PatientID: 8

KindredID: 4

Case: M, 14Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: A family pedigree is provided in figure 1. The parents of patient 8 were molecularly tested and neither possessed the mutation; thus, the mutation was identified as de novo. Neither parent had VHL syndrome characterized by retinal capillary hemangiomas (RCHs).

CasePresentingHPOs: HP:0006880; HP:0009711 (Cerebellar hemangioblastoma; Retinal capillary hemangioma)

CaseHPOFreeText: In 2019, a 14-year-old boy was diagnosed with visual impairment, due to visual acuity of 20/20 in the right eye and 20/640 in the left eye. Four peripheral RCHs were detected in the right eye. The visual impairment of the left eye was due to the severe exudative process involving the macula. Moreover, numerous microhemangioblastomas were revealed by fluorescein angiography. Laser therapy was performed in both eyes, but vitreous hemorrhage occurred in the left eye. Bevacizumab was given three times, as well simultaneous cryotherapies were performed under general anesthesia. Many laser sessions were performed for regression of the RCHs to occur. Further testing revealed a cerebellar hemangioblastoma.

CaseNotHPOs: N/A

CaseNotHPOFreeText: Patient did not have other known tumours.

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R113* (c.337C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 220414, https://www.ncbi.nlm.nih.gov/clinvar/variation/220414/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: R113* (c.337C>T)

MultipleGeneVariants: N/A

PatientID: 16

KindredID: 16

Case: F, 20Y0M, Asian Indian

DiseaseAssertion: pheochromocytoma

FamilyInfo: positive family history

CasePresentingHPOs: HP:0002666 (pheochromocytoma)

CaseHPOFreeText: bilateral pheochromocytoma

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET/ SDHB/ SDHD/ NF1

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R161Q (c.482G>A)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 182983 https://www.ncbi.nlm.nih.gov/clinvar/variation/182983/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: R161Q (c.482G>A)

MultipleGeneVariants: N/A

PatientID: 17

KindredID: 17

Case: F, 6Y0M, Asian Indian

DiseaseAssertion: pheochromocytoma

FamilyInfo: positive family history

CasePresentingHPOs: HP:0002666 (pheochromocytoma)

CaseHPOFreeText: unilateral pheochromocytoma

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET/ SDHB/ SDHD/ NF1

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R161Q (c.482G>A)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 182983 https://www.ncbi.nlm.nih.gov/clinvar/variation/182983/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: R161Q (c.482G>A)

MultipleGeneVariants: N/A

PatientID: 31

KindredID: 31

Case: M, 21Y0M, Asian Indian

DiseaseAssertion: pheochromocytoma

FamilyInfo: None - apparently sporadic

CasePresentingHPOs: HP:0002666 (pheochromocytoma)

CaseHPOFreeText: patient had unilateral pheochromocytoma

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET/ SDHB/ SDHD/ NF1

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.L178Q (c.533T>A)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 625260 https://www.ncbi.nlm.nih.gov/clinvar/variation/625260/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: L178Q (c.533T>A)

MultipleGeneVariants: N/A

PatientID: 15

KindredID: 15

Case: M, 12Y0M, Asian Indian

DiseaseAssertion: assumed VHL

FamilyInfo: Positive family history

CasePresentingHPOs: HP:0002666; HP:0002668; HP:0000107; HP:0001737 (pheochromocytoma; paraganglioma; renal cyst; pancreatic cysts)

CaseHPOFreeText: unilateral pheochromocytoma with sympathetic paraganglioma. Renal and pancreatic cysts

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET/ SDHB/ SDHD/ NF1

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.Y98S (c.293A>C)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 219160 https://www.ncbi.nlm.nih.gov/clinvar/variation/219160/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: Y98S (c.293A>C)

MultipleGeneVariants: N/A

PatientID: 163

KindredID: 63

Case: F, 37Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 163) had a brother and niece who were both confirmed with the mutation. The brother (patient 164) had a CNS hemangioblastoma at 27, retinal angioma at 26, and pheochromocytoma at 8 years old. The niece (patient 165) was asymptomatic at the time of analysis. The proband also had a mother (patient 166) who had multiple pancreatic cysts/tumors and a pheochromocytoma at age 56, but for whom no DNA sample was available for analysis.

CasePresentingHPOs: HP:0001737; HP:0001732; HP:0010797; HP:0002666; HP:0005584 (Pancreatic cysts, Abnormality of the pancreas, Hemangioblastoma, Pheochromocytoma, Renal cell carcinoma)

CaseHPOFreeText: The proband presented with a pheochromocytoma at 37, and at age 37 presented with a CNS hemangioblastoma, renal cell carcinoma, and multiple pancreatic cysts/tumors.

CaseNotHPOs: HP:0009711 (Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.R161Q (c.482G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 182983, https://www.ncbi.nlm.nih.gov/clinvar/variation/182983/?new_evidence=true

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: R161Q (c.482G>A)

MultipleGeneVariants: N/A

PatientID: 94

KindredID: 31

Case: F, 56Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 31) has a son who has also genetically confirmed with the mutation. The proband's son presented at age 29 with retinal angioma, renal cell carcinoma, multiple pancreatic cysts/tumors, and pheochromocytoma.

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0001737; HP:0001732 (Hemangioblastoma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas)

CaseHPOFreeText: The proband presented with renal cell carcinoma and multiple pancreatic cysts/tumors at 51, and CNS hemangioblastoma at age 56.

CaseNotHPOs: HP:0002666; HP:0009711 (Pheochromocytoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.E94* (c.280G>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 584477; https://www.ncbi.nlm.nih.gov/clinvar/variation/584477/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: E94* (c.280G>T)

MultipleGeneVariants: N/A

PatientID: 3

KindredID: 2

Case: M, 22Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: His father also had this mutation and presented with renal cell carcinoma and pancreatic cysts at age 48. His father's mother (his grandmother) presented with a CNS hemangioblastoma at age 61, and his father's brother (his uncle) presented with a CNS hemangioblastoma at age 33. His grandmother passed away before diagnosis, and there was no DNA sample available for his uncle.

CasePresentingHPOs: HP:0010797 (Hemangioblastoma)

CaseHPOFreeText: The patient presented with a CNS hemangioblastoma at the age of 22.

CaseNotHPOs: HP:0009711; HP:0002666; HP:0005584; HP:0001737 (Retinal Capillary Hemangioma, Pheochromocytoma, Renal cell carcinoma, Pancreatic cysts)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This cohort was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.S65W (c.194C>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 43597, https://www.ncbi.nlm.nih.gov/clinvar/variation/43597/

CAID:

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: S65W (c.194C>G)

MultipleGeneVariants: N/A

PatientID: 230

KindredID: 86

Case: F, 40Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 229) had a sister (patient 230) who was genetically confirmed with the mutation, and presented with a CNS hemangioblastoma at age 40. The proband's brother 1 (patient 231) was also confirmed with the mutation and had a retinal angioma at 25, and renal cell carcinoma at 54. The proband's brother 2 passed away before they could be diagnosed/ confirmed with the mutation, but they had a CNS hemangioblastoma at 35. Finally, the proband's nephew (son of brother 2) was genetically confirmed with the mutation and presented with renal cell carcinoma at age 30.

CasePresentingHPOs: HP:0010797 (Hemangioblastoma)

CaseHPOFreeText: The proband's sister (patient 230) had a CNS hemangioblastoma at age 40.

CaseNotHPOs: HP:0002666; HP:0001737; HP:0001732; HP:0005584; HP:0009711 (Pheochromocytoma, Pancreatic cysts, Abnormality of the pancreas, Renal cell carcinoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.L178R (c.533T>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 625261, https://www.ncbi.nlm.nih.gov/clinvar/variation/625261/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: L178R (c.533T>G)

MultipleGeneVariants: N/A

PatientID: 142

KindredID: 52

Case: F, 36Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 138) had multiple family members affected with the mutation. Their daughter (pt 139) was asymptomatic at the time of assessment; their son (pt 140) was also asymptomatic at the time of assessment; their mother (pt 141) presented with a CNS hemangioblastoma at 66, renal cell carcinoma at 69, and multiple pancreatic cysts/tumors at 66; their sister 1 (pt 142) presented with a CNS hemangioblastoma at 32, renal cell carcinoma at 36, and multiple pancreatic cysts/tumors at 36; the son of sister 1 was asymptomatic at the time of analysis; the daughter of sister 1 was asymptomatic at the time of analysis; the proband's sister 2 presented at age 39 with CNS hemangioblastoma, renal cell carcinoma, and multiple pancreatic cysts/tumors; and the son of sister 2 was asymptomatic at the time of analysis. All members of this family were genetically confirmed to have this mutation.

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0001737; HP:0001732 (Hemangioblastoma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas)

CaseHPOFreeText: The proband's sister 1 (patient 142) had a CNS hemangioblastoma at 31, and multiple pancreatic cysts/tumors and renal cell carcinoma at 36.

