PatientID: 127

KindredID: 47

Case: F, 28Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0001737; HP:0001732; HP:0009711 (Hemangioblastoma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas, Retinal capillary hemangioma)

CaseHPOFreeText: The proband presented at age 25 with a CNS hemangioblastoma, retinal angioma, and renal cell carcinoma, and presented with multiple pancreatic cysts/tumors at age 28.

CaseNotHPOs: HP:0002666 (Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This kindred was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.E134_V142del (c.402_428del)

LegacyVariant: N/A

CaseProblemVariantFreeText: Variant listed in the paper as c.402-428delATTATTTGTGCCATCTCTCAATGTTGA, p.Glu134Aspfs*72. Listed protein change does not match deletion. Deletion is in-frame and should not lead to a frame shift. Variant updated in this annotation based on protein change listed in ClinGen/ listed on Variant Validator for c.402-428del.

ClinVarID: N/A

CAID: CA2573320387, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2573320387

gnomAD: N/A

VariantEvidence: N/A

MutationType: inframe_deletion

CivicName: E134_V142del (c.402_428del)

MultipleGeneVariants: N/A

PatientID: 175

KindredID: 69

Case: F, 35Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The male proband, patient 143, was diagnosed with renal cell carcinoma and multiple pancreatic cysts/tumors at age 33. His mother, who was not confirmed with the mutation, had a CNS hemangioblastoma at 30, retinal angioma at 54, and renal cell carcinoma at 50. His sister had a CNS hemangioblastoma at 28, and renal cell carcinoma/ multiple pancreatic cysts/tumors at 35. His niece, who was not confirmed with the mutation, had a CNS hemangioblastoma at age 12. His aunt had a CNS hemangioblastoma at 37, retinal angioma at 45, and renal cell carcinoma at 53. The son of his aunt was asymptomatic at the time of analysis.

CasePresentingHPOs: HP:0005584; HP:0001737; HP:0001732; HP:0010797 (Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas, Hemangioblastoma)

CaseHPOFreeText: The proband's sister presented with a CNS hemangioblastoma at age 28 and renal cell carcinoma and multiple pancreatic cysts/tumors at age 35.

CaseNotHPOs: HP:0002666; HP:0009711 (Pheochromocytoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.C162W (c.486C>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223227; https://www.ncbi.nlm.nih.gov/clinvar/variation/223227/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: C162W (c.486C>G)

MultipleGeneVariants: N/A

PatientID: 1 (Proband)

KindredID: 12

Case: M, 57Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: This patient had a father that was assumed to have the c.406T>C germline mutation of the VHL gene but was not confirmed genetically. His father presented with renal cell carcinoma and died at 47Y.

CasePresentingHPOs: HP:0010797; HP:0009711; HP:0000077; HP:0001732 (Hemangioblastoma, Retinal capillary hemangioma, Abnormality of the kidney, Abnormality of the pancreas)

CaseHPOFreeText: This patient presented with CNS hemangioblastoma (37Y), retinal angioma (27Y) and renal and pancreatic cyst or tumor (unspecified) (28Y).

CaseNotHPOs: HP:0002666; HP:0005584 (Pheochromocytoma, Renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplementary Table 1.

Variant: p.S65P (c.193T>C)

LegacyVariant: c.406T>C

CaseProblemVariantFreeText: N/A

ClinVarID: 547829, https://www.ncbi.nlm.nih.gov/clinvar/variation/547829/

CAID: N/A

gnomAD: N/A

VariantEvidence: Variant reference sequence is unclear in the current paper. After consulting the SickKids patient database, and finding the protein change to be recorded as: p.Ser65Pro, it was concluded that the current paper reported the cDNA change according to the legacy reference sequence (AF010238.1) and was mapped to c.193T>C (NM_000551.3).

MutationType: missense_variant;transition

CivicName: S65P (c.193T>C)

MultipleGeneVariants: N/A