24,814 Matching Annotations
  1. Mar 2021
  2. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.24.21253489
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.24.21253489: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical approval: Our study was determined to be exempt by the Icahn School of Medicine at Mount Sinai Institutional Review Board (study#20-01964).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The survey was available electronically via REDCap and by paper upon request.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations: The high rate of COVID-19 vaccine acceptance in our population may be the result of response bias, where healthcare workers with favorable vaccine attitudes were more likely to complete the survey. Our study may have some limits in generalizability given the setting in New York City and a substantial representation from an academic health system. Additionally, Black and Hispanic respondents were underrepresented in our survey, comprising 10% and 16% of our survey population respectively, whereas approximately 20% of the healthcare workers in our systems’ hospitals identify as Black and 18% identify as Hispanic. We chose explicitly to use receipt as the primary outcome, rather than intent. As such, participants who indicated they “planned” to receive the vaccine were categorized for the primary outcome along with those who stated that they did not plan to. We did review the differences between these two groups and assessed differences over time (see Supplementary Figure 5). Those who stated an intent may have had perceptual or belief reasons for delaying, as several participants expressed in their free text responses. Additionally, while the COVID-19 vaccines were made available to employees at the time of the survey, many may have had access issues, which our survey was not designed to assess. The 11% of respondents in our survey who reported they planned to get the vaccine but had not scheduled or gone for their vaccine yet may have experienced access issues. We...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.24.21253489
  3. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.24.21252687
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.24.21252687: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The ethics committees of the four hospitals gave their approvals for the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our observational study has several limitations. The sample size (959 patients) was small; our findings will need to be replicated in larger studies. We could not evaluate separately the effects of ACEI and ARB treatment, although investigators have reported greater effectiveness for ACEI compared with ARB treatment [94]. We did not correct for immortal time bias. We did not have access to information on outpatient treatments and thus could not evaluate whether outpatient statin treatment was continued in the hospital or initiated only after hospital admission. We could not evaluate deaths that occurred after 28 days or that might have occurred after hospital discharge. We also did not evaluate the effects of treatment on length of stay, ICU admissions or mechanical ventilation. We are currently expanding our study to include the second pandemic wave (1 August to 31 December 2020) and additional outcomes (e.g., ICU admissions, mechanical ventilation). We will also evaluate separately the contributions of ACEI and ARB treatments alone or in combination with statins to reducing in-hospital COVID-19 mortality and their effectiveness in treating asymptomatic (but PCR test-positive) patients. Observational studies and RCTs both have their places in the hierarchy of research designs [95]. However, if there are no RCTs [96], physicians and health officials will be forced to consider the trade-off between pandemic learning and doing [97]. In this circumstance, they might have to rely...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.24.21252687
  4. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.24.21253576
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.24.21253576: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: This study was performed following the Helsinki Declaration and was approved by an independent ethical committee for clinical research (Comité de Ética de Investigación con medicamentos de La Rioja, CEImLAR, reference number PI-412).<br>Consent: All patients or their representatives/relatives gave their consent to participate in the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The rs4341 and rs4343 genotyping of the DNA samples was carried out using predesigned TaqMan SNP Genotyping Human Assays from Applied Biosciences (Foster City, CA) according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Applied Biosciences</div><div>suggested: (Applied Biosciences, RRID:SCR_012275)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was performed using GraphPad Prism 6 (GraphPad Prism®, La Jolla, California, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      There are obviously several limitations in our study, such as the small size of our cohort. Thus, studies with higher number of patients could be of interest to clarify these results. Large-scale GWAS (Genome Wide Association Study) combined with WGS (whole genome sequencing) studies, such as the one being carried out by the SCOURGE consortium(26), will be very interesting to corroborate these results and to explore if they are extrapolable to the whole Spanish cohort or, in contrast, it is specific to our region. In conclusion, the G-containing genotypes of rs4341 and rs4343 confer an additional risk factor of developing severe forms of COVID-19 in patients with hypertension, dyslipidemia, or possibly with diabetes independently of gender. These genotypes are also associated with an increased risk of death, mainly in hypertensive patients. Thus, the genotyping of rs4341 and rs4343 in COVID-19 patients could facilitate a more appropriate clinical management at admission.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.24.21253576
  5. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.25.21252280
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.25.21252280: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The gold nanoparticles (Nanocomposix, San Diego, USA) are coated with rabbit anti-Nucleocapsid antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Nucleocapsid</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The control line (C) is composed of a goat anti-rabbit antibody (Jackson ImmunoResearch Europe, Ely, UK).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">When a positive sample flows through the test membrane, the anti-SARS-CoV-2 antibodies present on the membrane (Test line) capture the antigen and form a colored conjugate complex on the test line.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      There are several limitations to this study. First, we present here the results of a method evaluation study and not a seroprevalence study. Therefore, the PPV obtained here (based on a 33.3% proportion of cases defined as laboratory confirmed SARS-CoV-2 by RT-PCR) will probably be lower in a low prevalence setting. Another limitation of this validation study lies in its limited sample size leading to broad 95% confidence intervals, requiring confirmation of these data at a larger scale. Finally, our present conclusions only apply to this RDT, and must not be applied to any other RDTs currently available. In conclusion, this RDT is not meant to replace a SARS-CoV-2 RT-PCR but could be a reliable option for quickly assessing the presence of SARS-CoV-2 antigen in moderate to high COVID-19 prevalence settings and when high viral loads are expected, especially in situations where a rapid result is needed or where RT-PCR is not available. Further investigations in low prevalence situations and using capillary blood are necessary.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.25.21252280
  6. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.24.21253992
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.24.21253992: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: The cell line was obtained from the ATCC and has been tested negative for contamination with mycoplasma.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">S2 (PDB 6VXX) was downloaded from PDB51, and formatted using PyMol. (The PyMOL Molecular Graphics System, Version 2.0 Schrödinger, LLC.) Flow cytometry: As detailed in previous manuscripts and reproduced here for convenience52, antibody clones and vendors used for flow cytometry analysis were as follows: BB515 anti-hHLA-DR (G46-6) (1:400</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-hHLA-DR ( G46-6 )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed three times with PBS-T (PBS with 0.1% Tween-20) and 50 μl of HRP anti-Human IgG Antibody (GenScript #A00166, 1:5,000) or anti-Human IgM-Peroxidase</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Human IgM-Peroxidase</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2, strain USA-WA1/2020, was obtained from BEI Resources (#NR-52281) and was amplified in Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The search for polymorphisms in comparison with the reference genome (MN908947.3) was performed using Python scripts, and visualization of genome annotations were done using DNA Features Viewer 3.0.163.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">S2 (PDB 6VXX) was downloaded from PDB51, and formatted using PyMol. (The PyMOL Molecular Graphics System, Version 2.0 Schrödinger, LLC.) Flow cytometry: As detailed in previous manuscripts and reproduced here for convenience52, antibody clones and vendors used for flow cytometry analysis were as follows: BB515 anti-hHLA-DR (G46-6) (1:400</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analysed using FlowJo software version 10.6 software (Tree Star).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations of Study: As with all case studies, a limitation on the generalizability of our findings to wider patient populations is present. Also, while the lack of immunological responsiveness to vaccination or acute infection in immunosuppressed and solid organ transplant populations is well documented, there may be additional mechanisms contributing to these defects beyond those discussed in this manuscript - particularly with regards to SARS-CoV-2 infection. Our analysis of the immunophenotype of the patient was limited to surveys of circulating immune dynamics; however, numerous studies have also described perturbations in immunity at tissue sites not easily amenable to direct interrogation. We also did not directly analyze antigen specific T-cell responses during either infection, which may reveal additional dysfunction not discussed within this manuscript. Lastly, we also did not fully address every potential avenue of viral immune evasion to immune responses and accordingly suggest that a greater understanding of the virus-intrinsic and host-intrinsic features determining susceptibility to SARS-CoV-2 reinfections is required. Future studies should investigate not only the circulating and systemic adaptive immune responses during SARS-CoV-2 reinfections, but also the possibility that local defects in immune responsiveness among barrier tissue sites may also enable recurrent SARS-CoV-2 infection. Quantification and Statistical Analysis: All statistical analysis was per...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.24.21253992
  7. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.24.21253923
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.24.21253923: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequences were aligned using DECIPHER (Wright 2015), converted to a Boolean vector, and subjected to PCA (Konishi et al. 2019).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DECIPHER</div><div>suggested: (DECIPHER, RRID:SCR_006552)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.24.21253923
  8. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.23.21253873
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.23.21253873: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      There are three important limitations to our analysis: while we attribute improved outcomes in Canada to concrete public health actions, it is also possible that they reflect differences in structural, societal factors that have enhanced COVID-19 risk in the United States. Excess risk of COVID-19 and COVID-19 related death in the United States has been associated with lower income status and non-white ethnicity, but similar relationships have been observed in Canada as well (6, 7). A second key limitation of our analysis is our use of Ontario-specific case fatalities, and hospitalization and intensive care admission risks, to estimate outcomes averted at a national level; however, Ontario’s epidemiology is likely similar to that of Canada overall, both because of similarities in demographics and health systems across the country, and also because the population of Ontario represents approximately 40% of the Canadian population, and 35% of Canada’s COVID-19 case load, such that the Province’s epidemiology strongly influences that of Canada as a whole. Lastly, we assume that attribution of COVID-19 deaths in Canada and the United States occurs in a comparable manner; questions around over- and under-assignment of COVID-19 mortality have been raised in both countries (8).

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.23.21253873
  9. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.24.20208835
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.24.20208835: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Thus, the most practical and representative material would be the nasal swab for both mild and severe cases, but with the caveat that its sensitivity is around 70%. A systematic review of the literature showed that the rate of false-negative results from RT-PCR is 29% (6). Out of the patients evaluated, 96% were positive for IgA (24/25) and 100% were positive for IgG (26/26), both of which were collected after 14 days. K Imai et al., using the immunochromatography technique, found IgM and IgG sensitivity for symptomatic patients with more than 14 days of symptoms of 95.8% and 65.2%, respectively. When the serological test is combined with chest tomography in symptomatic patients, sensitivity after two weeks reaches 100% (17). As the molecular analysis through RT-PCR can be falsely negative, the erroneous investigative conduct of the case would lead to misdiagnosis with new exams and unnecessary treatments, thus postponing fundamental interventions to prevent the patient from evolving with pulmonary fibrosis and permanent functional alteration. Patients confirmed for COVID 19 who presented pneumonia maintained presented pneumonia maintained evaluated around 30 days after the onset of symptoms, reaching 84.2% of DLCO in the pulmonary function test. (18) Previous studies with SARS showed that 52.4% of the patients who were hospitalized maintained abnormalities in the DLCO after 2 years (19). However, in other analysis, the improvement of this parameter occurred in 80.4% in 3 mon...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.24.20208835
  10. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.23.21254146
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.23.21254146: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Informed consent was conducted via the survey questionnaire, requiring affirmative consent before proceeding with the survey and providing complete informed consent documentation at the start of each survey.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Independent variables: The initial baseline survey included self-reports of age (18-34, 35-44, 45-54, 55-64, 65+), sex/gender (male/female) and race/ethnicity (White non-Hispanic, any Hispanic/Latino, Black non-Hispanic, other).</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      [17] This rapid-reaction pilot study has a number of limitations. First, the sample size was small and addressed patients only in one portion of West Los Angeles. Nevertheless, the results have been received as valuable to public health officials who are supporting additional enrollments across all service areas to increase the sample. Second, while all homeless-flagged patients with phones had the opportunity to answer the survey and response rates were considerably higher than most online or phone-based polls, we know that those who answered the survey were more likely to be female (59% vs. 35%) and less likely to be African-American (9% vs. 24%) than that clinic’s homeless patient base as a whole. Given the lack of differences in hesitancy across any demographic groups and the small sample size, we did not report weighted results. Finally, we note that these interviews were conducted prior to PEH receiving universal vaccine eligibility on March 15, 2021, and that some hesitancy may more accurately reflect indifference or frustration at the difficulty of obtaining the vaccine. In spite of these limitations, our findings point to challenges in widespread vaccine scaleup that are not so different than those faced in the general population. It is important to know that those people who need the vaccine most - those who fear COVID-19 but are less likely to protect themselves through social distancing measures - are those most highly willing to be vaccinated. But achieving wides...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.23.21254146
  11. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.24.21254124
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.24.21254124: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">The group, while small (n=4), included two adults less than 30 years (two greater than 50 years); three women and one man and all reported an interest in vaccine hesitancy and had some experiences of it in friends and family.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.24.21254124
  12. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.23.21253730
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.23.21253730: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Based on these methods, in November-December 2020, a total of 110 000 eligible individuals were randomly selected from the National Population Register and were sent an invitation via text message.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Strengths and limitations: The strengths of our study include the random sample, population-based study design, high completion rate of DBS samples (88%), and the low risk of overestimation of seroprevalence. There are no stability issues related to the time elapsed from DBS sampling to time of arrival at the laboratory. However, this study also has limitations. The response rate was 30%; but the age and sex distributions were similar to that of the Norwegian general population, so the overall results may still be representative of the population. However, even though we oversampled, the results from some subgroups may be more uncertain and not representative of the Norwegian population. Studies involving personal information linked to risk behavior tend to have a lower response from high-risk groups [21]. However, having antibodies is not necessarily linked to a stigma or viewed as high risk. Because of the low response rate in the youngest age group and because this group had the highest seroprevalence, the estimates could be too low. On the other hand, weighting and adjustments for sensitivity and specificity of results reduced underreporting to a minimum. There are several reasons why seroprevalence may be underestimated in our study. First, those who were very recently infected, were less likely to have detectable antibody levels at the time of sampling [22]. Second, because of the sensitivity of the two tests (94% and 84%), some false negative results were expected, but...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.23.21253730
  13. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.24.21253599
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.24.21253599: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.24.21253599
  14. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.23.21253520
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.23.21253520: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This work was conducted under the public health mandate and institutional review board approval was waived.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A combined VoC testing strategy based on direct WGS and targeted N501Y mutation qPCR was employed to estimate point prevalence (Appendix Figure 1) based on samples resulted as positive for SARS-CoV-2 from January 30th to February 5th 2021.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>WGS</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      However, a limitation of this approach is that emergence of variants devoid of N501Y mutation such as the recently-recognized B.1.525, reported here, may be underestimated due to failure of detection by qPCR targets employed, and requires alternative qPCR assays for identification (9, 10). In summary, this study demonstrated the feasibility of a combined targeted and WGS testing strategy for VoC prevalence assessment in one Canadian province, which will be instrumental for continued VoC surveillance, and to inform public health efforts.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.23.21253520
  15. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.23.21254054
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.23.21254054: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">A study was considered eligible for inclusion in the analysis if it was 1) randomized controlled trial 2) reported outcomes of interest in hospitalized COVID-19 patients with tocilizumab therapy compared to standard treatment or placebo.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">This methodology explores the adequacy of sequestration, allocation sequence concealment, blinding of participants and study personnel, blinding for outcome assessment, incomplete outcome or selective outcome reporting, and another potential bias.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data Sources and Search Strategy: This study was conducted according to the Cochrane Collaboration and the Preferred Reporting Items for Systematic reviews and Meta-Analyses (PRISMA) statement [30].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cochrane Collaboration</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We conducted a systematic search in MEDLINE, EMBASE, Cochrane Central and preprint databases to identify all relevant articles using the following search terms: (“SARS-CoV2” OR “COVID-19”) AND (“tocilizumab” OR “IL6” OR “Anti-IL6”).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEDLINE</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div><div style="margin-bottom:8px"><div>EMBASE</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All results were imported into EndNote x8.2 (Clarivate Analytics) and duplicate results were identified and removed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EndNote</div><div>suggested: (EndNote, RRID:SCR_014001)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was performed using Review Manager, version 5.3 (Copenhagen: The Nordic Cochrane Centre, The Cochrane Collaboration, 2014).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Review Manager</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      One of the limitations of the meta-analysis is integral to the methodology. The summarization of information may ignore the important difference between studies. Secondly, the number of patients in the RECOVERY trial was much higher than other RCTs (study weight 77%) [33]. There were differences in enrollment criteria, the time at which anti–interleukin-6 therapy was initiated, the primary outcome, and background care. Also, five of the included studies had an open label design, implying high risk of performance and selection bias due to lack of blinding of participants and personnel to intervention, limiting our ability to interpret results. Lastly, we included one trial from the preprint databases, which has not been peer-reviewed [33]. Preprint articles possibly indicate the undetermined quality of available literature. One of the trials also ended early due to safety concerns, although mortality in the control arm was extremely low [29]. In conclusion, our meta-analysis suggests tocilizumab, when used along with dexamethasone, could be an effective therapeutic option with promising evidence on reduced mortality, progression to mechanical ventilation, and discharge from hospital. Limitations may exist in terms of obtaining tocilizumab as it is an expensive monoclonal antibody. Supplies may be limited, and many hospitals may not necessarily have adequate quantities. Clinical judgement is also necessary as some patients may not require the use of tocilizumab. Future studies ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.23.21254054
  16. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.23.21253460
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.23.21253460: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Ethics approval and consent to participate: The plasma sample use was reviewed by the WRAIR Human Subjects’ Protection Branch which determined that the research does not involve human subjects (NHSR protocol WRAIR #2567, WRAIR#2755, #EID-029) as the samples used were de-identified and no link between samples and subjects exists.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">As this was a retrospective analysis of COVID-19 samples collected during a public health investigation of a local outbreak, no a priori power calculation was carried out.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The detection antibody, SULFO-TAG either with anti-human IgG (Cat.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">No D20JL, MSD) antibody or anti-human IgM (Cat.No D20JP, MSD) was diluted to 2 µg/ml in Diluent 100 (MSD) and added to the wells (50 µl/well).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgM</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analysis was carried out in R using the stats, ggplot2, and corrplot,.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This limitation is highlighted in the apparent 50% IgM seropositivity for MERS-CoV in the Control Group. While there was a MERS outbreak in South Korea in 2015, there were only 186 confirmed cases in that outbreak [21] and a more likely explanation is that this reflects a cross-reactivity from immunity to a related beta coronavirus. On a similar note, we were surprised to find 25% IgG seropositivity for SARS-CoV-2 in the Control group. Given that they were all seronegative to SARS-CoV-2 by IgM, this suggests the possibility of either a prior asymptomatic SARS-CoV-2 infection or cross-reactivity from immunity to another coronavirus. Assessing the serological landscape of CoV-specific IgM and IgG responses resulted in several key observations: 1) IgG seropositivity to seasonal OC43 and HKU1 as well as influenza H3 was high, while IgM seropositivity to these antigens was low; 2) IgM seropositivity to SARS-CoV-2 was highly specific, with 90% seropositivity in COVID-19 samples and 0% seropositivity in Control or Pre-COVID samples; 3) SARS-CoV-2 IgG responses were highly cross-reactive with almost 60% of SARS-CoV-2 IgG seropositive samples being seropositive for all five CoV spike antigens; and 4) IgM and IgG SARS-CoV-2 spike responses appear to show different fine specificities, with IgM spike responses being largely recapitulated by the SARS-CoV-2 RBD antigen, while IgG spike responses were not. Taken together these observations suggest a few explanations. First, that the IgM res...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.23.21253460
  17. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.24.21253807
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.24.21253807: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Several survey limitations should be considered. Although these results provide a useful initial global snapshot of the impacts of COVID-19 on AMR, they could also be considered an oversimplification of complex and varying experiences across national and facility levels. Heterogeneity between countries in the robustness of their existing AMR surveillance systems and activities (i.e. capacity, experience, resources) may have affected survey interpretation. If national focal points did not coordinate their responses with other experts or did not have sufficient knowledge of the data or dynamics in their country, the validity and reliability of some responses may have been affected. Furthermore, self-reported perceptions of national focal points on the impacts of COVID-19 on AMR could have also been affected by self-desirability bias. This survey was the first concerted effort to explore the global impact of COVID-19 on AMR surveillance, prevention and control among GLASS countries. Although much focus is understandably placed on COVID-19 at present, we believe that AMR must remain high on the global health agenda. This survey included a wide range of country settings and responses which highlighted both the universal effects of COVID-19 on AMR as well as the heterogeneity of impacts across countries. The results underscore the importance of finding ways to leverage the COVID-19 response activities to also support routine AMR prevention and control, where possible, and advocate ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.24.21253807
  18. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.23.21253748
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.23.21253748: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04327570</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">In-depth Immunological Investigation of COVID-19.</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.23.21253748
  19. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.23.21253727
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.23.21253727: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/content/10.1101/2021.03.23.21253727v1
  20. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.22.21254125
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.22.21254125: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Strengths and Limitations: We calibrated our model to a real-world nursing home. The basal transmission model, in which no agents were vaccinated, generated plausible attack rates when compared to California nursing homes of a similar size. This, plus incorporating parameters from real-world data, provides external validity to the changes observed in our model. A particular strength of ABM is to show how complex outcomes can emerge from simple sets of rules; our model took advantage of this approach to show how interactions between staff and residents manifest the outbreak patterns observed in vivo. However, this model is primarily useful as an exploration of the impact of multiple interventions and introduction probabilities on an outbreak once introduction has occurred, and is therefore not meant to model the processes that lead to an introduction in the first place. Simulations were run for 150 days or until the facility was disease-free for up to 7 days; thus, it is also not able examine the impact of multiple introductions over longer periods of time or waning immunity from recovery or vaccination in its current form. Not all data-derived parameters were made equally. The estimated effect of PPE use on transmission varied widely, thus making a reliable parameter difficult to define and the model sensitive to changes. Testing was also oversimplified in our model, as we assumed instantaneous results and all tests were equally sensitive. Additionally, we assumed that the ef...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.22.21254125
  21. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.22.21254140
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.22.21254140: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.22.21254140
  22. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.23.21254060
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.23.21254060: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The studies were reviewed by the Yale University Human Investigation Committee and ethical approval was given by the Yale university Institutional Review Board.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human subjects: Volunteers from an ongoing serology study of health care workers were recruited to have their SARS-CoV-2 spike antigen-specific antibody levels followed over time after vaccination with SARS-CoV-2 mRNA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed three times with PBS-T (PBS with 0.1% Tween-20) and 50 μL of HRP anti-Human IgG Antibody (Parmingen/BD Biosiences, San Jose, CA) or HRP anti-human IgA (BioLegend, San Diego, CA) were added at 1:2000-fold dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgA</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.23.21254060
  23. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.22.21254127
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.22.21254127: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Finally, given the concentration of transmissions in the context of workplaces and their overlap with household density (3), vaccination at workplace and among subgroups with high rates of contact (i.e. essential workers) represents a potential prioritization strategy to mitigate transmissions, severe outcomes and VOC growth (9, 10) The limitations of these analyses include the use of ecological data, rather than individual-level data on income and occupation for this analysis; and the potential for differential SARS-CoV-2 testing across tertiles. Proportionally there has been less testing in lower-income neighbourhoods (3) resulting in the potential for underestimating both wild-type in VOC cases in economically marginalized communities. Restrictive intervention strategies have represented the foundation of most COVID-19 public health interventions. Given that VOCs rapidly spread in the same transmission networks as wild-type SARS-CoV-2, and their emergence during a period of intensive societal restrictions, suggests supportive measures in these communities are needed. Moving forward necessitates ensuring that public health measures avoid reinforcing underlying inequities by leveraging resource and service-based strategies to minimize the future spread of novel VOC and associated morbidity and mortality.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.22.21254127
  24. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.23.21254092
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.23.21254092: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.23.21254092
  25. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.22.21254139
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.22.21254139: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The Program is approved by an Institutional Review Board and written informed consent is obtained from all subjects or their legal representatives.<br>Consent: The Program is approved by an Institutional Review Board and written informed consent is obtained from all subjects or their legal representatives.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The AZSAND, through its Brain and Body Donation Program (https://www.brainandbodydonationregistration.org/) performs constitutively-rapid autopsies (median postmortem interval 3.0 hours for all 2,000 + autopsies) on Program participants and shares tissue samples with biomedical researchers worldwide 84.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Body Donation Program</div><div>suggested: (Brain and Body Donation Program, RRID:SCR_004822)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A limitation of our study is the lack of identification of the responsible pathogens. This is a common limitation to pneumonia studies 101. When pathogens are identified, they are viral more often than bacterial, with the top three in US hospitalized patients being human rhinovirus, influenza A and B, and Streptococcus pneumoniae 102. Although we did not attempt to determine, from clinical records or postmortem culture, the presence of associated pathogens, the confluent intra-alveolar accumulation of neutrophils is generally regarded as indicative of a bacterial cause 103 and therefore this study is likely to have been biased towards the inclusion of bacterial pneumonia and against the inclusion of purely viral pneumonia, although mixed bacterial and viral causes were very likely to have been common 101,102,103.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.22.21254139
  26. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.22.21253831
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.22.21253831: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the Institutional Review Board (IRB) at Mount Sinai Hospital (IRB 19-01243).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical tests were performed in GraphPad Prism, were 2-tailed, and significance level was set at p-values < 0.05.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.22.21253831
  27. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.21.21254061
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.21.21254061: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics statement: Deidentified data were obtained from the Infections in Oxfordshire Research Database which has generic Research Ethics Committee, Health Research Authority and Confidentiality Advisory Group approvals (19/SC/0403, 19/CAG/0144).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Post vaccination anti-spike IgG responses were assessed using the Abbott SARS-CoV-2 IgG II Quant antibody test targeting the spike receptor binding domain (RBD), with results available up to 11-March-2021.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-spike IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pre-vaccination antibody status was assessed using the Abbott anti-nucleocapsid IgG assay (defining readings of ≥1.4 as detected), the Abbott anti-spike IgG, and an anti-trimeric spike IgG ELISA16 (detected: ≥8 million units).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-nucleocapsid IgG</div><div>suggested: (Imported from the IEDB Cat# 3E9, RRID:AB_2848062)</div></div><div style="margin-bottom:8px"><div>anti-trimeric spike IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Staff were grouped into those with evidence of prior infection, i.e. any positive anti-spike or anti-nucleocapsid antibody test or positive PCR prior to first vaccination, and those without (including staff with no previous serology or PCR testing).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-nucleocapsid</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used multivariable logistic regression to identify predictors of any positive anti-spike antibody result ≥15 days post-first vaccination (but before a second vaccination), considering the vaccine given, previous infection status, age, sex, and ethnicity.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-spike</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Post vaccination anti-spike IgG responses were assessed using the Abbott SARS-CoV-2 IgG II Quant antibody test targeting the spike receptor binding domain (RBD), with results available up to 11-March-2021.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Study limitations include the use of a single assay to quantify post-vaccine anti-spike antibody levels, however as it is commercially-available and well calibrated (Figure S1), results should be generalisable. Our focus on a defined group, i.e. HCWs, is both a strength and a weakness, and we are not able to assess variations in vaccine response in children or those >65 years. Additional data on post-vaccine antibody responses in older individuals, at highest risk of adverse outcomes from SARS-CoV-2 infection, is particularly important. Our cohort was also 76% female and predominantly of white ethnicity. We did not assess neutralising antibodies or T cell responses, both of which reflect vaccine response and may vary by vaccine. Further work will be required to determine the duration of antibody responses. In summary, vaccination leads to detectable anti-spike antibodies in nearly all healthy adult HCWs. Markedly higher responses to vaccine are seen after previous infection; single dose or delayed vaccination could be considered where vaccine sparing is needed in healthy individuals with robust evidence of previous infection. Some caution is required with antibody result interpretation and any subsequent behaviour change, as despite good protection from vaccination, seroconversion with high antibody levels still does not afford absolute protection from infection. Large-scale studies will be required to assess how protection from infection varies by antibody titre.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.21.21254061
  28. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.17.21253847
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.17.21253847: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Another limitation of the study is that the data of days-since-symptom-onset came from limited documentation in the medical records based on patient self-reporting. These data may not always be accurate or complete. Ct values were not available from some rRT-PCR methods used in this study, and are in general not well-standardized across platforms 19. This may lead to heterogeneity in the nucleic acid data presented. We had access to a relatively small number of serial samples from immunocompromised patients. Finally, due to the poor culturability of most clinical specimens, we did not use viral culture to assess the infectivity of antigen positive samples. In future studies, the Microbubbling SARS-CoV-2 Antigen Assay can be automated and multiplexed with other infectious disease antigens, and applied to other sample types. With the convenient computer vision and ML based algorithms on smartphone for automated bubble recognition, quantitation and result classification, this assay also has the potential to be used at the point-of-care for frequent and repeated testing. Our relatively simple computer vision and ML pipeline produced accurate automatic classification results, which we expect will be further improved through training more sophisticated deep learning-based systems on larger datasets. In particular, a common failure mode in our current visual bubble detection system is when bubbles appear blurry because they are not on the focal plane, or are inconsistently lit in di...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.17.21253847
  29. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.22.21254006
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.22.21254006: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The RT-PCR itself was performed on a ThermoFisher QuantStudio 5 instrument.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher QuantStudio</div><div>suggested: (Primer Express Software, RRID:SCR_017376)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.22.21254006
  30. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.22.21254032
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.22.21254032: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Genotyping: All patients signed an informed consent to perform a genetic test for the analysis of 18 genetic variants that play a role in vitamin D metabolism, transport, degradation and downstream pathways.<br>IRB: Study approval: This project was approved by the Ethics Committee of Hospital de Santa Maria in Lisbon and Hospital de São João in Oporto.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data management: Clinical history, genotypic and phenotypic data, stored at the e-CRF, were collected and managed using REDCap electronic data capture tools (20) hosted by BioData.pt (https://biodata.pt/), the Portuguese distributed infrastructure for biological data, at INESC-ID research institute.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vitamin D polymorphisms prevalence in different populations was obtained from 1000 Genomes database (https://www.internationalgenome.org/) and from HeartGenetics’s research database for the Portuguese population, with more than 8,000 Portuguese individuals.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>1000 Genomes</div><div>suggested: (1000 Genomes Project and AWS, RRID:SCR_008801)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04370808</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Not yet recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">VITACOV: Vitamin D Polymorphisms and Severity of COVID-19 In…</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.22.21254032
  31. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.22.21253818
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.22.21253818: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Significant differences in median cycle threshold (Ct) were determined by using either one- or two way(s) ANOVA followed by Dunnett’s multiple comparisons test on GraphPad Prism version 8·02 (GraphPad Software, US).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Above all, as some individuals reportedly remain PCR positive weeks after SARS-CoV-2 infection recovery, knowing whether viral RNA in these persistent carriers is contagious provides key insights for quarantine policy, to safely discontinue self-isolation and contact tracing as essential public health measures to definitively prevent transmission.(6,26,32) Besides some limitations, the proposed viability RT-qPCR effectively reduced the amplification signals of non-infectious and free RNA of SARS-CoV-2 in complex matrices finally providing a better estimation of the infectiousness of samples. Thus, mathematical models derived from laboratory scale experiments comparing viability RT-qPCR and viral replication could correlate viral load and infectivity, finally providing relevant tools of interest based on rapid molecular assay for prevention strategies and risk assessment.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.22.21253818
  32. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.25.436907
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.25.436907: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and virus isolates: The African monkey kidney cell line VeroE6 tagged green fluorescent protein (VeroE6-GFP, kindly provided by M. van Loock, Janssen Pharmaceutica, Beerse, Belgium) and VeroE6 were maintained in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, catalogue no. 41965-039) supplemented with 10% v/v heat-inactivated foetal bovine serum (HI-FBS; HyClone, catalogue no. SV03160.03), 1% v/v sodium bicarbonate 7.5% w/v (NaHCO3; Gibco, catalogue no. 25080-060), and 1% v/v Penicillin-Streptomycin 10000 U/mL (P/S; Gibco, catalogue no. 15140148) at 37°C and 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The generation of virus stocks by serial passaging in Huh-7 and VeroE6 cells were fully reported7,8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: CLS Cat# 300156/p7178_HuH7, RRID:CVCL_0336)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BavPat1 isolate (passage 2 (P2)) and GHB-03021 isolate (P6 and P7) were used for the air liquid-interface experiment while only the latter was used for standard in vitro assays in VeroE6-GFP cells (P6 and P7) and in Huh7 cells (P9).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-GFP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: CLS Cat# 300156/p7178_HuH7, RRID:CVCL_0336)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and virus isolates: The African monkey kidney cell line VeroE6 tagged green fluorescent protein (VeroE6-GFP, kindly provided by M. van Loock, Janssen Pharmaceutica, Beerse, Belgium) and VeroE6 were maintained in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, catalogue no. 41965-039) supplemented with 10% v/v heat-inactivated foetal bovine serum (HI-FBS; HyClone, catalogue no. SV03160.03), 1% v/v sodium bicarbonate 7.5% w/v (NaHCO3; Gibco, catalogue no. 25080-060), and 1% v/v Penicillin-Streptomycin 10000 U/mL (P/S; Gibco, catalogue no. 15140148) at 37°C and 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-GFP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: All statistical comparisons in the study were performed in GraphPad Prism (GraphPad Software, Inc.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04315948</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Trial of Treatments for COVID-19 in Hospitalized Adults</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04385095</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Trial of Inhaled Anti-viral (SNG001) for SARS-CoV-2 (COVID-1…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04492475</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Adaptive COVID-19 Treatment Trial 3 (ACTT-3)</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.25.436907
  33. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.22.21251380
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.22.21251380: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This randomized trial was exempted by the UCLA Institutional Review Board.<br>Consent: Participants were excluded from the main study analysis if they were unable to complete the English language consent form, did not list a proper U.S. zip code, failed any one of the attention check questions in either the pre-test or the main survey, or completed the main survey in under 120 seconds—a threshold determined by the study team after pre-testing 15 college-educated individuals (Supplemental eFigure 3).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">This randomized trial was exempted by the UCLA Institutional Review Board.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">The sample size of 1,194 (398 per condition) was chosen so as to provide 80% power to detect the estimated effect size of 0.23, assuming a two-sample t-test and a two-sided significance level of 0.017 (3-fold Bonferroni correction for pairwise comparison of study arms).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2 (http://www.r-project.org).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>http://www.r-project.org</div><div>suggested: (R Project for Statistical Computing, RRID:SCR_001905)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations: There are several limitations to our study. First, survey respondents were recruited using MTurk, an online platform that—while as effective as traditional survey sampling methods— skews towards younger, more well-educated individuals [29]. Thus, our participant cohort cannot be interpreted as a nationally representative sample. Nonetheless, given the current pandemic and the need to minimize viral exposure for both researchers and participants, surveying study participants remotely using a well-established, online platform seemed the most reasonable and ethical means to conduct our study. Study findings may also be limited by the hypothetical nature of the survey design, where we asked participants to imagine how they would react in such a scenario. However, survey scenarios were designed to be easily readable and were repeated on several pages in order to facilitate participant comprehension and immersion (Supplement eFigure 4). To further reduce the number of participants who did not take an appropriate amount of time to imagine the scenario, we restricted analysis to participants who spent at least 2 minutes on the survey and passed all attention checks. External validity of this study is limited by the fact that the study only evaluated behavioral intentions. A large body of prior research has noted that behavioral intentions do not immediately translate to behavioral engagement but are rather attenuated or enhanced by other factors. Nevertheless, behavioral...