CaseNotHPOs: HP:0002666; HP:0009711 (Pheochromocytoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: c.464-1G>C

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223220; https://www.ncbi.nlm.nih.gov/clinvar/variation/223220/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: splice_site_variant

CivicName: Splice Site (c.464-1G>C)

MultipleGeneVariants: N/A

PatientID: 127

KindredID: 47

Case: F, 28Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0001737; HP:0001732; HP:0009711 (Hemangioblastoma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas, Retinal capillary hemangioma)

CaseHPOFreeText: The proband presented at age 25 with a CNS hemangioblastoma, retinal angioma, and renal cell carcinoma, and presented with multiple pancreatic cysts/tumors at age 28.

CaseNotHPOs: HP:0002666 (Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This kindred was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.E134_V142del (c.402_428del)

LegacyVariant: N/A

CaseProblemVariantFreeText: Variant listed in the paper as c.402-428delATTATTTGTGCCATCTCTCAATGTTGA, p.Glu134Aspfs*72. Listed protein change does not match deletion. Deletion is in-frame and should not lead to a frame shift. Variant updated in this annotation based on protein change listed in ClinGen/ listed on Variant Validator for c.402-428del.

ClinVarID: N/A

CAID: CA2573320387, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2573320387

gnomAD: N/A

VariantEvidence: N/A

MutationType: inframe_deletion

CivicName: E134_V142del (c.402_428del)

MultipleGeneVariants: N/A

PatientID: 175

KindredID: 69

Case: F, 35Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The male proband, patient 143, was diagnosed with renal cell carcinoma and multiple pancreatic cysts/tumors at age 33. His mother, who was not confirmed with the mutation, had a CNS hemangioblastoma at 30, retinal angioma at 54, and renal cell carcinoma at 50. His sister had a CNS hemangioblastoma at 28, and renal cell carcinoma/ multiple pancreatic cysts/tumors at 35. His niece, who was not confirmed with the mutation, had a CNS hemangioblastoma at age 12. His aunt had a CNS hemangioblastoma at 37, retinal angioma at 45, and renal cell carcinoma at 53. The son of his aunt was asymptomatic at the time of analysis.

CasePresentingHPOs: HP:0005584; HP:0001737; HP:0001732; HP:0010797 (Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas, Hemangioblastoma)

CaseHPOFreeText: The proband's sister presented with a CNS hemangioblastoma at age 28 and renal cell carcinoma and multiple pancreatic cysts/tumors at age 35.

CaseNotHPOs: HP:0002666; HP:0009711 (Pheochromocytoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.C162W (c.486C>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223227; https://www.ncbi.nlm.nih.gov/clinvar/variation/223227/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: C162W (c.486C>G)

MultipleGeneVariants: N/A

PatientID: 140

KindredID: 52

Case: M, Age Unknown, Chinese

DiseaseAssertion: Asymptomatic

FamilyInfo: The proband (patient 138) had multiple family members affected with the mutation. Their daughter (pt 139) was asymptomatic at the time of assessment; their son (pt 140) was also asymptomatic at the time of assessment; their mother (pt 141) presented with a CNS hemangioblastoma at 66, renal cell carcinoma at 69, and multiple pancreatic cysts/tumors at 66; their sister 1 (pt 142) presented with a CNS hemangioblastoma at 32, renal cell carcinoma at 36, and multiple pancreatic cysts/tumors at 36; the son of sister 1 was asymptomatic at the time of analysis; the daughter of sister 1 was asymptomatic at the time of analysis; the proband's sister 2 presented at age 39 with CNS hemangioblastoma, renal cell carcinoma, and multiple pancreatic cysts/tumors; and the son of sister 2 was asymptomatic at the time of analysis. All members of this family were genetically confirmed to have this mutation.

CasePresentingHPOs: N/A

CaseHPOFreeText: The proband's son was asymptomatic at the time of assessment.

CaseNotHPOs: HP:0010797, HP:0001737; HP:0001732; HP:0005584; HP:0002666; HP:0009711 (Hemangioblastoma, Pancreatic cysts, Abnormality of the pancreas, Renal cell carcinoma, Pheochromocytoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: c.464-1G>C

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223220; https://www.ncbi.nlm.nih.gov/clinvar/variation/223220/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: splice_site_variant

CivicName: Splice Site (c.464-1G>C)

MultipleGeneVariants: N/A

PatientID: 93

KindredID: 30

Case: M, 31Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; (Hemangioblastoma)

CaseHPOFreeText: The proband presented with a CNS hemangioblastoma at age 51.

CaseNotHPOs: HP:0002666; HP:0009711; HP:0005584; HP:0001737; HP:0001732 (Pheochromocytoma, Retinal capillary hemangioma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.E94* (c.280G>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 584477; https://www.ncbi.nlm.nih.gov/clinvar/variation/584477/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: E94* (c.280G>T)

MultipleGeneVariants: N/A

PatientID: 147

KindredID: 53

Case: F, 18Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband's mother presented with a CNS hemangioblastoma at age 17. She passed away before she could be diagnosed/ genetically confirmed with the same mutation as her daughter.

CasePresentingHPOs: HP:0010797 (Hemangioblastoma)

CaseHPOFreeText: The proband presented with a CNS hemangioblastoma at age 18.

CaseNotHPOs: HP:0009711; HP:0002666; HP:0001737; HP:0001732; HP:0005584 (Retinal capillary hemangioma, Pheochromocytoma, Pancreatic cysts, Abnormality of the pancreas, Renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This cohort was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: c.464-1G>A

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 43603, https://www.ncbi.nlm.nih.gov/clinvar/variation/43603/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: splice_site_variant

CivicName: Splice Site (c.464-1G>A)

MultipleGeneVariants: N/A

PatientID: 218

KindredID: 81

Case: M, 26Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The patient's sister (the proband) had the same germline mutation, and presented with a CNS hemangioblastoma at 24, renal cell carcinoma at 32, and multiple pancreatic cysts/tumors at 33. The proband's mother had a CNS hemangioblastoma at 35, however no genotyping information is available for her.

CasePresentingHPOs: HP:0010797; HP:0002666 (Hemangioblastoma, Pheochromocytoma)

CaseHPOFreeText: The patient presented with a CNS hemangioblastoma at age 20, and a pheochromocytoma at age 26.

CaseNotHPOs: HP:0009711; HP:0005584; HP:0001737; HP:0001732 (Retinal capillary hemangioma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This cohort was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.R167Q (c.500G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2216, https://www.ncbi.nlm.nih.gov/clinvar/variation/2216/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: R167Q (c.500G>A)

MultipleGeneVariants: N/A

PatientID: 2

KindredID: 2

Case: M, 48Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband's son also had this mutation, and presented with a CNS hemangioblastoma at age 22. The proband's mother presented with a CNS hemangioblastoma at age 61, and his brother presented with a CNS hemangioblastoma at age 33. His mother passed away before diagnosis, and there was no DNA sample available for his brother.

CasePresentingHPOs: HP:0005584; HP:0001732; HP:0001737 (Renal cell carcinoma, Abnormality of the pancreas, Pancreatic cysts)

CaseHPOFreeText: The proband presented with renal cell carcinoma and pancreatic cysts at the age of 48.

CaseNotHPOs: HP:0010797; HP:0009711; HP:0002666 (Hemangioblastoma, Retinal Capillary Hemangioma, Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This cohort was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.S65W (c.194C>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 43597, https://www.ncbi.nlm.nih.gov/clinvar/variation/43597/

CAID:

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: S65W (c.194C>G)

MultipleGeneVariants: N/A

PatientID: 249

KindredID: 95

Case: F, Age Unknown, Chinese

DiseaseAssertion: Asymptomatic

FamilyInfo: The proband (patient 244) has a daughter with the variant (patient 245) who was asymptomatic at the time of assessment.

CasePresentingHPOs: N/A

CaseHPOFreeText: The proband's nephew (son of sister) was asymptomatic at the time of assessment

CaseNotHPOs: HP:0001737; HP:0001732; HP:0005584; HP:0009711; HP:0002666; HP:0010797 (Pancreatic cysts, Abnormality of the pancreas, Renal cell carcinoma, Retinal capillary hemangioma, Pheochromocytoma, Hemangioblastoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This cohort was also published in an earlier paper by Wang et al., 2014 (PMID 24581539) as well as a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: Exon 1 Deletion (c.1-?_340+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: Exon 1 Deletion

MultipleGeneVariants: N/A

PatientID: 200

KindredID: 77

Case: F, 25Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 200) has six family members who passed away before diagnosis/ had no DNA sample available. Of the family who passed away before diagnosis: the proband's aunt 1 (patient 202) had a CNS hemangioblastoma at 27; the daughter of aunt 1 (patient 203) had a pheochromocytoma at 31; aunt 2 (patient 205) had a CNS hemangioblastoma at 43, renal cell carcinoma at 36, and multiple pancreatic cysts/tumors at 48. Of the family for whom no DNA sample was available: the proband's mother (patient 201) had a CNS hemangioblastoma at 51, multiple pancreatic cysts/tumors at 46, and a pheochromocytoma at 25; the grandson of aunt 1 (patient 204) had a pheochromocytoma at age 9; and the son of aunt 2 (patient 206) had a pheochromocytoma at 16 and renal cell carcinoma + multiple pancreatic cysts/tumors at 21.

CasePresentingHPOs: HP:0010797 (Hemangioblastoma)

CaseHPOFreeText: The patient presented with a pheochromocytoma and renal cell carcinoma at 36.

