GroupID/ KindredID: 62CE, 4873NCI

DiseaseAssertion: VHL

GroupSize: N/A

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: This germline familial VHL mutation was taken from multiple databases, including: the Munich, university of Freiburg and Institute of Pathology database, and the National Cancer Institute database, with an unknown number of members belonging to two family IDs: Family ID 62CE and 4873NCI. Table 4 lists all ID and mutations associated with individuals with pheochromocytoma.

GroupPresentingHPOs: HP:0002666 (pheochromocytoma)

GroupHPOFreeText: Described as 2 VHL families with pheochromocytoma. Other phenotypes are likely, including renal cell carcinoma, however not detailed here.

GroupNotHPOs: N/A

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.G93S (c.277G>A)

LegacyVariant: p.G93S (c.490G>A)

CaseProblemVariantFreeText: N/A

ClinVarID: 2237 https://www.ncbi.nlm.nih.gov/clinvar/variation/2237/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: G93S (c.277G>A)

MultipleGeneVariants: N/A

GroupID/ KindredID: 3682NCI

DiseaseAssertion: VHL

GroupSize: N/A

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: This germline familial VHL mutation was taken from the National Cancer Institute database, with an unknown number of members belonging to Family ID 3682NCI. Table 3 lists all ID and mutations associated with individuals possessing renal carcinoma, without pheochromocytoma. Additionally, this family ID is stated again in Table 3 under the mutation c.226T>A. Unclear if this is a typo, or if multiple mutations belong to this one family.

GroupPresentingHPOs: HP:0005548 (renal cell carcinoma)

GroupHPOFreeText: Described as a VHL familywith RCC, without pheochromocytoma. Other phenotypes are likely, however not detailed in this publication

GroupNotHPOs: HP:0002666 (pheochromocytoma)

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: 7728151

SupplementalData: N/A

Variant: p.E55Rfs*12 (c.163delG)

LegacyVariant: (c.376delG)

CaseProblemVariantFreeText: N/A

ClinVarID: 428800 https://www.ncbi.nlm.nih.gov/clinvar/variation/428800/

CAID: N/A

gnomAD: N/A

VariantEvidence: This paper declares this variant is predicted to compromise the Elongin-binding site by truncating the protein.

MutationType: minus_1_frameshift_variant

CivicName: E55fs (c.163delG)

MultipleGeneVariants: N/A

GroupID/ KindredID: 3682NCI

DiseaseAssertion: VHL

GroupSize: N/A

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: This germline familial VHL mutation was taken from the National Cancer Institute database, with an unknown number of members belonging to Family ID 3682NCI. Table 3 lists all ID and mutations associated with individuals possessing renal carcinoma, without pheochromocytoma. Additionally, this family ID is stated again in Table 3 under the mutation c.163delG. Unclear if this is a typo, or if multiple mutations belong to this one family.

GroupPresentingHPOs: HP:0005548 (renal cell carcinoma)

GroupHPOFreeText: Described as a VHL family with RCC, without pheochromocytoma. Other phenotypes are likely, however not detailed in this publication

GroupNotHPOs: HP:0002666 (pheochromocytoma)

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: 7728151

SupplementalData: N/A

Variant: p.F76I (c.226T>A)

LegacyVariant: p.F76I (c.439T>A)

CaseProblemVariantFreeText: N/A

ClinVarID: 820994 https://www.ncbi.nlm.nih.gov/clinvar/variation/820994/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: F76I (c.226T>A)

MultipleGeneVariants: N/A

GroupID/ KindredID: 79CA

DiseaseAssertion: VHL

GroupSize: N/A

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: This germline familial VHL mutation was taken from the Cambridge, Department of Pathology database, with an unknown number of members belonging to Family ID 79CA. Table 3 lists all ID and mutations associated with individuals possessing renal carcinoma, without pheochromocytoma.

GroupPresentingHPOs: HP:0005548 (renal cell carcinoma)

GroupHPOFreeText: Described as a VHL family with RCC, without pheochromocytoma. Other phenotypes are likely, however not detailed in this publication

GroupNotHPOs: HP:0002666 (pheochromocytoma)

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.I180V (c.538A>G)

LegacyVariant: p.I180V (c.751A>G)

CaseProblemVariantFreeText: N/A

ClinVarID: 161401 https://www.ncbi.nlm.nih.gov/clinvar/variation/161401/

CAID: N/A

gnomAD: 0.00001061 https://gnomad.broadinstitute.org/variant/3-10191545-A-G

VariantEvidence: This paper declares this variant is predicted to compromise the Elongin-binding site by location between codons 157 and 189.

MutationType: missense_variant; transition

CivicName: I180V (c.538A>G)

MultipleGeneVariants: N/A

GroupID/ KindredID: 21BMS

DiseaseAssertion: VHL

GroupSize: N/A

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: This germline familial VHL mutation was taken from the Bristol Myers Squibb database, with an unknown number of members belonging to Family ID 21BMS. Table 3 lists all ID and mutations associated with individuals possessing renal carcinoma, without pheochromocytoma.