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04459520</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Effect of Availability of COVID-19 Testing on Choice to Isol…</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.22.21251380
  34. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.22.21254090
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.22.21254090: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical approval was obtained from the Regional Committee for Medical and Health Research Ethics of South/East Norway (# 141135).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study population and data sources: We followed all women between 15 and 45 years of age registered in the Norwegian National Population Registry on March 1st, 2020 (n= 1,033,699), until February 28th, 2021.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were conducted in Stata version 16 (Statacorp, Texas).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Statacorp</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A limitation of registry studies is that health definitions rely on registrations from contact with healthcare. Test capacity for SARS-CoV-2 and healthcare availability for those with milder COVID-19 symptoms have varied through the pandemic. In the initial phase, testing was limited, and healthcare was restricted to those with more severe symptoms or underlying risk conditions. We found that pregnant women were slightly more likely to be tested in the initial phase than non-pregnant women, but after the initial months when testing capacity increased, pregnant women were slightly less likely to be tested. Asymptomatic women and women with milder symptoms were not captured and classified as infected in our data. However, results for the two waves of the pandemic in Norway yielded similar estimates, supporting that test-or healthcare availability was unlikely to explain our findings. Identifying ongoing pregnancies and early terminations through healthcare contacts is also prone to misclassification. Towards the end of the follow up period we were less likely to capture ongoing pregnancies that will end in miscarriage or induced abortions. Only 44.2% of miscarriages and induced abortions had a prior antenatal code. This could have resulted in underestimation of the number of pregnant women and attenuation of associations. Since antenatal visits are without information on gestational length information, we defined pregnancy start date and durations for ongoing pregnancies and ea...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.22.21254090
  35. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.22.21254057
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.22.21254057: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Written informed consent was obtained from all study participants.<br>IRB: The study was approved by the Leeds West Research Ethics Committee (20/YH/0225) and is registered on the ISRCTN Registry (ISRCTN10980107).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Model derivation and validation was performed in imputed datasets, with Rubin’s rules28 used to combine results.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Rubin’s</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Unsupervised clustering of patient symptom questionnaire, physical performance and cognitive assessment data (Dyspnoea-12, FACIT, GAD-7, PHQ-9, PCL-5, SPPB and MoCA as continuous variables) was performed using the clustering large applications (CLARA) k-medoids approach.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MoCA</div><div>suggested: (MOCA, RRID:SCR_010638)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This study has a number of limitations. The patients represent a small sample of the total number of patients discharged from hospital following COVID-19 infection in the UK. The study population is younger than the whole population in the UK that survived hospitalisation for COVID-19 infection40 and only included those able to attend clinic visits and undertake the study procedures. This acquisition bias might under-represent the most severely affected patients but conversely those patients with ongoing symptoms might have been more willing to participate. The patient-reported outcomes, physical and biological tests assessed cross-sectionally does not allow for the clear differentiation between the contribution from premorbid disease versus emergent impaired health status and symptoms. Further analysis of the trajectory of recovery and linkage to primary and secondary health records within PHOSP-COVID will enable further discrimination. Notwithstanding this limitation, the magnitude of burden of physical and mental health is substantial in this group. Our definition for recovery in this report is a subjective definition based on patient perception and will fail to identify pathological changes that have not yet led to clinical expression, but might become overt in later follow-up. However, patient-perceived recovery did correspond well to the overall burden of disease identified in the recovery phenotypes. Further comparisons are also required with recovery following acute r...

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">ISRCTN10980107</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.22.21254057
  36. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.20.21253990
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.20.21253990: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Institutional review board approval was not required because the deidentified data are publicly available.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A key limitation of this study is that the released provisional data from 2020 did not allow us to examine other outcomes, particular subgroups, or severely affected geographies. Future detailed data will allow researchers to study the patterns we identify here in greater detail, including changes in fertility decisions and other proposed mechanisms (e.g., elevated selection in utero, reduced air pollution, and changes in clinical practice) that may have caused the observed outcomes.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.20.21253990
  37. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.16.21253634
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.16.21253634: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The University of Essex Ethics Committee gave approval for data collection in the COVID-orientated surveys (ETH1920-1271); no further ethical permissions were required for the present analyses of anonymised data.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Study strengths and weaknesses: While the present study has its strengths, including its size, national representativeness, and timing, there are also some weaknesses. First, we used vaccine intentionality as an indicator vaccine uptake but the correlation is imperfect. In a small scale longitudinal study conducted during the period of the 2009 H1N1 pandemic in Hong Kong, less than 10% of people who expressed a commitment to being inoculated reported that they had received a vaccination two months later.50 Elsewhere, in a US adult population at high risk of seasonal influenza, around half of those intending to be vaccinated had received the inoculation within the following 5 months.51 Second, there was inevitably some loss to follow-up (figure 1). While this attrition may have impacted upon the estimation of the prevalence vaccine hesitancy which is likely to be lower in our select sample relative to the general population,52 it is unlikely to have influenced our estimation of its relationship with cognitive function. Thus, in other contexts, we have shown that highly select cohorts reveal very similar risk factor–disease associations to those seen in studies with conventionally high response.53 In conclusion, people with lower scores on standard tests of cognitive function reported being less willing to take up the future offer of vaccination for COVID-19. It is possible that erroneous social media news reports have complicated decision-making. Special efforts should be made...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.16.21253634
  38. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.25.21253802
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.25.21253802: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Typically, 100 µl of not inactivated swab medium were inoculated in monolayers of Vero cells (ATCC CCL-81) with Dulbecco’s Modified Eagle Medium (DMEM) (Gibco) supplemented with 2% (v/v) of fetal bovine serum (FBS) (Gibco) and 1% (v/v) of penicillin/streptomycin (Gibco) and incubated at 37°C with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quality check and mapping of the reads: Raw sequences were filtered for length and quality with Trimmomatic v0.40 12 according to the following parameters: ILLUMINACLIP:TruSeq3-PE-2:2:30:10 LEADING:30 TRAILING:30 SLIDINGWINDOW:4:20 MINLEN:90.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Trimmomatic</div><div>suggested: (Trimmomatic, RRID:SCR_011848)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">High quality reads were aligned on the SARS-CoV-2 reference genome (genbank ACC: NC_045512) with BWA-MEM v0.7.17 13.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA-MEM</div><div>suggested: (Sniffles, RRID:SCR_017619)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Duplicated reads were then removed with Picard tool v2.25.0 (http://broadinstitute.github.io/picard/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Picard</div><div>suggested: (Picard, RRID:SCR_006525)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Consensus sequence were generated using a combination of SAMtools v1.11 14 and VarScan v2.4.1 15 variant caller.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAMtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div><div style="margin-bottom:8px"><div>VarScan</div><div>suggested: (VARSCAN, RRID:SCR_006849)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Unfortunately, the nature of the B cell epitope recognized by the antibody utilised in the Abbott test is not known but apparently other SARS-CoV-2 antigen tests, COVID-19 Ag Respi-Strip and LumiraDX SARS-CoV-2, seem to suffer of the same limitation as supernatant of cultured cells infected with virus isolates D1_7_B.1.1.119, D1_8_B.1.177.7, D2_1_B.1.160, and D2_3_B.1.177.4 carrying respectively mutations R209I, P365S, M234I-A376T, and D348Y failed to generate a positive signal thus suggesting that these assays use antibodies with similar specificities. The fact that some virus variants are “undetectable” irrespectively of the Ct value combined with a lower sensitivity of antigen tests may have accounted for the partial and disappointing results obtained when antigen tests were utilised in large population screens. It should also be considered that the massive use of antigen tests could exert a positive selection for undetectable virus variants and thereby causing their relative increase in frequency over time. Our results would support this notion: The DNCOV+/ANCOV- A376T-M241I virus variant accounted for 42% of all mutation found in the N-antigen B cell epitope 337-422. Analysis of virus sequences isolated from January 2020 to December 2020 indicated that in Veneto the A376T-M241I variant progressively increased in frequency from the beginning of October 2020 to 20% by the end of December 2020 while in Europe and the rest of Italy, after a small peak in October 2020, it fol...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.25.21253802
  39. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.25.21253694
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.25.21253694: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: For the study, consent was given by the Ethics Committee of the University Medical Center Freiburg.<br>IRB: For the study, consent was given by the Ethics Committee of the University Medical Center Freiburg.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">4.1 Sample: A professional classically trained free-lance female singer of the Bamberg area, a professional female singer trained in different popular music styles of the Popakademie Baden-Württemberg, and a professional classically trained male singer of the Freiburg University of Music voluntarily took part in the study.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Aside from our findings and risk assessments, some limitations of our study have to be taken into account. First, the study was conducted with highly professional singers, and the results can therefore not automatically be transferred to other settings or amateur singers. Second, the test results are rather specific. We took into account different singing styles and three different singers from two different musical backgrounds. Therefore, the findings are very representative for professional classical singers as well as modern rock/pop singers, with restricted transferability to the amateur music sector and large choir groups. Since the test singers have been part of the study and know their voices very well, relevant lung capacity or ways of singing were identified for every test person. This seems to be one of the strengths of our study. Further limitations concern the fact that the measurements were conducted with three singers only, while being sensitive to individual differences of singing, lung volume, etc. They were also performed only once for every singer, whereas more repetitions of the same sequence or analyzing more persons would have given more information on reproducibility of the test setting. Another limitation of the measurements is the fact that air velocity measurements are very sensitive to surrounding movements, with the waving of a hand already influencing the measurements at the sensor.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.25.21253694
  40. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.23.21253487
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.23.21253487: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Both studies were approved by the UCSF Institutional Review Board under protocols 17-24056 and 20-30497, respectively, which granted a waiver of initial consent for tracheal aspirate and blood sampling.<br>Consent: Informed consent was subsequently obtained from patients or their surrogates for continued study participation, as previously described(11).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Identification and mitigation of environmental contaminants: To minimize inaccurate taxonomic assignments due to environmental and reagent derived contaminants, non-templated “water only” and HeLa cell RNA controls were processed with each group of samples that underwent nucleic acid extraction.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: CLS Cat# 300194/p772_HeLa, RRID:CVCL_0030)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bulk RNA sequencing and host transcriptome analysis: Pathway analysis: Gene set enrichment analyses (GSEA) were performed using the fgseaMultilevel function in the R package fgsea(32) and REACTOME pathways(33) with a minimum size of 10 genes and a maximum size of 1,500 genes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene set enrichment analyses</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>REACTOME</div><div>suggested: (Reactome, RRID:SCR_003485)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Significant pathways were defined as those with a Benjamini-Hochberg adjusted p-value < 0.05. Ingenuity Pathway Analysis (IPA) Canonical Pathway and Upstream Regulator Analysis(34) was employed on genes with p<0.1 and ranked by the test statistic to identify cytokine regulators.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ingenuity Pathway Analysis</div><div>suggested: (Ingenuity Pathway Analysis, RRID:SCR_008653)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical significance of pathway expression over time between VAP and No-VAP groups was calculated using a two-way analysis of variance (ANOVA) in GraphPad PRISM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad PRISM</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Sample size is a limitation of this study; however, the reproducibility of our observations across both bulk and scRNA-seq analyses and the significant number of differentially expressed genes among the comparator groups support the validity of our conclusions. Because this study was limited to critically ill, intubated patients, we were unable to assess early stages of COVID-19, which may provide additional insight regarding determinants of secondary bacterial infection. Additionally, we were unable to assess whether epithelial cells contributed to VAP risk due to enrichment for immune cells prior to scRNA-seq. With larger cohorts, the early detection of specific immune pathway suppression and microbiome collapse could be leveraged to develop clinically useful models for identifying COVID-19 patients with increased susceptibility to secondary bacterial pneumonia.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.23.21253487
  41. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.24.21253517
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.24.21253517: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      As with any modelling study, the various assumptions and simplifications can contribute to a number of limitations. With no reneging or balking or priority-based service order, the vaccination pathway actually represents a straightforward queueing network. Given also the evidence that arrivals are random (Poisson distributed) and that activity-level service times are adequately represented by the considered 2-parameter distributions, the limitations of this study relate mainly to application as opposed to conceptual or methodological appropriateness. Specifically, the conditions surrounding data collection should be carefully considered. First, vaccinees were typically over 70, since vaccination priority in the UK was based primarily upon decreasing age [10]. Second, vaccinations took place over winter, when additional clothing was being worn. Third, data was collected within four to six weeks of each site opening, when staff would not yet be fully familiarised to their new roles. Therefore, in the months following this study it would reasonably be expected that service times would reduce, which, in turn, would allow greater throughput than that deduced here. However, it is important to note that these three factors are not wholly explanative of service time variation, given the substantial differences in Combined duration between Vaccination Centres A and B (Section 3.3). This would therefore suggest caution in seeking to extend the specific results of this study to other si...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.24.21253517
  42. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.21.21254065
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.21.21254065: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.21.21254065
  43. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.26.437153
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.26.437153: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.26.437153
  44. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.24.21253587
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.24.21253587: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For nanopore reads the ARTIC-nCov-2019 bioinformatics protocol was used, reads were size filtered, demultiplexed, trimmed with Porechop (https://github.com/rrwick/Porechop) and mapped against the reference strain Wuhan-Hu-1 (GenBank accession number MN908947), followed by clipping of primer regions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Porechop</div><div>suggested: (Porechop, RRID:SCR_016967)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Variants were called using Nanopolish 0.11.3 (https://github.com/jts/nanopolish).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://github.com/jts/nanopolish</div><div>suggested: (Nanopolish, RRID:SCR_016157)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For Illumina, reads were trimmed with trim_galore (bioinformatics.babraham.ac.uk/projects/trim_galore/) and mapped with BWA20 to the Wuhan-Hu-1 reference sequence, followed by primer trimming and consensus calling with iVar.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA20</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All consensus genomes are available from the GISAID database (https://www.gisaid.org), the COG-UK consortium website (https://www.cogconsortium.uk/data/) and BAM files from the European Nucleotide Archive’s Sequence Read Archive service, BioProject PRJEB37886 (https://www.ebi.ac.uk/ena/data/view/PRJEB37886).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioProject</div><div>suggested: (NCBI BioProject, RRID:SCR_004801)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All full genomes of SARS-CoV-2 from Scotland sequenced as part of the COG-UK consortium were included and aligned using MAFFT v7.310 and with the HKY+I+G4 nucleotide substitution model determined by modeltest.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SRT algorithm was coded in R version 3.6.0, using the ape v5.3 package for calculation of pairwise SNP differences and PostcodesioR v0.1.1 and gmt v2.0-1 packages to calculate distances between postcodes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PostcodesioR</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A limitation of the study is the sequences available for analysis; accurate estimation of the likely source of infection depends on having sufficient sequences available from the community of affected patients and of cases from the hospital setting. Here, we obtained sequences from two-thirds of the lab-detected SARS-CoV-2 cases from RDU1-RDU5, and 44% for RDU6. We also compared data from the RDUs with 944 other cases in the community, 700 inpatients and 546 samples taken from patients presenting in emergency departments in the same health boards as provide care for dialysis patients. Additionally, COVID-19 is asymptomatic in up to 20% of patients, which may have reduced the number of infections captured.26 Further, early in the pandemic, HCWs were ineligible for testing. Frequent, regular testing of all HCWs and all patients, regardless of symptoms is warranted. There is also mounting evidence that HCWs have a higher seroprevalence for SARS-CoV-2 antibodies than the general population, with a high proportion being asymptomatic.27,28 The low substitution rate of SARS-CoV-2 limits the granularity of outbreak analysis; as demonstrated in this study, indistinguishable sequences may not be part of a transmission cluster if there is widespread circulation in the patients’ home communities. To address this limitation, we employed the SRT, which combines sequence data with both temporal and geographic data to improve estimates of within-unit and within-hospital versus community tran...