CaseNotHPOs: HP:0009711; HP:0001737; HP:0001732; HP:0002666; HP:0005584 (Retinal capillary hemangioma, Pancreatic cysts, Abnormality of the pancreas, Pheochromocytoma, Renal cell carcinoma )

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.R167W (c.499C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2218; https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: N/A

gnomAD: 0.000007954; https://gnomad.broadinstitute.org/variant/3-10191506-C-T?dataset=gnomad_r2_1

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

PatientID: VHL-11

KindredID: 11

Case: Sex Unknown, Age Unknown, Italian

DiseaseAssertion: VHL

FamilyInfo: None.

CohortInfo: Forty-three index cases were referred to the Service of Medical Genetics, Genova, for germline mutation analysis in the VHL gene between 1995 and 2008.

CasePresentingHPOs: HP:0010797, HP:0009711 (hemangioblastoma, retinal capillary hemangioma)

CaseHPOFreeText: The patient had multiple hemangioblastomas.

CaseNotHPOs: HP:0005584, HP:0001737, HP:0002666 (renal cell carcinoma, pancreatic cysts, pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.N78S(c.233A>G)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 93326 https://www.ncbi.nlm.nih.gov/clinvar/variation/93326/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType:missense_variant;transition

CivicName: N78S(c.233A>G)

MultipleGeneVariants: N/A

PatientID: VHL-16

KindredID: 16

Case: Sex Unknown, Age Unknown, Italian

DiseaseAssertion: VHL

FamilyInfo: Family history of VHL. No further details provided.

CohortInfo: Forty-three index cases were referred to the Service of Medical Genetics, Genova, for germline mutation analysis in the VHL gene between 1995 and 2008.

CasePresentingHPOs: HP:0010797; HP:0001732 (Hemangioblastoma, Abnormality of the pancreas)

CaseHPOFreeText: Multiple CNS hemangioblastomas. Clinical classification: A1.

CaseNotHPOs: HP:0005584; HP:0002666; HP:0009711 (Renal cell carcinoma, Pheochromocytoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.G114R (c.340G>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223193, https://www.ncbi.nlm.nih.gov/clinvar/variation/223193/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: G114R (c.340G>C)

MultipleGeneVariants: N/A

PatientID: III-A

KindredID: 1

Case: M, 30Y0M, EthnicityUnknown

DiseaseAssertion: VHL

FamilyInfo: Multiple first- and second-degree relatives affected with similar phenotypes. Of these, he is genetically tested and found to share VHL mutations with his uncle (proband).

CasePresentingHPOs: N/A

CaseHPOFreeText: Paper asserts that this individual presented with VHL phenotypes but does not specify which.

CaseNotHPOs: NA

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Information obtained from Figure 1

Variant: p.L158Q (c.473T>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 376048, https://www.ncbi.nlm.nih.gov/clinvar/variation/376048/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: P86S (c.256C>T) and Splice Region (c.340+5G>C)

MultipleGeneVariants: Germline, VHL, c.340+5G>C

PatientID: II.6

KindredID: F8

Case: F, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: 6/10 genetically tested family members across two generations were found to harbor the c.340+648T>C and c.340+617C>G germline mutations of the VHL gene. Patient I.2 presented with retinal capillary hemangioma, pheochromocytoma (pheo) and renal cell carcinoma. Patient I.3 presented with CNS hemangioblastoma and pheo. Patient II.1 presented with pheo. Patients II.2, II.6 and II.7 presented with retinal capillary hemangioma.

CasePresentingHPOs: HP:0009711 (Retinal capillary hemangioma)

CaseHPOFreeText: Presented with retinal capillary hemangioma. Tumor detected at age 16.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: c.340+617C>G

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 827582, https://www.ncbi.nlm.nih.gov/clinvar/variation/827582/

CAID: N/A

gnomAD: N/A

VariantEvidence: These variants segregated in 6 patients of this family who developed VHL disease and were absent in 4 healthy tested descendants, indicating their presence on a single disease-associated allele. Sequencing of tumor DNA did not display loss of heterozygosity, suggesting that a WT VHL deletion (as observed in classic VHL disease) may not be a prerequisite in cells of patients with this specific VHL genotype.

MutationType: missense_variant;transversion; splice_site_variant

CivicName: c.340+617C>G and c.340+648T>C

MultipleGeneVariants: Germline, VHL, c.340+648T>C

PatientID: None (Father)

KindredID: F6

Case: M, Age Unknown, Ethnicity Unknown

DiseaseAssertion: Asymptomatic

FamilyInfo: N/A

CasePresentingHPOs: N/A

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.Q164H (c.492G>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 456566, https://www.ncbi.nlm.nih.gov/clinvar/variation/456566/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: Q164H (c.492G>T)

MultipleGeneVariants: N/A

PatientID: I (mother)

KindredID: F12

Case: F, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: 4 members of this family (I.mother, II.daughter, II.son, III.granddaughter) presented with pheochromocytoma and were found to have the P138= (c.414A>G) germline variant of the VHL gene.

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.P138= (c.414A>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223206, https://www.ncbi.nlm.nih.gov/clinvar/variation/223206/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition; synonymous_variant

CivicName: P138= (c.414A>G)

PatientID: I.1

KindredID: F10

Case: M, Age Unknown, Ethnicity Unknown

DiseaseAssertion: Asymptomatic

FamilyInfo: This patient’s partner and two children were all carriers of the D143= (c.429C>T) germline VHL variant. Their son was diagnosed with splenomegaly and polycythemia and was homozygous for the variant. All other family members were asymptomatic.

CasePresentingHPOs: N/A

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.D143= (c.429C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 416990, https://www.ncbi.nlm.nih.gov/clinvar/variation/416990/

CAID: N/A

gnomAD: 0.000007953, https://gnomad.broadinstitute.org/variant/3-10188286-C-T?dataset=gnomad_r2_1

VariantEvidence: N/A

MutationType: missense_variant;transition; synonymous_variant

CivicName: D143= (c.429C>T)

MultipleGeneVariants: N/A

PatientID: 57

KindredID: 57

Case: Sex Unknown, 16Y0M, Ethnicity Unknown

DiseaseAssertion: Pheochromocytoma

FamilyInfo: N/A

CasePresentingHPOs: HP:0002666 (pheochromocytoma)

CaseHPOFreeText: The patient had a single pheochromocytoma.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Patient information pulled from Supplemental Table 1. There is additional tumour specific information in Supplemental Table 2.

Variant: p.R167Q (c.500G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2216 https://www.ncbi.nlm.nih.gov/clinvar/variation/2216/

CAID: N/A

gnomAD: 0.000003977 https://gnomad.broadinstitute.org/variant/3-10191507-G-A

VariantEvidence: Carbonic anhydrase 9 (CA9) mRNA level of 25.67 was detected. Membrane CA9 immunostaining was observed (supplemental table 1).

MutationType: missense_variant;transition

CivicName: R167Q (c.500G>A)

MultipleGeneVariants: N/A

PatientID: 74

KindredID: 74

Case: Sex Unknown, 31Y0M, Ethnicity Unknown

DiseaseAssertion: Assumed VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: Single benign PCC.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Patient information pulled from Supplemental Table 1a.

Variant: Complete Deletion (c.1-?_642+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: Carbonic anhydrase 9 (CA9) mRNA level of 34.31 was detected. Membrane CA9 immunostaining was observed.

MutationType: deletion

CivicName: Deletion

MultipleGeneVariants: N/A

PatientID: 47

KindredID: 47

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: Assumed VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: Bilateral pheochromocytoma.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Patient information pulled from Supplemental Table 1b.

Variant: p.Y156S (c.467A>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351756049

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: Y156S (c.467A>C)

MultipleGeneVariants: N/A

PatientID: None

KindredID: Family C

Case: M, 54Y0M, Ethnicity Unknown

DiseaseAssertion: Assumed VHL

FamilyInfo: There was no family history of VHL disease or familial pheochromocytoma. Her parents (mother age 85, father age 79) were asymptomatic and were not available for DNA testing. A 58-year-old maternal half-brother was tested and did not carry the mutation.

CasePresentingHPOs: HP:0006748, HP:0000107, HP:0009713 (adrenal pheochromocytoma, renal cyst, spinal hemangioblastoma)

CaseHPOFreeText: The patient had bilateral pheochromocytoma. A small vascular lesion was identified by a screening MRI, which that authors of the papers assumed could possibly a spinal hemangioblastoma,

CaseNotHPOs: None

CaseNotHPOFreeText: No other central nervous system abnormalities were detected and her ophthalmologic examination was normal.

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.V84L (c.250G>T)

LegacyVariant: p.V84L (c.463G>T)

ClinVar: 2236 https://www.ncbi.nlm.nih.gov/clinvar/variation/2236/

CAID: CA020170 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.250G%3ET

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: V84L (c.250G>T)

MultipleGeneVariants: N/A

PatientID: II1(Ca01)

KindredID: C

Case: F, 37Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Patient’s father (I-2) presented with hemangioblastoma and possessed the same exon 2 deletion. The patient’s two siblings also possessed the deletion. The sister (II-3) had retinoblastoma, pancreatic cyst and pheochromocytoma, while the other sibling (II-5) had hemangioblastoma, pancreatic cyst, and clear cell renal carcinoma. The patient and her two siblings each had a child and all possessed the same deletion, but did not exhibit phenotypes (Please see Figure 1. Family C matches with Pedigree B).