GroupPresentingHPOs: HP:0005548 (renal cell carcinoma)

GroupHPOFreeText: Described as a VHL family with RCC, without pheochromocytoma. Other phenotypes are likely, however not detailed in this publication

GroupNotHPOs: HP:0002666 (pheochromocytoma)

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.D121G (c.362A>G)

LegacyVariant: p.D121G (c.575A>G)

CaseProblemVariantFreeText: N/A

ClinVarID: 223200 https://www.ncbi.nlm.nih.gov/clinvar/variation/223200/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: D121G (c.362A>G)

MultipleGeneVariants: N/A

GroupID/ KindredID: 4414NCI, 4577NCI

DiseaseAssertion: VHL

GroupSize: N/A

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: This germline familial VHL mutation was taken from the National Cancer Institute database, with an unknown number of members belonging to two family IDs: Family 4414NCI and 4577NCI. Table 4 lists all ID and mutations associated with individuals with pheochromocytoma.

GroupPresentingHPOs: HP:0002666 (pheochromocytoma)

GroupHPOFreeText: Described as 2 VHL families with pheochromocytoma. Other phenotypes are likely, including renal cell carcinoma, however not detailed here.

GroupNotHPOs: N/A

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.F119L (c.357C>G)

LegacyVariant: p.F119L (c.570C>G)

CaseProblemVariantFreeText: N/A

ClinVarID: 625240 https://www.ncbi.nlm.nih.gov/clinvar/variation/625240/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: F119L (c.357C>G)

MultipleGeneVariants: N/A

GroupID/ KindredID: 53CA

DiseaseAssertion: VHL

GroupSize: N/A

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: This germline familial VHL mutation was taken from the Cambridge, Department of Pathology database, with an unknown number of members belonging to Family ID 53CA. Table 3 lists all ID and mutations associated with individuals possessing renal carcinoma, without pheochromocytoma.

GroupPresentingHPOs: HP:0005548 (renal cell carcinoma)

GroupHPOFreeText: Described as a VHL family with RCC, without pheochromocytoma. Other phenotypes are likely, however not detailed in this publication

GroupNotHPOs: HP:0002666 (pheochromocytoma)

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.G104Hfs*27 (c.309_310delTG)

LegacyVariant: FS (c.522delTG)

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA658795178 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.309_310delTG

gnomAD: N/A

VariantEvidence: This paper declares this variant is predicted to compromise the Elongin-binding site by truncating the protein.

MutationType: minus_2_frameshift_variant

CivicName: G104fs (c.309_310del)

MultipleGeneVariants: N/A

GroupID: 52

DiseaseAssertion: assumed VHL

GroupSize: 11

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: 11 of the 573 patients discussed in this paper were found to have identical variants. This mutation (c.194C>T) was found in 4 VHL families with 11 patients altogether.

GroupPresentingHPOs: HP:0006880; HP:0005584; HP:0009711 (cerebellar hemangioblastoma; renal cell carcinoma; retinal capillary hemangioma)

GroupHPOFreeText: 4 total patients had cerebellar hemangioblastoma; 2 had renal cell carcinoma; and 10 patients had retinal capillary hemangioma. Mean ages for each diagnosis follows: 25Y (RH), 43Y (CHB), 48Y (RCC).

GroupNotHPOs: HP:0002666 (pheochromocytoma)

GroupNotHPOFreeText: No patients had pheos

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplementary Table S1.

Variant: p.S65L (c.194C>T)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 182975 https://www.ncbi.nlm.nih.gov/clinvar/variation/182975/

CAID: N/A

gnomAD: https://gnomad.broadinstitute.org/variant/3-10183725-C-T

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: S65L (c.194C>T)

MultipleGeneVariants: N/A

GroupID: 31

DiseaseAssertion: assumed VHL

GroupSize: 30

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: 30 of the 573 patients discussed in this paper were found to have identical variants. This nonsense mutation (R161* (c.481C>T)) was found in 7 VHL families with 30 patients altogether.

GroupPresentingHPOs: HP:0009711; HP:0006880; HP:0005584; HP:0002666 (retinal capillary hemangioma, cerebellar hemangioblastoma, renal cell carcinoma, pheochromocytoma)

GroupHPOFreeText: 24 had retinal hemangioblastoma, 13 had cerebellar hemangioblastomas, 14 had renal cell carcinoma, and 3 had pheochromcytoma. Mean ages for each diagnosis follows: 23 (RH), 28 (CHB), 38.7 (RCC), 34 (Pheo)

GroupNotHPOs: N/A

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplementary Table S1.

Variant: p.R161* (c.481C>T)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 2217 https://www.ncbi.nlm.nih.gov/clinvar/variation/2217/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: R161* (c.481C>T)

MultipleGeneVariants: N/A

GroupID: 26

Case: 61Y0M, Sex Unknown, Ethnicity Unknown

DiseaseAssertion: assumed VHL

FamilyInfo: 1 of the 573 patients discussed in this paper were found to have this variant. This mutation was found in 1 VHL family with a single patient.