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04405934</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Not yet recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">COG-UK Project Hospital-Onset COVID-19 Infections Study</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.24.21253587
  45. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.24.21252635
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.24.21252635: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All patients gave informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04812496</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Tenofovir-DF Versus Hydroxychloroquine in the Treatment of H…</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.24.21252635
  46. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.22.21254121
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.22.21254121: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Interested individuals were emailed an information sheet and consent form.<br>IRB: Ethical approval for this study was obtained from the Health Research Ethics Board at the University of Alberta.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Descriptive analysis of response counts was performed using Microsoft Excel.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Strengths and Limitations: A strength of this study was the variety of perspectives that were obtained on routine immunization programs during the COVID-19 pandemic from most P/Ts. As well, the use of key informant interviews rather than survey methods allowed us to gather in-depth perspectives on routine immunization programs in each P/T. However, as only a few select individuals were interviewed from each P/T, the perspectives gathered are not representative of entire P/Ts. Furthermore, there may be variation in individual perspectives across a single P/T, although the perspectives shared were very consistent within a given P/T. At the time the interviews were conducted, most P/Ts did not have up-to-date information on routine immunization coverage rates during the pandemic. Similarly, given that the COVID-19 pandemic is ongoing and there is a lack of available information on immunization coverage rates, we do not know which P/T strategies were the most effective in ensuring continuity of routine immunization programs. Implications: This study adds to existing literature by identifying and synthesizing pan-national public health approaches to the continuity of routine immunization programs during the pandemic. Results can inform policymakers and program planners and can assist in future development of national guidelines. As well, we anticipate that the information in this study will enable P/Ts to learn from one another by comparing their approach to maintaining routine im...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.22.21254121
  47. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.22.21254120
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.22.21254120: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study protocols for human subject research were approved by the Institutional Review Board and the Hospital Sant Joan de Déu Ethics Committee (Ref.<br>Consent: CEIC-7455), and written informed consent was obtained from participants or guardians before starting study procedures.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Saliva samples were collected with Oracol devices (Malvern Medical Development, UK) for optimal harvesting of crevicular fluid, enriched with serum antibodies10,11.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibodies10,11</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Measurement of antibodies: Quantitative suspension array technology (qSAT) assays to measure IgM, IgA and IgG against SARS-CoV-2 were adapted from our previous standardized serum/plasma protocols12 to a saliva matrix for SARS-CoV-2 antibody evaluation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG against SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies in serum eluted from DBS and from serum/plasma samples are shown together since no differences were observed in the available paired samples of plasma and DBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DBS</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After antigen-coupled beads were incubated with samples, plates were washed and phycoerythrin-labeled secondary antibodies (anti-human IgG, IgM, or IgA, Moss) added.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA , Moss ) added.</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Study design, human subjects and samples: We compared the levels of SARS-CoV-2 antibodies in subjects with a positive diagnosis by nasopharyngeal RT-PCR and/or ELISA SARS-CoV-2 IgG, IgM test (Euroimmune Architect – Abbott) independently of the COVID-19 compatible symptoms or not, and subjects with negative nasopharyngeal RT-PCR9 and serology by RDT (SureScreen)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The ggplot2 package was used to perform boxplot graphs14.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A study limitation was that seropositivity thresholds could not be estimated with pre-pandemic saliva samples due to lack of access to them, and thus sensitivity and specificity could not be established for the saliva assays by standard methods. Using RT-PCR negative pandemic samples was somewhat useful for serum/plasma samples, but with saliva there was substantial overlap between antibody levels in infected and non-infected individuals. In addition, being pandemic samples, we cannot ascertain that they were not previously exposed at low levels and therefore this approach is not optimal. This constraint could be overcome in follow up studies by assessing seroconversion in consecutive samples calculating the fold change increase in levels (e.g. ≥4) over a given study period16 and, in future, access to pre-pandemic samples in international biobanks will be sought. Finally, there could be some imbalance between age and infection that could affect the antibody results. However, we analyzed the effect of age stratifying by infection status to take that into account. In conclusion, antibody levels in saliva measured with our high-throughput qSAT assay largely correlated with those in serum/plasma from individuals with confirmed RT-PCR diagnosis of SARS-CoV-2 infection, depending on the antigen. Higher antibody levels found in asymptomatic individuals and in children, particularly among males, could indicate protection against disease and stronger immunity. This non-invasive field ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.22.21254120
  48. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.22.21254130
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.22.21254130: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">18 Data collection using online REDCap surveys began on 24 June 2020 and is ongoing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Baseline and monthly survey response data were extracted from REDCap, linked, and analysed in Stata (version 16.0, StataCorp).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Another important limitation is that only households with a lead householder able to speak English were able to take part in the study and that all participants must have access to the internet. Guided by the advice from our community advisory board, the study surveys have since been translated into 9 languages to allow non-English speakers to participate. The increase in intention to accept a COVID-19 vaccine when offered observed in this study is encouraging. It is possible that public health communications to promote vaccination uptake have contributed to this shift; it is also possible that growing numbers of people being vaccinated during the period of this study has contributed to the change in intention. It is particularly encouraging that the intention to accept a COVID-19 vaccine has increased consistently across ethnic and social groups. Our findings show the importance of making repeated offers of a COVID-19 vaccine because many people have changed their mind over the course of a few months. Our findings also suggest that communications focussing on COVID-19 vaccine safety and effectiveness may be more effective than those focussing on COVID-19 illness risk and perception. Disparities in vaccination coverage should not be conflated with disparities in vaccination intention. If differences in vaccination coverage persist between ethnic groups and areas of social deprivation, our findings suggest they may not be fully explained by differences in vaccination intention...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.22.21254130
  49. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.21.21253498
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.21.21253498: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Another limitation is the small number of positive cases for the 501Y.V2 compared to the two other strains. This number was principally due to the only few positive cases in Paris area at that time. Our data observed a gradient in Ct values. Indeed, the two new variants seem to present a higher viral load compared to the historical SARS-CoV-2 which might arise from the fact that they share the same N501Y mutation probably leading to a better infectivity [2,3,10]. When we compared these two variants, we observed that the 501Y.V2 seems to be associated with lower viral load compared to the 501Y.V1 for the N target gene, a difference which fades for the ORF1ab target gene. The difference of Ct values that we have observed could be due to their other specific mutations. Considering the 501Y.V2, it does not seem that the Spike RBD has higher affinity for ACE2 as compared to the reference Spike. If indeed the transmission is enhanced, this could be due to mutation outside the direct ACE2–Spike interface[11]. Moreover, it has been shown that an active viral replication was associated with the transcription of subgenomic viral RNA and that this active replication occurs during the first days after the onset of symptoms[12]. As we collected only the first presentation test sample, which suggest the presence of an active viral replication, the difference between the N and the ORF1ab genes for these two new variants could be explained by the presence of these subgenomic viral RNA. Our s...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.21.21253498
  50. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.20.21253896
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.20.21253896: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In addition to searching PubMed (MEDLINE), we included searches of specialized databases (e.g.,CoronaCentral; WHO Global Literature on Coronavirus Disease) and relied on expert recommended key articles, with snowball techniques to find similar studies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We then used a Python script to extract symptoms;.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.20.21253896
  51. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.25.437060
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.25.437060: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The protocols were approved by the Johns Hopkins University Institutional Animal Care and Use Committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Male mice, 6-8 weeks old were used for this study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibody, anti-SARS-CoV-2 spike protein (1:200 dilution; catalog # GTX135356, lot # 43957, Genetex) was applied at 36°C for 60 minutes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 spike protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies were detected using an anti-rabbit HQ detection system (catalog # 7017936001 and 7017812001, Roche Diagnostics) followed by Chromomap DAB IHC detection kit (catalog # 5266645001, Roche Diagnostics), counterstaining with Mayer’s hematoxylin, dehydration, and mounting.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HCT-8 [HRT-18]</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCT-8</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ATCC CCL-244) and Vero C1008 [Vero 76, clone E6, Vero E6] (ATCC CRL-1586) cells were used for growing virus and determining virus stock titers.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero C1008</div><div>suggested: ATCC Cat# CRL-1586, RRID:CVCL_0574)</div></div><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero C1008 cells, MRC-5 (ATCC CCL-171) cells, and Caco-2 (ATCC HTB-37) cells were used as host cells in antiviral assays.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MRC-5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Caco-2 cells were grown in Minimum Essential Media supplemented with 10% FBS, 1x sodium pyruvate and penicillin-streptomycin at 37°C with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Heterozygous K18-hACE2 C57BL/6J mice (strain: 2B6.Cg-Tg(K18-ACE2)2Prlmn/J) were obtained from The Jackson Laboratory and propagated at Johns Hopkins University School of Medicine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: RRID:MGI:3589388)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FCS files were analyzed using Flowjo v10.6.2 software (BD).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flowjo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Data were analyzed using Prism 9.0.1 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      While the K18-hACE2 mouse model has been previously used to recapitulate features of COVID-19 in humans 12, our study has several limitations. The expression of the hACE2 transgene is non-physiological, resulting in tissue expression levels that are distinct from endogenously expressed ACE2. Sex differences, which are known to occur with SARS-CoV-2 infection, could not be assessed since we only used male animals in these experiments. Finally, the absorption of SFN after oral administration can be modified by the intestinal microbiome 1, leading to potentially variable drug exposures between animals. Our results demonstrate that pharmacologically relevant micromolar concentrations of SFN inhibited viral replication and virus-induced cell death. The bioavailability of SFN in humans is dependent on dosage and dietary form 1. Safety studies using SFN-rich broccoli sprouts corresponding to 50 to 400 μM SFN daily have shown that SFN is well tolerated without clinically significant adverse effects 1,21,49,50. After intake, the plasma concentration of SFN is rapidly eliminated but SFN exerts a sustained effect on gene expression 51. Consumption of SFN-rich broccoli sprouts (single oral daily dose equivalent to 200μM of SFN) reportedly results in a peak plasma concentration (Cmax) of 1.9 μM at 2-3h 52,53. By comparison, SFN inhibited in vitro SARS-CoV-2 replication in human cells with an IC50 of 2.4μM. Doses of 100μM of SFN administered twice daily led to higher steady-state concentra...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.25.437060
  52. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.22.21253577
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.22.21253577: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study design was approved by the research ethics committee and the institutional review board of the Egyptian Ministry of Health and Population.<br>Consent: The informed consent for data collection was obtained from patients or first degree relatives, the study procedures were carried out following the Code of Ethics of the World Medical Association (Declaration of Helsinki), all information/images were anonymized and coded, and the privacy and confidentiality rights of the study participants were observed throughout the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: Retrospective data from the study participants’ standardized electronic medical records were collected and coded, and the data were analyzed using the statistical package for the social sciences software (SPSS version 25).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>statistical package for the social sciences</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.22.21253577
  53. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.20.21253956
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.20.21253956: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.20.21253956
  54. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.20.21254035
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.20.21254035: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: IRB Approval and Consent: The study was approved by the institutional review boards at the Children’s Hospital of Orange County (CHOC) and the University of California Irvine (UCI).<br>Consent: Informed assent from the children and informed consent from parents or legally authorized guardians, or from the adult participants, were obtained remotely or in person.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IgG and IgM antibody titers against N and receptor binding domain from spike protein (RBD) were measured using standard ELISA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Presence of nucleocapsid protein (N)-specific IgG was determined with the Abbott Architect immunoassay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott Architect</div><div>suggested: (Abbott ARCHITECT i1000sr System, RRID:SCR_019328)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.20.21254035
  55. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.20.21253835
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.20.21253835: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plate 9 was sequenced using both Nanopore and Illumina technologies, as well as by applying the Cleanplex assay by Paragon Genomics, followed by MGI sequencing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Nanopore</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To do so, reads were aligned to a hybrid reference including SARS-CoV-2 (MN908947.3) and GRCh38 using bwa-mem (v0.7.17).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: (Active Motif Cat# 91351, RRID:AB_2847848)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samtools (v1.9) was used to produce a pileup which was then used as input by iVar (v1.3) to create a consensus sequence for regions with a minimum of 10x depth, using reads with a Q score >20 and a minimum allele frequency of 0.75.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nanopolish (v0.13.1) was used to call variants in regions with a minimum depth of 16x and a flank of 10bp.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Nanopolish</div><div>suggested: (Nanopolish, RRID:SCR_016157)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Augur/align module was then called to execute the multiple sequence alignment with MAFFT (https://github.com/GSLBiotech/mafft, version v7.463) using Wuhan-1 (Genbank accession MN908947) as a reference genome.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used IQ-TREE (http://www.iqtree.org/, version 1.6.12) to construct a phylogenetic tree of Québec only sequences and another tree of Québec and global context sequences, with the GTR substitution model.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IQ-TREE</div><div>suggested: (IQ-TREE, RRID:SCR_017254)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylodynamics: The molecular clock signal was assessed by plotting the root-to-tip phylogenetic distance against time using TempEst (Rambaut et al. 2016).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TempEst</div><div>suggested: (TempEst, RRID:SCR_017304)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The largest (>50 cases) QC transmission lineages were analyzed using Bayesian phylogenetic tree reconstruction with Markov chain Monte Carlo (MCMC) implemented in BEAST v2.6.2 (Bouckaert et al. 2019) with the Birth-Death Skyline (BDSKY) model, assuming a gamma distributed Hasegawa-Kishino-Yano (HYK) nucleotide substitution model (with a uniform distribution 0.25 [0,1] of the nucleotide frequencies, a lognormal 2 [0, ∞] for ϰ, and a γ count of 4 with an exponential distribution 0.5 [-∞, ∞]) and a strict molecular clock (0.8 x 10−3 substitutions/site/year).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BEAST</div><div>suggested: (BEAST, RRID:SCR_010228)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.20.21253835
  56. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.16.21253669
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.16.21253669: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.16.21253669
  57. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.18.21253604
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.18.21253604: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The reverse transcriptase incubation step was performed with sequential incubation at 23°C for 10 min, 50°C for 30 min, and 80°C for 10 min, according to the manufacturer’s protocol with adjustment of the incubation times recommended by Swift Biosciences SNAP low input protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Swift Biosciences</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The libraries’ size distribution was checked on the Agilent Bioanalyzer using the DNA High Sensitivity Kit (Agilent Technologies, Cat# 5067-4626).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Agilent Bioanalyzer</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Low quality bases were trimmed using Trimmomatic v0.38 (1), and were then aligned to the NC_045512.2 reference genome using bwa mem v 0.7.17-r1188 (2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Trimmomatic</div><div>suggested: (Trimmomatic, RRID:SCR_011848)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.18.21253604
  58. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.21.21253418
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.21.21253418: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The present study was approved by Ethical Review Board/Brazilian Commission of Ethical Study (Research Ethics Committee of: Universidade Federal Rio Grande do Norte - CAAE 36287120.2.0000.5537</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Ninety-two males and 93 females were included, with age ranging between 11-90 years and with CT values between 8.70 to 29.00 (Appendix 1 Table S1).</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Modifications were clustering aligned sequences by 0.99985 similarity with CD-hit [14], keeping only the oldest record of each cluster and removing restrictions by country.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD-hit</div><div>suggested: (CD-HIT, RRID:SCR_007105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All sequence alignment steps were conducted using MAFFT [15].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Simultaneously, the substitution model was selected with ModelFinder [16] using the global sequences as a proxy for genomic diversity within the larger alignment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ModelFinder</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We extracted P.1 and P.2 clades from the resulting maximum likelihood phylogeny to infer divergence dates and spatial dispersion with BEAST v1.10.4 [17].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BEAST</div><div>suggested: (BEAST, RRID:SCR_010228)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After evaluating with TempEst [18] the correlation between root-to-tip distances and sampling dates (Figure S1), we selected the strict clock model to date P.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TempEst</div><div>suggested: (TempEst, RRID:SCR_017304)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.21.21253418
  59. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.20.21253819
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.20.21253819: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Only the willing participants were included in this study and written informed consent was obtained from each participant.<br>IRB: The study protocol was approved by the Institutional Human Ethics Committee of the Indian Council of Medical Research-Regional Medical Research Centre, Bhubaneswar.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Collection of blood: Sera samples were collected and tested to determine the presence of IgG antibodies against the nucleocapsid protein of SARS-CoV-2 in an automated analyzer ARCHITECT i1000SR (Abbott Laboratories, Chicago, USA) using chemiluminescent microparticle immunoassay (CMIA) technology.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott Laboratories</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Descriptive statistical analyses were performed by SPSS software (IBM SPSS Statistics for Windows, version 24.0, Armonk, NY) and GraphPad Prism software version 7.0 for Windows (GraphPad Software, La Jolla, California, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our study also has a few limitations. First, as our participants were from the anaesthesia department of hospital settings, thus it may not speculate the exact association of immune response among the whole HCW community. Second, underestimation during reporting of the symptoms might be happened due to the immense workload of health workers which force them to neglect mild symptoms and timely diagnosis. In conclusion, health workers are the most susceptible group to get COVID infection. Conditions like asymptomatic or pre-symptomatic make the scenario complicated due to the non-occurrence of routine diagnosis. Although our study has few limitations, there is no such study with health workers only from the anaesthesia department of hospital settings to demonstrate the seroprevalence and its association with symptoms, RT-PCR test, age and gender to our best knowledge. Our result concludes that HCWs should routinely get tested for COVID-19 as most of them may be asymptomatic or pre-symptomatic which indeed a much more concerning situation when it comes to patients’ safety.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.20.21253819
  60. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.18.21253888
    1
    1. sciscore 28 Mar 2021

      SciScore for 10.1101/2021.03.18.21253888: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data from responses were entered onto a Research Electronic Capture (REDCap) Database system hosted at the University of Oxford and linked with data documented during the admission with acute Covid-19 for the analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      There are several limitations to our study. First, we were not able to follow all the cases that were discharged from hospital, either because they did not give permission or because they did not respond to repeated requests for information. We attempted to reach non-responders to the survey via telephone follow-up to limit potential for selection bias, but not all could be reached. It is possible that those who did not respond might have been well and therefore uninterested in responding, but it could also be that some were too unwell to respond, had died or moved away. Our results may therefore not be fully representative of with the entire population of those hospitalised with Covid-19. Secondly, we did not include patients hospitalised with other non-Covid-19 illness or a contemporaneous control group, therefore it is unknown if the changes in our outcomes e.g. quality of life, are specific to recovery from Covid-19 or may be linked to other aspects of life during the pandemic. Thirdly, patients only completed the survey at one timepoint, limiting comparison across repeat measures. This also meant retrospective measures asking patients to rate outcomes before their Covid-19 illness were included, which are open to recall bias. Finally, as our study focussed on hospitalised patients primarily from the first wave of infection in the UK, our data cannot be generalised to those with disease managed in the community who comprise the majority of individuals affected by Covid-19...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.18.21253888
  61. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.25.437083
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.25.437083: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics review: Approval for this study was obtained from the University of Florida Institutional Review Board (IRB202001328).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Using seqtk v1.3 (https://github/com/lh3/seqtk), we randomly down-sampled (without replacement) the 2×150 nt reads of each ONETest library so that the resulting library had the same number of reads as the matched ARTIC library; each ONETest library was sub-sampled three times in this manner to generate three simulated replicates of the library.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Among the patients, 30 (43%) were male and 40 (57%) were female.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plus RealAmp Kit from OSANG Healthcare Co. Ltd., South Korea), which targets the RdRp, N, and E genes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>OSANG Healthcare</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reads from these libraries were analyzed using a bioinformatics pipeline (v1.3.0; https://github.com/connor-lab/ncov2019-artic-nf) that automates the ARTIC data analysis protocol for Illumina reads (https://artic.network/ncov-2019/ncov2019-bioinformatics-sop.html), which utilizes bwa mem 15, samtools 16, and iVar 17.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reads were discarded that mapped to the human genome sequence (GRCh38.p13, release 35) using bowtie2 v2.4.2 18.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>bowtie2</div><div>suggested: (Bowtie 2, RRID:SCR_016368)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The pipeline was implemented in C/C++ and Python using a combination of in-house software and third-party tools, including Biopython v1.78 19, bedtools v2.29.2 20, pybedtools v0.8.1 21, samtools/bcftools/htslib v1.11 16, and Snakemake v5.26.1 22.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div><div style="margin-bottom:8px"><div>Biopython</div><div>suggested: (Biopython, RRID:SCR_007173)</div></div><div style="margin-bottom:8px"><div>bedtools</div><div>suggested: (BEDTools, RRID:SCR_006646)</div></div><div style="margin-bottom:8px"><div>samtools/bcftools/htslib</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Snakemake</div><div>suggested: (Snakemake, RRID:SCR_003475)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Visualization was done in R using ggplot2 23.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.25.437083
  62. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.25.437035
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.25.437035: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Prediction of B cell epitopes across variants: Predicted B cell epitopes across spike variants were assessed using the DiscoTope 2.0 server (http://www.cbs.dtu.dk/services/DiscoTope/) [30].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DiscoTope</div><div>suggested: (DiscoTope, RRID:SCR_018530)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The amino acid number and DiscoTope score were used to map variant B cell epitopes in RStudio (version 3.6.1) using the ggplot2 package (version 3.3.2)[31].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The T cell epitopes predicted for the Wuhan and variant SARS-CoV-2 were compared by filtering the data in RStudio using the tidyverse package (version 1.3.0) [34].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RStudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Variant spike glycosylation site analysis: Wild-type and variant amino acid sequences were uploaded to the NetNGlyc 1.0 server (http://www.cbs.dtu.dk/services/NetNGlyc/) [35] to assess potential N-linked glycosylation sites (Asn-Xaa-Ser/Thr sequons).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NetNGlyc</div><div>suggested: (NetNGlyc, RRID:SCR_001570)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The predicted glycosylation sites across variants were modelled using PyMOL (The PyMOL Molecular Graphics System, Version 2.3.5, Schrödinger, LLC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.25.437035
  63. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.25.436930
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.25.436930: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All samples were then pooled together and ligated with sequencing adapters, purified samples were finally quantified using Qubit 4.0 Fluorometer (Invitrogen), followed by loading of 15ng of pooled barcoded material and sequencing on MinION flow cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MinION</div><div>suggested: (MinION, RRID:SCR_017985)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All reads from both the platforms were checked for their quality using FastQC (20).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FastQC</div><div>suggested: (FastQC, RRID:SCR_014583)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pilon (25) was used for polishing and generation of final consensus sequences.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pilon</div><div>suggested: (Pilon , RRID:SCR_014731)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Python (version 3.4) codes were used for extracting mutations and further analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.25.436930
  64. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.24.436885
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.24.436885: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.24.436885
  65. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.24.436523
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.24.436523: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">In this study, 32 male and female specific-pathogen-free, research-naïve Chinese-origin rhesus macaques (age 3 - 7 years) were distributed—on the basis of age, weight and sex—into 4 cohorts of 8 animals (table S1).</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We expanded the assessment of the breadth of SpFN immunogenicity by interrogating the neutralizing and non-neutralizing antibody and cellular immune responses against SARS-CoV-1, Binding of vaccinee sera to SARS-CoV-1 RBD, as measured by biolayer interferometry, was absent in controls but was relatively potent in vaccinated animals—binding at half the strength of that observed to SARS-CoV-2 RBD (fig. S3, S4, Fig. 6A).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody-dependent cellular phagocytosis (ADCP) activity also increased remarkably in all vaccine groups, reaching a score that was 100-fold higher two-weeks after last 50 µg SpFN vaccination than baseline or unvaccinated controls (Fig. 6B).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antibody-dependent cellular phagocytosis (ADCP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animals were vaccinated intramuscularly with either 50 or 5 µg of SpFN, formulated with ALFQ, or 1ml of phosphate buffer solution (PBS) in the anterior proximal quadriceps muscle, on alternating sides with each dose in the series.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ALFQ</div><div>suggested: (aLFQ, RRID:SCR_005925)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      We have made attempts to overcome this limitation by analyzing specimens with orthogonal assays harmonized to consensus platforms. Additionally, our pseudovirus neutralization assay demonstrated equivalence to others in a multi-site concordance survey of reference laboratories. Potent neutralizing antibody responses may offer advantages for both vaccine efficacy and durability. Thus far, neutralizing activity has been predictive of efficacy in human trials, as vaccines that generate lower antibody titers have diminished efficacy (34). An open question remains, however, regarding the length of immunity conferred by SARS-CoV-2 vaccines. For those infectious diseases that are contained by neutralizing antibodies, peak titers have been shown to predict durability (43-45). As such, SpFN may offer longer protection than counterparts; though this requires empirical confirmation. Cross-neutralizing activity against SARS-CoV-2 VOCs is largely diminished for other vaccines at an approximately ten-fold reduction. SpFN induced serum cross-neutralizing responses, however, that were not significantly reduced. Additionally, we found serum binding to mutated SARS-CoV-2 RBD was either unaffected or mildly diminished. Cross-neutralizing activity against SARS-CoV-1 has not been reported yet for other vaccines in advanced development. Some early reports of nanoparticle vaccine approaches presenting RBD have begun to show breadth of neutralizing but these studies either have been limited murine i...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.24.436523
  66. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.20.21253892
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.20.21253892: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Individuals who do not consent to participate in the study were excluded.<br>IRB: Ethical Considerations: This study has been approved by Ethics and Technical Committee of High Institute of Public Health Alexandria University.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data Analysis: Data were fed to the computer and analyzed using IBM SPSS software package version 20.0 (Armonk, NY: IBM Corp).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      However, our study is not without limitations. There is a risk of selection bias and this would limit the generalizability of our findings to all the healthcare professionals in EMRO. Additionally, our study only included nurses, physicians, and pharmacists. Despite these limitations, these findings are not inconsistent with the findings from previous studies about vaccine hesitancy among healthcare workers. The survey questionnaire was available in English and distributed in an online format, which can further introduce selection bias favoring English-literate HCWs and those with access to the Internet. Social desirability bias may also affect the interpretation of our study results. Most importantly, the survey was conducted in January 2021 when information regarding COVID-19 vaccines may have not circulated widely. Therefore, it possible that intention to be vaccinated would have changed.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.20.21253892
  67. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.18.21253862
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.18.21253862: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the Ethics Committee of the Friuli Venezia Giulia Region (CEUR-2020-Os-156), and informed consent was obtained verbally for telephone interviews.<br>Consent: The study was approved by the Ethics Committee of the Friuli Venezia Giulia Region (CEUR-2020-Os-156), and informed consent was obtained verbally for telephone interviews.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The data form the present study should be taken cautiously owing to several study limitations. Symptoms were self-reported, based on cross-sectional surveys, and may therefore contain suboptimal sensitivity. Subjective evaluation of the olfactory function was observed, indeed, to be inadequate to fully evaluate olfactory recovery with several authors having underlined that subjectivity of self-reporting may lead to underestimation of the prevalence of olfactory dysfunction. It is clear that patients’ rating of whether smell and or taste are impacted differentially is very difficult to interpret, due to impact of loss perception of flavour through retronasal olfaction, and little can be inferred from this aspect of the study. Moreover, the study cohort was relatively small and patients with more severe COVID-19 were excluded. In conclusion, a substantial proportion of patients with previous mild-to-moderate symptomatic COVID-19 characterized by new onset of chemosensory dysfunction still complained on altered sense of smell or taste one-year after the onset. As recovery from post-viral loss may continue beyond this period [6,15], further assessments will be necessary to conclude whether smell and taste dysfunction is permanent. Moreover, there is urgent need for more efforts and research on treatment strategies for post-COVID-19 chemosensory dysfunction.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.18.21253862
  68. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.16.21253662
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.16.21253662: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Additionally, depending on campus priorities and resource limitations, different campuses can use this same data to model policies differently. The effectiveness of reopening policies is expected to be sensitive to a campus’ specific context that includes physical infrastructure, overarching guidelines, and human compliance [5]. For certain campuses policies might not need to be constrained by exposure risk as testing might be frequent, ubiquitous, and voluminous. Other campuses could have limits on quarantining capacity. Policymakers might even consider the cost tradeoffs by actually forecasting actual financial losses incurred by reduction in mobility [6], or valuate loss of services based on community needs [53]. We elaborate on these considerations in the SI Implications for Policy Design. Operational Considerations: Beyond assessing cost-benefits, universities also need to consider practical methods of obtaining, storing, and processing mobility of the community as WiMob. University can access logs from the managed network internally as it is passively collected. Moreover, it does not require any new form of surveillance sensing but universities must revise terms of use and stay sensitive to community perspectives. While aggregate data on population mobility is valuable for many applications [64], which includes informing pandemic response [8], the major privacy challenge with localization data is to avoid accumulation [56]. Instead, operational applications need to conc...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.16.21253662
  69. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.24.436812
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.24.436812: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.24.436812
  70. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.19.21253675
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.19.21253675: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.19.21253675
  71. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.17.21253849
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.17.21253849: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Asymptomatic or mild cases were randomly sampled from observation patients.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-SARS-CoV-2 immunoglobulins: The presence of anti-S-IgM and anti-S-IgG antibodies was determined using chemiluminescence immunoassay (MAGLUMI 2019-nCoV IgM/IgG, Snibe Co. Ltd., Shenzhen, China) in the serum of 55 patients.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S-IgM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-S-IgG</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Study limitation: The authors suggested that relatively young age of patients and absence of cases with severe illness were restricted the chance to find enough significant differences in hematological and immunological features according to disease course of SARS-CoV-2 infected patients in this study.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.17.21253849
  72. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.21.21253984
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.21.21253984: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      These limitations are not minute, and caution should be employed in reporting any results based on this widely cited and publicly available dataset. While informative conclusions can be reached, they must be followed by proper disclosure about issues surrounding how representative or small the filtered, high quality data actually is, even if the parent dataset spans millions of entries.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.21.21253984
  73. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.17.21253760
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.17.21253760: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The institutional review board (IRB) of the US Naval Academy approved the study.<br>Consent: Informed consent was secured for all participants at the commencement of the survey.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This study has some limitations. Adherence to or support for NPIs are self-reported. Social pressure on respondents to report greater affinity toward mask wearing, or support for school closures for example, may be higher given the state of the ongoing pandemic. We note however that the measurement of relative difference between groups was highly significant across a variety of NPIs. It is difficult to imagine why these pressures would differ between groups; further, it is unlikely that social pressures would be greater on individuals reporting chronic diseases than those without to the point that they confound otherwise insignificant results. Additionally, our sample may not be representative of the US public as this study utilized a convenience sample using quotas based on reported disease state. We have controlled for multiple demographic factors, and note that it would be extremely difficult to recruit sufficient populations that satisfied quotas for disease state while maintaining representative sampling. This limitation thus represents a necessary trade-off between our ability to test our key hypotheses about chronic respiratory and autoimmune diseases, and our ability to make statements about the general population. Samples also reflect the real-world social dimensions of these diseases, such as the disproportionate recruitment of women in the autoimmune quota being indicative of the higher prevalence of those diseases among women. This research provides a timely first...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.17.21253760
  74. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.17.21253791
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.17.21253791: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Strengths and limitations of the study: The study employed a systematic and rigorous approach to source for the information relevant to these research objectives. This research summarizes global distributions and quantitative impacts of COVID-19 on global health. This will stimulate the research community, stakeholders in the government and non-governmental organizations, and healthcare professionals to optimize strategies to mitigate the impact of the ongoing pandemic and strengthening preparedness for any future outbreaks. Also, it will inform the entire public to emulate compliance towards personal protective measures against the future outbreak. Our study only focuses on the top 20 countries with the highest confirmed cases in the COVID-19 global timeline. Although, it failed to reflect the entire COVID-19 cases worldwide due to redundancy in some countries’ figures.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.17.21253791
  75. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.16.21253632
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.16.21253632: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      In interpreting the above results, it is important to acknowledge some limitations. Our analyses do not formally establish causation, which would be very challenging in the context where this study is conducted and the research questions we attempt to answer. Yet, the consistent patterns of findings across multiple outcomes and specifications is suggestive of potential underlying causal path-ways. Moreover, all our outcomes, including Covid-19 knowledge and prevention behavior, are necessarily self-reported, and therefore subject to “social desirability” bias. This limitation is inherent as in-person surveys and direct observation were not feasible during the time-period of this study, and indirect measures (e.g., based on cell phone mobility data) are not viable in a rural Malawi context where cell phone ownership continues to be uncommon (albeit growing). Also, notwithstanding the “success” that we highlight in terms of curtailing Covid-19 infections and mortality in Malawi, the social and economic impacts of the pandemic are severe and possibly lasting. For example, a substantial fraction of the MLSFH respondents reduced non-food consumption as a result from Covid-19, and about 61% reported worries about having enough food to eat. For more than half of the interviewed respondents (55%), the economic situation deteriorated compared to the previous year. Worries about access to health care for NCDs and other medical needs such as malaria treatment or HIV/AIDS care were also ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.16.21253632
  76. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.17.21253626
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.17.21253626: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.17.21253626
  77. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.15.21253601
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.15.21253601: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations to this work include uncertainty around the counterfactual conditions; between June 2016 and March 2020 TB case notifications were declining and for the counterfactual “no COVID” scenario we modelled them as continuing to decline at the same rate. Since December 2020, Malawi has had a second wave of COVID-19. Whilst our electronic enhanced surveillance data is entered in real time, data is monitored and verified on a quarterly basis, so we do not yet have information on the impact of the COVID-19 second wave in Malawi. Malawi is also fortunate to have well-functioning TB and HIV programmes that may be more resilient to COVID-19 than in other countries. Malawi did not introduce any substantial restrictions on population movement and gathering due to COVID-19, so there have been no legal restrictions on travelling to TB clinics. Therefore, our data are not necessarily generalisable to other settings in Southern Africa or elsewhere. The individual and household impact of missed or delayed TB diagnoses are likely to be severe for the affected people. However, it is relatively reassuring that the initial COVID-19 related decline in TB case notification was not sustained and that the Malawi TB programme had a relatively quick recovery once COVID-19 first wave rescinded. We observed a shorter period of disruption that earlier modelling of COVID-19 impact on TB assumed.(4) It is neither possible nor desirable to consider either COVID-19 or TB diagnosis, treatment, care an...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.15.21253601
  78. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.22.21253621
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.22.21253621: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This limitation of available and accurate testing in LMICs could pose a threefold challenge: impeding modeling of the spread of the pandemic to facilitate well-planned trials, reducing identification and recruitment of proven cases, and further limiting diagnostic capacity for direct research use. Lastly, these interventions require trial expertise in multiple clinical settings: as treatment of severe, hospitalizing disease to reduce morbidity and mortality, as treatment of mild or moderate disease to reduce progression and transmission of disease, and as prophylactic or presumptive treatment. Indeed, targeted prophylaxis or presumptive treatment to high risk groups may be one of the more promising roles for such agents, with examples of success in LMICs with meningococcal disease113 and malaria114. Though these challenges are significant, they are not insurmountable. New drug candidates appear rapidly and a coordinated adaptive trial design should be used. As the clinical context of this disease is global, focused clinical endpoints that do not require extensive resources can provide rigor without burdening researchers with added cost and complexity. Designing such trials requires broad expertise and thus broad collaboration. Such trial protocols can be then distributed, decreasing burdens on aspiring trialists and increasing sample sizes and sites, and thus improving power and generalizability of findings. Indeed, some or all of the above approaches have been used by groups...