CasePresentingHPOs: HP:0010797 (Hemangioblastoma)

CaseHPOFreeText: Patient presented with a CNS hemangioblastoma and had surgery one time.

CaseNotHPOs: HP:0001737; HP:0006770; HP:0002666; HP:0009919 (Pancreatic cysts; Clear cell renal cell carcinoma, pheochromocytoma, retinoblastoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: Exon 2 Deletion

LegacyVariant: N/A

CaseProblemVariantFreeText: large fragment deletion in exon 2

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: Variant reported as GRCh37 chr3:10188300ATATCACACTGCCA>T in paper

MutationType: minus_2_frameshift_variant; deletion

CivicName: Exon 2 (deletion)

MultipleGeneVariants: N/A

PatientID: I2(Cd01)

KindredID: C

Case: M, 81Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: All the patient’s 3 children possess the same exon 2 deletion. One daughter (II-1) presented with a CNS hemangioblastoma, the other daughter (II-3) had retinoblastoma, pancreatic cyst and pheochromocytoma, the other child (II-5) had hemangioblastoma, pancreatic cyst, and clear cell renal carcinoma. Each of the three children of the patient had a child each. All three grandchildren possessed the same deletion, but did not exhibit phenotypes (Please see Figure 1. Family C matches with Pedigree B).

CasePresentingHPOs: HP:0010797 (Hemangioblastoma)

CaseHPOFreeText: Patient presented with a CNS hemangioblastoma.

CaseNotHPOs: HP:0001737; HP:0006770; HP:0002666; HP:0009919 (Pancreatic cysts; Clear cell renal cell carcinoma, pheochromocytoma, retinoblastoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: Exon 2 Deletion

LegacyVariant: N/A

CaseProblemVariantFreeText: large fragment deletion in exon 2

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: Variant reported as GRCh37 chr3:10188300ATATCACACTGCCA>T in paper

MutationType: minus_2_frameshift_variant; deletion

CivicName: Exon 2 (deletion)

MultipleGeneVariants: N/A

PatientID: III1(Ca001)

KindredID: C

Case: F, Age Unknown, Ethnicity Unknown

DiseaseAssertion: Asymptomatic

FamilyInfo: The patient’s grandfather (I-2) presented with hemangioblastoma and possessed the same exon 2 deletion. The patient’s mother also possessed the deletion and had hemangioblastoma. Mother’s sister (II-3) had retinoblastoma, pancreatic cyst and pheochromocytoma, while the mother’s other sibling (II-5) had hemangioblastoma, pancreatic cyst, and clear cell renal carcinoma. The patient’s 2 cousins each possessed the same deletion, but did not exhibit phenotypes (Please see Figure 1. Family C matches with Pedigree B).

CasePresentingHPOs: N/A

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0010797; HP:0006770; HP:0001737; HP:0002666; HP:0009919 (Hemangioblastoma; clear cell renal cell carcinoma; pancreatic cysts; pheochromocytoma, retinoblastoma)

CaseNotHPOFreeText: Patient did not present with any symptoms.

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: Exon 2 Deletion

LegacyVariant: N/A

CaseProblemVariantFreeText: large fragment deletion in exon 2

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: Variant reported as GRCh37 chr3:10188300ATATCACACTGCCA>T in paper

MutationType: minus_2_frameshift_variant; deletion

CivicName: Exon 2 (deletion)

MultipleGeneVariants: N/A

PatientID: 14

KindredID: AD

Case: F, 50Y0M, Indian

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; HP:0001737; HP:0005584 (Hemangioblastoma, Pancreatic cysts, Renal cell carcinoma)

CaseHPOFreeText: Multi-cystic pancreatic lesions, RCC and CNS hemangioblastoma.

CaseNotHPOs: HP:0009711; HP:0002666; HP:0030393 (Retinal capillary hemangioma, Pheochromocytoma, Endolymphatic sac tumor)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.G114D (c.340+1G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223190, https://www.ncbi.nlm.nih.gov/clinvar/variation/223190/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: splice_site_variant; missense_variant;transition

CivicName: G114D (c.340+1G>A) and c.340+5G>C

MultipleGeneVariants: Germline, VHL, c.340+5G>C

PatientID:18

KindredID: D

Case: M, 46Y0M, Indian

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0009711, HP:0002666 (retinal capillary hemangioma, pheochromocytoma)

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0001737, HP:0010797, HP:0005584, HP:0030393 (pancreatic cyst, hemangioblastoma, renal cell carcinoma, endolymphatic sac tumor)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167W (c.499C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2218 https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: N/A

gnomAD: 0.000007 https://gnomad.broadinstitute.org/variant/3-10191506-C-T?dataset=gnomad_r2_1

VariantEvidence: N/A

MutationType: missense_transition

CivicName: R167W(c.499C>T)

MultipleGeneVariants: N/A

PatientID: 29

KindredID: PM

Case: F, 35Y0M, Indian

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0001737 (Pancreatic cysts)

CaseHPOFreeText: Multi-cystic pancreatic lesions.

CaseNotHPOs: HP:0010797; HP:0030393; HP:0009711; HP:0002666; HP:0005584 (Hemangioblastoma, Endolymphatic sac tumor, Retinal capillary hemangioma, Pheochromocytoma, Renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: Complete Deletion

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: This variant is noted as a full-length deletion involving genes BRK1 and FANCD2.

MutationType: deletion

CivicName: Deletion

MultipleGeneVariants: N/A

PatientID: 21

KindredID: NS

Case: M, 35Y0M, Indian

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0009711; HP:0010797; HP:0005584 (Retinal capillary hemangioma, Hemangioblastoma, Renal cell carcinoma)

CaseHPOFreeText: RCC, retinal angioma and CNS hemangioblastoma.

CaseNotHPOs: HP:0001737; HP:0030393; HP:0002666 (Pancreatic cysts, Endolymphatic sac tumor, Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: Exon 3 Deletion (c.464-?_642+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: Exon 3 Deletion

MultipleGeneVariants: N/A

PatientID: None

KindredID: 1

Case: F, 39Y0M, Ethnicity Unknown

DiseaseAssertion: Clear cell renal cell carcinoma

FamilyInfo: N/A

CasePresentingHPOs: HP:0006770 (Clear cell renal cell carcinoma)

CaseHPOFreeText: A 57-year-old Caucasian woman with an unremarkable past medical history presented with lumbar pain. Physical examination revealed a mass on the right flank. An FDG-PET scan revealed a renal mass highly suggestive of malignancy, signs of liver spread, and pelvic and lumbar spinal cord bone metastases. Open right radical nephrectomy was performed. The histopathologic report revealed Fuhrman grade 4 advanced ccRCC. New response assessment after 2 cycles of treatment revealed disease progression with new liver and bone lesions and clinical deterioration. In August 2015, a new solitary bone metastasis arose in the skull, whereas others remained with no change.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplementary eTable1

Variant: p.W88L (c.263G>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351750675, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_canonicalid?canonicalid=CA351750675

gnomAD: N/A

VariantEvidence: VHL and MTOR variants were not explicitly stated to be germline in the text but were not present in Supplementary eTable 1 where variants present in tumor/metastasis and absent in blood are listed. The number of tumor mutations (single nucleotide variants and indels) leading to nonsynonymous coding or loss-of-function (LOF) variants in the primary tumor was 160. Tumor mutations refer to those detected in the tumor but absent in the blood. In total, 116, 76, and 65 mutations were detected in each of the 3 tumor regions and from these, 41 were shared. Among the shared tumor mutations, 39 were missense variants and 2 were LOF variants caused by frameshifts. The variants affecting genes frequently mutated in ccRCC were detected in all tumor samples analyzed: VHL (c.263G>T; p.W88L), BAP1 (c.1359dup; p.E454Rfs*15), and MTOR (c.5920T>C; p.Y1974H). For a comprehensive list of somatic variants see Supplementary eTable1.

MutationType: missense_variant;transversion

CivicName: W88L (c.263G>T)

MultipleGeneVariants: Germline, MTOR, c.5920T>C (p.Tyr1974His) MultipleGeneVariants: Somatic, BAP1, c.1359dup (p.Glu454Argfs*15)

PatientID: 2

KindredID: 2

Case: M, 10Y6M, Ethnicity Unknown

DiseaseAssertion: adrenal pheochromocytoma

FamilyInfo: de novo mutation found: his parents were said to have tested negative for the mutation (neither parent had this R167W mutation). All other family history was negative.

CasePresentingHPOs: HP:0006748 (adrenal pheochromocytoma)

CaseHPOFreeText: this patient was described to be practically asymptomatic, with an incidental finding: Diagnosed with adrenal incidentaloma, he had intermittent abdominal pain for 6 months (beginning at age 10Y). CT scan showed a left adrenal solid tumor (3x3cm) with no calcifications; I-MIBG was normal; he underwent an adrenalectomy for this pheochromocytoma.