CasePresentingHPOs: HP:0006880; HP:0005584 (cerebellar hemangioblastoma; renal cell carcinoma)

CaseHPOFreeText: patient had cerebellar hemangioblastoma diagnosed at 61Y, and RCC diagnosed at 53Y

CaseNotHPOs: HP:0009711; HP:0002666 (retinal capillary hemangioma; pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplementary Table S1.

Variant: p.N141Mfs*18 (c.422delA)

LegacyVariant: p.N141Mfs*18 (c.421delA)

CaseProblemVariantFreeText: Written in supply. table as c.421delA, this automaps to c.422delA due to redundancy in code

ClinVarID: N/A

CAID: CA432421876 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.421delA

gnomAD: N/A

VariantEvidence: N/A

MutationType: minus_1_frameshift_variant

CivicName: N141fs (c.422del) 

MultipleGeneVariants: N/A

GroupID: 78

DiseaseAssertion: assumed VHL

GroupSize: 5

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: 5 of the 573 patients discussed in this paper were found to have identical variants. This mutation (c.496G>T) was found in 2 VHL families with 5 patients.

GroupPresentingHPOs: pheochromocytoma; retinal capillary hemangioma; cerebellar hemangioblastoma (HP:0002666; HP:0009711; HP:0006880)

GroupHPOFreeText: 2 patients had retinal angiomas with a mean age of diagnosis of 24Y, 2 patients had cHBs with a mean age of diagnosis of 23Y, and 4 patients had pheos with a mean age of diagnosis of 22Y,

GroupNotHPOs: HP:0005584 (renal cell carcinoma)

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplementary Table S1.

Variant: p.V166F (c.496G>T)

CaseProblemVariantFreeText: Paper (suppl. table) records this as c.498A>G, however this doesn't match the given protein change (p.V166F). As the Latif et al. 1993 (AFO10238) sequence given was c.709G>T, can deduce with high likelihood that this "c.498A>G" should have wrote "c.496G>T".

LegacyVariant: N/A

ClinVarID: 2224 https://www.ncbi.nlm.nih.gov/clinvar/variation/2224/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: V166F (c.496G>T)

MultipleGeneVariants: N/A

PatientID: II-1

KindredID: 2

Case: F, Age Unknown, German

DiseaseAssertion: VHL (Asymptomatic)

FamilyInfo: Family 2 is comprised of 131 individuals over six generations including 65 members (50% of those at risk) with VHL type 2A (72% clinically affected, 12% obligate carriers, and 15% positive genetic analysis alone) and nearly equal gender distribution for affected status (54% male). An additional six members (II-3, II-4, II -5, III-1, III-2, and III-3) are suspected to have VHL without confirmation. Of note, the nuclear family (branch IV-13) contains 13 siblings, of whom 12 have been diagnosed with pheo. The presenting tumor types in Family 2 were pheo (70%), HB (17%), and RA (13%). No Family 2 member had RCC as the initial manifestation. Distribution of HB and RA are not described except for patient IV-8.

CasePresentingHPOs: N/A

CaseHPOFreeText: Deceased.

CaseNotHPOs: HP:0005584; HP:0002666 (Renal cell carcinoma, Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 7759077

SupplementalData: N/A

Variant: p.Y98H (c.292T>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2223, https://www.ncbi.nlm.nih.gov/clinvar/variation/2223/

CAID: N/A

gnomAD: 0.00001343, https://gnomad.broadinstitute.org/variant/3-10183823-T-C

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: Y98H (c.292T>C)

MultipleGeneVariants: N/A

PatientID: IV-5

KindredID: 2

Case: F, Age Unknown, German

DiseaseAssertion: VHL

FamilyInfo: Family 2 is comprised of 131 individuals over six generations including 65 members (50% of those at risk) with VHL type 2A (72% clinically affected, 12% obligate carriers, and 15% positive genetic analysis alone) and nearly equal gender distribution for affected status (54% male). An additional six members (II-3, II-4, II -5, III-1, III-2, and III-3) are suspected to have VHL without confirmation. Of note, the nuclear family (branch IV-13) contains 13 siblings, of whom 12 have been diagnosed with pheo. The presenting tumor types in Family 2 were pheo (70%), HB (17%), and RA (13%). No Family 2 member had RCC as the initial manifestation. Distribution of HB and RA are not described except for patient IV-8.

