N2), and B strains (B/Maryland/15/16 and B/Phuket/3073/13) were evaluated in serum samples.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>H3N2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus stock and receptor: The SARS-CoV-2 (strain 2019-nCoV/USA-WA1/2020) isolate was obtained from the Center for Disease Control and stock virus prepared by passage in Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sf9 cells cultures were infected with recombinant baculovirus expressing the HA genes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sf9</div><div>suggested: CLS Cat# 604328/p700_Sf9, RRID:CVCL_0549)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">At the end of incubation, 100 µL of 1.5×105 mL-1 MDCK cells were added to each well and the plates were incubated with 5% CO2 at 37°C for influenza A virus or 32°C for influenza B virus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDCK</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, female BALB/c mice were immunized with SARS-CoV-2 US-WA recombinant spike (rS) protein adjuvanted with Matrix M1 on day 0 and day 14 by intramuscular injection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pBac1 plasmids were transfected into Sf9 with Flash-bacGOLD bacmid containing the Autographa californica polydedrosis virus genome (Oxford Expression Technology, Oxford UK).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBac1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pBac1 plasmids were transfected into Sf9 with Flash-bacGOLD bacmid containing the Autographa californica polydedrosis virus genome (Oxford Expression Technology, Oxford UK).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Oxford Expression Technology</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Individual animal hACE2 receptor inhibiting titers, group GMT ± 95% CI were plotted using GraphPad Prism 8 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: GraphPad Prism 7.05 software was used for statistical analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04368988</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Evaluation of the Safety and Immunogenicity of a SARS-CoV-2 …</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04533399</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Study Looking at the Effectiveness and Safety of a COVID-1…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04583995</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Study Looking at the Effectiveness, Immune Response, and S…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04611802</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Study to Evaluate the Efficacy, Immune Response, and Safet…</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.05.442784: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: All ABSL-3 animal experiments were conducted under West Virginia University (WVU<br>Euthanasia Agents: Euthanasia and necropsy of SARS-CoV-2 infected mice: Euthanasia was conducted by administering 200 µL of pentobarbital (Patterson Veterinary 07-805-9296, 390 mg/kg diluted in 0.9% sterile NaCl) and cardiac puncture.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Male and female (Figures 2-3) or male (Figures 4-7) eight-week-old B6.Cg-Tg(K18-hACE2)2Prlmn/J mice (Jackson Laboratory 034860) were anesthetized with a single intraperitoneal dose of ketamine (Patterson Veterinary 07-803-6637, 80 mg/kg) + xylazine (Patterson Veterinary 07-808-1947, 8.3 mg/kg) and the 50µL infectious dose was administered with a pipette intranasally, 25µL per nare.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibody (100µL 1:500 anti-human IgG HRP, Invitrogen 31410) was added and plates were incubated for 10 minutes at room temperature shaking at 60rpm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After blocking, 100µL were transferred into 2µL of antibody cocktail including 0.5µg of: hamster anti-mouse CD3e BV510: BD Biosciences 563024</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse CD3e</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For viral growth kinetics, Vero E6 cells (6-well plate, 106 cells/well, triplicates) were infected (MOI 0.01) with SARS-CoV-2 WA-1, B.1.1.7 or B.1.351.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Male and female (Figures 2-3) or male (Figures 4-7) eight-week-old B6.Cg-Tg(K18-hACE2)2Prlmn/J mice (Jackson Laboratory 034860) were anesthetized with a single intraperitoneal dose of ketamine (Patterson Veterinary 07-803-6637, 80 mg/kg) + xylazine (Patterson Veterinary 07-808-1947, 8.3 mg/kg) and the 50µL infectious dose was administered with a pipette intranasally, 25µL per nare.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B6.Cg-Tg(K18-hACE2)2Prlmn/J</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Raw reads were quality filtered using Trimmomatic v0.39 (Bolger et al., 2014) and mapped to a SARS-CoV-2 reference genome (Genbank Accession No. MN985325) with Bowtie2 v2.4.1 (Langmead and Salzberg, 2012).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Trimmomatic</div><div>suggested: (Trimmomatic, RRID:SCR_011848)</div></div><div style="margin-bottom:8px"><div>Bowtie2</div><div>suggested: (Bowtie 2, RRID:SCR_016368)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We genotyped each sample for low frequency VoCs with LoFreq* v2.1.3.1 (Wilm et al., 2012) and filtered sites with allele frequencies less than 20%.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>LoFreq*</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 viral RNA from stocks used for K18-hACE2 transgenic mice infection was deep sequenced and reads were aligned to the MN908947.3 reference genome using BWA version 0.7.17 (Li and Durbin, 2009) and trimmed for base-calling quality using iVar version 1.3.1 (Grubaugh et al., 2019) with default parameters.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA</div><div>suggested: (BWA, RRID:SCR_010910)</div></div><div style="margin-bottom:8px"><div>iVar</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Coverage was computed using samtools mpileup version 1.11 (Li et al., 2009).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">LAVA constructs a candidate reference genome from early passage virus using bwa (Li and Durbin, 2009), removes PCR duplicates with Picard, calls variants with VarScan (Koboldt et al., 2009, 2012), and converts these changes into amino acid changes with Annovar (Wang et al., 2010).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Picard</div><div>suggested: (Picard, RRID:SCR_006525)</div></div><div style="margin-bottom:8px"><div>VarScan</div><div>suggested: (VARSCAN, RRID:SCR_006849)</div></div><div style="margin-bottom:8px"><div>Annovar</div><div>suggested: (ANNOVAR, RRID:SCR_012821)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1.351 is accession number MZ065365 and SRA BioProject PRJNA726258.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioProject</div><div>suggested: (NCBI BioProject, RRID:SCR_004801)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CT values and copy numbers were calculated and analyzed in Microsoft Excel and GraphPad Prism v9.0.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses: All statistical tests were performed on groups with n > 3 in GraphPad Prism v9.0.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:It is important to point out the caveat that we did not investigate antibody dependent enhancement of infection. The observed differences in our mouse challenge studies may be attributable to the alterations in the viral B.1.351 S RBD region of the S protein, which may increase affinity for the hACE2 receptor (Bozdaganyan et al., 2021; Laffeber et al., 2021; Ozono et al., 2021; Shah et al., 2020; Tian et al., 2021) and could result in increased infectivity and pathogenicity. Although this yet speculative, sequencing results in Supplementary Figure 2-3 illustrate that many other mutations exist within the B.1.351 SARS-CoV-2 genome. Mutations within other viral proteins, particularly those involved in viral replication and genome packaging may provide additional advantages for this VoC during infection. It is currently unknown what impact the B.1.351 ORF7a deletion we observed has on pathogenesis, but other studies have suggested limited impacts of similar ORF7a mutations in cell culture (Chiem et al., 2020; Narayanan et al., 2008; Sims et al., 2005). Dissecting the consequences of these B.1.351 non-S mutations will be useful in determining the mechanisms behind the increased disease severity observed here and may help better inform containment of these VoCs, and others emerging in the future. Several additional observations were made in this study, including discovering significant differences in cytokine production of B.1.351 SARS-CoV-2 VoC infected mice. IL-27 is an indicato...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.05.442536: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.04.442548: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Chemicals and Antibodies: Fura 2-AM (F1221) was purchased from Thermofisher Scientific.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>F1221</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV Spike (S) antibodies - polyclonal anti-SARS coronavirus (BEI</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Resources: NR-10361 antiserum, Guinea Pig) was used for immunoblotting and monoclonal anti-SARS-CoV S protein antibody (BEI Resources: NR-616, similar to 240C) was used for immunocytochemistry.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV S protein</div><div>suggested: (BioLegend Cat# 944301, RRID:AB_2890871)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies for detection of human STIM1 (5668S) was purchased from Cell Signaling Technologies, that for detection of interferon alpha and beta receptor 1 (IFNAR-1) was purchased from Leinco Technologies, Inc. (I-400), that for detection of surface ORAI1 (ACC-060) was purchased from Alomone labs and that for detection of β-actin (sc-47778), was obtained from Santa Cruz Biotechnology.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STIM1</div><div>suggested: (Cell Signaling Technology Cat# 5668, RRID:AB_10828699)</div></div><div style="margin-bottom:8px"><div>β-actin</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-47778 HRP, RRID:AB_2714189)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Endogenous ORAI1 staining and analysis: For total endogenous ORAI1 detection, control, STIM1 KO and ORAI1 KO HEK293 or A549 cells (0.5 × 106) were fixed with 4% PFA at room temperature for 15 mins, followed by permeabilization with PBS + 0.5% Igepal CA-630 and incubated with 1 μg unlabeled anti-ORAI1 antibody (ACC-060, Alomone labs) in PBS + 2% FBS + 0.5% Igepal CA-630.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ORAI1 KO HEK293</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-ORAI1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero cells were cultured in EMEM growth media (ATCC) supplemented with 10% (v/v)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 was passaged once in Vero E6 cells and viral stocks were aliquoted and stored at −80°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentiviral transduction of HEK293 and A549 cells: To generate HEK293-ACE2 cells, HEK293T cells were transfected with plasmid encoding ACE2 and packaging vectors (pMD2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For generation of ORAI1-/- and STIM1-/- cells, HEK293T cells were transfected with plasmids encoding sgRNA and packaging vectors as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STIM1-/-</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single-cell Ca2+ imaging and immunofluorescence analysis: HEK293-ACE and A549 cells were grown overnight on coverslips and loaded with 1 μM Fura 2-AM for 40 min at 25°C for imaging.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 Infection: Control, ORAI1-/-, or STIM1-/- HEK293-ACE2 cells were seeded at 1 x 105 cells per well in 0.4 ml volumes using a 48-well plate, or 5 x 104 cells per well in 0.2 ml volume in a 96-well plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">sgRNAs targeting human ORAI1 (Forward primer: CACCGGATCGGCCAGAGTTACTCC; Reverse primer: AAACCGGAGTAACTCTGGCCGATCC) and human STIM1 (Forward primer: CACCGTGAGGATAAGCTCATCAGCG; Reverse Primer: AAACCGCTGATGAGCTTATCCTCAC) genes were subcloned into pLentiguide puro (Addgene).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLentiguide puro</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">sgRNAs targeting human interferon alpha and beta receptor subunit 1 (IFNAR1) subcloned into pLentiCRISPR v2 was purchased from GenScript (catalog # IFNAR1 crRNA 1; gRNA target sequence GGCGTGTTTCCAGACTGTTT).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLentiCRISPR</div><div>suggested: RRID:Addgene_102315)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentiviral transduction of HEK293 and A549 cells: To generate HEK293-ACE2 cells, HEK293T cells were transfected with plasmid encoding ACE2 and packaging vectors (pMD2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMD2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">G and psPAX2, Addgene) using calcium phosphate transfection method.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>psPAX2</div><div>suggested: RRID:Addgene_12260)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were subsequently treated with FITC-conjugated secondary antibody, washed and data was acquired on a BD Fortessa flow cytometer (BD Biosciences) and analyzed using FlowJo software (Treestar Inc)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were stained overnight in the blocking buffer with primary antibodies washed and treated with secondary antibody for 1 h, stained for DAPI in permeabilization solution and visualized using 40X oil immersion lens and imaged using Slidebook 6.0 software (Intelligent Imaging Innovations, Inc.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Slidebook</div><div>suggested: (SlideBook , RRID:SCR_014300)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Demultiplexing was performed with Illumina Bcl2fastq v2.19.1.403 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bcl2fastq</div><div>suggested: (bcl2fastq , RRID:SCR_015058)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Illumina reads from all the samples were mapped to human and SARS-CoV-2 reference genomes by STAR v2.27a (Dobin et al., 2013) and read counts per gene were quantified using human Ensembl GRCh38.98 and SARS-CoV-2 GTF file to generate raw reads counts.