CaseNotHPOs: N/A

CaseNotHPOFreeText: brain and spinal cord MRI, ophthal-moscopy, whole body CT scan and ultrasonography of the testes, showed no abnormalities.

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167W (c.499C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2218, https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: N/A

gnomAD: 0.000007954, https://gnomad.broadinstitute.org/variant/3-10191506-C-T?dataset=gnomad_r2_1

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

GroupID/ KindredID: 12

Case: Age unknown, Sex unknown, Polish

DiseaseAssertion: VHL

FamilyInfo: This mutation was found in Family No. 12 with 1 member affected. There was no family history of VHL, however the parents were not tested (No confirmed de novo)

CasePresentingHPOs: HP:0009711; HP:0010797 (retinal capillary hemangioma, hemangioblastoma)

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0005584 (renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.S111R (c.333C>G)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 223187 https://www.ncbi.nlm.nih.gov/clinvar/variation/223187/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: S111R (c.333C>G)

MultipleGeneVariants: N/A

GroupID/ KindredID: 10

DiseaseAssertion: VHL

GroupSize: 4

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: Polish

GroupAgeRange: N/A

GroupInfo: Familial VHL stated; 4 family members recorded with this mutation.

GroupPresentingHPOs: HP:0009711; HP:0010797; HP:0005584 (retinal capillary hemangioma, hemangioblastoma; renal cell carcinoma)

GroupHPOFreeText: 4 patients were tallied with a retinal capillary hemangiomas, 3 with cHemangioblastomas, and 1 with RCC. These phenotypes couldn’t be paired as it was not clear.

GroupNotHPOs: N/A

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.N78I (c.233A>T)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 223169 https://www.ncbi.nlm.nih.gov/clinvar/variation/223169/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: N78I (c.233A>T)

MultipleGeneVariants: N/A

GroupID/ KindredID: 15

Case: Age unknown, Sex unknown, Polish

DiseaseAssertion: VHL

FamilyInfo: This mutation (p.R161* (c.481C>T)) was found in Family No. 15 with 1 member affected.

CasePresentingHPOs: HP:0009711; HP:0010797; HP:0005584 (retinal capillary hemangioma, hemangioblastoma, renal cell carcinoma)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R161* (c.481C>T)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 2217 https://www.ncbi.nlm.nih.gov/clinvar/variation/2217/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: R161* (c.481C>T)

MultipleGeneVariants: N/A

GroupID/ KindredID: 28

PatientID: IV

Case: 62Y0M, Sex unknown, Polish

DiseaseAssertion: VHL

FamilyInfo: Family 28 consisted of 4 members; one relative (age 27Y) was found with multiple cerebellar HABs at 25Y, and multiple spinal HABs, another was diagnosed with a single cerebellar HAB at 24Y, and a final relative (40Y), was diagnosed at 30Y with multiple cerebellar HABs, and multiple spinal HABs

CasePresentingHPOs: HP:0006880 (cerebellar hemangioblastoma)

CaseHPOFreeText: Patient was diagnosed with a single HAB at 62Y.

GroupNotHPOs: HP:0009713; HP:0009711; HP:0005584 (spinal hemangioblastoma, retinal capillary hemangioma; renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: complete deletion of VHL gene

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: Haplotype analysis information in Table 3

MutationType: deletion

CivicName: deletion

MultipleGeneVariants: N/A

GroupID/ KindredID: 28

PatientID: III

Case: 40Y0M, Sex unknown, Polish

DiseaseAssertion: VHL

FamilyInfo: Family 28 consisted of 4 members; one relative (age 27Y) was found with multiple cerebellar HABs at 25Y, and multiple spinal HABs, another was diagnosed with a single cerebellar HAB at 24Y, and a final relative (62Y), diagnosed with a single HAB.

CasePresentingHPOs: HP:0009713; HP:0006880 (spinal hemangioblastoma, cerebellar hemangioblastoma)

CaseHPOFreeText: Patient was diagnosed at 30Y with multiple cerebellar HABs, and multiple spinal HABs

GroupNotHPOs: HP:0009711; HP:0005584 (retinal capillary hemangioma; renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: complete deletion of VHL gene

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: Haplotype analysis information in Table 3

MutationType: deletion

CivicName: deletion

MultipleGeneVariants: N/A

GroupID/ KindredID: 28

PatientID: I

Case: 27Y0M, Sex unknown, Polish

DiseaseAssertion: VHL

FamilyInfo: Family 28 consisted of 4 members; one relative (age 24Y) diagnosed with a single cerebellar HAB, another (40Y) diagnosed at 30Y with multiple cerebellar HABs, and multiple spinal HABs, and a final relative (62Y), diagnosed with a single HAB.

CasePresentingHPOs: HP:0009713; HP:0006880 (spinal hemangioblastoma, cerebellar hemangioblastoma)

CaseHPOFreeText: Patient was found with multiple cerebellar HABs at 25Y, and multiple spinal HABs

GroupNotHPOs: HP:0009711; HP:0005584 (retinal capillary hemangioma; renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: complete deletion of VHL gene

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: Haplotype analysis information in Table 3

MutationType: deletion

CivicName: deletion

MultipleGeneVariants: N/A

GroupID/ KindredID: 7

DiseaseAssertion: VHL

GroupSize: 2

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: Polish

GroupAgeRange: N/A

GroupInfo: Familial VHL stated; 2 family members recorded with this mutation.

GroupPresentingHPOs: HP:0009711; HP:0010797 (retinal capillary hemangioma, hemangioblastoma)

GroupHPOFreeText: 1 patient was tallied with a retinal capillary hemangioma and both (2) with cHemangioblastomas.

GroupNotHPOs: HP:0005584 (renal cell carcinoma)

GroupNotHPOFreeText: None of the patients were recorded to have RCC

GroupPreviousTesting: N/A

PreviouslyPublished: 32179488

SupplementalData: N/A

Variant: p.F76del (c.226_228delTTC)

CaseProblemVariantFreeText: NM_000551.3:c.226_228delTTC automaps to updated c.227_229delTCT

LegacyVariant: N/A

ClinVarID: N/A

CAID: CA357012 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.226_228delTTC

gnomAD: N/A

VariantEvidence: N/A

MutationType: inframe_deletion

CivicName: F76del (c.227_229del)

MultipleGeneVariants: N/A

PatientID: 1 (case)

KindredID: 1

Case: F, 32Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: The patient’s mother had a history of hemangioblastoma located in thoracic cord, however no testing was mentioned

CasePresentingHPOs: HP:0001737; HP:0009713 (pancreatic cysts, spinal hemangioblastoma)

CaseHPOFreeText: she presented with 2-month history of severe glutea and right leg pain. At 32Y, MRI showed a well-demarcated, ellipsoidal mass at the level of L5 which almost completely obliterated the spinal canal (originally thought to be a cauda equine nerve sheath tumour). Immunohistology confirmed a hemangioblastoma. MRI scans of abdomen displayed multiple cysts of the pancreatic body

CaseNotHPOs: HP:0010797; HP:0000107 (hemangioblastoma, renal cyst)

CaseNotHPOFreeText: There are no other tumours in brain scans; MRI scans of abdomen displayed but no change in renal

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.E94*(c.280G>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 584477 https://www.ncbi.nlm.nih.gov/clinvar/variation/584477/

CAID: N/A

gnomAD: N/A

VariantEvidence: Not explicitly said to be germline. However family history gives presumption, and: “the final diagnosis of VHL is based on the VHL gene mutation analysis and the demonstration of clinical manifestation”. On immunohistochemistry, the endothelial cells were positive for CD31 and CD34, and the stromal were positive for NSE and vimentin, were negative for Ki-67/MIB-1, GFAP and AE1/AE3, EMA, S-100 and P53

MutationType: stop_gained

CivicName:p.E94*(c.280G>T)

MultipleGeneVariants: N/A

PatientID: V-PH-34T

KindredID: 6

Case: M, 40Y0M, Ethnicity Unknown

DiseaseAssertion: assumed VHL

FamilyInfo: A family history of VHL associated phenotypes was given. This patient is said to be the sibling of V-PH-33T with the germline VHL mutation: p.W117S (c.350G>C). V-PH-35T is also said to be a sibling, with the VHL mutation p.Arg161Ter.

CasePresentingHPOs: HP:0006748; HP0010797; HP:0100565 (adrenal pheochromocytoma, hemangioblastoma, hydromyelia)

CaseHPOFreeText: diagnosed with left adrenal phaeochromocytoma at age 40Y, surgery the same year. He also had a personal history including recurrent pheaochromocytoma and hemangioblastomas, and hydromyelia. He also had raised noradrenaline and normetanephrine levels

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET, SDHA, SDHB, SDHC, TMEM127

PreviouslyPublished: Likely; 26796762 (ID: RNSH10)

SupplementalData: Yes (see table S1 and S10)

Variant: p.R161* (c.481C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: Patient given as ENSP00000256474.2:p.Arg161Ter/ENSP00000256474.2:p.Arg200GlyfsTer2

ClinVarID: 2217, https://www.ncbi.nlm.nih.gov/clinvar/variation/2217/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: CivicName: R161* (c.481C>T) AND R200fs (c.598del)

MultipleGeneVariants: Germline, KIF1B, c.184-6_184-5del; Germline, KIF1B, c.608+8dup; Somatic, VHL, c.delC; Germline, VHL, c.598del (p.Arg200GlyfsTer2)

PatientID: 8

KindredID: B

Case: Sex Unknown, 42Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Positive VHL family history.