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0005584 (Renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 7759077

SupplementalData: N/A

Variant: p.Y98H (c.292T>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2223, https://www.ncbi.nlm.nih.gov/clinvar/variation/2223/

CAID: N/A

gnomAD: 0.00001343, https://gnomad.broadinstitute.org/variant/3-10183823-T-C

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: Y98H (c.292T>C)

MultipleGeneVariants: N/A

PatientID: V-4

KindredID: 2

Case: M, Age Unknown, German

DiseaseAssertion: VHL

FamilyInfo: Family 2 is comprised of 131 individuals over six generations including 65 members (50% of those at risk) with VHL type 2A (72% clinically affected, 12% obligate carriers, and 15% positive genetic analysis alone) and nearly equal gender distribution for affected status (54% male). An additional six members (II-3, II-4, II -5, III-1, III-2, and III-3) are suspected to have VHL without confirmation. Of note, the nuclear family (branch IV-13) contains 13 siblings, of whom 12 have been diagnosed with pheo. The presenting tumor types in Family 2 were pheo (70%), HB (17%), and RA (13%). No Family 2 member had RCC as the initial manifestation. Distribution of HB and RA are not described except for patient IV-8.

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0005584 (Renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 7759077

SupplementalData: N/A

Variant: p.Y98H (c.292T>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2223, https://www.ncbi.nlm.nih.gov/clinvar/variation/2223/

CAID: N/A

gnomAD: 0.00001343, https://gnomad.broadinstitute.org/variant/3-10183823-T-C

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: Y98H (c.292T>C)

MultipleGeneVariants: N/A

PatientID: V-11

KindredID: 2

Case: F, Age Unknown, German

DiseaseAssertion: VHL (Asymptomatic)

FamilyInfo: Family 2 is comprised of 131 individuals over six generations including 65 members (50% of those at risk) with VHL type 2A (72% clinically affected, 12% obligate carriers, and 15% positive genetic analysis alone) and nearly equal gender distribution for affected status (54% male). An additional six members (II-3, II-4, II -5, III-1, III-2, and III-3) are suspected to have VHL without confirmation. Of note, the nuclear family (branch IV-13) contains 13 siblings, of whom 12 have been diagnosed with pheo. The presenting tumor types in Family 2 were pheo (70%), HB (17%), and RA (13%). No Family 2 member had RCC as the initial manifestation. Distribution of HB and RA are not described except for patient IV-8.

CasePresentingHPOs: N/A

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0005584; HP:0002666 (Renal cell carcinoma, Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 7759077

SupplementalData: N/A

Variant: p.Y98H (c.292T>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2223, https://www.ncbi.nlm.nih.gov/clinvar/variation/2223/

CAID: N/A

gnomAD: 0.00001343, https://gnomad.broadinstitute.org/variant/3-10183823-T-C

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: Y98H (c.292T>C)

MultipleGeneVariants: N/A

GroupID: 287

DiseaseAssertion: VHL

GroupSize: 2

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: French

GroupAgeRange: N/A

GroupInfo: 2 members of this family are reported as carrying the c.197_220del24 germline variant of the VHL gene. Member 6396 presented with mild renal disease. Member 6611 presented with severe renal disease (RCC). Families were recruited from the French VHL Registry. Enrolment in the study required identification of the germline VHL mutation (currently 85% of the families included in the French VHL Registry) and available data regarding renal phenotype. A total of 126 families fulfilled these criteria.

GroupPresentingHPOs: HP:0009726; HP:0005584 (Renal neoplasm, Renal cell carcinoma)

GroupHPOFreeText: Mild renal disease (simple renal cyst, multicystic kidney[s], small lesion [less than 10 mm in size] of unknown significance, or small solid tumor without indication for surgical removal [less than 30 mm in size]). Severe renal disease (any solid lesion before 25 years of age, five or more solid lesions within one or two kidneys, or metastasis of renal cell carcinoma).

GroupNotHPOs: N/A

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: Paper states that this family is previously reported in PMID 9829912, where 1 patient with this mutation is reported but relation to this patient is unclear.

SupplementalData: Phenotype and genotype information can be found in Supplementary Table S1.

Variant: p.N67_V74del (c.197_221del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA2573130203, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2573130203

gnomAD: N/A

VariantEvidence: Variant reported as c.197_220del and was mapped to c.198_221del.

MutationType: inframe_deletion; deletion

CivicName: N67_V74del (c.197_221del)

MultipleGeneVariants: N/A

PatientID: 5654

KindredID: 266

Case: Sex Unknown, Age Unknown, French

DiseaseAssertion: VHL

FamilyInfo: N/A

CohortInfo: Families were recruited from the French VHL Registry. Enrolment in the study required identification of the germline VHL mutation (currently 85% of the families included in the French VHL Registry) and available data regarding renal phenotype. A total of 126 families fulfilled these criteria.

CasePresentingHPOs: HP:0005584 (Renal cell carcinoma)

CaseHPOFreeText: Mild renal disease (simple renal cyst, multicystic kidney[s], small lesion [less than 10 mm in size] of unknown significance, or small solid tumor without indication for surgical removal [less than 30 mm in size]). Individual RCC phenotype is noted as positive.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: Paper states that this patient is previously reported in PMIDs ​​12202531 and/or 9829912. Unclear if the patient reported in both these other papers is the same as he current patient.

SupplementalData: Phenotype and genotype information can be found in Supplementary Table S1.