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_004463)</div></div><div style="margin-bottom:8px"><div>Ensembl</div><div>suggested: (Ensembl, RRID:SCR_002344)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differential expression analysis was performed using DESeq2 v1.28.1 in R v4.0.3 (Love et al., 2014).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Unsupervised principal component analysis was performed using pcaExplorer (Marini and Binder, 2019) in R v4.0.3 (Love et al., 2014)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Binder</div><div>suggested: (Binder, RRID:SCR_016437)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reactome pathway analysis was performed for DEGs using human all genes as reference data set in the Reactome v65 (Jassal et al., 2020) implemented in PANTHER.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PANTHER</div><div>suggested: (PANTHER, RRID:SCR_004869)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The ggplot2 v3.3.2 in R and Prism GraphPad v8.4.3 were used to generate figures.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The genes in the DEGs directly regulated by transcription factors (FOS, ATF2, MEF2C) were identified based on binding profiles of all public ChIP-seq data for particular gene loci from the ChIP-Atlas database (Oki et al., 2018).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ChIP-Atlas</div><div>suggested: (ChIP-Atlas, RRID:SCR_015511)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.03.441323: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Blood samples were obtained from consented healthy, self-reporting SARS-CoV-2 uninfected volunteers under a Mass General Brigham Institutional Review Board (IRB)-approved protocol (1999P001694).<br>Consent: Patients signed informed consent to participate in a Mass General Brigham IRB-approved</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">tSNE was performed unsupervised from a maximum of 5,000 randomly selected cells from each sample, with a perplexity set to 80, using the implementation of tSNE plugin in flowJo.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Biotinylated anti-human IgG antibodies (Bethyl Laboratories A80-148B) were diluted in Homebrew Detector/Sample Diluent to final concentrations of 7.73ng/mL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Biotinylated anti-human IgG antibodies</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To evaluate surface markers on nAPCs, antibodies to the following were used: CD15, CD66b, CD11c, HLA-DR, CD40, CD86 and CCR7 (Source Table).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD15</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD66b</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD11c</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HLA-DR , CD40</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD86</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To evaluate cell surface markers on T cells, antibodies to the following markers were used: CD3, CD4, CD8, CD45RA, CCR7, CD27, GPR56, CX3CR1, IFN-γ (Source Table).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD3</div><div>suggested: (RayBiotech Cat# CS-11-0110, RRID:AB_1228004)</div></div><div style="margin-bottom:8px"><div>CD4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD8</div><div>suggested: (Abcam Cat# ab34397, RRID:AB_2291359)</div></div><div style="margin-bottom:8px"><div>CD45RA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CCR7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD27</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GPR56</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CX3CR1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell cytokine detection and analysis: nAPCs and monocyte-derived DCs (moDC) were cultured for 72h and supernatants were collected and analyzed for cytokine and chemokine levels using human cytokine 42-plex discovery assay (Eve Technologies, Calgary, AB).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AB</div><div>suggested: RRID:BDSC_203)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FCS (flow cytometry standard format) 3.0 data file was used to export data that was analyzed using FlowJo (Mac version 10.7).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometric data analysis: Sample files were exported as FCS 3.0 files from FACSDiva and imported into flowJo v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FACSDiva</div><div>suggested: (BD FACSDiva Software, RRID:SCR_001456)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Intensities for markers of interest were overlaid on the dot-plot to show the expression of those markers on different cell islands and facilitate assignment of cell subsets to these islands using FlowSOM plugin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowSOM</div><div>suggested: (FlowSOM, RRID:SCR_016899)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analyses for cell-based assays were performed using Graphpad prism 8 (LaJolla, CA), and JMP10 software (SAS Institute, Inc, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">10X Genomics Cell Ranger Software Suite (v.4.0.0) (70) was used to process raw fastq files to expression tables and assemble V(D)J clonotypes, performing all the necessary barcode processing, mapping to the Human reference genome (GRCh38, GENCODE v32/Ensembl 98) and unique molecular identifier (UMI) expression counting; each batch contained an estimated > 7K cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GENCODE</div><div>suggested: (GENCODE, RRID:SCR_014966)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The gene-cell matrix of all cells was analyzed in R v4.0.3 with Seurat v3.9.9 (71)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Seurat</div><div>suggested: (SEURAT, RRID:SCR_007322)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The heatmap plot was created using the R package ComplexHeatmap, version 2.6.2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ComplexHeatmap</div><div>suggested: (ComplexHeatmap, RRID:SCR_017270)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Circos plot was generated using the R package circlize, version 0.4.12.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Circos</div><div>suggested: (Circos, RRID:SCR_011798)</div></div><div style="margin-bottom:8px"><div>circlize</div><div>suggested: (circlize, RRID:SCR_002141)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.05.03.440524: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In the sub-sections below we describe, in detail, the key modifications of Prokka v1.14.5 (8) for improved unsupervised annotation of SARS-CoV-2 genomes (Section 4.2.1) and the addition of custom-built supervised algorithms to improve identification of specific proteins that were unable to be detected using the base implementation (Section 4.2.2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prokka</div><div>suggested: (Prokka, RRID:SCR_014732)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This version of InterProScan contains a number of InterPro, Gene Ontology and Pathway codes specific to the SARS-CoV-2 proteome and reference data.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>InterProScan</div><div>suggested: (InterProScan, RRID:SCR_005829)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">4.4 Comparative analysis: To compare our method against other published viral genome annotation tools, VAPiD (v1.2 with Python3) was run on a set of 100 randomly selected SARS-CoV-2 genomes above quality control thresholds previously defined in Section 4.1 using the following parameters: reference (--r) NC 045512.2</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein names and sequences were extracted from VAPiD output files using BioPython’s parser.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioPython’s</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein annotations were evaluated against the SARS-CoV-2 proteome reference sequences indicated in ViralZone, SIB Swiss Institute of Bioinformatics (22) for complete protein set membership per genome, sequence length, and sequence similarity to known references indicated in NCBI UniProt (21).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ViralZone</div><div>suggested: (ViralZone, RRID:SCR_006563)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For domain accuracy comparative analysis, our predicted domains identified in spike glycoprotein (S protein) were analyzed for set membership completeness against the expected InterPro domain architecture for UniProt reference sequence P0DTC2 (https://www.ebi.ac.uk/interpro/protein/reviewed/P0DTC2/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>InterPro</div><div>suggested: (InterPro, RRID:SCR_006695)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">e Python SDK, and Docker container) or web interface, which can be accessed by requesting credentials at the link above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.04.27.21256153: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The process by which the data is de-identified is attested to through a formal determination by a qualified expert as defined in Section §164.514(b)(1) of the HIPAA Privacy Rule, so that ethical approval from an institutional review board is not needed.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">These two cohorts were then matched to the cohort of patients with COVID-19 for age (defined as a continuous variable), sex (defined as a categorical variable taking the value: female, male, or other), and race (defined as a categorical variable taking the value: White, Black or African American, Asian, American Indian or Alaska Native, Native Hawaiian or Other Pacific Islander, or Unknown) using propensity score matching (see details below).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These two cohorts were then matched to the cohort of patients with COVID-19 for age (defined as a continuous variable), sex (defined as a categorical variable taking the value: female, male, or other), and race (defined as a categorical variable taking the value: White, Black or African American, Asian, American Indian or Alaska Native, Native Hawaiian or Other Pacific Islander, or Unknown) using propensity score matching (see details below).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>value: White</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:However, the study also has several limitations and results should be interpreted with caution. First, while cohorts were matched for age, sex, and race, they were not matched for comorbidities so that the latter might be contributing to the association between COVID-19 and subsequent CVT/PVT. Second, we have no information about diagnostic accuracy or completeness of records, though this is likely to be less of an issue for CVT or PVT compared to many diagnoses. Third, some cases of COVID-19, especially those early in the pandemic, are undiagnosed, and we cannot generalise our risk estimates to this population. Similarly, COVID-19 vaccines are also being delivered by sites which are not part of an HCO, and many of these may not be coded in the electronic health record, and so the relative risk estimates may not apply to them. Fourth, the absence of key haematological laboratory data from many patients limits our ability to comment on whether the mechanism of CVT after COVID-19 is likely to be similar or different from that observed after ChAdOx1 nCoV-19 or Ad26.COV2.S. In particular, we do not have information regarding anti-platelet factor 4 (PF4) antibodies that have been associated with VITT [2,3]. In summary, COVID-19 is associated with a markedly increased incidence of CVT compared to patients with influenza, people who have received BNT162b2 or mRNA-1273 vaccines and compared to the best estimates of the general population incidence. The risk with COVID-19 also appears...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.10.21256192: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The trial was approved by the Federal Authority Paul-Ehrlich-Institute and by the Ethical Committee of the University of Ulm and the ethical committees of the participating hospitals.<br>Consent: Written informed consent was obtained from all study participants or their legal representatives.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Design: This is a multicenter, open-label randomized clinical trial to evaluate the efficacy and safety of CCP added to standard therapy (CCP group) vs. standard therapy alone (control group) in hospitalized patients with COVID-19 (Figure 1).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were performed according to the statistical analysis plan using SAS® (version 9.4M6 or newer, www.sas.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS®</div><div>suggested: (SASqPCR, RRID:SCR_003056)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04433910</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Clinical Trial of Convalescent Plasma Compared to Best Sup…</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.10.21256955: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Specimens were collected via oral swabs and processed as has been previously reported (12).<br>IRB: The Mass General Brigham institutional review board deemed the analysis of de- identified data did not constitute human subjects’ research (2020P003530).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:However, given the diversity within Los Angeles (mirrored partially among our sample), and the fact that Los Angeles in particular is an important case study of the ongoing socioeconomic disparities surrounding the SARS-CoV-2 pandemic, we do not feel that limitation reduces the importance of our results. Our study is additionally limited in that we were unable to adjust our analysis based on socioeconomic status, and thus our results may be confounded, thus further research is warranted.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.08.21256619: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your code.