CohortInfo: 10 VHL patients with renal cell carcinoma and a definite VHL family history.

CasePresentingHPOs: HP:0010797, HP:0005584 (hemangioblastoma, renal cell carcinoma

CaseHPOFreeText: The patient had a hemangioblastoma diagnosed at age 30. The patient was diagnosed with renal cell carcinoma at age 38. A nephron-sparing surgery was performed on the left side. He was found to have one lesion with a diameter of 5.5 cm. The tumour had invaded and broken through the pseudocapasule. The patient was found to have a cyst on the right nephron.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167Q (c.500G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2216 https://www.ncbi.nlm.nih.gov/clinvar/variation/2216/

CAID: N/A

gnomAD: 0.000003977 https://gnomad.broadinstitute.org/variant/3-10191507-G-A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: R167Q (c.500G>A)

MultipleGeneVariants: N/A

PatientID: IV-5

KindredID: 2

Case: F, Age Unknown, German

DiseaseAssertion: VHL

FamilyInfo: Family 2 is comprised of 131 individuals over six generations including 65 members (50% of those at risk) with VHL type 2A (72% clinically affected, 12% obligate carriers, and 15% positive genetic analysis alone) and nearly equal gender distribution for affected status (54% male). An additional six members (II-3, II-4, II -5, III-1, III-2, and III-3) are suspected to have VHL without confirmation. Of note, the nuclear family (branch IV-13) contains 13 siblings, of whom 12 have been diagnosed with pheo. The presenting tumor types in Family 2 were pheo (70%), HB (17%), and RA (13%). No Family 2 member had RCC as the initial manifestation. Distribution of HB and RA are not described except for patient IV-8.

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0005584 (Renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 7759077

SupplementalData: N/A

Variant: p.Y98H (c.292T>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2223, https://www.ncbi.nlm.nih.gov/clinvar/variation/2223/

CAID: N/A

gnomAD: 0.00001343, https://gnomad.broadinstitute.org/variant/3-10183823-T-C

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: Y98H (c.292T>C)

MultipleGeneVariants: N/A

PatientID: V-4

KindredID: 2

Case: M, Age Unknown, German

DiseaseAssertion: VHL

FamilyInfo: Family 2 is comprised of 131 individuals over six generations including 65 members (50% of those at risk) with VHL type 2A (72% clinically affected, 12% obligate carriers, and 15% positive genetic analysis alone) and nearly equal gender distribution for affected status (54% male). An additional six members (II-3, II-4, II -5, III-1, III-2, and III-3) are suspected to have VHL without confirmation. Of note, the nuclear family (branch IV-13) contains 13 siblings, of whom 12 have been diagnosed with pheo. The presenting tumor types in Family 2 were pheo (70%), HB (17%), and RA (13%). No Family 2 member had RCC as the initial manifestation. Distribution of HB and RA are not described except for patient IV-8.

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0005584 (Renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 7759077

SupplementalData: N/A

Variant: p.Y98H (c.292T>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2223, https://www.ncbi.nlm.nih.gov/clinvar/variation/2223/

CAID: N/A

gnomAD: 0.00001343, https://gnomad.broadinstitute.org/variant/3-10183823-T-C

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: Y98H (c.292T>C)

MultipleGeneVariants: N/A

PatientID: V-11

KindredID: 2

Case: F, Age Unknown, German

DiseaseAssertion: VHL (Asymptomatic)

FamilyInfo: Family 2 is comprised of 131 individuals over six generations including 65 members (50% of those at risk) with VHL type 2A (72% clinically affected, 12% obligate carriers, and 15% positive genetic analysis alone) and nearly equal gender distribution for affected status (54% male). An additional six members (II-3, II-4, II -5, III-1, III-2, and III-3) are suspected to have VHL without confirmation. Of note, the nuclear family (branch IV-13) contains 13 siblings, of whom 12 have been diagnosed with pheo. The presenting tumor types in Family 2 were pheo (70%), HB (17%), and RA (13%). No Family 2 member had RCC as the initial manifestation. Distribution of HB and RA are not described except for patient IV-8.

CasePresentingHPOs: N/A

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0005584; HP:0002666 (Renal cell carcinoma, Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 7759077

SupplementalData: N/A

Variant: p.Y98H (c.292T>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2223, https://www.ncbi.nlm.nih.gov/clinvar/variation/2223/

CAID: N/A

gnomAD: 0.00001343, https://gnomad.broadinstitute.org/variant/3-10183823-T-C

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: Y98H (c.292T>C)

MultipleGeneVariants: N/A

PatientID: V-30

KindredID: 2

Case: M, Age Unknown, German

DiseaseAssertion: VHL

FamilyInfo: Family 2 is comprised of 131 individuals over six generations including 65 members (50% of those at risk) with VHL type 2A (72% clinically affected, 12% obligate carriers, and 15% positive genetic analysis alone) and nearly equal gender distribution for affected status (54% male). An additional six members (II-3, II-4, II -5, III-1, III-2, and III-3) are suspected to have VHL without confirmation. Of note, the nuclear family (branch IV-13) contains 13 siblings, of whom 12 have been diagnosed with pheo. The presenting tumor types in Family 2 were pheo (70%), HB (17%), and RA (13%). No Family 2 member had RCC as the initial manifestation. Distribution of HB and RA are not described except for patient IV-8.

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0005584 (Renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 7759077

SupplementalData: N/A

Variant: p.Y98H (c.292T>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2223, https://www.ncbi.nlm.nih.gov/clinvar/variation/2223/

CAID: N/A

gnomAD: 0.00001343, https://gnomad.broadinstitute.org/variant/3-10183823-T-C

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: Y98H (c.292T>C)

MultipleGeneVariants: N/A

PatientID: 29

KindredID: 6

Case: F, 19Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: 2 members of this family, IDs #28 (13Y, M) and #29 (19Y, F) presented with the same variant and pheochromocytoma. Patient #28 also presented with head and neck as well as abdominal paraganglioma.

CohortInfo: Thirty-one subjects were included in this study consisting of 16 SDHB mutation carriers and 15 subjects with VHL disease followed-up between 1975 and 2008. Subjects were included in the study if they had complete imaging from the base of the skull to the pelvis and measurements of urinary or plasma catecholamines. The case-notes and hospital databases were examined for the required data, which included: age at first symptom/diagnosis, family history, disease penetrance, site and size of tumor, symptoms, secretion of catecholamines, multifocal disease, metastatic disease, treatment and disease outcome.

CasePresentingHPOs: HP:0009711 (Pheochromocytoma)

CaseHPOFreeText: Asynchronous multifocal pheochromocytoma. 19Y at VHL diagnosis.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.L118R (c.353T>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 428802, https://www.ncbi.nlm.nih.gov/clinvar/variation/428802/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: L118R (c.353T>G)

MultipleGeneVariants: N/A

PatientID: 1

KindredID: 1

Case: F, 42Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; HP:0030393; HP:0002315; HP:0002321 (Hemangioblastoma, Endolymphatic sac tumor, Headache, Vertigo)

CaseHPOFreeText: Admitted with complaints of a 15-day history of intermittent headaches and dizziness, without nausea and vomiting. Computed tomography (CT) revealed a giant mass lesion with mixed density in the right CPA region along with the destroyed petrous bone, and a low density space-occupying lesion in the left cerebellar hemisphere. Cranial MRI described two tumors in the right CPA region and in the left cerebellar hemisphere. A classic radiological feature of hemangioblastoma was observed in the left cerebellar hemisphere which was supported by post-operative biopsy.

CaseNotHPOs: HP:0002012 (Abnormality of the abdominal organs)

CaseNotHPOFreeText: No abnormal physical and laboratory examination, including abdominal CT, were found.

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.Y98Afs*37 (c.282_291dup)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA2573050500, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_canonicalid?canonicalid=CA2573050500

gnomAD: N/A

VariantEvidence: 291st site of Exon 1 was insertion of 10 nucleotides (GCCGCAGCCC).

MutationType: plus_1_frameshift_variant; duplication

CivicName: p.Y98Afs (c.282_291dup)

MultipleGeneVariants: N/A

PatientID: Case 8

KindredID: 8

Case: Gender Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0006880 (Cerebellar hemangioblastoma)

CaseHPOFreeText: No individual phenotypic information was given.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.G93A(c.278G>C)

LegacyVariant: N/A

ClinVarID: N/A

CAID: CA351750780, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_canonicalid?canonicalid=CA351750780

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: G93A(c.278G>C)

MultipleGeneVariants: N/A

PatientID: V87

KindredID: V87

Case: Sex Unknown, Age Unknown, Sex Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CohortInfo: 92 unrelated patients with VHL disease.