Variant: p.W88S (c.263G>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2220, https://www.ncbi.nlm.nih.gov/clinvar/variation/2220/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: W88S (c.263G>C)

MultipleGeneVariants: N/A

PatientID: 3194

KindredID: 229

Case: Sex Unknown, Age Unknown, French

DiseaseAssertion: VHL

FamilyInfo: N/A

CohortInfo: Families were recruited from the French VHL Registry. Enrolment in the study required identification of the germline VHL mutation (currently 85% of the families included in the French VHL Registry) and available data regarding renal phenotype. A total of 126 families fulfilled these criteria.

CasePresentingHPOs: HP:0005584 (Renal cell carcinoma)

CaseHPOFreeText: Severe renal disease (any solid lesion before 25 years of age, five or more solid lesions within one or two kidneys, or metastasis of renal cell carcinoma). Individual RCC phenotype is noted as positive.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Phenotype and genotype information can be found in Supplementary Table S1.

Variant: Rearrangement

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: rearrangement_region

CivicName: Rearrangement

MultipleGeneVariants: N/A

PatientID: 6270

KindredID: 279

Case: Sex Unknown, Age Unknown, French

DiseaseAssertion: VHL

FamilyInfo: N/A

CohortInfo: Families were recruited from the French VHL Registry. Enrolment in the study required identification of the germline VHL mutation (currently 85% of the families included in the French VHL Registry) and available data regarding renal phenotype. A total of 126 families fulfilled these criteria.

CasePresentingHPOs: HP:0005584 (Renal cell carcinoma)

CaseHPOFreeText: Severe renal disease (any solid lesion before 25 years of age, five or more solid lesions within one or two kidneys, or metastasis of renal cell carcinoma). Individual RCC phenotype is noted as positive.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: Paper states that this family is previously reported in PMID 12202531 and/or 9829912, where 3 individuals and 3 families respectively with this mutation are reported. It is unclear if one or both of these previously reported groups are the same as the current family. These previously published individuals could alternatively correspond to family 60.

SupplementalData: Phenotype and genotype information can be found in Supplementary Table S1.

Variant: p.R161Q (c.482G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 182983, https://www.ncbi.nlm.nih.gov/clinvar/variation/182983/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: R161Q (c.482G>A)

MultipleGeneVariants: N/A

PatientID: None

KindredID: 1

Case: F, 45Y0M, Japanese

DiseaseAssertion: VHL

FamilyInfo: No evidence of a family history of VHL.

CasePresentingHPOs: HP:0001737; HP:0030405; HP:0006880; HP:0006748; HP:0009711; HP:0001732; HP:0002896 (Pancreatic cysts, Pancreatic endocrine tumor, Cerebellar hemangioblastoma, Adrenal pheochromocytoma, Retinal capillary hemangioma, Abnormality of the pancreas, Neoplasm of the liver)

CaseHPOFreeText: The proband had a cerebellar hemangioblastoma resected at age 17, retinal hemangioblastoma surgery at age 26, and an adrenalectomy for pheochromocytoma at age 30. An abdominal CT revealed a 4cm abdominal mass and diffuse pancreatic cystic lesions, diagnosed as pancreatic neuroendocrine tumor.

CaseNotHPOs: N/A

CaseNotHPOFreeText:

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.Q132* (c.394C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 288749, (https://www.ncbi.nlm.nih.gov/clinvar/variation/288749/)

CAID: CA10606205 (http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA10606205)

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: Q132* (c.394C>T)

MultipleGeneVariants: N/A

PatientID: 104

KindredID: 35

Case: F, 28Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband, patient 104, presented with multiple pancreatic cysts/tumors at age 27. Their sister, patient 105 presented with pancreatic cysts/tumors at age 28. Their mother presented with a CNS hemangioblastoma at 45 but passed away before diagnosis/genetic testing.

CasePresentingHPOs: HP:0001737; HP:0001732 (Pancreatic cysts, Abnormality of the pancreas)

CaseHPOFreeText: The proband's sister presented with multiple pancreatic cysts/tumors at age 28.

CaseNotHPOs: HP:0005584; HP:0002666; HP:0009711; HP:0010797 (Renal cell carcinoma, Pheochromocytoma, Retinal capillary hemangioma, Hemangioblastoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This cohort was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.Y98S (c.293A>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 219160; https://www.ncbi.nlm.nih.gov/clinvar/variation/219160/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: Y98S (c.293A>C)

MultipleGeneVariants: N/A

PatientID: 252

KindredID: 97

Case: M, 46Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; HP:0009711; HP:0001737; HP:0001732; HP:0005584 (Hemangioblastoma, Retinal capillary hemangioma, Pancreatic cysts, Abnormality of the pancreas, Renal cell carcinoma)

CaseHPOFreeText: The patient presented with a CNS hemangioblastoma, retinal angioma, renal cell carcinoma, and multiple pancreatic cysts/tumors at age 46.