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04414618</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Study of Opaganib in Coronavirus Disease 2019 Pneumonia</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04467840</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Opaganib, a Sphingosine Kinase-2 (SK2) Inhibitor in COVID-19…</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.22.21253621
  79. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.19.21253940
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.19.21253940: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations: Due to the nature of the vaccination rollout, we only had a limited follow-up time and subsequently a small number of events. At the time of analysis we did not include information on second doses due to very small numbers. We will continue to monitor the care home population and will update our analysis with an extended follow-up time and second doses when possible. In further work we aim to include background prevalence of COVID-19, and multi-morbidities and we will investigate additional adverse events such as mortality and hospitalisation. Conclusion: Our findings suggest care home residents with frailty are the most susceptible to infection post vaccination and should be prioritised for a second dose of the SARS-CoV-2 vaccine. We also found a susceptible period of reinfection of up to 42-days, indicating extra care and precautions should be taken in this period.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.19.21253940
  80. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.20.21252888
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.20.21252888: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This study has limitations. It is a single-site study of modest-size population; studies of larger populations in multiple sites are needed to assess its general applicability. It is a retrospective study, albeit of prospective patient accrual, so it has inherent potential for biases.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.20.21252888
  81. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.16.21253753
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.16.21253753: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our study has several limitations. During the study period, 197,817 cases of COVID-19 were reported in Harris County and eight contiguous counties (https://usafactsstatic.blob.core.windows.net/public/data/covid-19/covid_confirmed_usafacts.csv; last accessed March 12, 2021). Thus, our genome sample represents 4.8% of all cases in the metropolitan region and 94% of Houston Methodist cases. Our eight hospitals are widely distributed across the metropolitan region and serve patients who are demographically and geographically highly diverse, but it is likely our sample underrepresents SARS-CoV-2 genotypes circulating in difficult-to-reach populations, such as homeless and otherwise disenfranchised individuals. Finally, our hospitals care mainly for adult patients, which means that SARS-CoV-2 variants infecting pediatric patients are underrepresented in our study, although these are rare.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.16.21253753
  82. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.24.436850
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.24.436850: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These sequences were aligned using the MAFFT [42], MEGA [43] or JalView [44] sequence alignment programs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div><div style="margin-bottom:8px"><div>MEGA</div><div>suggested: (Mega BLAST, RRID:SCR_011920)</div></div><div style="margin-bottom:8px"><div>JalView</div><div>suggested: (Jalview, RRID:SCR_006459)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sequences were then analyzed through in-house Python or R scripts.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Relative abundance (RA) of mutations in S protein from different geographic regions was determined by an in-house python script using the scikit-learn (Python) library [45] and plotted with R (codes available upon request).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>scikit-learn</div><div>suggested: (scikit-learn, RRID:SCR_002577)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The structural analyses were conducted using the Schrodinger Suite (Schrodinger LLC, NY) and PyMol [46].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.24.436850
  83. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.19.21253518
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.19.21253518: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: At PHU, this study was approved by Portsmouth Hospital NHS Trust Research Ethics Committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-SARS-CoV-2 assays: Samples from PHU were initially analysed for SARS-CoV-2 antibodies at the Department of Medical Microbiology, PHU, using the Abbott nucleocapsid IgG assay [Abbott, Chicago, IL, USA] as part of the SIREN study.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples from RH were analysed using the Abbott nucleocapsid IgG assay [Abbott, Chicago, IL, USA] and further evaluated using the Elecsys® Anti-SARS-CoV-2 IgG nucleocapsid immunoassay [Roche, Basel, Switzerland].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: Analyses were performed using Graphpad Prism v9.0.1 (La Jolla, California, USA) and SPSS v27.0 (IBM Corp, Armonk, NY).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The present study has some limitations. Firstly, our sample sets may under-represent ethnic groups, did not comprise children and did not capture sufficient clinical metadata required for full clinical and analytical result interpretation. We propose a further study to be conducted, where along with participant’s PCR status and clinical symptoms, investigation of these immunoassays to detect responses in asymptomatic and mild cases should be evaluated to deduce the clinical sensitivity of different immunoassays. Whilst limited, the study highlights that the TBS assay showed enhanced sensitivity in detecting mild and asymptomatic antibody responses [9].

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr style="background-color:#FF0000"><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT12345678</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Trial number did not resolve on clinicaltrials.gov. Is the number correct?</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td></tr></table>

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.19.21253518
  84. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.19.21253558
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.19.21253558: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The protocol was evaluated by the research ethics committees of each participating unit.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.19.21253558
  85. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.19.21253756
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.19.21253756: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A limitation of our analysis is that we did not validate our phenotypes, and therefore measurement error is possible; however, we used the CDC description for PASC in developing our phenotype15. Also, patient attrition to primary care sites out of network may have contributed to bias in the EHR database. We have demonstrated the feasibility of characterizing the natural history of post-acute COVID-19 infections on both EHR and claims databases. The implications of our analysis may lead to public health interventions that can reduce the global burden of long-term sequelae from the COVID-19 pandemic.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.19.21253756
  86. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.25.437046
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.25.437046: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The two Illumina RNASeq workflows (#1 and #2 in Table 1) perform read mapping with bwa-mem and bowtie2, respectively, followed by sensitive allelic-variant (AV) calling across a wide range of AFs with lofreq (see AV calling section below).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>bowtie2</div><div>suggested: (Bowtie 2, RRID:SCR_016368)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All four workflows use SnpEff, specifically its 4.5covid19 version, for AV annotation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SnpEff</div><div>suggested: (SnpEff, RRID:SCR_005191)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The fifth workflow (Reporting) takes a table of AVs produced by any of the other four workflows and generates a list of AVs by Samples and by Variant.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Variant</div><div>suggested: (VARIANT, RRID:SCR_005194)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SNVer is no longer actively maintained).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SNVer</div><div>suggested: (SNVer, RRID:SCR_002061)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FreeBayes contains a mode specifically designed for finding sites with continuous AFs; Mutect2 features a so-called mitochondrial mode, and lofreq was specifically designed for microbial sequence analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FreeBayes</div><div>suggested: (FreeBayes, RRID:SCR_010761)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.25.437046
  87. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.17.21253813
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.17.21253813: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.17.21253813
  88. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.24.436864
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.24.436864: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: SARS-CoV-2 hamster studies: All procedures involving animals were performed in accordance with guidelines of the Institutional Animal Care and Use Committee of Washington University in Saint Louis.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animals were randomized from different litters into experimental groups and were acclimatized at the BSL3 facilities for 4-6 days prior to experiments.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Four- to six-week old male Syrian hamsters were obtained from Charles River Laboratories and housed in an enhanced ABSL3 facility at Washington University in St Louis.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed and sequentially incubated with an oligoclonal pool of SARS2-2, SARS2-11, SARS2-16, SARS2-31, SARS2-38, SARS2-57, and SARS2-71 anti-S antibodies (33) and HRP-conjugated goat anti-mouse IgG (Sigma 12-349) in PBS supplemented with 0.1% saponin and 0.1% bovine serum albumin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS2-57</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS2-71</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: Expi293F cells were cultured in Expi293 Expression Medium (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293F</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All viruses were passaged once in Vero-TMPRSS2 cells and subjected to deep sequencing after RNA extraction to confirm the introduction and stability of substitutions (16).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, plaque assays were performed to isolate the VSV-SARS-CoV-2 escape mutant on Vero cells with mAb 2C08 in the overlay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Area under the curve was calculated using Graphpad Prism v8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Four μL RNA was used for real-time qRT-PCR to detect and quantify N gene of SARS-CoV-2 using TaqMan™ Fast Virus 1-Step Master Mix as described (53) or using the following primers and probes: Forward: GACCCCAAAATCAGCGAAAT; Reverse: TCTGGTTACTGCCAGTTGAATCTG; Probe: ACCCCGCATTACGTTTGGTGGACC; 5’Dye/3’Quencher: 6-FAM/ZEN/IBFQ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GACCCCAAAATCAGCGAAAT</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Reverse</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>TCTGGTTACTGCCAGTTGAATCTG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Probe</div><div>suggested: (UniPROBE, RRID:SCR_005803)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 27. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.24.436864
  89. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.20.21254038
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.20.21254038: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The survey was approved by the Ethics Review Committee on Human Research of Waseda University (approval #: 2020-050).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This study has several limitations. We do not have data on the pre-COVID mental health conditions of our respondents, and thus our findings are descriptive, not causal. Additionally, although our surveys were designed so that our respondents were representative of the Japanese population in terms of their sex, age group, and area of residence, it is possible that some segments of the population were not represented in our sample because they were online surveys. Despite these limitations, this study presented evidence that COVID-induced economic shocks can have a differential detrimental effect on mental health depending on the sex of workers. The economic ramifications of the COVID-19 pandemic can remain with us much longer than the disease itself. More work is necessary to identify vulnerable individuals during the pandemic so that we can monitor their mental health status.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.20.21254038
  90. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.23.21254175
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.23.21254175: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To determine the SNPs located in the ACE and ACE2 genes as defined above, we searched the annotation files for the following RefSeq transcript identifiers: ACE - ENST00000290866 (Ensembl identifier) or NM_000789 (National Center for Biotechnology Information (NCBI) Reference</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RefSeq</div><div>suggested: (RefSeq, RRID:SCR_003496)</div></div><div style="margin-bottom:8px"><div>Ensembl</div><div>suggested: (Ensembl, RRID:SCR_002344)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Since these studies did not make their data publicly, our analysis was based on the reported list of SNPs possibly associated with ME/CFS. 2.4 Analysis of case-control EWAS: We focused our analysis on four available case-control EWAS on ME/CFS (Brenu et al., 2014; De Vega et al., 2017, 2014; Trivedi et al., 2018), which were reviewed elsewhere (Almenar-Pérez et al., 2019), and two additional case-control studies published after this review (Helliwell et al., 2020; Herrera et al., 2018) (Table 2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ME/CFS.</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We conducted a joint analysis of the four of the array-based studies which had their data available in the NCBI Gene Expression Omnibus (GEO) data repository (Barrett et al., 2013).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene Expression Omnibus</div><div>suggested: (Gene Expression Omnibus (GEO, RRID:SCR_005012)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In this analysis, we used the following Bioconductor packages: hgu133a.db, hgu133plus2.db, IlluminaHumanMethylation450kanno.ilmn12.hg19, and IlluminaHumanMethylationEPICanno.ilm10b2.hg19 to analyze the annotation files of the GeneChip HG-U133A, GeneChip U133+2</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bioconductor</div><div>suggested: (Bioconductor, RRID:SCR_006442)</div></div><div style="margin-bottom:8px"><div>GeneChip</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      We attempted to compensate this data limitation with the analysis of a new data from a cohort of German patients. This analysis suggested that the gene expression of ACE or ACE2 in PBMCs were similar between patients and healthy controls. Data scarcity can be explained by five main reasons. Firstly, there were only few GWAS, EWAS, and GES available in the ME/CFS literature. This limited number of studies could be related to a poor societal recognition of ME/CFS as a disease, which ultimately limits the funding available for the respective research. Access to limited research funding could also imply an additional difficulty in assembling multidisciplinary teams required to tackle the various challenging technical aspects of these studies. Secondly, three published case-control GES based on microarray technology were excluded from this investigation, because they used broad or alternative case definitions of ME/CFS. Given the absence of an objective disease biomarker, the research community should aim to use consensual case definitions for research with the intention to make diagnostic comparable across studies while reducing between-studies heterogeneity. In this regard, our requirement for ME/CFS diagnosis was the 1994 CDC/Fukuda definition or the 2003 CCC according to the recommendation for research given by the European Network on ME/CFS (Pheby et al., 2020). Thirdly, four RNA-seq studies were not included in our investigation due to unclear data quality. Issues concerning...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.23.21254175
  91. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.24.436830
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.24.436830: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.24.436830
  92. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.23.21254185
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.23.21254185: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our model has important limitations. While the model’s qualitative findings are robust, we cannot estimate the outbreak size necessary to ensure introduction of new variants into a population as many parameters required to do so are unknown. For instance, it is not yet clear whether the percentage of immunocompromised hosts varies across populations based on factors such as HIV prevalence and availability and use of immunosuppression for organ transplantation and cancer treatment. The number of secondary infections created by a person with new variants may also differ from that of other members of the population in ways that are difficult to project. On the one hand, these individuals may shed for longer and at a higher viral load (5, 7). Yet, they also may be more ill and therefore quarantined at home or in the hospital limiting contact exposures. Moreover, while all variants will be impacted in the same way by the introduction of NPIs such as masking and physical distancing, the utilization of these interventions varies considerably among regions and over time. Our model does not capture these nuances and in this sense is intended to be phenomenological only. We demonstrate that new variants are frequently created and introduced into the population during large waves of SARS-CoV-2 infection. Yet, most variants ultimately burn out and those that ultimately predominate likely were associated with early super-spreader events. These variants are most likely to emerge when the p...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.23.21254185
  93. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.19.21253922
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.19.21253922: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.19.21253922
  94. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.19.21253921
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.19.21253921: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study received Monash Health ethics committee approval (RES-19-0000-763A).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Researchers weren’t blinded to outcomes.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.19.21253921
  95. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.15.21253542
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.15.21253542: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.15.21253542
  96. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.17.21253408
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.17.21253408: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: After they give written informed consent, patients are screened through a blood-sampling procedure to determine their RAS and BRAF tumor status according to plasma analysis of circulating cell free DNA, using Intplex technology20,21.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The PANIRINOX study is a first line randomized phase II study, assessing the activity of a combination chemotherapy with fluorouracil, leucovorin, oxaliplatin and panitumumab ± irinotecan (FOLFOX + panitumumab vs FOLFIRINOX + panitumumab) in unresectable mCRC patients, selected by RAS and B-RAF status obtained from cirDNA analysis.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT02980510</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Comparison FOLFIRINOX Panitumumab vs mFOLFOX6 Panitumumab in…</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.17.21253408
  97. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.18.21253778
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.18.21253778: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Strengths and limitations: This open science study comes with certain limitations, but also with unique strengths by virtue of our access to an international network of standardized databases. Below, we discuss potential limitations one by one, as well as ways through which our study addresses them to the extent practically possible. First, the study only partially addresses the question of whether alpha-1 blockers alleviate the disease progression of COVID-19 as postulated by Konig et al. 2020. With COVID-19 being an emergent disease, the number of in-patient COVID-19 cases was rather small during the studied period even in the extensive network of databases we have access to. We thus determined the number to be insufficient for us to directly estimate the effectiveness against the disease progression in a scientifically meaningful manner. Instead, we attempted to investigate the question under the hypothesis that, if alpha-1 blockers were indeed protective against severe COVID-19 symptoms, we should see a negative association between the prevalent use of alpha-1 blockers and COVID-19 related outcomes such as hospitalization. Even COVID-19 diagnosis alone could be indicative of relatively severe symptoms since patients are otherwise unlikely to seek interactions with healthcare systems. Second, we used a prevalent-user cohort design since there are so few patients initiating BPH therapies during and immediately preceding the pandemic that a new-user design is infeasible. A p...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.18.21253778
  98. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.23.21254203
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.23.21254203: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Descriptive statistics and comparisons between parametric and non-parametric samples were calculated using the GraphPad PRISM statistics software (GraphPad, San Diego, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PRISM</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This limitation has been reported to be mitigated by the addition of the respiratory rate: the ROX index23. We document improved mortality with HFNO compared with face mask CPAP like numerous others10,13,14,21,26,27. The ranges of measurements for the ROX were similar for HFNO and CPAP in SARS-CoV-2 ARF. For HFNO, we note a similar ROX at 4 hours to the French investigators (>5.37 for success) 10,14 and UK reports at 12 hours (ROX-12h <4.88 for failure)11. We note different results to a South African study (<3.7 for failure versus <4.46)13 which may be explained by the younger age of the population (52y vs 60y), a lower presenting PF ratio (68 vs 106) and differing treatment regimens (70% corticosteroid use) and comorbidities particularly HIV. The increased sensitivity of the ROX with time is well reported particularly at or before 24 hours aiming to maximise decisions about escalation early11,13. While our HFNO data is not significant at 4 and 6 hours, the trend with time is clearly significant with divergence at 4 hours and may reflect the smaller HFNO patient numbers in our study, a limitation due to the late UK adoption of HFNO. We provide an early positive report of the value of the ROX in CPAP, unlike the small studies in the past with 20 and 18 patients who report mixed results11,25. The ROX discriminates outcomes early from 1 hour onwards with the most sensitivity at 24 hours. This should enable timely decision making, particularly in the ‘golden window’ between 24 ho...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.23.21254203
  99. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.17.21253821
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.17.21253821: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All donors gave consent to participate in this research project, which was approved by the Héma-Québec Research Ethics Committee.<br>IRB: All donors gave consent to participate in this research project, which was approved by the Héma-Québec Research Ethics Committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Samples: Caucasian convalescent plasmas were randomly chosen from adult participants in the CONCOR-1 study (#NCT04348656), from the Québec cohort having received an official diagnosis of COVID-19 by the Québec Provincial Health Authority after epidemiologic investigation or confirmed by polymerase chain reaction (PCR) tests.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">The average age of our convalescent plasma donor cohort was 40.4 ± 15.0 years and included 68% males.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04348656</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">CONvalescent Plasma for Hospitalized Adults With COVID-19 Re…</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.17.21253821
  100. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.21.21251651
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.21.21251651: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Procedures: The study was approved by the Institutional Review Board at Colorado State University (CSU).<br>Consent: Participants gave their informed consent prior to enrollment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serology and qRT-PCR Testing: Serum was tested for IgG antibodies seroreactive to SARS-CoV-2 antigens by the National Jewish Health CLIA Diagnostic Laboratory using an Abbott Architect IgG SARS-CoV-2 testing platform. 9-10 RNA was extracted from nasal swabs and qRT-PCR was performed as previously described.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations of this study include the use of self-reported data which could have resulted in response bias for reported protective behaviors. This was a cross-sectional study so we could not determine temporality between protective behaviors and COVID-19 outcomes; however, given that there were not any positive cases and only two participants who were seropositive for COVID-19 suggests previous exposure unlikely influenced protective behaviors, and that protective behaviors contributed to the low level of disease in this population. There may have also been nonresponse bias, whereby those who were invited and did not participate differed in some way from those who did. However, our participation rate (33.7%) and number of respondents (n=508) was significant and helps to mitigate this concern.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.21.21251651
  101. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.22.21254134
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.22.21254134: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The calculations were made using the STATISTICA software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATISTICA</div><div>suggested: (STATISTICA , RRID:SCR_014213)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.22.21254134
  102. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.14.21252289
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.14.21252289: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Informed consent was obtained from all patients and relatives, and the IDIBELL Research Ethics Committee approved this study (PR152/20).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Ten male patients fulfilled all selection criteria (Table 1).</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mutation Surveyor software was used to detect variants and nomenclature was given according to HGVS guidelines.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Mutation Surveyor</div><div>suggested: (Mutation Surveyor, RRID:SCR_001247)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.14.21252289
  103. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.22.21254131
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.22.21254131: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">COVAM considers the possibility that not all individuals infected with SARS-CoV-2 will be tested positive and reported.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: (Active Motif Cat# 91351, RRID:AB_2847848)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our study has several limitations related to uncertainty in vaccine effectiveness in real-world settings. Authorized COVID-19 vaccines to date have demonstrated high efficacy for preventing COVID-19 illness and hospitalization.3 COVAM assumes that vaccination also prevents transmission of SARS-CoV-2. However, studies to determine the effect of vaccination on acquisition and shedding of SARS-CoV-2 are ongoing. Our model also assumes that COVID-19 vaccines will be effective in preventing transmission of new and future variants of the virus. The B.1.1.7 (UK), B.1.351 (South Africa), and P.1 (Brazil) variants have all been detected in the US,20 and all contain mutations in the spike protein. Both the Pfizer and Moderna vaccines are believed to be effective against the B.1.1.7 variant.21–23 However, a recent study suggests the neutralizing antibodies induced by vaccination are less potent against the B.1.351 and B.1.1.7 variants in vitro.24 As long as SARS-CoV-2 is replicating at high levels, new variants can be expected to emerge, underscoring the importance of high-level adherence to NPIs and rapid vaccination with high-level coverage. Furthermore, we do not use a full calibration procedure that is commonly used in simulation modeling to estimate the unobservable inputs of the model, which may have led to suboptimal set of inputs.25–27 Finally, our model does not consider age-based differences in the administration and effectiveness of the vaccines. However, currently used vacci...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.22.21254131
  104. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.23.21254165
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.23.21254165: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Research Design: Ethical approval for the study was granted by the MBRU, Institutional Review Board (Reference # MBRU-IRB-2020-032).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A Strengths, Weaknesses, Opportunities, and Threats (SWOT) analysis of the impact on education of the pandemic highlights, among many of the factors discussed in the preceding paragraphs, the opportunity for educational leadership in times of crisis and the challenge of executing it with budgetary constraints (36). The COVID-19 experience is also a living example to demonstrate to students the health inequities and difficult ethical decisions in a contemporary life or death scenarios; it constituted an invaluable experience that reinforces knowledge of health systems and standards of practice (7). Resilience, grit, and tolerance have transformed from mere teaching points to demonstrable practice (7). The tag: front-liner, has become a proud identity, inspirational for the budding physician. This study is characterized by several limitations that are worth shedding light on. Although the focus on a single program enabled the development of thorough reflections and insights, the generalizability of the generated findings is limited to institutions that are characteristically and contextually like MBRU. It would be worthwhile for future studies to collect data from several programs and run a comparative analysis. The small sample size and low response rate were also limitations. The data collection extended until after the end of course assessments, and hence, the perception of the participating students might have been influenced by their performance in the respective exams and...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.23.21254165
  105. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.15.21253582
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.15.21253582: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.15.21253582
  106. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.23.21254170
    1
    1. sciscore 27 Mar 2021