CasePresentingHPOs: HP:0002666 (pheochromocytoma)

CaseHPOFreeText: This family was classified as VHL type 2B meaning they had a pheochromocytoma and presence of renal and pancreatic manifestations.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.Y156D(c.466T>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351756043 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.466T%3EG

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName:Y156D(c.466T>G)

MultipleGeneVariants: N/A

GroupID: V8

DiseaseAssertion: VHL

GroupSize: 14

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: French

GroupAgeRange: N/A

GroupInfo: Patients are grouped by family.

FamilyInfo: 14/27 members of this family that underwent genetic testing had the same mutation.

GroupPresentingHPOs: N/A

GroupHPOFreeText: Diagnosed with VHL Type 1.

GroupNotHPOs: HP:0002666 (Pheochromocytoma)

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.T105P (c.313A>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 496055, https://www.ncbi.nlm.nih.gov/clinvar/variation/496055/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: T105P (c.313A>C)

MultipleGeneVariants: N/A

PatientID: V233

KindredID: V233

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: One unaffected family members were tested and found to be negative. No other family history was available.

CohortInfo: 92 unrelated patients with VHL disease.

CasePresentingHPOs: HP:0002666 (pheochromocytoma)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.N131K(c.393C>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 420074 https://www.ncbi.nlm.nih.gov/clinvar/variation/420074/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName:N131K(c.393C>A)

MultipleGeneVariants: N/A

PatientID: V262

KindredID: V262

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167Q (c.500G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2216 https://www.ncbi.nlm.nih.gov/clinvar/variation/2216/

CAID: N/A

gnomAD: 0.000003977 https://gnomad.broadinstitute.org/variant/3-10191507-G-A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: R167Q (c.500G>A)

MultipleGeneVariants: N/A

PatientID: 14

KindredID: 14

Case: M, 26Y0M, Ethnicity unknown

DiseaseAssertion: pancreatic endocrine tumor

FamilyInfo: None

CasePresentingHPOs: HP:0030405 (pancreatic endocrine tumor)

CaseHPOFreeText: See Table 1 for more information

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.V170G (c.509T>G)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: N/A

CAID: CA351756196 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.509T%3EG

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: V170G (c.509T>G)

MultipleGeneVariants: N/A

PatientID: 3

KindredID: 3

Case: F, 34Y0M, Ethnicity unknown

DiseaseAssertion: pancreatic endocrine tumor

FamilyInfo: None

CasePresentingHPOs: HP:0030405 (pancreatic endocrine tumor)

CaseHPOFreeText: See Table 1 for more information

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: c.340+1G>A

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 223190 https://www.ncbi.nlm.nih.gov/clinvar/variation/223190/

CAID: CA357042 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.340%2B1G%3EA

gnomAD: N/A

VariantEvidence: N/A

MutationType: splice_site_variant

CivicName: c.340+1G>A

MultipleGeneVariants: N/A

PatientID: 2

KindredID: 2

Case: F, 28Y0M, Ethnicity unknown

DiseaseAssertion: pancreatic endocrine tumor

FamilyInfo: None

CasePresentingHPOs: HP:0030405 (pancreatic endocrine tumor)

CaseHPOFreeText: See Table 1 for more information

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167W (c.499C>T)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 2218 https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: CA020450 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.499C%3ET

gnomAD: 0.000007954 https://gnomad.broadinstitute.org/variant/3-10191506-C-T?dataset=gnomad_r2_1

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

PatientID: 7

KindredID: 7

Case: M, 26Y0M, Ethnicity unknown

DiseaseAssertion: pancreatic endocrine tumor

FamilyInfo: None

CasePresentingHPOs: HP:0030405 (pancreatic endocrine tumor)

CaseHPOFreeText: See Table 1 for more information

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: N/A; Null (large rearrangement)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: rearrangement_region

CivicName: Rearrangement

MultipleGeneVariants: N/A

PatientID: S-FPH1

KindredID: S-FPH1

Case: F, 60Y0M, Korean

DiseaseAssertion: VHL

FamilyInfo: 2 affected individuals in this family. Pheochromocytoma is noted as familial.

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: Bilateral pheochromocytoma. Diagnosed with VHL type 2C.

CaseNotHPOs: HP:0005584; HP:0010797 (Renal cell carcinoma, Hemangioblastoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 25078357

SupplementalData: N/A

Variant: p.V84L (c.250G>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2236, https://www.ncbi.nlm.nih.gov/clinvar/variation/2236/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: V84L (c.250G>T)

MultipleGeneVariants: N/A

PatientID: 3

KindredID: K-V7/V6

Case: M, Age Unknown, Korean

DiseaseAssertion: VHL

FamilyInfo: The proband (ID 1) was affected with retinal hemangioblastoma, bilateral pheochromocytoma, and pancreatic tumor. The daughter (ID 2) was affected with retinal hemangioblastoma and bilateral pheochromocytoma. The son (ID 3) was affected with retinal hemangioblastoma. All three were positive for the D121N (c.361G>A) germline variant of the VHL gene.

CasePresentingHPOs: HP:0009711 (Retinal capillary hemangioma)

CaseHPOFreeText: Retinal hemangioblastomas, pancreatic tumor and bilateral pheochromocytoma. Diagnosed with VHL type 2.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.D121N (c.361G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351753750, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_canonicalid?canonicalid=CA351753750

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: D121N (c.361G>A)

MultipleGeneVariants: N/A

PatientID: 18

KindredID: F01

Case: M, Age Unknown, Unknown Ethnicity

DiseaseAssertion: VHL

FamilyInfo: A total of 12 members of this family (F01) had a complete deletion of the VHL gene. Five of these patients (16, 18, 21, 33, 43) presented with clinical features of VHL. This family was previously published except for patients 43 and 48 which were newly diagnosed with VHL disease in the current study.

CasePresentingHPOs: HP:0010797; HP:0001737 (Hemangioblastoma, Pancreatic cysts)

CaseHPOFreeText: CNS hemangioblastoma and pancreatic cyst.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 17537157

SupplementalData: Figure 2.

Variant: Complete Deletion

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: Deletion of ~250.9kb resulted in deletion of the VHL gene.

MutationType: deletion

CivicName: Deletion

MultipleGeneVariants: N/A

PatientID: 37

KindredID: F01

Case: F, Age Unknown, Unknown Ethnicity

DiseaseAssertion: Asymptomatic

FamilyInfo: A total of 12 members of this family (F01) had a complete deletion of the VHL gene. Five of these patients (16, 18, 21, 33, 43) presented with clinical features of VHL. This family was previously published except for patients 43 and 48 which were newly diagnosed with VHL disease in the current study.

CasePresentingHPOs: N/A

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 17537157

SupplementalData: Figure 2.

Variant: Complete Deletion

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: Deletion of ~250.9kb resulted in deletion of the VHL gene.

MutationType: deletion

CivicName: Deletion

MultipleGeneVariants: N/A

PatientID: N/A (Case 1)

KindredID: 1

Case: Sex Unknown, 9Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Patient’s twin and 16Y0M sibling possessed the same VHL variant and had abnormal vestibular assessments.

CasePresentingHPOs: HP:0001756 (Vestibular hypofunction)

CaseHPOFreeText: Following a genetic VHL diagnosis, patient presented with no audiovestibular symptoms. Vestibular assessment highlighted an abnormal cVEMP showing a left-sided weakness.

CaseNotHPOs: HP:0009713; HP:0006880 (spinal hemangioblastoma; cerebellar hemangioblastoma)

CaseNotHPOFreeText: peripheral hearing assessment and screening MRI of brain/spine were normal.

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: Exon 1-3 Deletion

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: deletion

CivicName: Exon 1-3 Deletion

MultipleGeneVariants: N/A

PatientID: 15

KindredID: 503

Case: Sex unknown, Age unknown, French

DiseaseAssertion: VHL

FamilyInfo: One other member belonging to family 503 was mentioned (Patient: 7). This patient was found to have a pancreatic endocrine tumour, pheochromocytoma and renal cell carcinoma.