CaseNotHPOs: HP:0002666 (Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This cohort was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: Exon 1 Deletion (c.1-?_340+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: Exon 1 Deletion

MultipleGeneVariants: N/A

PatientID: 144

KindredID: 52

Case: F, Age Unknown, Chinese

DiseaseAssertion: Asymptomatic

FamilyInfo: The proband (patient 138) had multiple family members affected with the mutation. Their daughter (pt 139) was asymptomatic at the time of assessment; their son (pt 140) was also asymptomatic at the time of assessment; their mother (pt 141) presented with a CNS hemangioblastoma at 66, renal cell carcinoma at 69, and multiple pancreatic cysts/tumors at 66; their sister 1 (pt 142) presented with a CNS hemangioblastoma at 32, renal cell carcinoma at 36, and multiple pancreatic cysts/tumors at 36; the son of sister 1 was asymptomatic at the time of analysis; the daughter of sister 1 was asymptomatic at the time of analysis; the proband's sister 2 presented at age 39 with CNS hemangioblastoma, renal cell carcinoma, and multiple pancreatic cysts/tumors; and the son of sister 2 was asymptomatic at the time of analysis. All members of this family were genetically confirmed to have this mutation.

CasePresentingHPOs: N/A

CaseHPOFreeText: The proband's niece (daughter of sister 1) was asymptomatic at the time of analysis.

CaseNotHPOs: HP:0010797; HP:0005584; HP:0001737; HP:0001732; HP:0002666; HP:0009711 (Hemangioblastoma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas, Pheochromocytoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: c.464-1G>C

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223220; https://www.ncbi.nlm.nih.gov/clinvar/variation/223220/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: splice_site_variant

CivicName: Splice Site (c.464-1G>C)

MultipleGeneVariants: N/A

PatientID: 288

KindredID: 113

Case: M, 24Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 288) presented with a CNS hemangioblastoma, renal cell carcinoma, and multiple pancreatic cysts/tumors at 23, and a retinal angioma at 24. Their sister (patient 289) presented with a CNS hemangioblastoma, retinal angioma, and renal cell carcinoma at 30.

CasePresentingHPOs: HP:0010797; HP:0001732; HP:0001737; HP:0005584; HP:0009711 (Hemangioblastoma, Abnormality of the pancreas, Pancreatic cysts, Renal cell carcinoma, Retinal capillary hemangioma)

CaseHPOFreeText: The proband (patient 288) presented with a CNS hemangioblastoma, renal cell carcinoma, and multiple pancreatic cysts/tumors at 23, and a retinal angioma at 24.

CaseNotHPOs: HP:0002666 (Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This cohort was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: Exon 3 Deletion (c.464-?_642+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: Exon 3 Deletion

MultipleGeneVariants: N/A

PatientID: 101

KindredID: 34

Case: F, 51Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 99) presented with a CNS hemangioblastoma, retinal angioma, renal cell carcinoma, multiple pancreatic cysts/tumors, and pheochromocytoma at age 40. Their mother (patient 100) presented with a CNS hemangioblastoma at age 50 and multiple pancreatic cysts/tumors at age 63, but passed away before diagnosis/ genetic testing. Their sister (patient 101) had the mutation and presented with a CNS hemangioblastoma and a retinal angioma at age 51. Their second sister (sister 2, patient 102) passed away before diagnosis/genetic testing but presented with a CNS hemangioblastoma at 40, renal cell carcinoma at 43 and multiple pancreatic cysts/tumors at 43. Their brother (patient 103), who also passed away before diagnosis/genetic testing, presented with a CNS hemangioblastoma and retinal angioma at age 47.

CasePresentingHPOs: HP:0010797, HP:0009711 (Hemangioblastoma, Retinal capillary hemangioma)

CaseHPOFreeText: The sister (patient 101) presented with a CNS hemangioblastoma and a retinal angioma at age 51.

CaseNotHPOs: HP:0005584; HP:0001737; HP:0001732; HP:0002666 (Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas, Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This cohort was also published in an earlier paper by Wang et al., 2014 (PMID 24581539) as well as a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.Y98N (c.292T>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351750883, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.292T%3EA

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: Y98N (c.292T>A)

MultipleGeneVariants: N/A

PatientID: 163

KindredID: 63

Case: F, 37Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 163) had a brother and niece who were both confirmed with the mutation. The brother (patient 164) had a CNS hemangioblastoma at 27, retinal angioma at 26, and pheochromocytoma at 8 years old. The niece (patient 165) was asymptomatic at the time of analysis. The proband also had a mother (patient 166) who had multiple pancreatic cysts/tumors and a pheochromocytoma at age 56, but for whom no DNA sample was available for analysis.

CasePresentingHPOs: HP:0001737; HP:0001732; HP:0010797; HP:0002666; HP:0005584 (Pancreatic cysts, Abnormality of the pancreas, Hemangioblastoma, Pheochromocytoma, Renal cell carcinoma)

CaseHPOFreeText: The proband presented with a pheochromocytoma at 37, and at age 37 presented with a CNS hemangioblastoma, renal cell carcinoma, and multiple pancreatic cysts/tumors.