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.08.21256775: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:There are limitations to this study. First, it is a single center study biased towards patients with severe clinical disease rather than a population-based sample. This contrasts with the majority of SARS-CoV-2 infected persons, who do not require hospitalization. Second, many participants did not have enough viral RNA at time points subsequent to baseline for NGS to yield complete genome coverage. This was expected as in most cases, viral RNA is detectable by swab of the nasopharyngeal cavity (NP-swab) 2-3 days before onset of symptoms (pre-symptomatic), but rapidly disappears within 5 days after clinical symptom onset17,33-36. The genome copy numbers reported here are consistent with a report of 35 RT-QPCR positive specimens that were collected at >10 days after symptom onset, and that failed to yield infectious virus upon culture 25,37,38. Control experiments established that complete genome coverage and confident SNV detection was possible down to a limit of 7 pfu/ml; however, it is possible that persistent intra-host replication predominanty leads to the accumulation of fragmented viral genomes or debilitated viral particles with low transmission potential as the intra-host selection pressures differ from the selection pressures that lead to increased transmissibility between hosts. In sum, this study suggests that widely divergent SARS-CoV-2 variants, including VOC, will continually emerge spontaneously as long as there is significant community infection (often stipulat...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.10.21256951: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We applied for access to the DeSC database (https://desc-hc.co.jp/archives/2188) in March 2021, which was approved by DeSC Healthcare, Inc. (https://desc-hc.co.jp/en), permitting us to use the data in April 2021. 2.2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DeSC Healthcare</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We referred to the Anatomical Therapeutic Chemical classification system (ATC code) for identifying medications (A) and the 10th version of the International Statistical Classification of Diseases and Related Health Problems (ICD-10) for identifying diseases (B). 2.5.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ATC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">where the term “month number since August 2018” denotes long-term trend (slope) of the month since August 2018, and the term “Period 2020 Apr ∼ July” means that it is after the declaration of state of emergency.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>August</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Our study has several limitations. First, the disease definition of neurological diseases used in this study has not always been validated, and it is impossible to return to the original electronic medical record for validation. The disease definitions used in this study are focused more on the content of prescriptions, which could lead to some underestimation of the actual diseases of interest. For example, patients with AD dementia do not always take anti-cholinesterase drugs because of their positive side effects or negative main effects. PD patients in their earliest stage would not be detected by our definition because they often do not receive any anti-PD medications. Furthermore, there is another concern about the overestimation of neurological diseases, especially in the case of epilepsy, since anti-epileptic drugs can sometimes be used for other indications. For instance, valproic acid is often used for bipolar disorder or migraine prophylaxis, and carbamazepine can also be prescribed for bipolar disorder or trigeminal neuralgia. Clonazepam is another anti-epileptic drug that is frequently used to treat symptoms of movement disorders. Moreover, because the DeSC database used in this study does not disclose the details of the regions and localities of the insurers, NHI and SHI, we were unable to account for regional differences caused by differences in the timing and the extent to which the COVID-19 pandemic influenced the local medical systems across Japan, which may...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.06.21256706: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For affinity confirmation, bound proteins were eluted using buffer BXT (IBA Lifesciences) and after running on SDS-PAGE were subjected to silver staining and western-blot using anti-strep-II antibody (ab76949).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-strep-II</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The raw reads from HEK293T RNA-sequencing were processed and trimmed using trimmomatic 60 and mapped to annotated ENSEMBL transcripts from the human genome (hg19) 79,80 using kallisto81.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmid and cloning: The pLVX-EF1alpha-SARS-CoV-2-N-2xStrep-IRES-Puro was a gift from Nevan Krogan (Addgene plasmid # 141391; http://n2t.net/addgene:141391; RRID:Addgene_141391)36.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_141391)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Genome assembly, SNP and indel calling: Illumina adapters and low quality sequences were trimmed using Trimmomatic v0.38 60.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Trimmomatic</div><div>suggested: (Trimmomatic, RRID:SCR_011848)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reads were mapped to SARS-CoV-2 Wuhan-Hu-1 NCBI reference sequence NC_045512.2 using BWA 61</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA</div><div>suggested: (BWA, RRID:SCR_010910)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mapped reads were processed using GATK v 4.1.7 pipeline commands MarkDuplicatesSpark, HaplotypeCaller, VariantFiltration, SelectVariants, BaseRecalibrator, ApplyBQSR, and HaplotypeCaller to identify variants 62.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GATK</div><div>suggested: (GATK, RRID:SCR_001876)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differential expression analysis was performed after normalization using EdgeR integrated in the NetworkAnalyst 82.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EdgeR</div><div>suggested: (edgeR, RRID:SCR_012802)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.06.21256788: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics statement: This study was approved by Yokohama City University Certified Institutional Review Board (Reference No. B160800009, B200600115, B210300001), and the protocols used in the study were approved by the ethics committee.<br>Consent: Written informed consent was obtained from all the participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production of hiVLP: HEK293 cells (ATCC #CRL-1573), VeroE6/TMPRSS2 cells (JCRB #1819), and VeroE6/TMPRSS2-LgBiT (VTMLG) cells 3 were cultured in DMEM containing 10% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>VeroE6/TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Modified hiVNT: VeroE6/TMPRSS2-LgBiT cells seeded in 96-well plates were washed and inoculated with hiVLP stocks (50 µl) containing diluted serum (1:20).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6/TMPRSS2-LgBiT</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">hiVLP was produced by transient transfection of HEK293 cells with pHIV-GagPol-HiBiT and pSARS2-Spike-FLAG at a ratio of 1:1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHIV-GagPol-HiBiT</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pSARS2-Spike-FLAG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: The statistical significance of differences between two groups was evaluated by two-tailed unpaired t-test in the Prism 8 software (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.06.21256705: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used BLAST for nuclei (blastn) as the alignment tool to align the 817,351genome sequences to the WIV04-reference.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The newest version of BLASTN was downloaded from the National Institutes of Health BLAST website (https://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/LATEST/), which was ncbi-blast-2.11.0+.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLASTN</div><div>suggested: (BLASTN, RRID:SCR_001598)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The regression methods were automatically selected by the ggplot2 package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.07.21256742: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:As with any modelling study, our analysis has limitations to note, which should be regarded as illustrating the importance of different factors for policy decisions, and not as a predictive framework. It is subject to various uncertainties, for example, the increased risk of death as a result of comorbidities. Further data on these excess risks will be valuable in refining our findings. In considering the key worker population, although we incorporated vaccination coverages consistent with the size of this population, we did not explicitly capture the broader societal impact of failing to vaccinate these individuals, another important area for future work. Finally, an important uncertainty relevant to our current work is the dynamics of immunity, whether induced by vaccination or by infection. For example, there is evidence that memory B-cells and neutralising antibodies persist at detectable levels in blood for months post-infection 24–26. Despite important recent advances in understanding implications for disease outcome upon reinfection 27, there remains much uncertainty, including on the role of the cellular immune response 28. A recent modelling study showed how immune mechanisms could mediate a decline in the severity of COVID-19 as it becomes endemic in the coming years 29, but it remains unclear how current licensed vaccines, in India and elsewhere, might shape these dynamics. Addressing these issues are beyond the scope of our current work, which focuses on the impli...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.07.21256743: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.04.21255575: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The protocol was approved by the Johns Hopkins Medicine Institutional Review Board (IRB00083646).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We tested identity-unlinked stored remnant blood specimens of patients ≥18 years presenting to the Johns Hopkins Hospital ED between May–November 2020 for IgG to SARS-CoV-2 using the Abbott Architect SARS-CoV-2 IgG Assay (Supplementary Methods).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott Architect</div><div>suggested: (Abbott ARCHITECT i1000sr System, RRID:SCR_019328)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Heat map of SARS-CoV-2 infection (IgG and/or RT-PCR) prevalence by ZIP code for the JHH ED catchment area in Baltimore City was created using Microsoft Excel Map function.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.06.21256753: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">For the purpose of comparing performance between libraries, random subsampling was performed to obtain the same number of input reads for each library using seqtk v1.2.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV-2 quantification standard was created by inserting the envelope gene (NCBI: 43740570) and the nucleocapsid gene (NCBI: 43740575) of SARS-CoV-2 into the pGEM-3z vector (Promega Corp.) using the BamH I site.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pGEM-3z</div><div>suggested: RRID:Addgene_26665)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Manufacturer’s instructions were followed with one exception: incubation time at 50°C was increased from 10 minutes to 30 minutes, as recommended by the Swift Biosciences SARS-CoV-2 Additional Genome Coverage amplicon panel library preparation protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Swift Biosciences</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Amplicon sequencing analysis: Compressed, demultiplexed reads were obtained from the Illumina MiniSeq instrument and assessed for sequencing quality using FastQC 0.11.9-0 (https://www.bioinformatics.babraham.ac.uk/projects/fastqc/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FastQC</div><div>suggested: (FastQC, RRID:SCR_014583)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Adapter trimming was done using Fastp v0.20.132 (sequences AGATCGGAAGAGCACACGTCTGAACTCCAGTCA and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fastp</div><div>suggested: (fastp, RRID:SCR_016962)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Trimmed reads were mapped to the SARS-CoV-2 reference genome (NC_045512.2) using BWA v 0.7.17.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA</div><div>suggested: (BWA, RRID:SCR_010910)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">QC metrics were generated using Picard (v 2.9.2; http://broadinstitute.github.io/picard) BedToIntervalList, CollectTargetedPcrMetrics, CollectGcBiasMetrics.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Picard</div><div>suggested: (Picard, RRID:SCR_006525)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Snakemake v5.17.0 was used for workflow management on a Microsoft Azure CycleCloud instance.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Snakemake</div><div>suggested: (Snakemake, RRID:SCR_003475)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.07.21256388: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics: This study was performed as a national surveillance study under the authority task of Statens Serum Institut (SSI; Copenhagen, Denmark, the Danish National Institute for Infectious Disease Control and Prevention which performs the epidemiological surveillance of infectious diseases for the Danish government), hence does not require any formal approval from an ethics committee according to Danish law.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Alcohol abuse was defined as drinking more than the national recommendations of <1 or <2 beverages per day for women and men, respectively (22).