CasePresentingHPOs: HP:0030405 (pancreatic endocrine tumour)

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0002666; HP:0005584 (pheochromocytoma, renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.P86S (c.256C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 178692 https://www.ncbi.nlm.nih.gov/clinvar/variation/178692/

CAID: N/A

gnomAD: N/A

VariantEvidence:N/A

MutationType: missense_variant;transition

CivicName: P86S (c.256C>T)

MultipleGeneVariants: N/A

PatientID: 14

KindredID: 12

Case: Sex unknown, Age unknown, French

DiseaseAssertion: VHL

FamilyInfo: None

CasePresentingHPOs: HP:0030405; HP:0002666; HP:0005584 (pancreatic endocrine tumour, pheochromocytoma, renal cell carcinoma)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R82P (c.245G>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 193118 https://www.ncbi.nlm.nih.gov/clinvar/variation/193118/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: R82P (c.245G>C)

MultipleGeneVariants: N/A

PatientID: 13

KindredID: 354

Case: Sex unknown, Age unknown, French

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0002666; HP:0030405 (pheochromocytoma, pancreatic endocrine tumour)

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0005584 (renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167Q (c.500G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVar: 2216 https://www.ncbi.nlm.nih.gov/clinvar/variation/2216/

CAID: N/A

gnomAD: 0.000003977 https://gnomad.broadinstitute.org/variant/3-10191507-G-A

VariantEvidence:N/A

MutationType: missense_variant;transition

CivicName: R167Q (c.500 G >A)

MultipleGeneVariants: N/A

PatientID: 8

KindredID: 8

Case: Sex Unknown, 39Y0M, Ethnicity Unknown

DiseaseAssertion: clear cell renal cell carcinoma

FamilyInfo: N/A - not stated

CasePresentingHPOs: HP:0006770 (clear cell renal cell carcinoma)

CaseHPOFreeText: Clear cell RCC diagnosed first at 39Y was recorded

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Yes

Variant: c.340+578C>T

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 849869 https://www.ncbi.nlm.nih.gov/clinvar/variation/849869/

CAID: N/A

gnomAD: 0.0005097 https://gnomad.broadinstitute.org/variant/3-10184449-C-T

VariantEvidence: N/A

MutationType: splice_site_variant; intron_variant

CivicName: Splice Site (c.340+578C>T)

MultipleGeneVariants: N/A

PatientID: 2

KindredID: 2

Case: Sex Unknown, 35Y0M, Ethnicity Unknown

DiseaseAssertion: paraganglioma

FamilyInfo: N/A - not stated

CasePresentingHPOs: HP:0100635 (Carotid Paraganglioma)

CaseHPOFreeText: A carotid body PGL diagnosed first at 34Y was found, with follow up of a 1 year duration.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Yes

Variant: c.340+578C>T

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 849869 https://www.ncbi.nlm.nih.gov/clinvar/variation/849869/

CAID: N/A

gnomAD: 0.0005097 https://gnomad.broadinstitute.org/variant/3-10184449-C-T

VariantEvidence: N/A

MutationType: splice_site_variant; intron_variant

CivicName: Splice Site (c.340+578C>T)

MultipleGeneVariants: N/A

PatientID: None

KindredID: 16

Case: Sex Unknown, 31Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The patient's father had a hemangioblastoma of the central nervous system at age 45. He was deceased before diagnosis could occur. The patient's sister, daughter, and nephew were all confirmed to have the same genetic mutation but were asymptomatic.

CasePresentingHPOs: HP:0010797, HP:0005584, HP:0001732 (hemangioblastoma, renal cell carcinoma, abnormality of the pancreas)

CaseHPOFreeText: The patient presented with hemangioblastoma at age 18. Later at age 31, he/she presented with renal cell carcinoma and pancreatic cysts or tumours.

CaseNotHPOs: HP:0009711, HP:0002666, HP:0009715 (retinal capillary hemangioma, pheochromocytoma)

CaseNotHPOFreeText: The patient did not have epididymal or ovarian cystadenoma.

CasePreviousTesting: N/A

PreviouslyPublished:29330336

Variant: Exon 1 deletion

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVar: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: Exon 1 Deletion

MultipleGeneVariants: N/A

PatientID: None

KindredID: 7

Case: Unknown, 31Y0M, Chinese

DiseaseAssertion:VHL

FamilyInfo: None.

CasePresentingHPOs: HP:0010797, HP:0005584, HP:0001732, HP:0002666 (hemangioblastoma, renal cell carcinoma, abnormality of the pancreas, pheochromocytoma)

CaseHPOFreeText:The patient presented with hemangioblastoma and pheochromocytoma at age 30. One year later he was found to have renal cell carcinoma and pancreatic cysts or tumors.

CaseNotHPOs: HP:0009711(retinal capillary hemangioma)

CaseNotHPOFreeText: No epididymal/ovarian cystadenomas.

CasePreviousTesting: N/A

PreviouslyPublished: 29330336

Variant: p.V130L (c.388G>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2229 https://www.ncbi.nlm.nih.gov/clinvar/variation/2229/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: V130L (c.388G>C)

MultipleGeneVariants: N/A

PatientID: None

KindredID: 5

Case: Sex Unknown, 54, Chinese

DiseaseAssertion:VHL

FamilyInfo: Positive. The patient's nephew and niece although did not undergo genetic testing, presented with VHL associated conditions. The nephew had renal cell carcinoma at age 34 and cysts or tumours of the pancreas at age 37. The niece had renal cell carcinoma and cysts or tumours of the pancreas at age 35.

CasePresentingHPOs: HP:0005584, HP:0001732 (renal cell carcinoma, abnormality of the pancreas)

CaseHPOFreeText: The patient had renal cell carcinoma at age 37 and cysts or tumours of the pancreas at age 54.

CaseNotHPOs: HP:0002666, HP:0009715, HP:0010797, HP:000971(pheochromocytoma, Papillary cystadenoma of the epididymis, hemangioblastoma, retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 29330336

SupplementalData: N/A

Variant: p.Q73* (c.217C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223164 https://www.ncbi.nlm.nih.gov/clinvar/variation/223164/

CAID: N/A

gnomAD: N/A

VariantEvidence:N/A

MutationType: stop_gained

CivicName: Q73* (c.217C>T)

MultipleGeneVariants: N/A

PatientID: None

KindredID: 1

Case: Sex Unknown, 39Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: Positive. Patient's mother did not undergo genetic testing but had a hemangioblastoma at age 50 and a pancreatic cyst or tumour at age 62. The patient's sister also had this mutation but was asymptomatic. Another one of the patient's sisters presented with hemangioblastoma (age 40), renal cell carcinoma (age 43), and pancreatic cysts or tumours (age 43). This patient died before diagnosis. The proband's brother also died before diagnosis and presented with hemangioblastoma and retinal angioma at age 27.

CasePresentingHPOs: HP:0010797, HP:0005584, HP:0001732, HP:0009711 (hemangioblastoma, renal cell carcinoma, abnormality of the pancreas, retinal capillary hemangioma)

CaseHPOFreeText: The patient presented with hemangioblastoma at age 35. At age 37 she presented with retinal angioma and pancreatic cysts or tumours. At age 39 she presented with renal cell carcinoma.

CaseNotHPOs: HP:0002666, HP:0009715 (pheochromocytoma, Papillary cystadenoma of the epididymis)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 29330336

SupplementalData: N/A

Variant: p.Y98N (c.292T>A)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: N/A

CAID: CA351750883 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.292T%3EA

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: Y98N (c.292T>A)

MultipleGeneVariants: N/A

PatientID: 5

KindredID: 5

Case: M, 11Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: No details on family information.

CasePresentingHPOs: HP:0002666 (pheochromocytoma)

CaseHPOFreeText: Patient had clinical diagnosis of von Hippel Lindau syndrome and presented with pheochromocytoma.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: SBHB, SDHC, SDHD, SDHAF2, VHL, EPAS1 (exons 9 and 12), RET (exons 10–11 and 13–16), TMEM127 and MAX

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.V170G (c.509T>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351756196, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_canonicalid?canonicalid=CA351756196

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: V170G (c.509T>G)

MultipleGeneVariants: N/A

PatientID: VH5

KindredID: F3

Case: F, 26Y0M, Ethnicity Unknown

DiseaseAssertion: pheochromocytoma

FamilyInfo: Family history of pheo (type 2 VHL with no other lesions). two other family members are given: VH6, 54Y Male, and VH7, 25Y Male both with an isolated pheochromocytoma too.

CasePresentingHPOs: HP:0002666 (pheochromocytoma)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 24735130

SupplementalData: N/A

Variant: p.R82L (c.245G>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 526675 https://www.ncbi.nlm.nih.gov/clinvar/variation/526675/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: R82L (c.245G>T)

MultipleGeneVariants: N/A

PatientID: 5

KindredID: F03

Case: M, Age Unknown, Taiwanese

DiseaseAssertion: VHL

FamilyInfo: A total of 2 members of this family (F02) had a complete deletion of the VHL gene. One of these patients (3) presented with clinical features of VHL.

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0001737 (Hemangioblastoma, Renal cell carcinoma, Pancreatic cysts)

CaseHPOFreeText: Brain hemangioblastoma, pancreatic cyst, renal cell carcinoma.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Figure 1

Variant: Exon 3 Deletion (c.464-?_642+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: Deletion of 3.3kb resulted in deletion of Exon 3 in the VHL gene.

MutationType: exon_loss_variant

CivicName: Exon 3 Deletion

MultipleGeneVariants: Germline, FANCD2, deletion

PatientID: F1-II-3

KindredID: 1

Case: M, 30Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: This patients brother (F1-II-1) was a 31-year old male patient with pheochromocytoma, renal cell carcinoma, and epididymal papillary adenoma. The patients nephew (F1-III-1) was a 5 year old male with no clinical presentation, yet had the same VHL mutation.

CasePresentingHPOs: HP:0005584, HP:0030421, HP:0001737 (renal cell carcinoma, epididymal neoplasm, pancreatic cysts)

CaseHPOFreeText: presented with multiple right renal masses, epididymal nodules and multiple pancreatic cysts

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.N78S (c.233A>G)

LegacyVariant: N/A

ClinVar: 93326 https://www.ncbi.nlm.nih.gov/clinvar/variation/93326/

CAID: CA020131

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: N78S (c.233A>G)

MultipleGeneVariants: N/A