      SciScore for 10.1101/2021.03.23.21254170: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.23.21254170
  107. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.20.21253624
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.20.21253624: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: According to national law, the performance and publishing the results of such a project can be done without asking the permission of the competent research ethics committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.2 Platform: The interactive dashboard was built using Shiny [36], based on the opensource programming language R [37] in the RStudio Interactive Development Environment [38].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Shiny</div><div>suggested: (Shiny, RRID:SCR_001626)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The dashboard relies on several packages: shinydashboard [39] for the page structure, plotly [40], and ggplot2 [41] for interactive graphs, DT [42] for interactive tables, shinyjs [43] for some custom interaction, shinyWidgets [44] for input objects and readxl [45], plyr [46], dplyr [47], lubridate [48], tidyr [49], tidyverse [50], stringr [51], psych [52] and forcats [53] for data wrangling.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.20.21253624
  108. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.24.436822
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.24.436822: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1:2000); rabbit anti-SARS-CoV-2 N antibody (9103, Prosci, 1:2000); rabbit anti-SARS-CoV-2 S antibody (PA5-81795, Invitrogen, 1:1000);</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 N</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">rabbit anti-TDRD3 antibody (Bethyl Laboratory,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-TDRD3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">mouse anti-SMN antibody (610646, BD Biosciences, 1:2000); rabbit anti-G3BP1 antibody (1F1, Rhône-Poulenc Rorer, 1:1000</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SMN</div><div>suggested: (BD Biosciences Cat# 610646, RRID:AB_397973)</div></div><div style="margin-bottom:8px"><div>anti-G3BP1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunofluorescence were performed with the following antibodies: mouse anti-Flag monoclonal antibody (F1804, Sigma Aldrich, 1:500);</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Flag</div><div>suggested: (Sigma-Aldrich Cat# F1804, RRID:AB_262044)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alexa Fluor-conjugated goat anti-rabbit, goat anti-mouse secondary antibodies were from Invitrogen.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture and transfection: HEK293 and VeroE6 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and grown at 37°C with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293 and Huh-7 cells were transfected with plasmid DNAs by standard calcium phosphate precipitation and Lipofectamine 3000 (Invitrogen), respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">rabbit anti-TDRD3 antibody (Bethyl Laboratory,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bethyl Laboratory</div><div>suggested: (Bethyl, RRID:SCR_013554)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.24.436822
  109. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.23.436686
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.23.436686: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.23.436686
  110. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.24.435771
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.24.435771: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies: ACE2 antibody abcam, ab27269 1:400 TMPRSS2 antibody Santa Cruz sc-515727 1:400 Anti-NP, sino-biological 40143-MM05 1:400 Anti-NP, sino-biological 40143-R001 1:400 Anti-NP, thermofisher MA1-7401 1:400 K8/K18, progen, 90001 1:400 Donkey-anti-rabbit750, abcam ab175731</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antibodies: ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>TMPRSS2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-NP</div><div>suggested: (Bio-Rad Cat# MCA400, RRID:AB_2151884)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">With rigorous washing steps in between the proteins were detected with mouse anti-strep-tag-antibodies (IBA) and goat anti-mouse IgG antibodies (Life Biosciences). IDISCO: SARS-CoV-2 infected and non-infected Syrian hamster lungs were provided in 10% formalin, for longer storage hamster lungs were kept in PBS and 0.01% sodium azide.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Obtained image stacks were analyzed with ImageJ v1.54f and Imaris 9.6.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the 3D renders obtained imaging data was imported into Imaris, display adjustments were made for each channel.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Imaris</div><div>suggested: (Imaris, RRID:SCR_007370)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The generated surfaces were subsequently used to mask the TMPRSS2 and ACE2 channels, after which statistical values were obtained and exported to GraphPad Prism 9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 6. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.24.435771
  111. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.23.436684
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.23.436684: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Human subjects: Blood and peripheral blood mononuclear cells (PBMCs) were isolated from COVID19+ patients using protocols approved by Institutional Review Boards at Fred Hutch Cancer Research Center, University of Washington and Seattle Children’s Research Institute.<br>Consent: Informed consent was obtained from all participants and the University of Washington and/or Fred Hutchinson Cancer Research Center and CHUM Institutional Review Boards approved the entire study and procedures.<br>IACUC: All experiments adhered to the guidelines approved by the Emory University Institutional Animal Care and Committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Peripheral blood mononuclear cells (PBMCs) and serum from pre-pandemic controls were blindly selected at random from the study “Establishing Immunologic Assays for Determining HIV-1 Prevention and Control”, with no considerations made for age, or sex, participants were recruited at the Seattle Vaccine Trials Unit (Seattle, Washington, USA).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Cell Lines: All cell lines were incubated at 37°C in the presence of 5% CO2. 293-6E (human female, RRID:CVCL_HF20) and 293T cells (human female, RRID:CVCL_0063) cells were maintained in Freestyle 293 media with gentle shaking.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We recently reported an initial characterization of the anti-S antibody responses generated by CV1 (Seydoux et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Some samples appear to show enhanced binding in the presence of ACE2, perhaps because ACE2 binding stabilizes and exposes their binding sites, these antibodies are considered not competitive with ACE2. mAb competition BLI: To measure competition between individual mAbs for binding to SARS-CoV-2 S-2P and RBD, S-2P and RBD were biotinylated using EZ-Link NHS-PEG4 Biotin at a molar ratio of 1:2/ Biotinylated protein was purified using a Zeba spin desalting column.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S-2P</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HCoV-OC43, HCoV-HKU1, HCoV-NL63 and HCoV-229E S1+S2 ECTs (Cat#’s 40607-V08B, 40606-V08B, 40604-V08B, 40605-V08D), SARS-HCoV-2 S1 domain (CAT#: 40591-V08B1), SARS-CoV-2 S1 N-terminal domain (CAT#40591-V41H) SARS-HCoV-2 S2 extra-cellular domain (CAT#: 40590-V08B) and SARS-CoV2 RBD (CAT#: 40150-V05H) were purchased from SinoBiologicals.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV-NL63</div><div>suggested: RRID:CVCL_RW88)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell Lines: All cell lines were incubated at 37°C in the presence of 5% CO2. 293-6E (human female, RRID:CVCL_HF20) and 293T cells (human female, RRID:CVCL_0063) cells were maintained in Freestyle 293 media with gentle shaking.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>the</div><div>detected: ( RRID:CVCL_HF20)</div></div><div style="margin-bottom:8px"><div>293T</div><div>detected: (CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, plasmids expressing the HIV-1 Gag and pol (pHDM-Hgpm2), HIV-1Rev (pRC-CMV-rev1b), HIV-1 Tat (pHDM-tat1b), the SARS CoV2 spike (pHDM-SARS-CoV-2 Spike) and a luciferase/GFP reporter (pHAGE-CMV-Luc2-IRES-ZsGreen-W) were co-transfected into 293T cells at a 1:1:1:1.6:4.6 ratio using 293 Free transfection reagent (EMD Millipore Cat #72181) according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The culture supernatant was harvested after 72 hours at 32°C, clarified by centrifugation, filtered and frozen at −80C. 293 cells stably expressing ACE2 (HEK293T-hACE2) were seeded at a density of 4000 cells/well in a 100 µl volume in flat clear bottom, black walled, tissue culture 96-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The media was aspirated from 293T-ACE2 cells and 100 µl of the virus-antibody mixture was added.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monitoring RBD-binding to 293-ACE2 cells by flow cytometry: 8 pmol of biotinylated S-2P with strep tag peptide sequence on C terminus were mixed with 10 pmol of mAb and incubated for 10 min at RT in a round-bottom tissue culture 96-well plate. 200,000 HEK293T-hACE2 cells in 50 µL of cDMEM were then added to each well and the mixture of cells + RBD or S-2P + mAb was incubated for 20 min on ice.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293-ACE2</div><div>suggested: RRID:CVCL_DR94)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infection of k18-hACE2 mice with SARS-CoV-2: B6.Cg-Tg(K18-ACE2)2Prlmn/J mice were purchased from Jackson Laboratories.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B6.Cg-Tg(K18-ACE2)2Prlmn/J</div><div>suggested: RRID:IMSR_JAX:034860)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IMGT/V-QUEST was used to assign V, D, J gene identity, and CDRL3 length to the sequences (Brochet et al., 2008).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IMGT/V-QUEST</div><div>suggested: (IMGT/V-QUEST, RRID:SCR_010749)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The V(D)J enriched library was sequenced on an Illumina HiSeq or MiSeq.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MiSeq</div><div>suggested: (A5-miseq, RRID:SCR_012148)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Remaining model building was completed using COOT (Emsley and Cowtan, 2004) and refinement was performed in Phenix (Adams et al., 2004).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structural figures were made in Pymol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pymol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Particles were picked with DogPicker (Voss et al., 2009) and processed in RELION 3.0 (Scheres, 2012).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RELION</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence analysis: Sequences were analyzed using Geneious software (Version 8.1.9)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Geneious</div><div>suggested: (Geneious, RRID:SCR_010519)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: All graphs were completed using GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.23.436684
  112. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.23.436648
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.23.436648: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Certain caveats merit airing. First, the correlation we observe between antiviral activity and phospholipidosis, as strong as it is, does not illuminate the mechanism by which phospholipidosis is itself antiviral. Phospholipidosis itself is only partly understood mechanistically, and there are no known genetic or chemical ways to inhibit drug-induced phospholipidosis, nor are there reliable target-selective reagents to induce it. Second, there is no consistent standard in the field as to the physical properties that will predict whether a molecule will induce phospholipidosis, and there are even non-CAD molecules that induce it (e.g., azithromycin). Thus, we have chosen conservative criteria to predict phospholipidosis-inducing CADs; while we believe that these will have relatively few false positive predictions, many phospholipidosis-inducing drugs may be missed. Third, phospholipidosis is a confound that only affects drugs repurposed for direct antiviral activity—it is irrelevant for drugs like dexamethasone (62) and for the CAD fluvoxamine (63) which have been repurposed for immunomodulatory treatment of COVID-19, nor is it relevant for antiviral CADs whose activity against the virus is well-below the range where phospholipidosis occurs. Fourth, our estimates of the clinical trial costs of CAD advancement for COVID-19 are clearly rough. If we have inadvertently included CADs advanced for immunomodulatory treatment, for instance, they will be too high. This would be balance...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.23.436648
  113. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.15.21253313
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.15.21253313: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.15.21253313
  114. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.21.21253158
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.21.21253158: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primers design: In order to design primer suitable PCR sets to partial SARS-CoV-2 Spike (S1 and S2 region) protein, 3 sequences (NC_045512.2); SARS-CoV-2 Wuhan-Hu-1, and two 2 sequences from the first case reported in Brazil, MT350282.1 and MT126808.1; (Araujo, 2020) were obtained from NCBI and imported into BioEdit sequence alignment editor (version 7.0.5.2) program.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Wuhan-Hu-1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primers design: In order to design primer suitable PCR sets to partial SARS-CoV-2 Spike (S1 and S2 region) protein, 3 sequences (NC_045512.2); SARS-CoV-2 Wuhan-Hu-1, and two 2 sequences from the first case reported in Brazil, MT350282.1 and MT126808.1; (Araujo, 2020) were obtained from NCBI and imported into BioEdit sequence alignment editor (version 7.0.5.2) program.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioEdit</div><div>suggested: (BioEdit, RRID:SCR_007361)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.21.21253158
  115. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.17.21253773
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.17.21253773: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Ethics approval: Written informed consent was obtained from all participants.<br>IRB: This study was approved by the University of British Columbia/Providence Health Care and Simon Fraser University Research Ethics Boards (protocol H20-03906).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Residents were predominantly male (58%) and a median 82 years of age, while seronegative HCW were predominantly female (72%) and a median of 36 years of age.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Total binding antibodies in serum against the SARS-CoV-2 nucleocapsid (N) and spike protein receptor binding domain (S/RBD) were determined using the Roche Elecsys Anti-SARS-CoV-2 and Anti-SARS-CoV-2 S assays, respectively, on a cobas e 601 module analyzer (Roche Diagnostics).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">NAbs were determined using pseudovirus and live SARS-CoV-2 infectivity assays employing VeroE6-TMPRSS2 cells (JCRB-1818) as targets.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudotyped virions were generated by co-transfecting 293T cells (ATCC) with a plasmid encoding SARS-CoV-2 Wuhan-Hu-1 Spike glycoprotein (Genscript) or VSV-G Indiana glycoprotein control (pHEF-VSV-G; NIH HIV Reagent Program) along with a lentiviral packaging plasmid (pCMV-dR8.2 dvpr 17 ; Addgene) and luciferase expression plasmid (pLenti CMV Puro LUC (w168-1) 18 ; Addgene).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were conducted using Prism v9.0.2 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.17.21253773
  116. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.16.21251286
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.16.21251286: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Patients: This study was reviewed and approved by the ethics committees of the above four participant hospitals.<br>Consent: Written informed consent was obtained from all participants enrolled in this</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data processing and analysis: Cutadapt software (cutadapt v1.16) was used to remove the reads contained adaptor contamination.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cutadapt</div><div>suggested: (cutadapt, RRID:SCR_011841)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The clean reads were mapped to the hg19 UCSC transcript set using Bowtie2 version 2.1.0 and the gene expression level was estimated using RSEM v1.2.15.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bowtie2</div><div>suggested: (Bowtie 2, RRID:SCR_016368)</div></div><div style="margin-bottom:8px"><div>RSEM</div><div>suggested: (RSEM, RRID:SCR_013027)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Several limitations should be taken into consideration for the interpretation of this study. First, this study focused on the transcriptome analysis of PBMCs in blood. Adding the data of immune cells from lesion sites such as the lung and bronchoalveolar lavage fluid will make the analysis more comprehensive and conclusive. Second, the PBMC samples were collected within 4 days of admission from asymptomatic and symptomatic groups to maintain uniformity of timing for comparison between groups. Future studies with longitudinal samples from COVID-19 patients may help to determine the cause-and-effect relationships between immune response and disease outcome. In summary, this study will help us extend our understanding of host immune response during the progression COVID-19 disease, and may help elucidate the COVID-19 infection and provide a basis for rationally designed immune therapies.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.16.21251286
  117. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.16.21253744
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.16.21253744: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: We circulated a google form with informed consent on the hospital WhatsApp platform and asked them to self-report their vaccination experience.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed in Statistical Package for the Social Sciences (SPSS) version 20.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Statistical Package for the Social Sciences</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.16.21253744
  118. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.14.21253554
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.14.21253554: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For these four prediction tasks, we experimented with the following types of input features: i) historical data; ii) individual Google search trend for nine COVID-19 related symptoms; iii) historical data and single Google search trend for nine COVID-19 related symptoms; iv) historical data and top two Google search trends for nine COVID-19 related symptoms determined using the validation set in step 3 experiments; v) historical data and top three Google search trends for nine COVID-19 related symptoms determined using the validation set in step 3 experiments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Google</div><div>suggested: (Google, RRID:SCR_017097)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      To overcome this limitation, we are interested in developing state-specific models, which is the subject of our ongoing work.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.14.21253554
  119. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.18.21253734
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.18.21253734: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Short fragments (30 nt) containing the novel mutations identified in our study were used as queries to blast search the local databases consisting of the downloaded sequences to determine the incidence of the novel mutations using the “BLAST” function of the Geneious software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Geneious</div><div>suggested: (Geneious, RRID:SCR_010519)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.18.21253734
  120. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.19.21253351
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.19.21253351: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data processing and statistical analysis: Data were analyzed using Microsoft Excel v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">. 16.43 for Mac (Microsoft Corporation, Seattle, WA) and statistical analyses were conducted with Stata/IC v. 16.1 for Mac (StataCorp LCC, College Station, TX).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Figures were made using GraphPad Prism version 9.0.2 for Mac (GraphPad Software, San Diego, CA) or Lucidchart (www.lucidchart.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Due to methodological limitations, the apparent difference between competitive swimming and recreational swimming should be interpreted with caution (see limitations below). As the risk episodes exposed on average 13.6 (95% CI: 11.9;15.3) participants to SARS-CoV-2, in total 2,201 (95% CI: 1,923;2,479) swimmers are estimated to have been exposed to SARS-CoV-2 at the recorded risk episodes. Of these swimmers, 23 subsequently tested positive for SARS-CoV-2, leading to an estimated risk of infection of 1.0 (95% CI: 0.9;1.2)% by participating in a risk episode. This number is an estimate of a participant’s risk of getting infected with SARS-CoV-2 at an indoor swimming activity (under the restrictions prevailing in the study period) if another participant is SARS-CoV-2 positive. For comparison, a cohort study showed SARS-CoV-2 transmission from non-hospitalized COVID-19 patients to 12-24% of close contacts, i.e. health care-workers, household contacts, nursing home workers or residents[17]. Further, an observational study of Danish households showed SARS-CoV-2 transmission to 48% of household residents 14 days after the primary case tested positive[18]. Competitive swimming comprises less than 5% of DSF members but accounted for an estimated 39.4% of the three swimming activity categories’ pool activity hours during the period under study. When normalizing to pool activity hours the incidence rate analysis also suggests there was a higher rate of transmission during competitive sw...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.19.21253351
  121. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.17.21253751
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.17.21253751: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Written and informed consent was obtained from all participants.<br>IRB: The protocol was approved by the ethics committee of the Clinical Hospital of Infectious Diseases Cluj-Napoca.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">In total, we present the results for 122 participants, 100 (82%) female.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These healthcare workers had tested subsequently positive for SARS-CoV-2 IgG antibodies before getting vaccinated.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The p-values between various groups were calculated with the ttest_1samp and ttest_ind functions from the SciPy stats package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SciPy</div><div>suggested: (SciPy, RRID:SCR_008058)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plots were created with the Seaborn package of Python. Development of the enzyme-linked immunosorbent (ELISA) assays:</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.17.21253751
  122. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.19.21253328
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.19.21253328: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This kinetic scheme was then converted into a system of ordinary differential equations modeling the rate of change in the concentration of each reaction component as a function of time and the concentrations of the components using Mathematica.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Mathematica</div><div>suggested: (Wolfram Mathematica, RRID:SCR_014448)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mass spectrometry data acquisition and processing were performed using MassLynx software (version 4.1, Waters).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MassLynx</div><div>suggested: (MassLynx , RRID:SCR_014271)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Limit-of-detection analysis for LbuCas13-TtCsm6: For determination of limit of detection using the triplicate data in Fig. 3C, a one-tailed t-test with Welch’s correction was used to compare mean fluorescence fold-change of a positive reaction (with initial point being t = 6 min) to that of the control without RNA target, using GraphPad Prism 9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Custom control of the imaging hardware was implemented in MATLAB (2020a), using Thorlabs drivers and SDK (ThorCam) to control the camera acquisition, and serial communication to an Arduino Bluefruit Feather board to electronically trigger the LED illumination.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MATLAB</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.19.21253328
  123. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.23.21251968
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.23.21251968: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This study has several limitations. First, the data were obtained from routine diagnostic tests and were dependent on hospitals’ test requesting patterns. Second, changes in healthcare-seeking behavior during the pandemic may have influenced the trends observed, but the magnitude and direction of these changes cannot be easily ascertained. Third, age information was unavailable, which means that pediatric-adult differences were crudely inferred from the hospitals’ typical patient population.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.23.21251968
  124. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.16.21253377
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.16.21253377: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">] running Jupyter Notebook 6.0.3, R 3.6.3 and Python 3.7.6.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations: Our study population comes from a single inner-city healthcare institution and therefore needs to be compared with findings from other centres. Our dataset included cases identified by SARS-CoV-2 RNA testing in our laboratory, so some cases diagnosed by external laboratories prior to admission may not be represented unless subsequently testing positive in our laboratory. The impact of differences in testing strategy and capacity during both waves needs further investigation, particularly the impact of the increase in asymptomatic cases in wave two. Finally, the analysis of clinical characteristics in this study was restricted to those recorded on admission to hospital. A follow-up study will include outcome data, when the wave two cohort has completed hospital stay, alongside other unstructured data points such as radiology or genome sequence results in clinical or external reports, to facilitate linkage with national and international research studies.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.16.21253377
  125. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.16.21253405
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.16.21253405: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.16.21253405
  126. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.15.21253596
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.15.21253596: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A limitation of the ontology is that the inclusion of codes and terms in the computable phenotypes is based on a limited number of sites though we obtained feedback from nine large healthcare systems across the United States. Thus, the heterogeneity of coding that we observed is likely to be limited. As we deploy the ontology across all 50 sites in the ACT network, we will solicit feedback and update the ontology iteratively. Another limitation is that new codes for COVID-19 are being continually introduced, especially LOINC codes for new SARS-CoV-2 tests. Therefore, it is critical to keep the ontology updated with the newest codes. We plan to develop and publish new versions of the ontology on a regular basis. Though we primarily developed the COVID-19 ontology for the ACT network, the ontology is has been leveraged by other COVID-19 research groups. In particular, the computable phenotypes that characterize the severity COVID-19 and disease outcomes have be beneficial in standardizing these computable phenotype definitions beyond the ACT network [12]. Since the publication of the ontology, the 4CE, the N3C, and the PCORnet consortia have adapted the ontology for their own use.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.15.21253596
  127. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.20.21253414
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.20.21253414: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the Research Ethics Committee of the University of Campinas (Certificate of Ethical Appreciation Presentation - CAAE 31556920.0.0000.5404), and all subjects signed a consent form to participate.<br>Consent: This study was approved by the Research Ethics Committee of the University of Campinas (Certificate of Ethical Appreciation Presentation - CAAE 31556920.0.0000.5404), and all subjects signed a consent form to participate.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We successively recruited the first 87 responders (who did not require hospitalization and presented a confirmed diagnosis of COVID-19 (by a polymerase chain reaction [PCR] test or confirmed presence of IgM or IgG antibodies) to visit our center and perform the four steps of the complete protocol: a personal structured interview and neurological examination (performed by certified neurologists), 3T MRI acquisition, neuropsychological testing, and blood sample collection at our University Hospital (University of Campinas, Campinas, Brazil).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses: Clinical data were analyzed with SPSS 22.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.20.21253414
  128. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.23.21253258
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.23.21253258: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Patients who denied consent for CTPA, and pregnant or breastfeeding women were excluded from the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Patients who denied consent for CTPA, and pregnant or breastfeeding women were excluded from the study.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A data collection sheet was created in Microsoft Excel where all variables were automatically collected.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis and processing of the data was carried out using the SPSS version 19 statistical package (IBM Corp.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The main limitations of our study are the small sample size, and the lack of generalized study with CTPA in all the admitted COVID patients at hospital. It is possible that our incidence of PE, as in other studies, is probably highly underestimated due to the paucity of CTPA performed for PE during hospitalization, and most of the studies included only critical patients in Intensive Care Unit (ICU). In fact, the risk for VTE in COVID-19 patients is high, particularly in ICU patients. We therefore cannot establish a realistic prevalence for PE in all our COVID patients. Another limitation is the possible bias of patient selection by incorporating only the most severe or expected diagnosis of PE results, but this has been attempted to control by consecutive incorporation of all CTPA performed. A considerable incidence of PE diagnosed by CTPA in SARS-CoV-2 infected patients in our hospital has been observed, despite thrombo-prophylaxis. The infected patients with PE should be examined for assessing myocardial damage.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.23.21253258
  129. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.17.21253290
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.17.21253290: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This is an important limitation of this work. If feasible, we will update this report as more data become available. We intend for these findings to be used to contextualize potential increases in adverse events of special interest (AESI)11 during the COVID-19 vaccine rollout in NH residents. Whereas mortality, hospitalization, and ED visit rates were highly stable over 10 pre-pandemic years, the marked changes in rates observed during 2020 indicate that caution is needed in determining the appropriate baseline to use when interpreting rates of AESIs following the COVID-19 vaccine rollout. Existing investigations on mortality in elderly and frail individuals who received COVID-19 vaccines has identified that mortality rates were consistent with high background rates of death in this population;12 our data will help contextualize Canada- and Ontario-specific rates in a similar way.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.17.21253290
  130. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.17.21253283
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.17.21253283: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We conducted a rapid review based on the proposed methodology guide of the Cochrane Rapid Reviews Methods Group12.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cochrane Rapid Reviews</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The MEDLINE strategy was peer reviewed by another senior information specialist prior to execution using the PRESS Checklist14.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEDLINE</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">& Other Non-Indexed Citations, Embase Classic+Embase</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Embase</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PsycINFO, Cochrane Database of Systematic Reviews and the Cochrane Central Register of Controlled Trials.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PsycINFO</div><div>suggested: (PsycINFO, RRID:SCR_014799)</div></div><div style="margin-bottom:8px"><div>Cochrane Database</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Cochrane Central Register of Controlled Trials</div><div>suggested: (Cochrane Central Register of Controlled Trials, RRID:SCR_006576)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our rapid review had certain limitations. Due to our study design, screening and data extraction were performed by single reviewers. However, we did perform pilot-testing for each review form to optimize consistency between reviewers. Despite our best efforts to identify all relevant studies, it is possible that some were missed. To mitigate this, we searched multiple grey literature sources, including preprint databases, review and trial registries, and several websites.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.17.21253283
  131. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.16.21252974
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.16.21252974: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the Cyprus National Bioethics committee (EEBK 21.1.01.03)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mapping, alignment and lineage assignment: The Burrows-Wheeler Aligner (BWA), version: 0.7.15 was used to map the raw reads to the coronavirus reference genome Wuhan-Hu-1 (NCBI ID:NC_045512.2) [8].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA</div><div>suggested: (BWA, RRID:SCR_010910)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Duplicate reads, which are likely to be the results of PCR bias, were marked using Picard version: 2.6.0 (http://broadinstitute.github.io/picard/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Picard</div><div>suggested: (Picard, RRID:SCR_006525)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samtools, version: 0.1.19, was used for additional BAM/SAM file manipulations [9].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenetic analysis: All phylogenetic analyses were conducted in MEGA7 [13].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGA7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The alignment of consensus sequences was performed using MUSCLE.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MUSCLE</div><div>suggested: (MUSCLE, RRID:SCR_011812)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In addition, jModelTest [14] was used for evaluating the best fitting nucleotide substitution model under BIC yielding the same result (TN93model + gamma distributed rates).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>jModelTest</div><div>suggested: (jModelTest, RRID:SCR_015244)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.16.21252974
  132. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.16.21253652
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.16.21253652: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Comparisons between two groups were made using Mann-Whitney tests and between multiple groups using Kruskal-Wallis tests with Dunn’s correction36–38.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Dunn’s</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All graphing and statistical analyses associated with the described experiments were performed using GraphPad Prism Version 9.0.0</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(GraphPad Software, LaJolla, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      For the workflow described in this study, BRSV seems a reasonable process control for estimating the recovery of SARS-CoV-2 RNA, given the limitations inherent to all process controls.45 The mean recovery of BRSV observed during this study is much lower than the 6.6% recovery reported for electronegative membrane filtration with acidification and MgCl2 amendment reported during a study in Virginia9. However, electronegative membrane filtration methods have demonstrated recoveries ranging from approximately 10% to less than 1% during virus concentration from sewage42. While the BRSV recovery efficiencies in the current study span 2.7 orders of magnitude, the range of SARS-CoV-2 concentration efficiencies, only spanned 1.9 orders of magnitude. Importantly, a statistically meaningful difference was observed in recovery efficiencies for the process control between WWTP A and B. This difference was also observed for the concentration recovery assessment of SARS-CoV-2 RNA. Enveloped viruses, such as SARS-CoV-2, partition favorably to solids43,46,47 and their recoveries from solids can be low46. The partitioning is likely further complicated by the presence of SARS-CoV-2 genetic material in various forms in wastewater, including free RNA and capsid-contained RNA48. In a study of SARS-CoV-2 adsorption to surfaces in solution, electrostatic adhesion correlated with both solution ionic strength and surface chemistry49. Additionally, a physicochemical model suggested specific absorbance...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.16.21253652
  133. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.14.21253532
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.14.21253532: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: All proceedings were approved by the research and ethics committee of the INCMNZ (Ref. 3383) and informed consent was waived due to the nature of the study.<br>Consent: All proceedings were approved by the research and ethics committee of the INCMNZ (Ref. 3383) and informed consent was waived due to the nature of the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This work has certain strengths and limitations. The study analyses a large number of patients in whom EAT thickness was measured at admission and who were followed throughout hospitalization to record COVID-19 relevant outcomes. Furthermore, this work is novel as it assesses the different types of intrathoracic adipose tissue, including EAT, subthoracic and pericardialm in addition to whole-body adipose tissue measures such as BMI. Using mediation analyses, the degree of contribution of EAT in risk of critical disease and mortality was also quantified. Limitations include the use of EAT thickness instead of volume; this was because the CT scans on admission were simple scans in which volume could not be assessed. There were only a small number of recorded cardiovascular events, this means the full impact of EAT on COVID-19 cardiovascular complications could not be evaluated. The results only apply to moderate or severe infection as mild cases were not included dut to the nature of case recruitment. The study was carried out at a single COVID-19 centre, and the findings may not be representative at a population level. Finally, since abdominal CT scans were not available for most patients, the contribution of thoracic vs. abdominal fat could not be assessed, an area which should be evaluated in future studies. In conclusion, EAT thickness was associated with increased risk for critical COVID-19 and mortality compared to other types of intrathoracic adipose tissue. EAT was also...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.14.21253532
  134. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.14.21253039
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.14.21253039: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.14.21253039
  135. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.14.21253537
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.14.21253537: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Furthermore, we noted sample size, study design, patient population, mean/median age, percentage male, percentage famotidine users, and adjusted confounding variables.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Search Strategy: Five databases, namely Ovid Medline, Embase, Cochrane Central Register of Controlled</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Embase</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Risk of Bias Assessment: The Risk Of Bias In Non-randomized Studies – of Interventions (ROBINS-I) tool, developed by the Cochrane Bias Methods Group, was used to assess risk of bias for all observational studies included in this meta-analysis (21).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cochrane Bias</div><div>suggested: (Robot Reviewer, RRID:SCR_018961)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      There are several limitations to this study. First, the strength of our findings is limited by the quality of included studies as is the case for all systematic reviews and meta-analyses. To account for confounding, this meta-analysis contains only observational data that reported adjusted relative risks. Although all the included observational studies had some concern for risk of bias, they employed propensity score matching to minimize selection bias. Additionally, only one study explicitly included patients with COVID-19 treated with famotidine before and during hospitalization (15). Other studies may have included patients who also used famotidine before hospitalization as they may have used as continuation of home use—an assumption made by Freedberg et al. Furthermore, while we employed a random effects model for our analysis, the heterogeneity is high. Lastly, there are subtle yet meaningful differences in the definition of composite outcome across the four studies, thereby allowing for potential bias when calculating aggregate ORs/HRs. Given the paucity of data reported in the literature, the directionality of these results should only be used for hypothesis-generation rather than clinical decision making. In conclusion, this meta-analysis suggests that famotidine does not reduce the risk of mortality in individuals hospitalized with COVID-19. Similarly, there was a point estimate suggesting a decreased risk of the composite outcome of death, intubation, and/or use of ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.14.21253537
  136. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.20.21253397
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.20.21253397: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The Ethics committee of the Hospital Universitario Virgen de Valme approved the study.<br>Consent: All patients gave written informed consent to be entered in the cohort.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 infection diagnosis: A diagnosis of SARS-CoV-2 infection was established if, at least, one of the following criteria were met: 1) SARS-CoV-2 RNA or antigen was detected in nasopharynx exudate by PCR or immunochromatography, respectively; 2) Seroconversion for SARS-CoV-2 antibodies was documented between the baseline (pre-pandemic) and the follow-up (intra-pandemic) samples.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These analyses were carried out using IBM SPSS 25.0 (IBM Corporation) and STATA 12.0 (StataCorp).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This work may have some limitations. First, incidence comparisons were not age nor sex-standardized. PLWH from this cohort are relatively younger, could bear less comorbidities than the general population and includes a higher proportion of males. Nevertheless, the analysis of factors associated with incident SARS-Cov-2 infection did not show the risk of infection varied according to sex or Charlson index, which includes age and comorbidities. Second, the study results are applicable to settings where most patients are under effective antiretroviral therapy, with HIV replication suppression and high CD4 cell counts. The present study conclusions may not be valid for PLWH in advanced or untreated HIV infection. As a counterpart, this was a prospective cohort study, with pre-planned visits and scheduled sera collection, which allows precisely estimating incident SARS-CoV-2 infection and the outcome of COVID-19. Since prospective data on the incidence and risk of SARS-CoV-2 infection in PLWH are lacking [6], the present study fills part of this gap. These are the most important strengths of this study. In summary, the incidence of COVID-19 among PLWH in Seville, Southern Spain after three waves of COVID-19 pandemic was lower to that observed in the general population in the same geographical area. The severity of COVID-19 was similar to that in patients without HIV infection and determined by comorbidities and age. Nevertheless, some HIV-related factors, as historical immunosupp...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.20.21253397
  137. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.17.21253076
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.17.21253076: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.17.21253076
  138. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.17.21253349
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.17.21253349: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics: The study was approved by the Regional Ethics Committee South-East (REK 19864)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Strengths and limitations: We use nation-wide register-based data on both notified COVID-19 and occupation. Because we include all residents of Norway aged 20 to 70 years and utilize routinely registered data, important strengths of our study are limited bias due to selection and misclassification. Important limitations are, first, we were not able to adjust for socioeconomic factors such as income or education, living conditions, urban living, health literacy or risky behavior. We acknowledge that all these factors are relevant for risk of infection and may be associated with persons’ occupation. Second, there may be differences within occupational groups in working contracts, working conditions and tasks. We hypothesize that workers on temporary contracts work more disadvantaged hours and perform tasks with higher risk of infection than others, as well as experience a stronger pressure to come to work even with symptoms of infection. Our data did not include information on whether participants had temporary or permanent position, but we suspect that immigrants more often than others work on temporary contracts. Third, other characteristics of occupations, such as distance to other people and possibility to work from home may (10) be just as relevant as occupations per se. A relatively large proportion of the population, about one in four, was not registered with any work, and excluding these from the reference group did not lead to substantial changes in results. A fourth l...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.17.21253349
  139. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.19.21253924
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.19.21253924: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data Source: We used the Optum de-identified COVID-19 EHR dataset, containing patient-level health records from January 1, 2007 through July 10, 2020, to identify patients tested for SARS-CoV-2 or COVID-19 antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COVID-19</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.19.21253924
  140. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.15.21253567
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.15.21253567: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      22,23 Therefore RT-PCR of sample pooling strategy has its own limitations, it cannot ensure the diagnostic integrity of the individual sample, 24 it can mask the technical errors like insufficient sampling, 19,25 it has higher percentage of false negatives, 10 reduces sensitivity 26 and sample dilution has led to the risk of missing weak viral load or borderline positive samples 17,21 Although pooling of samples facilitates rational use of resources, it might miss individuals who might be positive for COVID-19. 27,28 This information becomes crucial for deciding the pooled strategy testing for disease like COVID −19. In the current pandemic, we simply can’t afford to miss any positive cases. With the high Ro value around 3 for SARS-COV-2, 29 every missed positive case can lead to rapid spread of infection to others.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.15.21253567
  141. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.24.436620
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.24.436620: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Human Sera and monoclonal antibodies: Convalescent sera and sera from BNT162b2 or Moderna-vaccinated individuals were collected on day 28 following the second immunization at the NYU vaccine center with written consent under IRB approval (IRB 20-00595 and IRB 18-02037).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, anti-p24 mAb (AG3.0) and anti-GAPDH mAb (Life Technologies) followed by goat anti-mouse HRP-conjugated second antibody (Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-p24</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-GAPDH</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 spike lentiviral pseudotypes: SARS-CoV-2 spike-pseudotyped lentiviruses were produced by co-transfection of 293T cells with pMDL, pLenti.GFP-NLuc, pcCoV2.S-Δ19 (or variant spikes) and pRSV.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mixture was then added to 1 × 104 ACE2.293T cells, corresponding to an MOI of 0.2 in a 96-well cell culture dish.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2.293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantification and Statistical Analysis: All experiments were performed in technical duplicates or triplicates and data were analyzed using GraphPad Prism 8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">3D view of protein was obtained using PyMOL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.24.436620
  142. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.15.21253549
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.15.21253549: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All of the QC analysis was done using PLINK v1.911.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PLINK</div><div>suggested: (PLINK, RRID:SCR_001757)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      As a simple use-case, we report the changes of impact of the top 25 biomarkers (instead of all 50 due to space limitation) for the first approved UK drug called ‘Dexamethazone’ with its approval date as June 15, 2020 in Figure 3. We can observe that most of the 25 significant factors from the whole dataset still had similar impact after the drug being used, but only 5 features had significant impact before the drug was used. Similarly, we also wanted to assess how the impacts of clinico-genomic features change over different strains of SARS-CoV-2. In the UK, a reportedly more contagious strain named B.1.1.729 started surfacing from early September 2020 and it is estimated that by December 2020, over 60% of new COVID-19 patients had the newer strain. The UKBB also did not collect the virus genome prospectively. So the only way to assess the impact of clinico-genomic biomarkers is through the date when a patient was diagnosed with COVID-19. We divided the whole cohort into three parts: those diagnosed before Aug 31, 2020 (older strain), diagnosed between September 1st, 2020 and December 15, 2020 (both strains) and after December 15, 2020 (newer strain). Figure 4 shows how the effect of the top clinico-genomic features obtained by the global model change over these three cohorts. We can observe that some factors like age, prior DM condition and number of medication are consistent across both strains, while the smoking history (current and present) had larger impact on older stra...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.15.21253549
  143. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.23.21253433
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.23.21253433: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.23.21253433
  144. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.19.21253620
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.19.21253620: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The use of samples was approved by the Bioethics Committee of Universidad San Francisco de Quito (CEISH No. 1234).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">. cDNA MinION library preparation was performed using the Rapid Barcoding kit (SQK-RBK004), native barcoding kit (NB-114) with ligation sequencing kit (LSK-109) following manufacturer instructions and then loaded into a MinION flow cell (FLO-MIN 106).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MinION</div><div>suggested: (MinION, RRID:SCR_017985)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Also, the RAMPART software (v1.0.5) from the ARTIC Network (https://github.com/artic-network/rampart) was used to monitor sequencing in real-time.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RAMPART</div><div>suggested: (Rampart, RRID:SCR_016742)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence quality scoring, demultiplexing and adapter removal was performed with the NanoPlot (13) and Porechop (version 0.2.4) algorithms, respectively (https://github.com/rrwick/Porechop).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Porechop</div><div>suggested: (Porechop, RRID:SCR_016967)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A maximum likelihood phylogenetic reconstruction was performed with GTR substitution model and 1000 bootstrap resampling using IQtree 2.1.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IQtree</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.19.21253620
  145. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.14.21253557
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.14.21253557: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      However, despite all the strengths, there are still certain limitations. The major limitation of the meta-regression is the presence of unknown confounders. Multiple previous studies have reported that gender, age, smoking history, and presence of diabetes influence COVID-19 results. Even though these confounders are reported in most of the included studies, further studies focusing on the adjustment of confounders are necessary. We included studies from the medRxiv.org databases and other preprint database which did not go through peer review at that time. We considered this as a limitation, as peer reviewers could catch more deficiencies in reporting methods and other details. However, it was anticipated that majority of these studies would be peer-reviewed. Third, the use of ACE/ARB has been via medical record review which could be less reliable. Finally, the definition of COVID-19 severity and outcomes were not uniform among the included studies. In conclusion, meta-regression analysis suggest that the use of ACEIs/ARBs in patients with COVID-19 is not associated with increased mortality or increased severity. However, multivariate meta-regression model for mortality indicated that 36% study variation could be due to differences in age, female gender, proportion of heart diseases in the study samples. Similarly, multivariate meta-regression for the severity model exhibited that 8% of study variations could be explained by differences in age, proportion of diabetes, heart ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.14.21253557
  146. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.19.21253680
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.19.21253680: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Recruitment and enrolment: This study was approved by the Ethics committee of the Centro Hospitalar Lisboa Ocidental in compliance with the Declaration of Helsinki and follows international and national guidelines for health data protection.<br>Consent: All participants provided informed consent to take part in the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, coating was 0.5 µg/ml highly purified spike protein [11]; sera were diluted 1/50 in duplicate, 2nd antibodies were horseradish-peroxidase conjugated goat-anti human IgG, IgM, and IgA (Abcam), developed with TMB (BD OptEIA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.19.21253680
  147. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.16.21253371
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.16.21253371: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Our imputation technique was to randomly choose a value within the normal range for each test result, in order to reduce biasing the results.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations: We highlight the fact that the large majority of our cohort did not suffer from any significant side-effects from COVID-19. In fact, the clusters contain over 2300 patients who can be deemed to be ‘non-severe’ (clusters 1 and 3 in baseline K-Modes). This leaves only around 500 patients from whom we can derive more ‘interesting’ clusters and build classification models, leading to classifiers built from very small samples. Upsampling the smaller classes when training our models cannot capture diversity in test samples, so does not appear to be a good solution here. Therefore, our approach, especially when using the clusters found across multiple axes, must be tested on larger datasets. Additionally, although we have extrapolated meaning from the clusters found, we cannot truly know which clustering is ‘best’, or even, ‘good’ since they are found in an unsupervised setting. If clustering is not optimal, our classification will likely also be worse - but this is a hard problem to overcome! A larger and more diverse dataset may also help with our confidence in clustering ability and predictions made. Future Work: This work provides a demonstration of our methodology for exploring heterogeneous disease prognosis. Therefore, potential future work is vast. Predominantly, these techniques need to be tested on a larger dataset, particularly with more patients with severe outcomes. This will likely improve the accuracy of clustering on severe patients, and the ability of c...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.16.21253371
  148. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.17.21253138
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.17.21253138: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants read and signed an informed consent form authorizing the use of their de-identified data for research purposes.<br>IRB: – Plataforma Brasil number CAEE 40122320.8.0000.9433 and were formally reviewed and approved by an external Research Ethics Committee – Centro de Capacitação Física do Exército (reference number 4.459.555, December 13</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">After having applied the exclusion criteria, there remained a total of 6,101 alive participants – 4,004 men (65.6%) and 2,097 women (34.4%), aged 52.2 ± 12.7 years (mean ± standard deviation) at the time of their first evaluation.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Prism software version 8.4.3 (GraphPad, San Diego, US) was used for all statistical calculations.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations: This study has several relevant limitations: 1) The study has a retrospective design and there was a large range in the interval of time between the evaluations and the outcomes, i.e., death, as previously mentioned. While recent clinical data was available for some unhealthy and healthy participants that died, as in those that were attending onsite or remote exercise programs shortly before death, regarding many others, no recent information was available for the current study. However, this situation is similar for both COVID-19 and non-COVID-19 deaths in terms of the number of days elapsed between last evaluation and fatal outcomes (see table 2); 2) For this study, we relied on the information made available on the death certificates and no formal attempt was made to check their accuracy; 3) while this paper is being written (mid-February), the pandemic continues strong and Brazil is reaching new tragic records of 7-day rolling average of COVID-19 deaths/day; thus, we do not know if the findings herein would differ if a longer period of observation is considered; 4) A theoretical and logical possibility was that the participants dying from COVID-19 were more exposed and less “prudent” in regard to the virus infection. Unfortunately, there is no available information about how adherent the participants were to recommended sanitary precautions; however, as far as we could find out from information obtained from spouses, relatives and friends of the participants,...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.17.21253138
  149. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.19.21253429
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.19.21253429: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">The model also adjusted for sex, non-linear effect of age, percentage of urban settlement, population size, population density in the pincode, subdistrict-level solid-fuel use (as a measure of rural residence and lower socioeconomic status), female illiteracy, and language (as a proxy for geographic regions).</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Population tested: We included 448,518 people of all ages who underwent testing for SARS-CoV-2 antibodies between June 12, 2020 and December 31, 2020 by Thyrocare Laboratories.12 Thyrocare conducts central laboratory testing in Navi Mumbai from over 2200 franchised collection centers in all major cities in India.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 IgG serological assays: The SARS-CoV-2 antibody assays involved collection of 3 ml of serum, shipment overnight to Navi Mumbai, and central high-throughput analyses using one or both of two widely-used assays that detect antibodies to the SARS-Cov-2 nucleocapsid protein: the Abbott SARS-CoV-2 chemiluminescent microparticle immunoassay for IgG (positive cutoff: >=1.40),14 and the Cobas, Roche Elecsys Anti-SARS-CoV-2 electrochemiluminescence immunoassay for total immunoglobulin (most of which is IgG; positive cutoff: >=1.0).15 For both assays, the laboratory followed the manufacturers’ quality control procedures.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>total immunoglobulin</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 IgG serological assays: The SARS-CoV-2 antibody assays involved collection of 3 ml of serum, shipment overnight to Navi Mumbai, and central high-throughput analyses using one or both of two widely-used assays that detect antibodies to the SARS-Cov-2 nucleocapsid protein: the Abbott SARS-CoV-2 chemiluminescent microparticle immunoassay for IgG (positive cutoff: >=1.40),14 and the Cobas, Roche Elecsys Anti-SARS-CoV-2 electrochemiluminescence immunoassay for total immunoglobulin (most of which is IgG; positive cutoff: >=1.0).15 For both assays, the laboratory followed the manufacturers’ quality control procedures.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Nonetheless, the study has some limitations. First, we could not provide reliable estimates of COVID infection or mortality in rural areas, where most of India’s 10 million annual deaths occur.4 In rural areas, SARS-CoV-2 infection and deaths might already be substantial. The Registrar General of India needs to re-start its Million Death Study,4,37 a mortality surveillance that provides cause of death information in over 8000 randomly-selected villages and urban blocks, as only maternal death data have been published after 2013. Repeat properly-representative large serosurveys that avoid some of the sampling limitations of current surveys29 are needed to monitor changes in natural and vaccine-induced immunity. Second, we had to rely on published estimates of IFR from three cities in Western India. IFRs may well vary by city and on variables such as background rates of obesity and other risk factors which are not well understood.5 The mortality-derived seroprevalence, while crude, is transparent and can be updated with improved IFR estimates.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.19.21253429
  150. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.22.436375
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.22.436375: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Immunization of mice: For immunogenicity studies, 6-week-old female B6C3F1 mice (SLC, Japan) were randomly assigned into experimental groups (n = 6).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Bioluminescence imaging: For bioluminescence imaging studies, 6-week-old female Balb/c nude or C57BL/6N mice (SLC, Japan) were used.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The primary and secondary antibodies were SARS-CoV-2-S1 (Novus, Centennial, CO, USA), beta-actin (Cell signaling, Danvers, MA, USA) and anti-rabbit (Invitrogen, Thermo Scientific, Waltham, MA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>beta-actin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antigen-specific antibody titer was determined by end-point dilution ELISA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antigen-specific</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound antibodies were detected with HRP-conjugated goat anti-mouse total IgG antibody (Jackson, PA, USA) diluted 1:5000 for 1 hour at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse total IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture and mRNA transfection: HEK-293T cell was obtained from ATCC (Manasass, VA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">EG-COVID 001, 002, 003 and 004 (10 ug mRNA containg complex each) were introduced into 293T cells by 18 hour incubation in OPTi-MEM (Thermo Scientific, MA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero cells were seeded at 8 × 105 cells/well in 6 well plates and cultured overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bioluminescence imaging: For bioluminescence imaging studies, 6-week-old female Balb/c nude or C57BL/6N mice (SLC, Japan) were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Balb/c nude</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>C57BL/6N</div><div>suggested: RRID:MGI:5825016)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunization of mice: For immunogenicity studies, 6-week-old female B6C3F1 mice (SLC, Japan) were randomly assigned into experimental groups (n = 6).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B6C3F1</div><div>suggested: RRID:IMSR_JAX:100010)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 28. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.22.436375
  151. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.22.436522
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.22.436522: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: All work with SARS-CoV-2 was conducted in Biosafety Level-3 conditions either at the University of California San Diego or at the Eva J Pell Laboratory, The Pennsylvania State University, following the guidelines approved by the Institutional Biosafety Committees.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Plaque assays were performed and counted by a blinded experimenter.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies used were, anti-Spike antibody [1A9] (GeneTex, GTX632604), anti-Nucleocapsid antibody (GeneTex, GTX135357), Anti-HS (Clone F58-10E4) (Fisher Scientific, NC1183789), and 3G10 (BioLegend, 4355S).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Spike</div><div>suggested: (GeneTex Cat# GTX632604, RRID:AB_2864418)</div></div><div style="margin-bottom:8px"><div>GTX632604</div><div>suggested: (GeneTex Cat# GTX632604, RRID:AB_2864418)</div></div><div style="margin-bottom:8px"><div>anti-Nucleocapsid</div><div>suggested: (GeneTex Cat# GTX135357, RRID:AB_2868464)</div></div><div style="margin-bottom:8px"><div>GTX135357</div><div>suggested: (GeneTex Cat# GTX135357, RRID:AB_2868464)</div></div><div style="margin-bottom:8px"><div>Anti-HS</div><div>suggested: (US Biological Cat# H1890, RRID:AB_10013601)</div></div><div style="margin-bottom:8px"><div>NC1183789</div><div>suggested: (AMSBIO Cat# 370255-1, RRID:AB_10891554)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies were, Anti-His-HRP (Genscript, A00612), Avidin-HRP (Biolegend, 339902), and Streptavadin-Cy5 (Thermo Fisher, SA1011)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-His-HRP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A00612</div><div>suggested: (GenScript Cat# A00612, RRID:AB_915573)</div></div><div style="margin-bottom:8px"><div>Avidin-HRP</div><div>suggested: (Thermo Fisher Scientific Cat# ICN55898, RRID:AB_2334691)</div></div><div style="margin-bottom:8px"><div>SA1011</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 2 hr at 37°C, the inoculum was removed and cells were refed with DMEM supplemented with 10% FBS, 50 U/mL penicillin, 50 µg/mL streptomycin, and VSV-G antibody (I1, mouse hybridoma supernatant from CRL-2700; ATCC)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VSV-G</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>I1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunofluorescence imaging and analysis: Formaldehyde fixed cells were washed with PBS and permeabilized for immunofluorescence using BD Cytofix/Cytoperm according to the manufacturers protocol for fixed cells and stained for SARS-CoV-2 with a primary anti-Nucleocapsid antibody (GeneTex GTX135357) followed by a secondary Goat anti Rabbit AF594 antibody (ThermoFisher A-11037) and nuclei stained with Sytox Green.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti Rabbit AF594</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell Culture: Huh-7.5 cells 1 were generously provided by Charles M.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7.5</div><div>suggested: RRID:CVCL_7927)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Hep3B, BHK-15 and Calu-3 cells were from ATCC and were grown in DMEM medium containing 10% % fetal bovine serum, and 100 IU/ml of penicillin, 100 µg/ml of streptomycin sulfate and nonessential amino acids.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: KCLB Cat# 30055, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Hep3B, A375 and Vero E6 cells were from ATCC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A375</div><div>suggested: CLS Cat# 300110/p852_A-375, RRID:CVCL_0132)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293T, transfected to express full length SARS-CoV-2 spike proteins, were inoculated with VSV-G pseudotyped ΔG-luciferase or GFP VSV (Kerafast, MA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flavivirus and alphavirus infection: Sindbis virus (SINV) with mCherry-tagged NSP3 was propagated on BHK-15 cells 11.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-15</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Methods for human bronchial epithelial cell ALI generation and infection: Virus plaque assays: Confluent monolayers of Vero E6 or Hep3B cells were infected with SARS-CoV-2 at an MOI of 0.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Hep3B</div><div>suggested: RRID:CVCL_XE51)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Relative expression of SARS-CoV-2 Spike RNA was calculated by delta-delta-Ct by first normalizing to the housekeeping gene RPLP0 and then comparing to SARS-CoV-2 infected Vero E6 cells that were untreated (reference control).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 spike RBD protein production: Recombinant SARS-CoV-2 RBD (GenBank:</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GenBank</div><div>suggested: (GenBank, RRID:SCR_002760)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were washed twice and then analyzed using a FACSCalibur or a FACSCanto instrument (BD Bioscience).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FACSCalibur</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis was performed using FlowJo software and statistical analyses were done in Prism 8 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The trypsin supernatants were saved for GAG analysis, and the cell pellets were washed in complete media, followed by a PBS wash, and saved for BCA analysis (Pierce™ BCA Protein Assay Kit, Themo Fisher), according to vendor specifications.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GAG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RNA sequencing data analysis: A computational pipeline was written calling scripts from the CGAT toolkit to analyse the RNA sequencing data (https://github.com/cgat-developers/cgat-flow) 4,5.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CGAT</div><div>suggested: (CGAT, RRID:SCR_005550)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, FASTQ files were generated and assessed for quality using FASTQC, aligned to GRCh38 (hg38) and then aligned to the transcriptome using hisat2 v2.1.0 6.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FASTQC</div><div>suggested: (FastQC, RRID:SCR_014583)</div></div><div style="margin-bottom:8px"><div>hisat2</div><div>suggested: (HISAT2, RRID:SCR_015530)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differential gene expression analysis was performed using DESeq2 using treatment and time as factors in the model.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunofluorescence imaging and analysis: Formaldehyde fixed cells were washed with PBS and permeabilized for immunofluorescence using BD Cytofix/Cytoperm according to the manufacturers protocol for fixed cells and stained for SARS-CoV-2 with a primary anti-Nucleocapsid antibody (GeneTex GTX135357) followed by a secondary Goat anti Rabbit AF594 antibody (ThermoFisher A-11037) and nuclei stained with Sytox Green.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Cytofix/Cytoperm</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For images acquired with the Nikon Ti2, images were analysed using the Fiji distribution of ImageJ (PMID 22743772) and the DeepLearning plugin StarDist (Schmidt et al, 2012 – see below) as follows.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Proline distribution analysis: Protein amino acid sequences were downloaded from UniProtKB 13.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UniProtKB</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All plots were generated in ggplot2 18.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.22.436522
  152. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.18.21253633
    1
    1. sciscore 26 Mar 2021