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This POCT is a single use lateral flow chromatographic immunoassay rapid test, intended for qualitative detection and differentiation of SARS-CoV-2 immunoglobulin M (IgM) and immunoglobulin G (IgG) antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>immunoglobulin G (IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All personal data, obtained in REDCap, was kept in accordance with the general data protection regulation and data protection law stated by the Danish Data Protection Agency.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were performed using RStudio version 1.2.5001 (25).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RStudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Strengths and Limitations: Our study has several limitations. First, the cross-sectional study designs do not allow determination of time of infection nor provide information on when participants became seropositive. Individuals who might already have tested positive by PCR at an earlier point in time, might have chosen not to participate in this study. Individuals anticipating a positive result might have chosen not to participate, fearful of the consequences such as isolation. If so, our results could be biased and the seroprevalence be underestimated. However, our apprehension is that the desire to participate and get tested was high (10.2% of an estimated 6 431 homeless people in Denmark). Of the 827 participants in our study group, 544 (67.0%) reported having previously been tested (nasopharyngeal swab and/or antibody test) and still participated. Further, questions on sociodemographic characteristics, physical health, use of drugs and alcohol, co-morbidities, symptom manifestations and the use of personal protective equipment against SARS-CoV-2 were self-reported, hence an information bias could have affected our results We compared our seropositivity findings to that of blood donors serving as a proxy to the background population, with some limitations to consider. First, blood donors are required to have a good general health and are ineligible to donate blood if they have ever engaged in sex work, have certain medical conditions, travel to certain international desti...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.05.21256384: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical approval for the study was obtained by the Ethics Review Committee of the University of Sri Jayewardenepura.<br>Field Sample Permit: Each sampling location was indicated by a coloured bubble proportionate to the number of sequences sampled within.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The first step included randomly selecting one sequence per country per epi week.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The alignment and maximum likelihood tree construction were performed using MAFFT and IQ-TREE2 as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.07.21256839: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The present study was approved by the Ethics Committee of the University of Occupational and Environmental Health, Japan (reference No. R2-079).<br>Consent: Informed consent was obtained through the CORoNaWork study survey website at the time data were collected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were conducted using Stata (Stata Statistical Software: Release 16; StataCorp LLC, TX, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:This study had several limitations that warrant mention. First, the generalizability of the results is uncertain because this study was conducted through an Internet panel. However, we attempted to reduce bias in the target population as much as possible by sampling according to region, job type, and prefecture based on the infection incidence rate. Second, the timing of the survey might have affected the responses of the target population. Since the survey was conducted when Japan was experiencing a full-scale spread of infection, vaccine intention and the status of implementation of workplace infection prevention measures may have been affected. In addition, the vaccination plan in Japan was undecided and it was unclear when the vaccination would be available, which may have influenced vaccine intention responses. Third, POS was evaluated with a simple question (“Your company supports employees in finding a balance between active, productive working and healthy living” (Strongly agree/Agree/Disagree/Strongly disagree), and the measurement validity of the original concept of POS was untested. This study suggests that high POS during the COVID-19 pandemic increases employees’ vaccination intention. In addition, the relationship between POS and vaccination intention is strongly influenced by implementation of workplace infection prevention measures. Therefore, promoting the improvement of employees’ well-being and implementing appropriate workplace infection prevention measure...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.07.21256841: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The research proposal was evaluated by the UVA Institutional Review Board for Health Sciences Research and found to be exempt from IRB review / not human subjects research (tracking #23147)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Our study has several limitations. Given that the census of our program differs significantly from the national profile with a higher proportion of black patients and a lower census of latinx patients, some of our findings here may not directly translate to the national dialysis population. Also, unlike pre-vaccination surveys, we were not able to definitively obtain patient elements such as income and education level. Proxies for these were used, but may not be reliable. Additionally, due to limitations on data collection, unmeasured confounding factors may also have impacted our results. Finally, we were not able to directly verify receipt of the two-shot series in all patients obtaining vaccine outside of our mobile vaccine clinics (pharmacies, primary care offices, etc.). This may have caused underestimation of the proportion of patients fully vaccinated. In summary, we present the results of an early dialysis program-wide vaccination effort. In our program, it appears that real-world vaccine acceptance is higher than early estimates in the general population and align with more recent surveys of the dialysis population. This data is encouraging. Patients at high risk of refusal share common attributes and likely can be identified for additional interventions to address vaccine hesitancy.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.07.21256539: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Children that fully recovered or with PASC assessed in a dedicated post-covid outpatient service were invited to perform an immunological assessment which included: The study was approved by the ethic committee of our Institution (ID 3078).<br>Consent: Written informed consent was obtained from all participants or legal guardians.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Children with PASC after microbiologically confirmed (with PCR on nasopharyngeal swab) acute COVID-19 were identified using an internationally-developed survey (https://isaric.org/research/covid-19-clinical-research-resources/paediatric-follow-up/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PASC</div><div>suggested: (PASC , RRID:SCR_016642)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Limitations of our study are the low number of children included and the lack of ex-vivo immunologic studies performed after in-vitro stimulation with SARS-CoV-2, which we plan as a future study.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.04.21256650: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.07.21256531: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was reviewed and approved by the institutional review board of the Erasmus University Medical Center.<br>Consent: Written informed consent was obtained from every patient or legal representative.<br>IACUC: Barcelona cohort samples and data from patients included in this study were provided by the HUVH Biobank (PT17/0015/0047), integrated in the Spanish National Biobanks Network and they were processed following standard operating procedures with the appropriate approval of the Ethics and Scientific Committees.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Patients: Rotterdam cohort samples were collected from patients (n=50) participating in the ConCOVID nationwide multicenter open-label randomized clinical trial in the Netherlands.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-SARS-CoV-2 antibody measurements: Anti-SARS-CoV-2 IgM, IgG and IgA antibodies against nucleocapsid protein (N-protein) were measured in serum by ELISA using COVID-19 IgG ELISA (Tecan, 30177447), COVID-19 IgA ELISA (Tecan, 30177446) and COVID-19 IgM ELISA (Tecan, 30177448) according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA antibodies against nucleocapsid protein (N-protein</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>COVID-19 IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>COVID-19 IgA ELISA (Tecan, 30177446</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>COVID-19 IgM ELISA (Tecan, 30177448</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Network analysis: Network analysis was performed between immunotypes and select pro-inflammatory cytokines (IL-6, TNFα, IL-8, CCL2) interferons (IFNγ and IFNα) and anti-SARS-CoV-2 IgM, IgG and IgA antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IL-6, TNFα</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IL-8</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CCL2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IFNα</div><div>suggested: (Leinco Technologies Cat# T701, RRID:AB_2832118)</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 IgM, IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The workflow included running flowCut to check for changes in channels over acquisition time, UMAP for dimensionality reduction, flowSOM for clustering, and edgeR for statistical inference.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>edgeR</div><div>suggested: (edgeR, RRID:SCR_012802)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The optimal number of clusters for both cohorts was assigned with the NbClust (v1.0.12) package in R (44).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NbClust</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, heatmaps were plotted using the R package pheatmap (v1.0.12).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pheatmap</div><div>suggested: (pheatmap, RRID:SCR_016418)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.06.21256781: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Participants and ethics: All human samples used in this study were processed under Institutional Review Board approved protocols at Shanghai Jiao Tong University.<br>Consent: All study participants were recruited after providing informed consent and with approval by the Ethics Committee of Ren Ji Hospital (KY2021-046), School of Medicine, Shanghai Jiao Tong University, and the study was conducted according to the criteria set by the Declaration of Helsinki31 (2013).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Six healthy non-frail individuals who had not received any vaccine in the past one year were recruited in the Pu Dong Cohort, China, including 4 males and 2 females, aged 30-40 years old.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody and Serum cytokine detection: The levels of anti-SARS-CoV-2 (2019-nCoV) Spike RBD IgG in serum were tested using Sino Biological® SARS-CoV-2 (2019-nCoV) Spike RBD Antibody Titer Assay Kit (Catalog Number: KIT002) following the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were incubated with anti-IL-4 capture antibody coated magnetic beads and biotinylated detection antibody to form the immuno-complex.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IL-4</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single-Cell Data Processing: The matrices of unique molecular identifier (UMI) were generated for each sample by the Cell Ranger (10× Genomics, Version 4.0.0) Pipeline coupled with human reference version GRCh38 (10× Genomics, Version 3.0.0.) using STAR (version 2.5.1b).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_004463)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Additionally, we applied DoubletFinder package (version 2.0.2) to identify potential doublets. 3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DoubletFinder</div><div>suggested: (DoubletFinder, RRID:SCR_018771)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For each cell, we normalized the gene expression profiles with SCT-transform in Seurat package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Seurat</div><div>suggested: (SEURAT, RRID:SCR_007322)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GO and KEGG pathway enrichment analyses on these DEGs identify the biological keywords, that allowed us to summarize the keywords of classical immune responsive signal.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The regulons expression profile cluster plots were visualized using the ComplexHeatmap package of R.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ComplexHeatmap</div><div>suggested: (ComplexHeatmap, RRID:SCR_017270)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Our study has some limitations. Due to the currently high cost of single-cell sequencing and inaccessibility of other vaccine type at the moment, the coverage and the size of sampling of this study are relatively limited, which limits the power of this study. Due to the urgent need of COVID-19 related research, the follow-up time couldn’t be long enough, either. Despite of these limitations, we were able to observe the protective immunity induced by BBIBP-CorV at the single-cell level and identified a set of genes that not only featured the immune-responsive variation of the peripheral immune cells but also exhibited many interpretable signaling pathways. The signature expression described in here might facilitate to design a new assay to assess the immune protection and adverse effects after the vaccination or infection recovery.
Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04871932</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">COVID-2019 Vaccine Immune Response Base on Single Cell Multi…</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.07.21256725: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Approvals and registrations: This study was performed as a national cross-sectional surveillance study under the authority task of Statens Serum Institut (SSI, Copenhagen, Denmark; which performs the epidemiological surveillance of infectious diseases for the Danish government) and according to Danish law does not require any formal approval from an ethics committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Detection of SARS CoV-2 antibodies: The OnSite COVID-19 IgG/IgM Rapid Test (CTK Biotech inc., Poway, California, United States of America) is a single use lateral flow chromatographic immunoassay for qualitative detection and differentiation of IgG and IgM antibodies to SARS-CoV-2 in whole blood, which yields results in 15 minutes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Participants were categorized as seropositive if they had developed IgG and/or IgM anti-SARS-CoV-2 antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All personal data obtained in REDCap was kept in accordance with the general data protection regulation and data protection law stated by the Danish Data Protection Agency.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Strengths and limitations: Our study has several limitations. The study design does not provide information on the point of time when participants became seropositive nor determination of time of infection. It is possible that participants who had been detected with COVID-19 earlier (viral throat-or nasopharyngeal swab or antibody test) or experienced COVID-19 like symptoms did not participate, leading to an underestimation of the seroprevalence and an potential overestimation of participants concerned about prior infection. Seropositivity can be underestimated due to the fact that antibodies in response to SARS-CoV-2 infection can first be detected about one week after symptom onset (22, 26). Seropositivity of Danish blood donors in the same period was used as a proxy for the general population with some limitations to consider. Blood donors were in the age group 17-70 years and our study group are in the age group 15-83 years. Seroprevalence in blood donors is determined on the basis of ELISA and not POCT. In general, blood donors are in good health, why seropositivity in this group could be lower than expected. There is a tendency for health care professionals to be overrepresented as blood donors, and this group is found to have a higher risk of SARS-CoV-2 infection (13), why the seropositivity of blood donors could be higher than expected.Participants did not have to document a residential address in the SH areas, why there may be participants from other areas. There is ...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.05.21256690: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The French infectious diseases society ethics committee (Comité d’Éthique de la Recherche en Maladies Infectieuses et Tropicales, CER-MIT) approved the study (N° COVID 2021-06).<br>Consent: Written informed consent was waived.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Since all cases with B.1.616 infection confirmed by WGS lived in the Lannion district, this place was considered as the epidemic area.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>WGS</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Our study has limitations. First, the small sample size and the retrospective design both limit the statistical power. However, due to the fast pace of the pandemic, early communication on the characteristics of new variants is warranted, and this would be the first case series of B.1.616-related COVID-19 cases. Second, B.1.616 confirmed cases where those in whom a deep respiratory sample was obtained, mostly motivated by disease severity, hence constituting a selection bias.. Finally, the selection of controls may be an additional limitation: VOC-related cases were selected as controls mostly because these cases could be reliably classified as ‘non-B.1.616’: indeed, other COVID-19 cases managed during the study period were no longer available for virological characterization, hence we could not rule out that they could be B.1.616. Of note, our VOC control group was mostly constituted by the B.1.1.7 variant, which is largely dominant in Western Europe, and has been associated with an increased mortality4. Hence, as B.1.616 cases were independently associated with worse outcomes as compared to VOC, this would probably be even more pronounced if compared with COVID-19 cases non-related to VOC. In addition, all consecutive cases with available VOC screening were enrolled in the control group, which limits selection bias.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.08.21256792: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Reicher and Drury propose that the non-adherence to the confinement measures is not due to pandemic fatigue, but rather due to structural weaknesses in our society, such us the inability to effectively self-isolate35. Conversely, other authors have written about the psychological, physical and economic impact of the pandemic on people, which has led to the emergence of the pandemic fatigue in different countries in the world36–41. Given that the SARS-CoV-2 pandemic is expected to last for many more months, new confinements might be needed to control the transmission rate of the disease. However, the population is in a very different mental and economic state than they were at the beginning of the pandemic. Hence, policy makers should be sensitive to this situation in order to maximize the chances that future confinement measures will be both accepted and complied with by the population. 2. Gender and age matter: We identify very significant gender differences in the reported unwillingness to be confined with women being more likely to be unwilling throughout all the phases of the pandemic. According to the OR analysis, age does not seem to play a significant role in increasing the risk to report an unwillingness to be confined. However, our qualitative pattern discovery method identifies several patterns involving individuals (and especially women) of working age with some level psychological and/or economic impact and a clear unwillingness to remain in confinement any longer...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.08.21256831: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.08.21256845: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">From each study, various details including first author name, study type, hospitalized total covid-19 positive patients, the definition of COVID-19 severity, definition of obesity, total obese & non-obese COVID-19 positive patients, patients with high severity and mortality, median age, gender (female sex proportion), hypertension proportion, pulmonary disease proportion, cardiovascular disease proportion, diabetes proportion, dyslipidemia proportion, liver disease proportion were mentioned in a tabulated format in excel sheet.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">We also scanned the clinicaltrials.gov registry for completed, as well as in-progress randomized controlled trials (RCTs).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The search strategy consisted of keywords “SARS-CoV-2”, “COVID-19”, “CORONAVIRUS”, “OBESITY”, “BMI”, “OVERWEIGHT” across the COVID-19 database which included articles from Medline (PubMed)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Medline</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">), Embase, Science Web, and Cochrane Central Controlled Trials Registry.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cochrane Central Controlled Trials</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Other literature sources such as the BioRxiv (preprints), MedRxiv (preprints), ChemRxiv (preprints), and SSRN (preprints) were searched as well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioRxiv</div><div>suggested: (bioRxiv, RRID:SCR_003933)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All outcomes were analyzed using the Mantel-Haenszel method for dichotomous data to estimate pooled risk ratio (RR) utilizing the Review Manager (RevMan)-Version 5.4, The Cochrane Collaboration, 2020.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cochrane Collaboration</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:However, our study is also subject to few limitations. We included five studies from preprint databases71, 76, 83, 96, 101 that may not be comparable to peer-reviewed articles in terms of their quality of methodology. However, in view of the time-sensitive nature of this pandemic, benefit of early dissemination of critical information and its inclusion in various analyses outweighs the risk from minor methodological flaws. Second factor was the heterogeneity in the studies in terms of the study design and methodology, patient sample and treatment received. There was a lack of uniformity in the type of outcomes evaluated for severity and their definitions in different studies. For the same reason, it was not possible to deduce the effect of obesity on the individual outcomes-ICU admission and mechanical ventilation. Third limitation is that the analysis was done with hospitalized patients only; hence we cannot generalize our results for patients seen in the outpatient clinic or treated at home. Analyzing outpatient data as well may help us to get the complete picture of the impact of obesity on the overall COVID-19 outcomes. Fourth limitation is that our analysis did not compare the outcomes with respect to visceral obesity and only BMI was used. However, it was beyond the scope of this analysis because of the lack of those details in most of the included studies. We suggest that prospective studies should obtain and report this information about their sample population. Lastl...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.07.21256834: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: All specimens were collected via anterior nasal swabs, and testing was conducted using FDA-authorized real-time reverse transcription polymerase chain reaction (rRT-PCR) tests.<br>IRB: Whole Genome Sequencing: Ethical approvals: A waiver of HIPAA Authorization was obtained by the Western Institutional Review Board (WIRB #1-1290953-1) to obtain the clinical specimens for whole genome sequencing.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">24 Epidemiologic data analyses were performed using SAS software, version 9.4 (SAS Institute, Cary, NC), and RStudio, version 1.2.1335 (RStudio Team, Boston, MA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS</div><div>suggested: (SASqPCR, RRID:SCR_003056)</div></div><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div><div style="margin-bottom:8px"><div>RStudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:This analysis is subject to limitations. Full lists of off-campus students and staff and their COVID-19 testing histories were not available; therefore, attack rates could only be calculated for students living in on-campus residence halls. Data related to race, ethnicity, and other social determinants of health that may have impacted case counts and disease progression were not examined. Occupancy levels remained fluid throughout the semester, but available data used for residence hall census calculations represented a single point in time at the end of the outbreak, when occupancy was lower than at the start of the semester. UW-Madison’s rapid implementation of a series of interventions targeting different populations limits our ability to determine the effectiveness of each individual intervention. Specimens from students living in Residence Halls A and B were initially targeted for sequencing to understand transmission patterns within and across these housing units. Therefore, our sequencing results should not be generalized to the campus at large, as transmission events may have occurred after campus-related clusters outside of Residence Halls A and B that we did not characterize. In addition, sequencing of Dane County specimens in Nextstrain represented a small proportion of the total number infections within the county (about 3.0%) and were sampled non-randomly among clients of one large testing provider. Therefore, it is possible that descendant infections from UW-Mad...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.04.21256635: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.07.21256826: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: No ethics committee approval was necessary.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were performed using Stata version 15 (StataCorp, College Station, TX).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Our work has some limitations, the main one being represented by the possible under-reporting of the data reported in the Eudravigilance database. As the adverse effects are not always reported, the real cases of thrombotic events may be higher than those detected. As shown in Table 3, however, even in the presence of substantial under-reporting, the results suggest a clear benefit in everybody aged at least 30 years. Another important limitation is related to the fact that we did not produce gender-specific estimates. Future research should evaluate whether this vaccine is associated with larger TEE risk among young women, also considering that some of them take estrogen-progestin contraceptives or hormone replacement therapy. COVID-19 is having a dramatic impact on the Italian and other European Health Systems. Therefore, the use of ChAdOx1 nCoV-19 vaccine, extending its recommendation to younger population as well, should be a strategic and fundamental part of the immunization campaign considering its safety and efficacy in preventing COVID-19 and its complications.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.04.21255000: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical approval: The bioethics committee of the Pomeranian Medical University in Szczecin provided an exemption from an ethical consent-case number: KB-0012/34/03/2021/Z.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">The second section of the questionnaire was based on a review of EHP-30 (Khong et al., 2010), a validated tool designed to measure the health-related quality of life (HRQoL) in women with endometriosis (Bourdel et al., 2019; Moradi et al., 2019; Weeks, 2020).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The literature review included comparative studies, qualitative studies, clinical trials, controlled and randomized controlled trials, and multicenter studies.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Limitations of the study: Due to a low number of SARS-CoV-2 positive respondents, any test of association would be underpowered, and we are therefore unable to say whether there is a significant connection or not. With an international questionnaire, arising issues of cultural differences and subjective answers are likely inevitable. In most cases, the research team ensured that at least two people who spoke the target language were translating the survey from English to the target language, but could not always ensure that two translators whose mother tongue was English were also both fluent in the target language. Further limitations with a multiple-choice questionnaire are that participants can allude to different meanings when selecting the same answer. This problem increases when trying to reach an international sample of people. Furthermore, the questionnaire was anonymous, and we have no confirmation of whether the participants are indeed real and whether they answered honestly, although there is little reason to suspect otherwise, given that there was no incentive to take this questionnaire. Distribution of the survey online, through various platforms and with the help of national and international endometriosis organizations, resulted in varying levels of success, and in some countries, we did not manage to release the questionnaire at all. Europe and South America are more represented than other areas, with around 90% of the respondents residing in these continents....
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.10.21255146: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: 19 This study was approved by the VA Central Institutional Review Board.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study sample: The study sample consisted of all male Veterans who were alive as of February 15, 2020.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Weaknesses include the retrospective nature of the analysis and uncertainty about the underlying cause for ICU admission, mechanical ventilation, and death. While we treated VHA facility as a random effect in our severity analysis, the rapid change in treatment decisions and ability for hospitals to handle capacity at different times in the pandemic may leave confounding for patients who develop severe disease. Ongoing work in VA may provide further clarify the association between ADT and COVID-19 illness and determine the utility of ADT agents including LHRH analogs, androgen receptor antagonists, and 5-alpha reductase inhibitors. LHRH analogs achieve castrate levels of serum testosterone in virtually all patients, although the LHRH antagonist, degarelix, is the only FDA-approved LHRH analog that rapidly suppresses serum testosterone concentrations. A randomized, double-blind, placebo-controlled, multicenter VA trial entitled, “Hormonal Intervention for the Treatment of Veterans with COVID-19 Requiring Hospitalization (HITCH)” (Clinicaltrials.gov identifier NCT04397718), is prospectively testing the hypothesis that ADT with the LHRH antagonist, degarelix, reduces the severity of COVID-19 illness defined by a composite of ongoing hospitalization, intubation, or death within 15 days of randomization. The VA Million Veteran Program MVP035 COVID-19 Disease Mechanisms study is investigating the role of TMPRSS2 and other androgen-regulated genes in COVID-19 severity. Several other...
Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04397718</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Hormonal Intervention for the Treatment in Veterans With COV…</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.06.21256407: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Sampling: Our sampling methods have been previously described as part of the national COVIDVu study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">(4) We oversampled Fulton and Dekalb counties to facilitate estimation of seroprevalence in the City of Atlanta. Survey and Laboratory Procedures: One adult ≥18 years in each household listed household members by gender and age, and an adult household member was then randomly selected for participation by the electronic data system.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:The data obtained through this household-based, representative survey complement data on reported COVID-19 cases and overcome key limitations associated with data available through traditional state-based COVID-19 surveillance activities and seroprevalence surveys. Because our household sampling strategy was not restricted to individuals experiencing COVID-19 symptoms or seeking SARS-CoV-2 testing, biases associated with testing availability, test-seeking behaviors and the inability to identify asymptomatic individuals were minimal. Additionally, because these data are obtained from a random, representative sample of Georgia residents, the findings can provide reliable inference to all adult Georgia residents. Due to the finding that, as of mid-November 2020, Georgia had only recognized approximately 26% of adults infected with SARS-CoV-2, there is an ongoing need to lower barriers for testing. Our data also validate efforts made thus far in the pandemic response to encourage and invest in frequent, ample testing, despite pushback by lawmakers and certain segments of the general public who may have viewed public health mitigation strategies to have been excessive.(16) Population-based COVID-19 data at the state level allows for a more nuanced understanding of the continuum of infection, diagnosis and mortality and the relationship of these metrics to programmatic priorities. For example, as of November 16, 2020, Georgia’s estimated case fatality ratio (CFR) was 2.1%.(17) Beca...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.05.21256681: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: This work (ethics approval number 32077020.6.0000.0005) was approved on May 2020 by the National Committee in Ethics and Research, Brazil. in COMISSÃO NACIONAL DE ÉTICA EM PESQUISA.<br>IRB: This work (ethics approval number 32077020.6.0000.0005) was approved on May 2020 by the National Committee in Ethics and Research, Brazil. in COMISSÃO NACIONAL DE ÉTICA EM PESQUISA.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">As control tissue, FFPE lung of a healthy, 62-years old, male donor was used (NBP2-30182, Novusbio, cat. No 0028000B).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IAV foci immunostaining was achieved using mouse the anti-influenza A virus nucleoprotein monoclonal antibody clone AA5H (BioRad, MCA400) and visualised with goat anti-mouse IgG (H+L)-HRP conjugate (BioRad, 1721011) and TrueBlue Peroxidase Substrate (KPL, 5510-0030) following standard plaque assay protocols as described previously (Turnbull et al., 2016).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-influenza</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>MCA400</div><div>suggested: (Bio-Rad Cat# MCA400, RRID:AB_2151884)</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (Bio-Rad Cat# 172-1011, RRID:AB_11125936)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blots were probed with either antibodies raised against actin (mouse JLA20 hybridoma; courtesy of the Developmental Studies Hybridoma Bank, University of Iowa), OAS1 (rabbit polyclonal 14955-1-AP, Proteintech), OAS3 (rabbit polyclonal 21915-1-AP, Proteintech), or the rabbit anti-RNase L monoclonal antibody (Cell Signalling Technology, 27281).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibodies raised against actin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>OAS1</div><div>suggested: (Proteintech Cat# 14955-1-AP, RRID:AB_2158292)</div></div><div style="margin-bottom:8px"><div>OAS3</div><div>suggested: (Proteintech Cat# 21915-1-AP, RRID:AB_2876880)</div></div><div style="margin-bottom:8px"><div>anti-RNase L</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Thereafter, membranes were probed with species IgG-specific fluorescently labelled secondary antibodies goat anti-rabbit IgG or goat anti-mouse IgG (Thermo Scientific) and scanned using a LiCor Odyssey scanner.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunostaining was performed using a rabbit anti-OAS1 monoclonal antibody [clone D1W3A] (Cell Signaling Technology, 14498) and sheep anti-SARS-CoV-2-nsp5 antiserum, (https://mrcppu-covid.bio described in (Rihn et al., 2021)).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2-nsp5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibody staining was performed with Alexa Fluor™ 488 Goat anti-Rabbit IgG and Alexa Fluor™ 594 Donkey anti Sheep IgG both at 1:1000 (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti Sheep IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK-293T cells were propagated from lab stocks and A549-NPro cells were a kind gift of Prof. Richard E. Randall.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A549-NPro</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 cells were maintained in MEM supplemented with 10% FCS, 2 mM glutamine, 2 mM sodium pyruvate and 100 μM non-essential amino acids.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: KCLB Cat# 30055, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Indiana vesiculovirus (VSV) was a kind gift of Dr. Megan Stanifer and was propagated on BHK cells at low MOI as described previously (Rihn et al., 2019).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentiviral vectors were produced by transfecting 293T cells as described previously (Rihn et al., 2019) and 0.45 μm-pore-size-filtered supernatant was used to transduce AAT cells and were selected using 2 μg/ml puromycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549-ISRE::GFP cells (gift from Prof. Richard E.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-ISRE::GFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus inputs were normalized using plaque assays on VeroE6 cells to 500 PFU per well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Retroviral vectors and cell modification: The lentiviral vector pSCRPSY (KT368137.1) has been previously described (Kane et al., 2016).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSCRPSY</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pLV-EF1a-IRES-Puro (Addgene plasmid # 85132) was modified by PCR amplifying the tagRFP ORF (using pSCRPSY as template) flanked by directional SfiI sites which were further flanked by BamHI and EcoRI restriction sites (forward oligo: 5’-CTC TCG GAT CCG GCC GAG AGG GCC ATG AGC GAG CTG ATT AAG-3’ and reverse oligo: 5’-CTC TCG AAT TCG GCC AGA GAG GCC TCA CTT GTG CCC CAG-3’) and the BamHI-EcoRI fragment was subcloned into the vector to create the modified pLV-EF1a-IRES-Puro-SfiI-tagRFP construct.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLV-EF1a-IRES-Puro</div><div>suggested: RRID:Addgene_85132)</div></div><div style="margin-bottom:8px"><div>pLV-EF1a-IRES-Puro-SfiI-tagRFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cDNA corresponding to the ORFs of the following OAS genes (GenBank accession number): OAS1p46 (NM_016816), human OAS3 (NM_006187), macaque OAS1 (EF467665), bovine OAS1X (NM_178108), bovine OAS1Y (NM_001040606), bovine OAS1Z (AY650038), and Rhinolophus ferrumequinum OAS1 (XM_033097132 / Ensembl: ENSRFET00010016745) were chemically synthesised as gene-blocks with flanking SfiI sites (IDT DNA) and the SfiI fragment was subcloned into the modified pLV-EF1a-IRES-Puro-SfiI plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLV-EF1a-IRES-Puro-SfiI</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate the human OAS1p42 sequence (in accordance with GenBank accession NM_002534), OAS1p46-c397a, and OAS1p42-CTIL sequences, the pLV-SfiI-OAS1p46 lentiviral vector plasmid was modified by overlap extension PCR (using primer pair 5’-CTC TCT GGC CGA GAG GGC CAT GAT GGA TCT CAG AAA TAC CCC AG-3’ and 5’-TCT CTC GGC CAG AGA GGC CTC AAG CTT CAT GGA GAG GGG CAG GGA TGA ATG GCA GGG AGG AAG CAG GAG GTC TCA CCA GCA GAA TCC AGG AGC TCA CTG GG-3’ for OAS1p42, primer pair 5’-CTC TCT GGC CGA GAG GGC CAT GAT GGA TCT CAG AAA TAC CCC AG-3’ and 5’-TCT CTC GGC CAG AGA GGC CTC AGA GGA TGG TGG CGG TCC AGT CCT CTT CTG CCT GTG GG-3’ for p46-c395a, and primer pair 5’-CTC TCT GGC CGA GAG GGC CAT GAT GGA TCT CAG AAA TAC CCC AG -3’ and 5’-TCT CTC GGC CAG AGA GGC CTC AGA GGA TGG TGC AAG CTT CAT GGA GAG GGG CAG GGA TGA ATG GCA GGG AGG AAG CAG GAG GTC TCA CCA GCA GAA TCC AGG AGC TC ACT GGG -3’ for p42-CTIL) and the SfiI-fragment was subcloned in place of OAS1p46 in the pLV lentiviral vector plasmid described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLV-SfiI-OAS1p46</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pLV lentiviral</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CRISPR guides were designed using the CHOPCHOP online tool (https://chopchop.cbu.uib.no).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://chopchop.cbu.uib.no</div><div>suggested: (CHOPCHOP, RRID:SCR_015723)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Post-acquisition, the contrast of images within each set were optimised using Zen software (Carl Zeiss) to equal degrees for the vector, p42, p42-CTIL and p46 C397A samples, whereas the histogram maximum was increased independently in the p46 sample shown in (Figure 4) to prevent oversaturation in the green channel due to strong perinuclear concentration.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Zen</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DIGS uses a nucleotide or amino acid sequence probe to perform a BLAST similarity search through genome assemblies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DIGS</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We first used the nucleotide sequence of the syntenic region of R. ferrumequinum to human exon 7 (Ensembl) and the adjacent 580bp region with the detected LTR insertion until homology resumes to the human genome as a probe (Supplementary digs_probes.fas).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ensembl</div><div>suggested: (Ensembl, RRID:SCR_002344)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Matches were aligned using MAFFT v7.453 (Katoh and Standley, 2013) and inspected for covering all regions of the probe (Supplementary Table 1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PDE analysis: To examine the diversity of PDE proteins encoded by coronaviruses we first constructed an HMMER protein profile.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HMMER</div><div>suggested: (Hmmer, RRID:SCR_005305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The alignment was then manually curated using Bioedit based on the homology described in the literature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bioedit</div><div>suggested: (BioEdit, RRID:SCR_007361)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The EMBOSS getorf program (Rice et al., 2000) was used to extract the translated sequences of all methionine starting open reading frames (ORFs) with length above 100 nucleotides from the filtered virus genome dataset.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EMBOSS</div><div>suggested: (EMBOSS, RRID:SCR_008493)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The study was registered at https://www.isrctn.com/ISRCTN66726260. Pre-processed and STAR (Dobin et al., 2013) mapped paired-end reads of 499 whole-blood patient transcriptomes with known disease outcomes from the ISARIC4C study were analysed to stratify mild (hospitalised but not ICU-admitted patients) and severe (ICU admitted and/or deceased) patients further into p46 +ve and p46 -ve groups.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_004463)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were implemented using IBM SPSS Statistics version 25 (IBM Corp. Armonk, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">ISRCTN66726260</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.05.21256396: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, a further alignment using a multiple sequence alignment program (MAFFT) with a NJ / UPGMA phylogeny was performed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.05.21256675: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:There are some limitations to our study. Firstly, the model assumes that each of the four parameters remains constant in a specified time period. As such, we are unable to provide a time-varying measure to characterise the impact of different outbreak detection and control measures that were progressively rolled out in the population at a granular level. Instead, time periods were chosen based on prior knowledge of major policies that would affect at least one of the four model parameters. Secondly, those imported cases subjected to home quarantine and no quarantine were assumed to have the same potential of making contact with members of the community as household transmission might occur, while in reality the amount of community contact would be different as those under home quarantine could potentially only contact household members. In the absence of data, we made a conservative assumption that the imported cases under home quarantine were capable of generating local infections. Further model calibration would require data on the outcome of the various quarantine measures. Finally, missed infections could arise from asymptomatic or mildly symptomatic infections, or underreporting of symptomatic cases. We assumed that R is the same among these cases. More information is needed to determine the temporal variation in the types of cases to account for lowered transmission potential in asymptomatic or mildly symptomatic cases. At the same time, a key strength to our analysis i...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.05.21256667: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">The main RMC-focused question that was added in the second survey was ‘At this time, to what extent do you feel that you are able to provide respectful care to women and newborns compared to before the COVID-19 outbreak?’ (5-point Likert scale).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data management and analysis: Data were exported from the online server to Microsoft Excel and cleaned by the first author.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Strengths and limitations: This study is among the few studies that examined how the COVID-19 pandemic negatively impacted RMC globally from its onset. Our study provides a nuanced understanding of how the COVID-19 pandemic affected RMC across different settings and the potential areas of action that could be focused on to promote RMC and protect the rights of women and newborns in the remaining trajectory of the pandemic—the lessons learned could also be applied to future pandemics and health system disruptions. In our study, nearly half of the participants reported that their ability to provide respectful care was somewhat or substantially improved during the COVID-19 pandemic compared to before. This could be due to various factors including: 1) health workers perceiving certain RMC practices, such as companionship, as not essential to quality of care or not possible during a pandemic, 2) infection prevention measures taken during the pandemic, such as partitioning of rooms, providing more privacy, 3) resources, opportunities, and hygiene measures that evolved during the pandemic and improved the maternal health care system34, 4) reduced patient volumes in some settings due to women’s fear of viral infection35, resulting in more time and resources per client, and 5) new global guidelines that were introduced to protect the rights of childbearing women during the COVID-19 pandemic. However, our study is limited in terms of exploring how the ability of health workers to prov...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.05.21256677: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.06.21256615: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Search Strategy: The following electronic databases will be searched: LitCovid, medRxiv, Google Scholar and the WHO Covid-19 database.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Google Scholar</div><div>suggested: (Google Scholar, RRID:SCR_008878)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.04.21256611: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">With the 10 replicates, this gives ∼90% power of avoiding a type 2 error assuming an effect size equal to the standard deviation.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Thresholding was done using QuantaSoft™ Analysis Pro Software (Bio-Rad, version 1.0.596).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>QuantaSoft™ Analysis Pro</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.04.21256626: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Approval for this study was received from The Johns Hopkins Bloomberg School of Public Heath Institutional Review Board (JHSPH IRB).<br>Consent: As primary data collection for the survey instrument was anonymous, written consent was not required by JHSPH IRB.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Survey data were collected and managed using REDCap electronic data capture tools hosted at Johns Hopkins Bloomberg School of Public Health.