CaseNotHPOs: HP:0009711 (Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.R161Q (c.482G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 182983, https://www.ncbi.nlm.nih.gov/clinvar/variation/182983/?new_evidence=true

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: R161Q (c.482G>A)

MultipleGeneVariants: N/A

PatientID: 94

KindredID: 31

Case: F, 56Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 31) has a son who has also genetically confirmed with the mutation. The proband's son presented at age 29 with retinal angioma, renal cell carcinoma, multiple pancreatic cysts/tumors, and pheochromocytoma.

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0001737; HP:0001732 (Hemangioblastoma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas)

CaseHPOFreeText: The proband presented with renal cell carcinoma and multiple pancreatic cysts/tumors at 51, and CNS hemangioblastoma at age 56.

CaseNotHPOs: HP:0002666; HP:0009711 (Pheochromocytoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.E94* (c.280G>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 584477; https://www.ncbi.nlm.nih.gov/clinvar/variation/584477/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: E94* (c.280G>T)

MultipleGeneVariants: N/A

PatientID: 3

KindredID: 2

Case: M, 22Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: His father also had this mutation and presented with renal cell carcinoma and pancreatic cysts at age 48. His father's mother (his grandmother) presented with a CNS hemangioblastoma at age 61, and his father's brother (his uncle) presented with a CNS hemangioblastoma at age 33. His grandmother passed away before diagnosis, and there was no DNA sample available for his uncle.

CasePresentingHPOs: HP:0010797 (Hemangioblastoma)

CaseHPOFreeText: The patient presented with a CNS hemangioblastoma at the age of 22.

CaseNotHPOs: HP:0009711; HP:0002666; HP:0005584; HP:0001737 (Retinal Capillary Hemangioma, Pheochromocytoma, Renal cell carcinoma, Pancreatic cysts)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This cohort was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.S65W (c.194C>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 43597, https://www.ncbi.nlm.nih.gov/clinvar/variation/43597/

CAID:

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: S65W (c.194C>G)

MultipleGeneVariants: N/A

PatientID: 230

KindredID: 86

Case: F, 40Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 229) had a sister (patient 230) who was genetically confirmed with the mutation, and presented with a CNS hemangioblastoma at age 40. The proband's brother 1 (patient 231) was also confirmed with the mutation and had a retinal angioma at 25, and renal cell carcinoma at 54. The proband's brother 2 passed away before they could be diagnosed/ confirmed with the mutation, but they had a CNS hemangioblastoma at 35. Finally, the proband's nephew (son of brother 2) was genetically confirmed with the mutation and presented with renal cell carcinoma at age 30.

CasePresentingHPOs: HP:0010797 (Hemangioblastoma)

CaseHPOFreeText: The proband's sister (patient 230) had a CNS hemangioblastoma at age 40.

CaseNotHPOs: HP:0002666; HP:0001737; HP:0001732; HP:0005584; HP:0009711 (Pheochromocytoma, Pancreatic cysts, Abnormality of the pancreas, Renal cell carcinoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.L178R (c.533T>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 625261, https://www.ncbi.nlm.nih.gov/clinvar/variation/625261/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: L178R (c.533T>G)

MultipleGeneVariants: N/A

PatientID: 142

KindredID: 52

Case: F, 36Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 138) had multiple family members affected with the mutation. Their daughter (pt 139) was asymptomatic at the time of assessment; their son (pt 140) was also asymptomatic at the time of assessment; their mother (pt 141) presented with a CNS hemangioblastoma at 66, renal cell carcinoma at 69, and multiple pancreatic cysts/tumors at 66; their sister 1 (pt 142) presented with a CNS hemangioblastoma at 32, renal cell carcinoma at 36, and multiple pancreatic cysts/tumors at 36; the son of sister 1 was asymptomatic at the time of analysis; the daughter of sister 1 was asymptomatic at the time of analysis; the proband's sister 2 presented at age 39 with CNS hemangioblastoma, renal cell carcinoma, and multiple pancreatic cysts/tumors; and the son of sister 2 was asymptomatic at the time of analysis. All members of this family were genetically confirmed to have this mutation.

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0001737; HP:0001732 (Hemangioblastoma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas)

CaseHPOFreeText: The proband's sister 1 (patient 142) had a CNS hemangioblastoma at 31, and multiple pancreatic cysts/tumors and renal cell carcinoma at 36.

CaseNotHPOs: HP:0002666; HP:0009711 (Pheochromocytoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: c.464-1G>C

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223220; https://www.ncbi.nlm.nih.gov/clinvar/variation/223220/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: splice_site_variant

CivicName: Splice Site (c.464-1G>C)

MultipleGeneVariants: N/A

PatientID: 127

KindredID: 47

Case: F, 28Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0001737; HP:0001732; HP:0009711 (Hemangioblastoma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas, Retinal capillary hemangioma)

CaseHPOFreeText: The proband presented at age 25 with a CNS hemangioblastoma, retinal angioma, and renal cell carcinoma, and presented with multiple pancreatic cysts/tumors at age 28.