      SciScore for 10.1101/2021.03.18.21253633: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Participants were provided with information about the study and provided written informed consent prior to enrolment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Study design and participants: In March 2020, PHE initiated a prospective cohort study (ESCAPE) of PHE and National Health Service (NHS) healthcare workers to collect monthly blood samples for SARS-CoV-2 antibodies at multiple sites in England (PHE London, PHE Porton Down, PHE Manchester, NHS Manchester Royal Infirmary and NHS Wythenshawe Hospital).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">12 In brief, blood samples were tested using five different assays for Nucleoprotein (Roche N and Abbott) and for Spike (EUROIMMUN, Roche S, and an in-house assay named RBD) antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data management and statistical analyses: Data were managed using Microsoft Access (Microsoft Corporation, Redmond, Washington) and analysed using Stata 15.1 (StataCorp LLC, College Station, Texas).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A major limitation with all such studies, as highlighted by our study, is the lack of a control group to allow attribution of specific symptoms to long COVID. This is exemplified by reported long COVID symptoms such as headache (44%) and hair loss (25%) which were among the top five prevailing symptoms in a systematic review of long COVID.5 In our cohort, hair loss was much rarer and not significantly different among cases and controls (9.3% vs 7.4%, respectively), while headache was comparably common (46% cases vs.47 % controls). One US study surveyed 357 COVID-19 cases (9 of whom were hospitalised, 2.5%), 5,497 SARS-CoV-2 negative controls, and 19,095 non-tested individuals and found that 42.3% of cases had at least one persisting symptom at 30 days compared to 13.3% and 8.6%, respectively, with 14.8% still have at least one symptom after 90 days.9 This survey found a higher risk of persistent symptoms in those who were initially more ill. The most significant persisting symptoms in those with COVID-19 were anosmia, ageusia, difficulty concentrating, dyspnoea, memory loss, confusion, chest pain, and pain with deep breaths.9 The findings are similar to our cohort. Interestingly, while 14% of those with COVID-19 in our cohort reported on-going symptoms after 6 months, most of their symptoms were non-specific and those with more typical persisting symptoms associated COVID-19 such as anosmia or ageusia did not consider them persistent symptoms associated with their initial COV...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.18.21253633
  153. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.22.436405
    1
    1. sciscore 25 Mar 2021

      SciScore for 10.1101/2021.03.22.436405: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analysis was performed by SPSS version 24.0 software (SPSS Inc., Chicago, IL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The following limitations are acknowledged. First, the number of participants in the study was relatively small. Second, the population was not heterogeneous (composed by 28 males and only 2 females). Thus, considering that metabolic thresholds are influenced by phenotypical sex differences [44], further research should investigate the RQA of HRV time series separately in males and females. In addition, future physiological exercise studies should assess if the findings of the present work could be adopted in particular field tests which do not necessarily require the use of a cycle-ergometer.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
      • No funding statement was detected.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.22.436405
  154. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.22.21254026
    1
    1. sciscore 25 Mar 2021

      SciScore for 10.1101/2021.03.22.21254026: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In August 2020, a REDCap survey was disseminated to Survivor Corps group members on Facebook and in other online COVID-19 groups.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To focus on the experiences of people with PASC, the data analyzed were further limited to respondents who had experienced symptoms for longer than 21 days.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PASC</div><div>suggested: (PASC , RRID:SCR_016642)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.22.21254026
  155. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.23.436637
    1
    1. sciscore 25 Mar 2021

      SciScore for 10.1101/2021.03.23.436637: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.23.436637
  156. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.23.436642
    1
    1. sciscore 25 Mar 2021