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:While this study is the first to evaluate pandemic preparedness in a novel, yet critical, worker population, our study does have certain limitations. Like most volunteer questionnaire study designs, our research study is at risk of recall bias (selective memory for certain experiences/information), social desirability bias (participant responses influenced by researchers’ goals), and self-selection bias (individuals who feel strongly about a topic are more likely to participate in a study). We saw a high number of respondents who did not complete all sections of the survey. It is uncertain if this is due to the design or technical aspects of the online questionnaire or to external factors (e.g., participants were interrupted while taking the survey during working hours). However, there was no significant difference in job and demographic characteristics between those who completed the survey compared to those who did not. Another limitation is that our study population may not reflect the target veterinary and animal care workforce, limiting the external generalizability of our findings, as in the case of our low racial diversity and high percentage of female participants (veterinary medical field in US estimated at 63.9% female in 2020).31 Our findings suggest a need for future directions in preparedness response research within this critical worker population to address two main areas. First, there is a need to understand the relationship between changes in operational prac...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.06.21256651: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.06.21256523: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.05.21256649: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics approval for this study was granted by the KCL Ethics Committee REMAS ID 18210, review reference LRS-19/20-18210 and all participants (here, the proxy-reporting adult) provided consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Illness duration and symptom profile were determined in a randomly selected control cohort of these children (matched 1:1 for age, gender, and week of testing), and compared to children with a positive test.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.06.21256629: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the ethical review committee (ERC) of Jashore University of Science and Technology, Bangladesh (Reference: ERC/FBS/JUST/2020-45, Date: 06/10/2020).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Clinical sample selection and ethical consideration: The sample size was calculated based on the prevalence of positive samples using the following equationRandomly (random number generator using Microsoft Excel inc.) selected 6 positive and 4 negative samples were selected from left-over samples once in a week and tested by our proposed method besides the routine TaqMan based method.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Clinical sample selection and ethical consideration: The sample size was calculated based on the prevalence of positive samples using the following equation
Randomly (random number generator using Microsoft Excel inc.) selected 6 positive and 4 negative samples were selected from left-over samples once in a week and tested by our proposed method besides the routine TaqMan based method.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, HCoV-229E, HCoV-NL63, HCoV-HKU1, MERS-CoV, and SARS-CoV, and finally main respiratory and opportunistic viruses and pathogens in PrimerBLAST (supplementary table S1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV-NL63</div><div>suggested: RRID:CVCL_RW88)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Clinical sample selection and ethical consideration: The sample size was calculated based on the prevalence of positive samples using the following equationRandomly (random number generator using Microsoft Excel inc.) selected 6 positive and 4 negative samples were selected from left-over samples once in a week and tested by our proposed method besides the routine TaqMan based method.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Validation by Gel Electrophoresis and Targeted Amplification: We performed gel electrophoresis in 3% agarose gel having ethidium bromide at 60V and 100mA for 100 minutes to ensure amplification of the correct RT-qPCR products and analyzed in an automated Gel Doc Imager (Molecular Imager® Gel Doc™ XR+ System with Image Lab™ Software by Bio-Rad (Catalog # 170-8195) and the software Image Lab™ Software version 5.2.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Image Lab™</div><div>suggested: (Image Lab Software, RRID:SCR_014210)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The four representative amplicons were then subjected to Sanger sequencing with BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) in Applied Biosystems SeqStudio genetic analyzer as per the optimized protocol of Islam et al. (2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BigDye™</div><div>suggested: (UH Manoa Sequencing Facility, RRID:SCR_010114)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">NCBI BLAST was performed initially and the alignment to SARS-CoV-2 spike gene was also checked in MEGA7 (https://www.megasoftware.net/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div><div style="margin-bottom:8px"><div>MEGA7</div><div>suggested: None</div></div></td></tr></table>
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Nevertheless, this study has some limitations. We could not be consistent with the gold standard outcomes obtained by commercial kits with respect to Ct value measured for each gene. Discrepant results wherein one gene was detected in SYBR green assay were observed in more than half of the samples for both SYBR positive-Sansure kit positive (27/49) and SYBR positive-Sansurel kit negative groups (17/27). Other researchers however reported the similar trend despite with a very small percentage of the samples 20. Using a lower amount of RNA template, the less reliable results than TaqMan assay, multiplexing of three genes in SYBR Green, and arises of possible mutations during the study in highly dynamic nucleocapsid protein20,21 might reduce the chance to amplify N gene specific region. Moreover, the sensitivity and the specificity were not completely determined due to not validating all the studied samples, though an identical sensitivity and specificity was determined while comparing the 33 deviated samples between SYBR Green and TaqMan assay (Table 2). The reasons behind a low R2 value (0.938 for JUST_N1 and 0.917 for JUST_E1) might be the presence of non-specific RNA due to a quick RNA extraction system, possible presence of polymerase inhibitors, and formation of primer-dimer. Another subtle limitation of our technology is that only expert personnel will be able to analyze the results since it is based on melting curve analysis. SYBR Green technique was suitable for detecti...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a protocol registration statement.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.04.21256627: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Limitations: Administration of CP was not consistently coded in the N3C data. To restrict our analysis to patients who had received CP rather than other plasma products, we excluded all data from providers without specific codes or descriptions for CP data. That restriction reduced our potential population by over 90%. While we attempted to match patient severity using 9 day of CP predictors based on data available within N3C, there could be other predictors that better represent patient status for matching purposes. Furthermore, the study could be augmented, pending data availability, with information on the oxygen device that was used during the treatment period. Another limitation is that the N3C dataset did not track whether a patient was involved in a COVID-19 vaccination trial which may skew results. This, however, is unlikely as vaccinated individuals are unlikely to be hospitalized for COVID-19 given the timeframe this analysis considered is between 07/01/2020 and 12/19/2020. Finally, while the research team considered use of titer and blood type, the analyzed N3C dataset did not contain titer levels of CP that was administered and was sparse in blood type information. Future work: Our data do not demonstrate any clear benefit for CP administration in hospitalized patients with COVID-19 within the first 4 days of hospitalization. There was a trend towards reduced mortality for CP administered on Day 0 but a potential for increased mortality if administered on day 4. M...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.04.21256617: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In order to assess the associations of the PRS with Hospital Episode data and data from the General practice (GP), we used the PheWAS library [18] in R [23].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PheWAS</div><div>suggested: (PheWAS Catalog, RRID:SCR_003562)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.07.21256341: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All simulations were performed using the Simulx package on R.3.6.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Simulx</div><div>suggested: (Simulx, RRID:SCR_000486)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Our study has some important limitations that need to be acknowledged. First, the reporting of high-risk contacts is partial and remains prone to various reporting biases. One of them is the fact that at the time where the study was conducted, there was no firm evidence of the role of pre-symptomatic transmission. This could explain why in our study a large number of high-risk household contact were reported to occur the day of symptom onset. It is also possible that several of the household contacts were not unique and occurred multiple times. Because we had no information on these contacts, we did not conduct specific analyses on repeated contacts, but it is something that future epidemiological studies will need to investigate. Another limitation is that we had no genomic data to ensure that infection observed in contact individuals results from an infection by the index case. In most infected contacts, we also did not have data on the time of symptom onset, which prevented us from detecting infections unlikely related to the contact identified in our study. However, the temporality of symptoms would not be sufficient to bring a decisive information on the infection event. Indeed, the study was conducted during the first epidemic wave in Spain, where most individuals, including in hospital settings, had not yet applied social distancing and masking, causing dozens of thousands of individuals infected every day. Both the possibility of repeated contacts in household and inf...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.05.21256668: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The regression methods were implemented in MATLAB.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MATLAB</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Another relevant limitation of previous studies is the size of the available dataset. There are 10 participants in the EmoDB [29], 4 in the SAVEE dataset [30], 6 in the EMOVO dataset[31], 10 in the vlogger dataset [42]), 23 in the SEMAINE [34] and 46 in the RECOLA [35]. Our study, on the other hand, contains speech of 109 participants and 3,242 segments. Finally, emotion recognition is often limited by the inherent subjectivity in having emotions labelled by humans who perceive affect from audio, visual and linguistic information [43]. In this study, this intermediate step was removed as the affect is self-reported through the affective slider. In addition, the affective scores were validated by their statistically significant association with the HADS questionnaire (p < 0.01, ρArousal.= −0.62 and ρValence = −0.71), a long standing tool to screen for depression and anxiety.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.06.21256733: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: , Proteon Pharmaceuticals S.A. in the study was approved by the Bioethical Committee at the University of Lodz (Res. nr 3/KBBN-UŁ/I/2020-21).<br>Consent: Written informed consent was obtained from all participants before study entry.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Each positive sample was pooled by combining 3, 5 or 7 randomly chosen negative samples.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Subsequently, the cost of the screening test was calculated based on the following premises: 1) positive cases were randomly distributed among the tested population with an even distribution; 2) the test had ideal sensitivity and specificity; and 3) if the pool provided a positive result, each sample within the pool was subsequently tested individually with reference, validated, diagnostic tests.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples of genomic RNA isolated from human coronaviruses HCoV 229E and HCoV NL63 and respiratory syncytial viruses RSV A2001/3-12 and RSV B1 were obtained from BEI Resources.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV NL63</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 RNA isolated from infected Vero cell culture was serially diluted in ultrapure water.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Using BLAST 2.9.0+ (default parameters) and reference gene sequences as queries, desired genes were extracted from the remaining SARS-CoV-2 genomes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Curve fitting was performed in GraphPad Prism software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.05.21254694: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We assessed the geospatial spread of COVID-19 cases over time using the Python library geopandas (version 0.7.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a protocol registration statement.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.07.21256652: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The clinical protocol was approved by a central and site-specific institutional review board.<br>Consent: All participants provided written informed consent prior to enrollment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Key exclusion criteria included the following: acute febrile illness with temperature higher than 100.4°F (38.0°C) or acute onset of upper or lower respiratory tract symptoms (e.g., cough, shortness of breath, sore throat); positive serologic or molecular (reverse transcription polymerase chain reaction [RT-PCR]) test for SARS-CoV-2 at Screening; pregnant or breastfeeding, or intending to become pregnant or intending to father children within the projected duration of the trial starting from the Screening visit until 3 months following the last dose; known history of uncontrolled HIV based on a CD4 count less than 200 cells/mm3 or a detectable viral load within the past 3 months; currently participating or has participated in a study with an investigational product within 30 days preceding Day 0; previous receipt of an investigational vaccine for prevention or treatment of COVID-19, MERS, or SARS (documented receipt of placebo in previous trial would be permissible for trial eligibility); respiratory diseases (e.g., asthma, chronic obstructive pulmonary disease) requiring significant changes in therapy or hospitalization for worsening disease during the 6 weeks prior to enrollment; immunosuppression as a result of underlying illness or treatment; lack of acceptable sites for ID injection and EP.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study Design and Endpoints: The clinical trial is designed as a Phase 2/3, randomized, blinded, placebo-controlled, multi-center trial (NCT04642638) to evaluate the safety, immunogenicity, and efficacy of INO-4800 administered ID followed by electroporation (EP).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study Design and Endpoints: The clinical trial is designed as a Phase 2/3, randomized, blinded, placebo-controlled, multi-center trial (NCT04642638) to evaluate the safety, immunogenicity, and efficacy of INO-4800 administered ID followed by electroporation (EP).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">INO-4800 contains plasmid pGX9501 expressing a synthetic, full-length sequence of the SARS-CoV-2 Spike glycoprotein of the original Wuhan strain, created using Inovio’s proprietary in silico Gene Optimization Algorithm to enhance expression as previously described30.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pGX9501</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:These results further suggest that in addition to being a primary vaccine candidate, INO-4800 could represent a safe booster vaccine without significant limitations such as anti-vector responses or dosing-incremented toxicities. We have observed directly in the Phase 1 trial participants who were boosted with a third dose of their INO-4800 vaccine between 6 and 10 months resulted in higher levels of humoral and cellular immune responses without increased levels of AEs (Manuscript in preparation). Given the uncertainty about the durability of the natural infection or vaccine induced responses against COVID-19 disease, vaccine boosting by a benign approach like INO-4800 may be an important way to maintain protection over subsequent epidemic waves of COVID-19. It is also possible that INO-4800 could serve as a useful booster shot for other S protein-targeted vaccine candidates with limitations in boosting ability, and this potential should be further investigated. One of the major areas of research for COVID-19 is the investigation of the impact of recently emerged major variants of concern - first detected in the United Kingdom (B.1.1.7), South Africa (B.1.351), and Brazil (P.1 ) - on the protective efficacy of vaccines recently approved for emergency use as well as those vaccines currently in development. Previous studies indicated that neutralization activity in vaccinees’ sera only showed a minor reduction for B.1.1.734, but neutralization was significantly decreased against...
Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04642638</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Safety, Immunogenicity, and Efficacy of INO-4800 for COVID-1…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT03721718</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Evaluate the Safety, Tolerability and Immunogenicity Study o…</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a protocol registration statement.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.06.21256476: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.04.21256418: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: 2.1 Wastewater sample collection and physicochemical data: 24-hour time-weighted composite samples of raw wastewater were collected using Teledyne ISCO autosamplers.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.6 Data analysis: All data analysis was performed in Python (v3.6.9) using key modules Pandas (v1.1.5), NumPy (v1.19.5), SciPy (v1.4.1), and Plotnine (v0.6.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div><div style="margin-bottom:8px"><div>NumPy</div><div>suggested: (NumPy, RRID:SCR_008633)</div></div><div style="margin-bottom:8px"><div>SciPy</div><div>suggested: (SciPy, RRID:SCR_008058)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Despite limitations in clinical testing data and the potential lag in wastewater trends, assessing correlations between clinical and wastewater testing data can help validate WBE (Xagoraraki and O’Brien, 2020). Moderate correlations with clinical data observed in this study (τ=0.43) support that trends in wastewater surveillance data reflect trends in COVID-19 disease occurrence. Wastewater data paired with clinical data can be a more robust public health surveillance strategy compared to either method alone, both for sewershed-scale and facility-scale surveillance applications. In some settings, wastewater testing may be a less resource-intensive way to implement population-scale surveillance, and policymakers will need to balance allocation of resources to each approach. A critical question for public health decision-making is how much early warning WBE can provide ahead of clinical testing, which could allow more timely public health responses to slow COVID-19 outbreaks. However, lead time is difficult to measure. Biologically, the time between onset of fecal shedding and nasal shedding is unclear (Benefield et al., 2020; Walsh et al., 2020). Practically, lead time depends on testing turnaround time and frequency of sampling for both wastewater and clinical testing. For example, clinical testing capabilities can increase the lead time of wastewater data if patients are only tested after symptom onset and can decrease the lead time if asymptomatic and symptomatic individual...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.04.21256352: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.04.21256571: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: SNBTS blood donors gave fully informed consent to virological testing, donation was made under the SNBTS Blood Establishment Authorisation and the study was approved by the SNBTS Research and Sample Governance Committee IRAS project number 18005.<br>IRB: Ethical approval was given by the South Central - Oxford C Research Ethics Committee in England (Ref: 13/SC/0149) and by the Scotland A Research Ethics Committee (Ref: 20/SS/0028).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Researchers working with the samples in the laboratory were blinded to the clinical outcomes of the ICU patients during testing.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Enzyme-linked immunosorbent assay: SARS-CoV-2 spike, RBD as well as HCoV-229E, HCoV-NL63, HCoV-HKU1 and HCoV-OC43 spike IgG antibody responses were measured using ELISAs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV-OC43 spike IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibody rabbit anti-human whole IgG conjugated to alkaline phosphatase (Sigma, USA) was added at a dilution of 1:1000 in casein–PBS solution and incubated for 1 hour at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Secondary antibody rabbit anti-human whole IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human whole IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein sequences used in ELISAs: MSD V-PLEX assay: IgG antibody responses to SARS-CoV-2 spike, RBD, NTD and nucleocapsid and the spike proteins of SARS-CoV-1, HCoV-229E, HCoV-NL63, HCoV-HKU1 and HCoV-OC43 were assessed using the Meso Scale Diagnostics (MSD) Multi-Spot Assay System (MSD, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV-NL63</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HCoV-HKU1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A 1x working concentration of the SULFO-TAG anti-human IgG Detection Antibody was prepared in Diluent 100.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (RevMAb Biosciences Cat# 31-1019-MK, RRID:AB_2783627)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MSD ACE2 competition assay: The ability of antibodies present in serum/plasma to inhibit the binding of angiotensin-converting enzyme 2 (ACE2) to the SARS-CoV full-length spike proteins and RBD domains was assessed using the COVID-19 ACE2 competition assay (MSD, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Enzyme-linked immunosorbent assay: SARS-CoV-2 spike, RBD as well as HCoV-229E, HCoV-NL63, HCoV-HKU1 and HCoV-OC43 spike IgG antibody responses were measured using ELISAs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV-NL63</div><div>suggested: RRID:CVCL_RW88)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HCoV-229E, HCoV-NL63, HCoV-HKU1 and HCoV-OC43 spike antigens were bought from Sino Biological, China.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV-229E</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">ISRCTN51287266</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.04.21256472: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This includes the immunoreceptor used in the assay which is SARS-CoV-2 Spike Glycoprotein (S1) terminally tagged with a predominantly monomeric Sheep Fc-Tag (produced in HEK293 cells) and subsequently conjugated with electrochemically active Horseradish Peroxidase (HRP); Antibodies for spiking experiments, namely the Human recombinant monoclonal IgM Anti-SARS-CoV-2 Spike (S1) Antibody and Human recombinant monoclonal IgG1 Anti-SARS-CoV-2 Spike (S1) Antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This includes the immunoreceptor used in the assay which is SARS-CoV-2 Spike Glycoprotein (S1) terminally tagged with a predominantly monomeric Sheep Fc-Tag (produced in HEK293 cells) and subsequently conjugated with electrochemically active Horseradish Peroxidase (HRP); Antibodies for spiking experiments, namely the Human recombinant monoclonal IgM Anti-SARS-CoV-2 Spike (S1) Antibody and Human recombinant monoclonal IgG1 Anti-SARS-CoV-2 Spike (S1) Antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The standard bare carbon screen printed electrodes were contract manufactured by GSI Technologies, USA as per the designs provided by PathShodh Healthcare Pvt. Ltd.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PathShodh Healthcare</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.06.21256544: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sofia 2 SARS-CoV-2 IgG Antibody FIA assay: The Sofia 2 SARS-CoV-2 IgG Antibody FIA is a single-use lateral flow rapid assay for the semi-quantitative detection of IgG antibodies to SARS-CoV-2 S1, S2 and N proteins.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV-2 IgG antibodies present in the sample, bind to fluorescent beads containing anti-human IgG antibodies and subsequently bind to the immobilized S1, S2 and N antigens.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">R version 4.03 and RStudio version 1.4.1106 were used for study data analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RStudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Figures were generated using package ggplot2, version 3.3.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.06.21256282: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.06.21253948: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:These findings provide guidance to health authorities on the expected notification rates and limitations of app-based contact tracing. Experimental data on the performance of the app under real-life conditions could help building confidence among the public as well as push the technological process and improvement forward. These configurations are easily adjustable and should be regularly reassessed based on a combination of factors which could change over time, such as disease prevalence, infectiousness of new virus variants as well as changes in national advice and control measures. Thus, configurations settings should be carefully adapted to the national situation and tested under relevant exposure scenarios and not copied from other existing solutions abroad. Although there are still technological and other limitations that needs to be overcome before GAEN-based apps could replace manual contact tracing, we believe that transparency around the development and testing could contribute to increased acceptability and trust among the public.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.05.21256475: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:This study has limitations. First, it was not a randomised controlled trial and thus we cannot draw any definitive conclusions as to whether ECMO should be used in patients with COVID-19 and severe respiratory failure. However, our results are consistent with previously reported survival rates in acute hypoxaemic respiratory failure, supporting current ELSO recommendations that centres experienced in ECMO should withhold its use in refractory COVID-19-related respiratory failure in situations of healthcare system collapse. The ECMO may be demanding from both resource and ethical points. In a crisis scenario, the allocation of resources, whether human or financial, is challenging. Stricter selection criteria are recommended in order to use this resource for patients with greater chances of recovery. ECMO is recommended for the largest and certified centers only and it is not recommended when the system is overwhelmed[24]. A lot of research is still needed to show the role of ECMO support in COVID19 patients’ survival. In Brazil, in the second phase of the pandemic those centers may have improved ECMO procedures, as they established protocols and tried to avoid delayed indication, when it might have been too late to be of any benefit. We therefore hypothesize that future analyzes of data from a second phase of the pandemic might provide more encouraging mortality outcomes than those found in the first phase of lesser expertise with ECMO in patients with COVID-19 and even less k...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a protocol registration statement.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.05.21256598: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.04.21256444: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics: Ethical approval for this study was granted by London Metropolitan University Research Ethics Committee (reference: GSBL200401).<br>Consent: A participant information sheet (PIS) was provided, and informed consent (IC) was obtained from all participants before completion of the online survey; and for qualitative data collection PIS and IC were provided by email with consent forms orally recorded during the interviews or retuned by email.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.05.04.21256588: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a protocol registration statement.
Results from scite Reference Check: We found no unreliable references.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-