      SciScore for 10.1101/2021.03.23.436642: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study protocol was approved by the Cantonal Ethics Committee of Ticino, Switzerland (CE-TI-3428, 2018-02166).<br>Consent: All blood donors provided written informed consent for participation in the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, cells were stained with PE/Cy7-Streptavidin (cat. no. 405206) from BioLegend, and with the following fluorochrome-labeled mouse monoclonal antibodies: CD8-PE-Cy5 (clone B9.11; cat. no. A07758), CD56-PE/Cy5 (clone N901; cat. no. A07789) from Beckman Coulter, CD25-PE (clone M-A251; cat. no. 555432) from BD Biosciences,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD25-PE</div><div>suggested: (BD Biosciences Cat# 555432, RRID:AB_395826)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To determine HLA restriction, T cell clones were stimulated with autologous APCs pulsed with SARS-CoV-2 Spike peptides, in the absence or presence of blocking anti-class II monoclonal antibodies produced in house from hybridoma cell lines (anti-HLA-DR, clone L243 from ATCC, cat. no. HB-55; anti-HLA-DQ, clone SPVL3 (27); anti-HLA-DP, clone B7/21 (28), anti-pan-MHC-class-II, clone IVA12 from ATCC, cat. no. HB-145).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-class II</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-HLA-DR</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-HLA-DQ</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-HLA-DP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-pan-MHC-class-II</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Conservation analysis: Accession numbers of Spike protein sequences used for S346-365 conservation analysis are: SARS-CoV-2 Wuhan-Hu-1/2019 (GenBank: NC_045512.2) ; SARS-CoV-2 B.1.1.7 (GISAID: EPI_ISL_700654); SARS-CoV-2 B.1.351 (GISAID: EPI_ISL_700492); SARS-CoV-2 P.1 (GISAID: EPI_ISL_833137); Bat-CoV-RaTG13 (GenBank: QHR63300.2); GD Pangolin (GISAID: EPI_ISL_410721; 471470; 471469; 471468;</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Conservation</div><div>suggested: (Conservation, RRID:SCR_016064)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bat CoV WIV1 (GenBank:</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GenBank</div><div>suggested: (GenBank, RRID:SCR_002760)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analyses were performed using GraphPad Prism 8 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.23.436642
  157. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.23.436573
    1
    1. sciscore 25 Mar 2021

      SciScore for 10.1101/2021.03.23.436573: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Human subjects: The Institutional Review Boards of Osaka University (approval number 898-4) and National Institute of Infectious Diseases<br>Consent: Written informed consent was obtained from all participants or designated healthcare surrogates if participants were unable to provide informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">5 × 105 PBMCs were stimulated in the same medium with inactivated SARS-CoV-2, 1 or 10 μg/ml of recombinant S protein, 1 μg/ml of S peptide pool or 1 μg/ml of M + N (MN) peptide pool for 20 hours, followed by staining with anti-human CD3, CD69, CD137, CD154 and TotalSeq-C Hashtags antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human CD3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD69</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD137</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then stained with biotin-conjugated anti-PE antibody together with antibodies for surface markers for flow cytometric analysis using AttuneNxT (Thermo Fisher Scientific) and FlowJo 10.5.2 (BD Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-PE</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">), anti-mouse CD3 (17A2), anti-mouse CD69 (H1.2F3), anti-rat CD2 (OX-34) and biotin anti-phycoerythrin (PE)(PE001) antibodies were purchased from BioLegend.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse CD3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse CD69</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rat CD2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-phycoerythrin (PE)</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>PE001</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasma diluted at 1:5 followed by two-fold serial dilutions was incubated with equal volume of solution containing 100 TCID50 of SARS-CoV-2 for 1 hour at 37°C and added to VeroE6/TMPRSS2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6/TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the expression of S proteins of SARS-CoV-2 and HCoV-OC43, pME18S expression vectors for each protein were transfected into HEK293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.0 (The PyMOL Molecular Graphics System, Version 2.0 Schrödinger, LLC.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Hashtag oligo demultiplexing was performed on CLR-normalized hashtag UMI counts, and clonotypes were matched to the gene expression data through their droplet barcodes, using Python scripts.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Two vectors containing paired TCRα and β chains were transfected together into Phoenix packaging cells using PEI MAX (Polysciences)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phoenix</div><div>suggested: (Phoenix, RRID:SCR_003163)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then stained with biotin-conjugated anti-PE antibody together with antibodies for surface markers for flow cytometric analysis using AttuneNxT (Thermo Fisher Scientific) and FlowJo 10.5.2 (BD Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After initial phase determination, the model buildings were manually performed using program COOT (Emsley et al., 2010).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The stereochemical quality of the final model was assessed by program MolProbity (Williams et al., 2018).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MolProbity</div><div>suggested: (MolProbity, RRID:SCR_014226)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analysis was performed with t-test using SciPy and p-values were indicated in Figure 3A and 4D.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SciPy</div><div>suggested: (SciPy, RRID:SCR_008058)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The current study still has several limitations. 1) We analyzed only PBMCs. Although circulating Tfh cells in the periphery can reflect Tfh cells in germinal center (Crotty, 2019; Heit et al., 2017; Hill et al., 2019; Locci et al., 2013; Schmitt et al., 2014), the analysis of tissue resident Tfh cells of biopsy samples is ideal to fully characterize Tfh clonotype. 2) Although the present study suggests that these Tfh clonotypes contribute to amelioration of COVID-19 in patients recovered from mild symptoms, additional studies on patients with severe symptoms are helpful for further aspects. 3) The restricting HLA of the public clonotypes expanded in the patients were DRA-DRB1*15:01 (8.8%), DRA-DRB1*15:02 (2.5%), DRA-DRB1*15:03 (2.0%), DRA-DRB1*15:04 (0.02%), DRA-DRB4*01:03 (33.9% in local)(González-Quezada et al., 2019), DPA1*01:03 (60.7%)-DPB1*04:02 (16.5%), and DPA1*02:02 (24.7%)-DPB1*05:01 (14.8%), which cover a large part of, but not all, population worldwide (Gonzalez-Galarza et al., 2020). Notwithstanding, the current study proposes that combination of single cell paired TCR sequencing and public database is a potent tool to identify public clonotypes which actually responded to SARS-CoV-2 in patients. The rapid reconstitution and determination platform enables us to identify epitopes and responsible HLA simultaneously. As the identified T cell epitopes are conserved among emerging SARS-CoV-2 mutants (Elbe and Buckland-Merrett, 2017; Singer et al., 2020) (Figure 3C), th...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 59 and 55. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.23.436573
  158. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.23.436613
    1
    1. sciscore 25 Mar 2021

      SciScore for 10.1101/2021.03.23.436613: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody residues that are within 6 Å of the RBD are selected and fed to residue scanning in MOE, Rosetta, TopNetTree, and SAAMBE3D.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAAMBE3D</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.23.436613
  159. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.18.21253874
    1
    1. sciscore 25 Mar 2021

      SciScore for 10.1101/2021.03.18.21253874: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical review: The Medical Ethics Review Committee (METC) Utrecht concluded that ethics approval was not required because the study is outside the scope of the Dutch Medical Research Involving Human Subjects Act (protocol number: 20/750).<br>Consent: All participants signed an informed consent form prior to any study procedure.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Both Ag-RDT were applied according to manufacturer instructions with one exception: BD results were determined visually instead of using a BD Veritor Plus Analyzer. Interpretation of Ag-RDTs was always done prior to (thus blinded for) RT-PCR.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">We based our sample size calculation on an expected sensitivity of 80%, with a margin of error of 7%, type I error of 5% and power of 90%.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">At the Erasmus MC Viroscience diagnostic laboratory, samples of participants with a positive RT-PCR test result were cultured for seven days, and, once cytopathic effects (CPE) were visible, the presence of SARS-CoV-2 was confirmed with immunofluorescent detection of SARS-CoV-2 nucleocapsid protein (Rabbit polyclonal antibody, Sino Biological inc.), Eschborn, Germany) (Supplementary Material 2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 nucleocapsid protein</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our study also has some potential limitations. First, although we aimed to sample pre-/asymptomatic individuals at five days after exposure to an index case, 12% was sampled before the fifth day since last contact. It is known that the accuracy of the RT-PCR reference test is not yet optimal before the fifth day after contact with an index case 6. Interestingly though, our stratified analysis indicated that the RT-PCR positivity fraction was actually higher in close contacts who were sampled before the fifth day since last contact. We hypothesize that some of these individuals have had prolonged contact with the index case, for example because they live in the same household. Close contacts living in the same household on average test more often positive compared to non-household close contacts (20% vs. 10%) 16. This would also explain why these close contacts reported to have contact with the index case less than 5 days ago, as the last contact with an infected household member could be the same day of testing. A second limitation is that virus culture was only available in one of the two central laboratories. Hence, the assumed infectiousness viral load cut-off was extrapolated to the second laboratory. Reassuringly, the RT-PCR calibration curves of both laboratories indicated that Ct values corresponded to similar viral loads in both laboratories. A correlation between infectivity in culture and viral load of the specimen as well as negative associations between lower vira...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.18.21253874
  160. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.22.436481
    1
    1. sciscore 25 Mar 2021

      SciScore for 10.1101/2021.03.22.436481: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2 Pseudovirus Neutralization Assay: PSV was generated in 293T cells by co-transfection of pFC37K-CMV-S, an enhanced expression plasmid encoding for codon-optimized full-length SARS-CoV-2 S with the N-term HiBit tag removed, and pNL4-3.luc.R-E-mCherry-luciferase, an envelope deficient HIV-1 dual reporter construct that was cloned by recombination of the pNL.luc.R-E-plasmid (NIH AIDS Reagent Program) and the fully infectious pNL4-3 mCherry luciferase plasmid (Addgene) [24, 25].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For neutralization assays 104 293T-hACE2 cells were plated in 100uL media per well in 96 well white-wall white-bottom plates (Perkin Elmer) and incubated overnight at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-hACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">([Agonist] vs. response---variable slope-four parameters), and the Area Under Curve (AUC) were calculated using GraphPad Prism 9.0.2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.22.436481
  161. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.23.436611
    1
    1. sciscore 25 Mar 2021

      SciScore for 10.1101/2021.03.23.436611: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All cell lines were periodically tested negative for mycoplasma contamination prior to use in experiments.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: Lenti-X 293T cells (human embryonic kidney cells), A549 cells (Human alveolar basal epithelial carcinoma), and Vero E6 cells (African green monkey kidney cells) were maintained in Dulbecco Modified Eagle Medium (DMEM; Invitrogen Life Technologies) supplemented with 10% heat-inactivated fetal bovine serum (FBS) and 1% penicillin/streptomycin (P/S) and 1% GlutaMAX (Life Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Lenti-X 293T</div><div>suggested: ATCC Cat# CRL-11270, RRID:CVCL_4401)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viruses titer was ascertained by plaque assays in Vero E6 cells and expressed as PFU per ml.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T cells stably expressing ACE2 were seeded at 9×106 cells per T150 flask (3 flasks per condition) and inoculated with SARS-CoV-2 at a multiplicity of infection (MOI) of 0.001 or mock-treated.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549 cells stably expressing ACE2 were seeded in 24-well plate format (viral infection) or a 96-well plate (viability) and then were reverse transfected in duplicate with 30 nM of siRNA using the Lipofectamine RNAiMAX reagent (Invitrogen) according to manufacturer’s instruction.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell populations were sorted based on GFP expression with a BD FACSAria II (Becton Dickinson) with FACSDiva 6.1.2 software (Becton</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FACSDiva</div><div>suggested: (BD FACSDiva Software, RRID:SCR_001456)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Acquisition was performed on an Attune NxT Flow Cytometer (Thermo Fisher Scientific) and analysis was done by using FlowJo software (Tree Star) Comprehensive identification of RNA binding proteins by mass spectrometry: ChIRP-M/S was performed as previously described by Ooi and colleagues (Ooi et al., 2019).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">They were displayed together with the interacting-coronavirus proteins as an interaction network using Cytoscape (Shannon et al., 2003).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cytoscape</div><div>suggested: (Cytoscape, RRID:SCR_003032)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This list of new interactors was analyzed with the Functional Annotation Tool of the online knowledge base DAVID Bioinformatics Resources 6.8, NIAID/NIH (Dennis et al., 2003) to identify statistical enrichments in KEGG pathway annotations (Kanehisa and Goto, 2000)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.23.436611
  162. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.22.436476
    1
    1. sciscore 25 Mar 2021

      SciScore for 10.1101/2021.03.22.436476: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.22.436476
  163. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.23.436564
    1
    1. sciscore 25 Mar 2021

      SciScore for 10.1101/2021.03.23.436564: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nsp8 was probed with mouse monoclonal anti-nsp8 (5A10) from GeneTex (GTX632696), and HRP-conjugated rabbit anti-mouse secondary (Agilent Dako), washing 3X in PBS.T between each antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-nsp8</div><div>suggested: (Acris Antibodies GmbH Cat# AP09089SU-N, RRID:AB_2035808)</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV cofactor protein nsp10 was expressed under the control of a Tet-promoter in a pASK vector in E. coli NEB Express C2523 cells (New England Biolabs) carrying the pRare2LacI (Novagen) plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C2523</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV nsp14 was expressed from a pDEST14 vector in E. coli strain NEB Express C2566 cells (New England Biolabs) carrying the pRare2, in the presence of Ampicillin (100 μM/mL) and Chloramphenicol (17 μg/mL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C2566</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nsp8 was probed with mouse monoclonal anti-nsp8 (5A10) from GeneTex (GTX632696), and HRP-conjugated rabbit anti-mouse secondary (Agilent Dako), washing 3X in PBS.T between each antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Agilent Dako</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All movies were automatically recorded using SerialEM (Mastronarde, 2005) at a magnification of 105K, with a physical pixel size of 0.83 Å.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SerialEM</div><div>suggested: (SerialEM, RRID:SCR_017293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CTF estimation, 2D classification, 3D classification and refinements were all performed in cryoSPARC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The model was manually built in Coot (Emsley et al., 2010) with the guidance of the Cryo-EM map, and in combination with real space refinement using Phenix (Afonine et al., 2018).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 33. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.23.436564
  164. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.11.21253231
    1
    1. sciscore 25 Mar 2021

      SciScore for 10.1101/2021.03.11.21253231: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bioinformatic Analysis of SARS-CoV-2 genomes: Miseq read data was trimmed for adapters and low quality sequence using BBduk v38.79 (https://sourceforge.net/projects/bbmap/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Miseq</div><div>suggested: (A5-miseq, RRID:SCR_012148)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nucleotide alignments were performed with Muscle23 followed by trimming of ambiguous/under-represented sequence at the 5’/3’ ends of the alignment in Geneious.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Geneious</div><div>suggested: (Geneious, RRID:SCR_010519)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.11.21253231
  165. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.22.436379
    1
    1. sciscore 25 Mar 2021

      SciScore for 10.1101/2021.03.22.436379: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Both the double-transduced pool and the cloned cell lines were analyzed with SDS-PAGE using an anti-V5 antibody (#MA5-15253, Invitrogen) for TMPRSS2 and an anti-ACE2-antibody (#15983, Cell Signaling Technology).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-V5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-ACE2-antibody ( #15983 , Cell Signaling Technology) .</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The viral vectors were generated by transfecting HEK293T cells using polyethylenimine with the packaging vector pCMV-dR8.91 and the vesicular stomatitis virus (VSV-G) envelope expression vector pMD2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Another human lung epithelial cell line Calu-3 and human colorectal adenocarcinoma cell line Caco-2 were kept in Minimum Essential Medium Eagle (MEM) supplemented with 20% FCS, 1% L-Glutamine, 1% penicillin/streptomycin, and 1% MEM Non-essential Amino acid Solution (100X).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VeroE6-TMPRSS2 cells (ATCC® CRL-1586) were maintained in MEM supplemented with 10% FCS, 1% L-Glutamine and 1% penicillin/streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 virus isolates (wild type, B.1.1.7, and B.1.351), obtained from nasopharyngeal swabs of patients (Cantuti-Castelvetri et al., 2020; Virtanen et al., 2021) (MOI 0.05), were incubated with Calu-1 cells in 48-well plates (40.000 cells/well) for 1 h at 37°C and 5% CO2, after which virus inoculum was removed and cells were washed twice with PBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This compound also failed to change the viral infection in ACE2/TMPRSS2-expressing HEK cells after 24 h of treatment (Fig. 4f).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Slight reduction of cell viability was observed in infected HEK293T-ACE2-TMPRSS2 cells after fluoxetine, clomipramine, chlorpromazine, pimozide, and reboxetine treatment (Fig.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2-TMPRSS2</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.22.436379
  166. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.20.21252680
    1
    1. sciscore 25 Mar 2021

      SciScore for 10.1101/2021.03.20.21252680: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We analyzed raw sequences through a DADA2 pipeline [23] and assigned taxonomy to amplicon sequence variants (ASVs) using Silva SSU version 138 [24].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Silva</div><div>suggested: (SILVA, RRID:SCR_006423)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We performed standard nucleotide REFSEQ BLAST searches of ASV reference sequences using the National Center for Biotechnology Information’s Bacteria and Archaea 16S ribosomal RNA project database [26].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We calculated nasopharyngeal microbiome alpha (Shannon and Chao1 indices) and beta diversity (Bray-Curtis dissimilarity) using the phyloseq R package [27].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>phyloseq</div><div>suggested: (phyloseq, RRID:SCR_013080)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We then evaluated the association between age and nasopharyngeal microbiome composition with PERMANOVA using the adonis function within the vegan R package [28].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>vegan</div><div>suggested: (vegan, RRID:SCR_011950)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses conducted in ANCOM-II and DESeq2 were limited to ASVs present in at least 5% of samples and adjusted for the false discovery rate using the Benjamini-Hochberg procedure.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were performed using R version 4.0.3 [31] and all visualizations were created using the ggplot2 R package [32]</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our study had several limitations. First, nasopharyngeal samples were collected at a single time point, and we did not have nasopharyngeal samples prior to infection in SARS-CoV-2-infected participants. Therefore, we were unable to determine if the differences in nasopharyngeal microbiome composition observed by SARS-CoV-2 infection status preceded, or were the consequence of, SARS-CoV-2 infection. Secondly, all of the SARS-CoV-2-infected study participants had relatively mild symptoms, and no study participants required antiviral treatment or hospitalization. We therefore were unable to evaluate if the microbiome features that we identified as being associated with SARS-CoV-2 respiratory symptoms are additionally associated with severe COVID-19. In addition, our use of 16S rRNA gene amplicon sequencing prevented us from evaluating other components of the upper respiratory microbiome, including viruses and fungi. Additionally, 16S rRNA gene amplicon experiments have several well-documented biases [63], although we sought to minimize these biases in our study through inclusion of all samples in a single processing run and use of appropriate negative controls. Finally, although analyses adjusted for age in evaluating associations between the nasopharyngeal microbiome and SARS-CoV-2 susceptibility and illness severity, residual confounding by unmeasured factors remains possible. In conclusion, we found that age-associated changes in the nasopharyngeal microbiome are independentl...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.20.21252680
  167. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.21.21253978
    1
    1. sciscore 25 Mar 2021

      SciScore for 10.1101/2021.03.21.21253978: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Variants were called using the Annotate and Predict Find Variations/SNPs in Geneious and verified by using the V-PIPE SARS-CoV-2 application (https://cbg-ethz.github.io/V-pipe/sars-cov-2/)(28).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Geneious</div><div>suggested: (Geneious, RRID:SCR_010519)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A caveat with our approach, however, is that we cannot conclusively identify the presence of a Variant of Concern since our sequencing assay targets only a region of the receptor binding domain, and some significant mutations are outside the sequenced region. Furthermore, additional mutations occurring in the primer binding region may allow some mutations to go undetected because their DNA could not be amplified. We are expanding our targeted sequencing approach to include additional regions of interest to minimize the chance of missing important variants. Additionally, we intend to generate cDNA with random hexamers, and to incorporate a level of degeneracy in the sequencing primers to increase the breadth of our targeted sequencing. Our most recent data from March 14th suggests a slight decrease in the prevalence of the E484K variant, but we cannot draw firm conclusions due to the nature of our sequencing assay, which relies on the collective sequencing of a large pool of individuals. Nevertheless, our frequency data agrees with that recently observed in human clinical samples from NYC (23, 24, 27). We intend to supplement our targeted sequencing approach with whole genome amplicon sequencing in the future. We believe that our approach offers a viable alternative to whole genome sequencing for the detection of known variants and can be rapidly deployed to detect additional emerging variants of concern. Importantly as a cost saving measure, labs can generate the libraries th...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.21.21253978
  168. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.21.21254064
    1
    1. sciscore 25 Mar 2021

      SciScore for 10.1101/2021.03.21.21254064: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our study has a number of limitations that should be borne in mind. First, this is a comparative case study, which is inherently limited to a degree due to the complexity of the variation in mitigation measures at all levels between them. We believe, however, that the comparisons are strong enough to support the inferences drawn here concerning the importance of school mitigation strategies in limiting COVID-19 transmission. This is especially because COVID-19 incidence is likely underestimated in children, especially at younger ages, in part because milder illness and a higher fraction of asymptomatic infections are associated with decreased testing and case finding (Fisman et al., 2021). The second study limitation is that, since data were not available for Montréal and Calgary, we could not assess trends in test positivity by age. Finally, we could not evaluate trends in COVID-19 incidence among teachers and school staff members, because in Canada cases are not routinely reported by occupations other than health care workers.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.21.21254064
  169. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.19.21253005
    1
    1. sciscore 25 Mar 2021

      SciScore for 10.1101/2021.03.19.21253005: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.19.21253005
  170. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.21.21254068
    1
    1. sciscore 25 Mar 2021

      SciScore for 10.1101/2021.03.21.21254068: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The third author (SP) randomly selected and reviewed 50% of the extracted data from the included studies to ascertain data extraction quality.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Search strategy: From 21st to 31st December 2020, Scopus, Google Scholar, CINAHL and Web of Science databases were searched for relevant studies using the search terms: ‘Determinants’ ‘Predictors’ ‘COVID-19’ ‘SARS-CoV-2’ ‘Mortality’ ‘Length of hospital stay’ ‘Length of hospitalisation’.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Google Scholar</div><div>suggested: (Google Scholar, RRID:SCR_008878)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Regarding limitations, the review was restricted in conducting further analysis, specifically, meta-analysis, to precisely estimate the associations’ effect size due to included studies’ heterogeneity. Also, most of the included studies (n=12) used retrospective design, thus, there was the possibility of residual confounders that could influence this review’s findings. Additionally, all of them used secondary data from medical records of participants. Therefore, any omission or data entry error could affect their results and this review. Hence, caution must be taken when interpreting the findings of this review.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.21.21254068
  171. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.21.21254047
    1
    1. sciscore 25 Mar 2021

      SciScore for 10.1101/2021.03.21.21254047: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations and conclusion: This research has the limitation that the study cohort may not be entirely representative of the elderly population as a whole. Recruitment occurred in public places, and so the research cohort may have greater levels of activity in comparison to the wider elderly population. This group (those who were out in public) are worth researching as they have a greater likelihood of being in contact with coronavirus due to their increased outdoors activity, but as participants were most likely to be active elderly persons the research findings are not necessarily applicable to the elderly population as a whole. This undermines our ability to make generalisations from our sample to the population we were studying. Moreover, participants from our study might stay home most of time during the pandemic with limited social interactions. This means that these results cannot necessarily be extrapolated to the general elderly population. Third, the cross-sectional nature of this investigation precludes us from drawing causal inferences. Furthermore, the cross-sectional survey design necessarily represents a snapshot in time, rather than the evolving landscape of the public’s attitudes about COVID-19 vaccination. All the information obtained was self-reported and reporting bias always exists. Although the data was collected from the heterogenous group, we targeted individuals who are willing to participate and give their answers. The individual’s opinion also can b...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.21.21254047
  172. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.23.436644
    1
    1. sciscore 25 Mar 2021

      SciScore for 10.1101/2021.03.23.436644: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.23.436644
  173. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.16.21253764
    1
    1. sciscore 25 Mar 2021

      SciScore for 10.1101/2021.03.16.21253764: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.16.21253764
  174. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.22.436468
    1
    1. sciscore 25 Mar 2021

      SciScore for 10.1101/2021.03.22.436468: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies: The following antibodies were used in this study: mouse anti-spike S2 (1A9, Gene Tex), mouse anti-p55/24 (ARP366, Centre for AIDS Reagents), goat anti-ACE2 (AF933, R& D Systems), rabbit anti-ACE2 (EPR4435, abcam), rabbit anti-TMPRSS2 (EPR3861, abcam), mouse anti--actin (ab49900, abcam)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-spike S2</div><div>suggested: (Imported from the IEDB Cat# S2, RRID:AB_2833224)</div></div><div style="margin-bottom:8px"><div>anti-p55/24</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-TMPRSS2</div><div>suggested: (LSBio (LifeSpan Cat# LS-C105697, RRID:AB_2240746)</div></div><div style="margin-bottom:8px"><div>anti--actin</div><div>suggested: (Cell Signaling Technology Cat# 8844, RRID:AB_10998933)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: HeLa ACE2 (a kind gift from Dr. James Voss, SCRIPPS (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">51)), HEK 293T cells and Calu-3 cells were maintained at 37°C in Dulbecco’s Modified Eagle Medium supplemented with 10% foetal calf serum (FCS), 1% non-essential amino acids and 1% penicillin/streptomycin. Plasmids: Codon optimised open reading frames encoding spike proteins were synthesised (GeneArt, Thermo Fisher) and cloned into pCDNA3.1 and/or pD603 (ATUM) expression plasmids.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were acquired using an LSR Fortessa II (BD Biosciences) and analysed using FlowJo version 10.5.3 (FlowJo LLC, Becton Dickinson).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MUSCLE) method (67).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MUSCLE</div><div>suggested: (MUSCLE, RRID:SCR_011812)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: All statistical analysis (T-test, one-way ANOVA with Dunnet’s correction for multiple comparisons, curve fitting and F-test) were performed in GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.22.436468
  175. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.18.21252686
    1
    1. sciscore 25 Mar 2021

      SciScore for 10.1101/2021.03.18.21252686: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.18.21252686
  176. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.23.436593
    1
    1. sciscore 25 Mar 2021

      SciScore for 10.1101/2021.03.23.436593: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.3 SARS CoV2 Viral Infection: Vero cells seeded in 96-well plates were cultured at 37°C, 5% CO2 in Dulbecco Minimum Essential Medium (DMEM) (Gibco) supplemented with 10% (v/v) Fetal Bovine Serum (FBS) (Gibco), 3.7 g/L sodium bicarbonate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data is represented as mean ± SD using GraphPad Prism 8 (Ver 8.4.2 GraphPad Software, LLC.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.23.436593
  177. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.19.21253964
    1
    1. sciscore 24 Mar 2021

      SciScore for 10.1101/2021.03.19.21253964: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the Western Institutional Review Board, and all participants consented freely.<br>Consent: After enrollment and consent, participants completed an initial survey to collect information on demographics and health history, including suspected date of SARS-CoV-2 exposure.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nasal virus culture: VeroTMPRSS2 cells were grown in complete medium (CM) consisting of DMEM with 10% fetal bovine serum (Gibco), 1 mM glutamine (Invitrogen), 1 mM sodium pyruvate (Invitrogen), 100 U/ml of penicillin (Invitrogen), and 100 μg/ml of streptomycin (Invitrogen)5.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroTMPRSS2</div><div>suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.19.21253964
  178. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.22.436465
    1
    1. sciscore 24 Mar 2021

      SciScore for 10.1101/2021.03.22.436465: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">TMPRSS2 antibody (Novus biologicals, NBP1-20984) was added to membrane (1:1000 dilution in Super Block) and incubated overnight at 4C with gentle shaking.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TMPRSS2</div><div>suggested: (Novus Cat# NBP1-20984, RRID:AB_1643199)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Raw data was deconvoluted (intact protein of 20,000-25,000 Da) using BioConfirm software with background subtraction.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioConfirm</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">V0 was plotted vs substrate concentration and the data was fit to the Michaelis Menten equation using GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.22.436465
  179. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.22.436337
    1
    1. sciscore 24 Mar 2021

      SciScore for 10.1101/2021.03.22.436337: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Bioluminescence Imaging (BLI) of SARS-CoV-2 infection: All standard operating procedures and protocols for IVIS imaging of SARS-CoV-2 infected animals under ABSL-3 conditions were approved by IACUC, IBSCYU and YARC.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">SARS-CoV-2 infection and treatment conditions: For all in vivo experiments, the 6 to 8 weeks male and female mice were intranasally challenged with 1 x 105 FFU in 25-30 µl volume under anesthesia (0.5 - 5 % isoflurane delivered using precision Dräger vaporizer with oxygen flow rate of 1 L/min).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody depletion of immune cell subsets: For evaluating the effect of NK cell depletion during CV3-1 prophylaxis, anti-NK1.1 (clone PK136; 12.5 mg/kg body weight) or an isotype control mAb (BioXCell; clone C1.18.4; 12.5 mg/kg body weight) was administered to mice by i.p. injections every 2 days starting at 48 h before SARS-CoV-2-nLuc challenge till 8 dpi.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-NK1.1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">containing Fc blocking antibody against CD16/CD32 (BioLegend Inc) before staining with antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD16/CD32</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Grids were incubated 1 hr with 10% calf serum in PBS to block nonspecific antibody binding, then incubated 2 hrs with anti-S antiserum (Cohen et al., 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Grids were rinsed (4x 10’) with PBS then labeled for 2 hrs with 10 nm gold conjugated goat anti-mouse secondary antibody (Ted Pella, Inc.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">At 48 hours post transfection, 293T cells were stained with CV3-1 and CV3-25 antibodies (5μg/mL), using cross-reactive anti-SARS-CoV-1 Spike CR3022 or mouse anti-His tag (Sigma-Aldrich) as positive controls.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CV3-25</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alexa Fluor-647-conjugated goat anti-human IgG (H+L) Abs (Invitrogen) and goat anti-mouse IgG (H+L) Abs (Invitrogen) were used as secondary antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An anti-mouse SARS-CoV-2 nucleocapsid protein (Clone 1C7, Bioss Antibodies)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse SARS-CoV-2 nucleocapsid protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following extensive washing with PBS, an anti-mouse IgG HRP secondary antibody solution was formulated in PBS + 1% non-fat milk.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody dependent cellular cytotoxicity (ADCC) assay: For evaluation of anti-SARS-CoV-2 ADCC activity, parental CEM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 ADCC activity</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Second, serially diluted clarified tissue homogenates were used to infect Vero-E6 cell culture monolayer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Uninfected monolayer of Vero cells treated identically served as controls to determine basal luciferase activity to obtain normalized relative light units.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 cells were maintained in complete Dulbecco’s Modified Eagle Medium (DMEM; Thermo Fisher, Cat. #11965–092) containing 10% fetal bovine serum (Gibco, Thermo-Fisher, Cat. #16140–071), 1% HEPES Buffer Solution (15630–130), and 1 % penicillin– streptomycin (Thermo Fisher, Cat. #15140–122).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, pseudoviral particles were produced by transfecting 2×106 HEK293T cells with pNL4.3 Luc R-E- (3.5 μg), plasmids encoding for SARS-CoV-2 Spike or SARS-CoV-1 Spike (3.5 μg) protein and VSV-G (pSVCMV-IN-VSV-G, 1 μg) using the standard calcium phosphate method.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells were transfected by the calcium phosphate method with the pNL4.3 R-E-Luc plasmid (NIH AIDS Reagent Program) and a plasmid encoding for SARS-CoV-2 Spike at a ratio of 5:4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">THP-1 cells were used as effector cells and were stained with another cellular dye (cell proliferation dye eFluor670).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>THP-1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bioluminescence Imaging (BLI) of SARS-CoV-2 infection: All standard operating procedures and protocols for IVIS imaging of SARS-CoV-2 infected animals under ABSL-3 conditions were approved by IACUC, IBSCYU and YARC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>YARC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Image sequences were assembled and converted to videos using Image J.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Image J</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The images were processed using Nikon Elements AR version 4.5 software (Nikon Instruments Inc, Americas) and figures assembled with Photoshop CC and Illustrator CC (Adobe Systems, San Jose, CA, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Photoshop</div><div>suggested: (Adobe Photoshop, RRID:SCR_014199)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data were processed and plotted using GraphPad Prism 8 v8.4.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FlowJo software (Treestar) was used to generate FACS plot shown in Figure S7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tomographic tilt-series and large-area montaged overviews were acquired automatically using the SerialEM software package (Mastronarde, 2005, 2008; Mastronarde and Held, 2017).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SerialEM</div><div>suggested: (SerialEM, RRID:SCR_017293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tomographic data was calculated, analyzed, and modeled using the IMOD software package (Mastronarde, 2005, 2008; Mastronarde and Held, 2017) on iMac Pro and MacPro computers (Apple, Inc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IMOD</div><div>suggested: (IMOD, RRID:SCR_003297)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">S-MEN particles were then re-suspended in 50 mM pH 7.5 HEPES buffer, labeled with Cy3B(3S) and Cy5 derivative (LD650-CoA) and purified through an optiprep gradient as previously described (Lu et al., 2019; Lu et al., 2020; Munro et al., 2014) smFRET images of S-MEN particles was acquired on a home-built prism-based total internal reflection fluorescence (TIRF) microscope, as described previously (Lu et al., 2020). smFRET data analysis was performed using MATLAB (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MATLAB</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(MathWorks)-based customized SPARTAN software package (Juette et al., 2016).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPARTAN</div><div>suggested: (SPARTAN, RRID:SCR_014901)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">P values were indicated as ∗, p < 0.05; ∗∗, p < 0.01; ∗∗∗, p < 0.001; ∗∗∗∗, p < 0.0001. Schematics: Schematics for showing experimental design in figures were created with BioRender.com.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioRender</div><div>suggested: (Biorender, RRID:SCR_018361)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 65, 66, 67, 68, 62 and 63. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.22.436337
  180. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.21.436312
    1
    1. sciscore 24 Mar 2021

      SciScore for 10.1101/2021.03.21.436312: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenetic analysis and single nucleotide polymorphisms analysis: In this study, we applied Clustal Omega software [40]</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Clustal Omega</div><div>suggested: (Clustal Omega, RRID:SCR_001591)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(version 1.2.4) for multiple sequence alignment and RAxML software [41</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RAxML</div><div>suggested: (RAxML, RRID:SCR_006086)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Overcoming the limitation of sequence similarity-based methods to disclose the host information of novel viruses, DeepHoF demonstrated the practicality to SARS-CoV-2 in the 2020 pandemic. Using 17 SARS-CoV-2 isolates sequenced in the earliest stage of COVID-19 detection, DeepHoF evaluated the host likelihood scores on humans and non-human vertebrates for SARS-CoV-2. Filling the gap in predicting the host species for any novel virus that remained unsolved using the tools which were state of the art, we further analyzed the host likelihood score profile to further infer the specific hosts of SARS-CoV-2. The hosts determined by DeepHoF can be either reservoirs or susceptible middle hosts, which are not discriminated in this study. We found minks, bats, dogs and cats could be potential hosts of SARS-CoV-2, while minks might be one of the most noteworthy animal hosts. Due to mutations, the host likelihood score profiles of the isolates in the long period of the later pandemic had slightly varied, but followed normal distribution where those of the early 17 isolates locate in the center. As a consequence, the host range inferred with the profiles of the isolates during the pandemic was consistent with the inference using the early samples. Additionally, based on the model, we further found three genes (S gene, ORF7b and ORF1ab) and two genes (ORF1ab and ORF8) were significant in determining the host likelihood score on human and the host range for SARS-CoV-2, respectively. The gene...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.21.436312
  181. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.22.435960
    1
    1. sciscore 24 Mar 2021

      SciScore for 10.1101/2021.03.22.435960: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.22.435960
  182. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.21.21253754
    1
    1. sciscore 24 Mar 2021

      SciScore for 10.1101/2021.03.21.21253754: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Four major databases were searched: OVID Medline, Web of Science, PubMed, and Google Scholar from January 2020 until November 2020.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Medline</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div><div style="margin-bottom:8px"><div>Google Scholar</div><div>suggested: (Google Scholar, RRID:SCR_008878)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.21.21253754
  183. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.19.21253815
    1
    1. sciscore 24 Mar 2021

      SciScore for 10.1101/2021.03.19.21253815: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Written informed consent was obtained for postmortem examination from the next of kin of these patients.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sections were deparaffinized; after antibody retrieval, were stained using anti-human NLRP3 monoclonal antibody at 1:200 or anti-human caspase antibody at 1:100 (both from R%D Systems, Minneapolis, MN).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human NLRP3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human caspase</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were captured on the Aperio Pathology System and visualized by ImageScope (Leica Biosystems, Buffalo Grove, IL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageScope</div><div>suggested: (ImageScope, RRID:SCR_014311)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sections were deparaffinized; after antibody retrieval, were stained using anti-human NLRP3 monoclonal antibody at 1:200 or anti-human caspase antibody at 1:100 (both from R%D Systems, Minneapolis, MN).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>R%D Systems</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04540120</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Safety and Efficacy of Dapansutrile for Treatment of Moderat…</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.19.21253815
  184. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.19.21253947
    1
    1. sciscore 24 Mar 2021

      SciScore for 10.1101/2021.03.19.21253947: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The caveat is, however, that such systems require integration of healthcare and population specific data, enabling extraction of EHR data on a community wide rather than a hospital specific scale. Healthcare systems operating as individual units rather than covering the entirety of a regional population, may thus not be optimally suited for real-time deployment of these prediction models. This study has several limitations. First, we model data retrospectively and have not demonstrated a prospective value in this study. As such, although accurate on retrospective data predictions, novel features of a potential third COVID-19 wave could affect model performance. Furthermore, we model a selected subset of patient-derived variables based on previous experience7, although other data points could affect the model’s classification ability. Secondly, we have not performed external validation on a separate cohort. This, however, may not be desirable due to several factors: The model should be trained to forecast locally, and transferring to different healthcare systems with different social and geographical factors would require retraining of the model to capture these effects. We have also recently demonstrated that transferring COVID-19 ML prediction models between health care systems internationally results in a reduction of the classification precision, presumably due to inherent differences between healthcare systems even though patient demographics are comparable7. Thirdly, as ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.19.21253947
  185. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.20.21254021
    1
    1. sciscore 24 Mar 2021

      SciScore for 10.1101/2021.03.20.21254021: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">. (The R Project for Statistical Computing, Vienna Austria).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>R Project for Statistical</div><div>suggested: (R Project for Statistical Computing, RRID:SCR_001905)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our study has several limitations. We relied entirely on routinely collected medical record data, which may be incomplete in some cases. While interrupted time series analysis allows the ability to control for secular trends in the data (unlike pre-/post-cross-sectional studies) using population-level data with clear graphical presentation of results, this analysis does not illustrate how and why the introduction of COVID-19 resulted different scale-up patterns by DSD models and whether and to what extent the temporal changes may differ by setting. Future research may examine the drivers and barriers of multi-month dispensing from both the demand and supply side aspects in the context of COVID-19 to improve continuation of care. Moreover, this analysis focused on DSD enrolment only; we have not considered retention in the DSD models or care more generally. Future work should aim to understand how this rapid acceleration of DSD uptake has affected overall retention in care.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.20.21254021
  186. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.20.21254029
    1
    1. sciscore 24 Mar 2021

      SciScore for 10.1101/2021.03.20.21254029: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04378452</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Assessment of the Psycho-social Impact of COVID-19 Outbreak</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.20.21254029
  187. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.19.21253958
    1
    1. sciscore 24 Mar 2021

      SciScore for 10.1101/2021.03.19.21253958: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In all tests, the threshold for significance was set at p<0.05. SPSS 25.0J analytical software (IBM, NY) was used for the statistical analyses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.19.21253958
  188. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.21.21254048
    1
    1. sciscore 24 Mar 2021

      SciScore for 10.1101/2021.03.21.21254048: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.21.21254048
  189. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.19.21253425
    1
    1. sciscore 24 Mar 2021

      SciScore for 10.1101/2021.03.19.21253425: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Brief blurbs in each language included a link to the survey in REDCap.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Maps: A 2018 county-level shapefile and tabular datasets containing zip codes with county Federal Information Processing System (FIPS) code was downloaded from the United States Census Bureau and imported into ArcMap.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ArcMap</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The project also had several limitations. First, as a convenience sample, findings may not be representative of New York’s disability community by diagnosis or living situation. However, results may reflect biases in who chose to respond. Second, the survey items did not include specifiers for disability category or workplace setting (e.g., residential versus community). Comparisons across these subgroups may have yielded interesting findings, and future work on vaccine perceptions within the disability community should consider including these identifiers. Third, as the survey did not specify a definition of support, it is unclear if respondents who indicated that that did not need support were familiar with actual methods of obtaining an appointment, (e.g., computer registration or telephone access) and then traveling alone to a designated and possibly unfamiliar vaccine site. Fourth, data were analyzed descriptively, rather than through predictive models. The survey was developed primarily to inform messaging for community vaccine confidence campaigns; as such, we did not have a priori hypotheses or specific research questions identified. However, group differences emerged from the dataset suggest that more rigorous evaluation of characteristics that influence vaccine hesitancy would be warranted. Finally, findings were based solely upon self-report of intention to receive the COVID-19 vaccine and are not necessarily indicative of actual vaccination behavior. In addition, ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.19.21253425
  190. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.21.21254050
    1
    1. sciscore 24 Mar 2021

      SciScore for 10.1101/2021.03.21.21254050: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Measures and procedure: Respondents were informed of the purpose and scope of the study, and all provided informed consent before registering for participation.<br>IRB: Study was approved by the appropriate ethics review committee of the University of Economics and Human Sciences, prior to initiation.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">As regards gender, 68.3 percent were female (n = 476) while in terms of educational attainment, 8.3 percent had completed primary school (n = 58), 40.2 percent had completed secondary school (n = 280), and the remaining 51.5 percent had undertaken tertiary and/or postgraduate education (n = 359).</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.21.21254050
  191. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.19.21253969
    1
    1. sciscore 24 Mar 2021

      SciScore for 10.1101/2021.03.19.21253969: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The study was approved by the Independent Scientific Advisory Committee (protocol number 20_001RA2).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The GOLD database is extracted from the Vision® system, with most of its contributing general practices based in Northern Ireland, Scotland and Wales.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GOLD</div><div>suggested: (GOLD, RRID:SCR_000188)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Strengths and limitations: The main strength of our study is the broadly representative data source that included a large number of general practices across the UK. CPRD Aurum is broadly representative of geographical coverage, area-level deprivation, age, and sex in England 16 while CPRD GOLD dataset is broadly representative of the UK age and sex profile.17 This enables us to make inferences at national level about how the pandemic affected primary care clinical management of patients who have self-harmed. However, there are some limitations in utilising anonymised primary care records. The data are extracted from GP information systems and their accuracy is determined by the quality of the information inputted by contributing practices. Some of the self-harm episodes recorded in primary care would have been emergency department presentations that were subsequently added to the patient’s primary care record. Future research using linked Hospital Episode Statistics will enable separate examination of emergency department self-harm presentations. Finally, we were unable to examine referrals to mental health services in England due to limitations to the CPRD Aurum dataset. Comparison with existing literature: Previous research found that reductions in help-seeking were greatest among patients registered at practices located in more deprived areas.4 Our study found that patients at practices in the two most deprived quintiles who did seek help had similar rates of psychotropic ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.19.21253969
  192. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.19.21253987
    1
    1. sciscore 24 Mar 2021

      SciScore for 10.1101/2021.03.19.21253987: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.19.21253987
  193. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.19.21253991
    1
    1. sciscore 24 Mar 2021

      SciScore for 10.1101/2021.03.19.21253991: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.19.21253991
  194. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.19.21254000
    1
    1. sciscore 24 Mar 2021

      SciScore for 10.1101/2021.03.19.21254000: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All animal work in the current study was reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) with animal study protocol approval number TFBS2020-010 and CTPS-19-019-01.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animal studies: Crl:CD Sprague Dawley (SD) rats were obtained from BioLASCO Taiwan Co. Ltd., and studies were conducted in the Testing Facility for Biological Safety, TFBS Bioscience Inc., and the Center of Toxicology and Preclinical Sciences, QPS Taiwan and immunized as previously described12.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Crl:CD Sprague Dawley</div><div>suggested: RRID:RGD_734476)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus neutralization assay: Lentivirus expressing the SARS-CoV-2 spike proteins of the Wuhan-Hu-1 wildtype strain was constructed, and the neutralization assay performed as previously described12.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Wuhan-Hu-1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animal studies: Crl:CD Sprague Dawley (SD) rats were obtained from BioLASCO Taiwan Co. Ltd., and studies were conducted in the Testing Facility for Biological Safety, TFBS Bioscience Inc., and the Center of Toxicology and Preclinical Sciences, QPS Taiwan and immunized as previously described12.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioLASCO</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: The analysis package in Prism 6.01 (GraphPad) was used for statistical analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our study’s limitation is that the sera were taken four weeks after the second shot of MVC-COV19 when the immunity has peaked and starting to wane. Therefore, we could not evaluate the impact of waning immunity on the neutralizing capacity against the variants. The study cannot evaluate the role of T-cell responses elicited by the vaccine as it was reported that the T-cell responses to immunization may confer heterotypic coverage and is less affected by variants of concern23. COVID-19 vaccines that conduct phase III clinical trials in South Africa when the B.1.351 strain became predominant showed considerably high protection against severe clinical endpoints, while overall efficacy is lower than sites outside of South Africa24. Since there are no correlates of protection being published for either earlier strains or the emerging variants, it warrants further study on how the reduced neutralizing titers will translate to clinical endpoints.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04487210</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Study to Evaluate the Safety and Immunogenicity of MVC-COV…</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.19.21254000
  195. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.20.21253976
    1
    1. sciscore 24 Mar 2021

      SciScore for 10.1101/2021.03.20.21253976: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Parents and guardians provided consent for student testing.<br>IRB: This study was approved by the Mass General Brigham Institutional Review Board.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.20.21253976
  196. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.19.21251426
    1
    1. sciscore 24 Mar 2021

      SciScore for 10.1101/2021.03.19.21251426: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      We acknowledge several limitations in the present study, including smaller sample sizes at later timepoints analyzed, restriction of the cohort to symptomatic cases only, and limited ethnic diversity of the sample population. Nevertheless, these results collectively indicate that analysis of the TCR repertoire from small-volume standard blood samples may be a useful surrogate for evaluating past infection and immune protection months after COVID-19 illness that could overcome several challenges in nAb and serologic testing, including labor intensity, biohazard risks, scalability, incomplete or absent antibody signal in non-severe illness, or limited antibody durability over time. Future studies across diverse populations and longer-term follow-up are needed to better define the nature and duration of the detectable T-cell response and its utility as a biomarker for assessing both natural and vaccine-mediated immunity.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.19.21251426
  197. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.05.21251413
    1
    1. sciscore 24 Mar 2021

      SciScore for 10.1101/2021.03.05.21251413: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Written informed consent was obtained from all patients or their first degree relatives, and the trial was conducted under the principles stated in the Declaration of Helsinki and Good Clinical Practice guidelines and approval of Acibadem University ethics committee (Approval No: 2020-06/02) Clinical information of the groups was obtained from the hospital’s electronic medical records.<br>IRB: Written informed consent was obtained from all patients or their first degree relatives, and the trial was conducted under the principles stated in the Declaration of Helsinki and Good Clinical Practice guidelines and approval of Acibadem University ethics committee (Approval No: 2020-06/02) Clinical information of the groups was obtained from the hospital’s electronic medical records.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After one hour of incubation at room temperature, 10000 Vero cell/well is placed in a 96 Well Flat Bottom plate with 100 µl of complete DMEM (4% FBS + 1% PSA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Endotoxin Analysis: The gel-clot technique is used for detecting or quantifying endotoxins (Division of Charles River Laboratories, Inc Lot: L4451L)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Charles River Laboratories</div><div>suggested: (Charles River Laboratories, RRID:SCR_003792)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Although the study has some limitations such as short follow-up time and small sample size, concluded that convalescent plasma may improve survival if given early onset of the disease. In the study conducted by Liu et al. 39 hospitalized patients with severe to life-threatening COVID-19, received convalescent plasma compared to a non-transfused control group. According to their results patients receiving convalescent plasma therapy had improved survival and supplementary oxygen requirements at Day 14 post-transfusion compared to non-transfused controls. Moreover, the authors recommend the transfusion of the convalescent plasma immediately after the hospitalization which supports the current study results.24 In a large retrospective study it was revealed that convalescent plasma treatment is a safe treatment option in COVID-19.25 These findings are in line with our results that either plasma products are safe in clinical usage. Conflicting with the above-mentioned studies, the beneficial effect of convalescent plasma could not be confirmed in SARS-CoV2 pneumonia patients in previous placebo-controlled trials.17, 26 The reason for the controversial result is explained with the lack of neutralizing antibody titer measurement of the donor plasma in the PLACID trial.17 Also, convalescent plasma was administered to the patients later than 3 days, contrary to what is recommended in the FDA report. FDA suggested in its report, that convalescent plasma transfusion can be effective wit...

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04769245</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">The Effectiveness of ACB-IP 1.0 Convalescent Plasma in COVID…</td></tr></table>

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.05.21251413
  198. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.03.20.21254040
    1
    1. sciscore 24 Mar 2021

      SciScore for 10.1101/2021.03.20.21254040: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">To recruit the population-based comparison group, a total of 17,500 postcards were mailed to a simple random sample of Pima, Yuma, and Pinal counties beginning in July 2020.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      However, limitations of the work must also be considered. Although we have laboratory-confirmed negative participants, we cannot know the COVID-19 status of the untested participants. It is possible that some had already been infected but were asymptomatic or exhibited few symptoms. This would likely attenuate any associations between exposure and outcomes in this study. Additionally, there may be differences in the source population for cases as compared to the laboratory-negative participants and untested participants due to the differences in recruitment strategies for these populations. For example, while postcards were mailed to a random selection of households, it is possible Latinx participants were less likely to respond to this method than direct recruitment as cases during routine case follow-up. This could bias the association between being COVID-19-positive and Latinx away from the null. However, our race/ethnicity profile among cases is approximately similar to the overall distribution of cases throughout Arizona, suggesting a representative sample. Therefore, bias would potentially come from differential responses to other recruitment methods. In conclusion, the findings of this analysis from the Arizona CoVHORT study show variation in several individual characteristics between COVID-19-positive participants, negative participants, and the untested population, which will be studied in future publications to assess the contributors to these observations. In addit...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.03.20.21254040
  199. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.22.436427
    1
    1. sciscore 24 Mar 2021

      SciScore for 10.1101/2021.03.22.436427: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.22.436427
  200. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.22.436454
    1
    1. sciscore 24 Mar 2021

      SciScore for 10.1101/2021.03.22.436454: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.22.436454
  201. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.03.22.435957
    1
    1. sciscore 24 Mar 2021

      SciScore for 10.1101/2021.03.22.435957: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Key resources table: Cell culture: HEK293T cells (a kind gift from Paul Lehner, authenticated by STR profiling (Menzies et al., 2018; Miles et al., 2017)) and VeroE6 cells (a kind gift from Rupert Beale, authenticated by species-specific PCR (IDEXX BioAnalytics)) were cultured in DMEM supplemented with 10% fetal calf serum (FCS), 100 units/ml penicillin, and 0.1 mg/ml streptomycin at 37 C in 5% CO2.<br>Contamination: All cells were regularly screened and confirmed to be mycoplasma negative (Lonza MycoAlert and IDEXX BioAnalytics).</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then permeabilised with Perm/Wash buffer (BD), stained for SARS-CoV-2 spike protein using a mouse monoclonal antibody (GeneTex, GTX632604) for 30 mins at room temperature, washed twice, stained with an anti-mouse Alexa Fluor 594 (AF594) secondary antibody (Jackson ImmunoResearch, #715-585-150) for 30 mins at room temperature, washed extensively, mounted with 200 µL/well of Fluoroshield Mounting Media (Sigma, F6057), and analysed by automated microscopy.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 715-585-150, RRID:AB_2340854)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then permeabilised with Perm/Wash buffer (BD), stained for SARS-CoV-2 spike protein using a mouse monoclonal antibody (GeneTex, GTX632604) for 30 mins at room temperature, washed twice, stained with an anti-mouse AF647 secondary antibody (Jackson ImmunoResearch, #715-605-150) for 30 mins at room temperature, mounted with 200 µL/well of Fluoroshield Mounting Media (Sigma, F6057), and analysed by confocal microscopy using a Zeiss LSM 710 Inverted confocal microscope equipped with 405, 458, 543 and 633 nm lasers and a Plan Apochromat 63X/1.40 Oil DIC M27 objective.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse AF647</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Key resources table: Cell culture: HEK293T cells (a kind gift from Paul Lehner, authenticated by STR profiling (Menzies et al., 2018; Miles et al., 2017)) and VeroE6 cells (a kind gift from Rupert Beale, authenticated by species-specific PCR (IDEXX BioAnalytics)) were cultured in DMEM supplemented with 10% fetal calf serum (FCS), 100 units/ml penicillin, and 0.1 mg/ml streptomycin at 37 C in 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vectors for transgene expression: Generation of HEK293T-ACE2 and HEK293T-ACE2-30F-PLP2 cells: For transduction of HEK293T cells with ACE2, a pHRSIN-ACE2-Hygro lentiviral stock was generated by co-transfection of HEK293T cells with psPAX2 and pCMV-VSV-G using standard methods.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometric analysis of spike protein expression in SARS-CoV-2-infected cells: HEK293T-ACE2 cells were seeded at a density of 9 x 104 cells/48-well in 250 µL complete media.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The ratio of FlipGFP/mCherry mean fluorescence intensity (MFI) in BFP+ (transfected) cells was used to quantitate reporter activation (FlowJo 10.7).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For each reporter construct, the ratio of FlipGFP/mCherry MFI was calculated manually using Fiji (ImageJ), by creating a mask around syncytiated cells that were both spike+ (infected) and mCherry+ (transfected).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Instead, FASTA sequences were downloaded and aligned using MAFFT (Katoh et al., 2002) with default parameters.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Having manually inspected the genomic alignments to identify the regions of interest, we used the ‘extractalign’ function in the European Molecular Biology Open Software Suite (EMBOSS)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EMBOSS</div><div>suggested: (EMBOSS, RRID:SCR_008493)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting amino acid sequences were used as input for the WebLogo application (Crooks et al., 2004; Schneider and Stephens, 1990).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>WebLogo</div><div>suggested: (WEBLOGO, RRID:SCR_010236)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: General data manipulation was conducted using Microsoft Excel, and statistical analysis using Graphpad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      To overcome these limitations, we therefore generated luciferase-based reporters. We envisioned at least three advantages of this approach: first, luciferase-based assays are typically highly sensitive; second, since the first step in measuring luciferase activity involves lysing cells, the readout is not affected by syncytia formation during viral infection; and third, luciferase-based assays may be readily adapted to high-throughput platforms. Accordingly, compared with FlipGFP, the window for luciferase-based reporter activation was greatly increased in assays of recombinant proteases (139-fold versus 26-fold for Opt3c/MPro reporters, and 74-fold versus 12-fold for PLP2/PLPro reporters) and viral infection (12-fold vs. 3-fold for Opt3c/MPro reporters, and 29-fold versus 3-fold for PLP2/PLPro reporters). Interestingly, whilst our luciferase-based Opt3c/MPro reporter displayed a higher sensitivity for recombinant protease, our PLP2/PLPro reporter performed markedly better during SARS-CoV-2 infection. This may reflect inversion of the expression levels of MPro and PLPro in the different settings, or differential accessibility of the reporters (substrates) to viral proteases in the context of viral infection. Since PLPro of SARS-CoV has deubiquitylation (DUB) activity, and is able to regulate whole cell levels of ubiquitylation during viral infection, we suspect that PLPro of SARS-CoV-2 may also be able to readily access a wide variety of cellular proteins, including cytosolic...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 58, 55 and 47. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.
      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.03.22.435957