CaseNotHPOs: HP:0002666 (Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This kindred was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.E134_V142del (c.402_428del)

LegacyVariant: N/A

CaseProblemVariantFreeText: Variant listed in the paper as c.402-428delATTATTTGTGCCATCTCTCAATGTTGA, p.Glu134Aspfs*72. Listed protein change does not match deletion. Deletion is in-frame and should not lead to a frame shift. Variant updated in this annotation based on protein change listed in ClinGen/ listed on Variant Validator for c.402-428del.

ClinVarID: N/A

CAID: CA2573320387, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2573320387

gnomAD: N/A

VariantEvidence: N/A

MutationType: inframe_deletion

CivicName: E134_V142del (c.402_428del)

MultipleGeneVariants: N/A

PatientID: 175

KindredID: 69

Case: F, 35Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The male proband, patient 143, was diagnosed with renal cell carcinoma and multiple pancreatic cysts/tumors at age 33. His mother, who was not confirmed with the mutation, had a CNS hemangioblastoma at 30, retinal angioma at 54, and renal cell carcinoma at 50. His sister had a CNS hemangioblastoma at 28, and renal cell carcinoma/ multiple pancreatic cysts/tumors at 35. His niece, who was not confirmed with the mutation, had a CNS hemangioblastoma at age 12. His aunt had a CNS hemangioblastoma at 37, retinal angioma at 45, and renal cell carcinoma at 53. The son of his aunt was asymptomatic at the time of analysis.

CasePresentingHPOs: HP:0005584; HP:0001737; HP:0001732; HP:0010797 (Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas, Hemangioblastoma)

CaseHPOFreeText: The proband's sister presented with a CNS hemangioblastoma at age 28 and renal cell carcinoma and multiple pancreatic cysts/tumors at age 35.

CaseNotHPOs: HP:0002666; HP:0009711 (Pheochromocytoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.C162W (c.486C>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223227; https://www.ncbi.nlm.nih.gov/clinvar/variation/223227/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: C162W (c.486C>G)

MultipleGeneVariants: N/A

PatientID: 140

KindredID: 52

Case: M, Age Unknown, Chinese

DiseaseAssertion: Asymptomatic

FamilyInfo: The proband (patient 138) had multiple family members affected with the mutation. Their daughter (pt 139) was asymptomatic at the time of assessment; their son (pt 140) was also asymptomatic at the time of assessment; their mother (pt 141) presented with a CNS hemangioblastoma at 66, renal cell carcinoma at 69, and multiple pancreatic cysts/tumors at 66; their sister 1 (pt 142) presented with a CNS hemangioblastoma at 32, renal cell carcinoma at 36, and multiple pancreatic cysts/tumors at 36; the son of sister 1 was asymptomatic at the time of analysis; the daughter of sister 1 was asymptomatic at the time of analysis; the proband's sister 2 presented at age 39 with CNS hemangioblastoma, renal cell carcinoma, and multiple pancreatic cysts/tumors; and the son of sister 2 was asymptomatic at the time of analysis. All members of this family were genetically confirmed to have this mutation.

CasePresentingHPOs: N/A

CaseHPOFreeText: The proband's son was asymptomatic at the time of assessment.

CaseNotHPOs: HP:0010797, HP:0001737; HP:0001732; HP:0005584; HP:0002666; HP:0009711 (Hemangioblastoma, Pancreatic cysts, Abnormality of the pancreas, Renal cell carcinoma, Pheochromocytoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: c.464-1G>C

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223220; https://www.ncbi.nlm.nih.gov/clinvar/variation/223220/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: splice_site_variant

CivicName: Splice Site (c.464-1G>C)

MultipleGeneVariants: N/A

PatientID: IV-13

KindredID: 1

Case: M, 24Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Family’s roots were traced to the German town of Leipzig in Saxony, from whence the original 11 siblings had immigrated to America around 1670. The following report is a 2011 updated pedigree on the previously reported Tisherman kindred. At the time of this study, 43/49 patients have undergone mutational analysis revealing the VHL familial mutation (Y112H) and 35/49 patients have clinical VHL manifestations. Phenotypic cumulative lifetime risk was 71% for Pheo/PGL, 15% for hemangioblastoma, 33% for retinal angioma, 3% for renal cell carcinoma, and 3% for pancreatic cysts. 6 members of the family (all deceased; 4 males, 2 females) had suspected VHL and 2 (males) of these were suspected to have had Pheo/PGL.

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: Pheochromocytoma found on autopsy. Deceased (24Y). Cause of death: cardiac and renal failure.

CaseNotHPOs: HP:0005584; HP:0009711; HP:0002668 (Renal cell carcinoma, Retinal capillary hemangioma, Paraganglioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 9201016; 8239848 (no genetic information; only phenotypes)

SupplementalData: N/A

Variant: p.Y112H (c.334T>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2222, https://www.ncbi.nlm.nih.gov/clinvar/variation/2222/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: Y112H (c.334T>C)

MultipleGeneVariants: N/A

PatientID: VI-7

KindredID: 1

Case: M, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Family’s roots were traced to the German town of Leipzig in Saxony, from whence the original 11 siblings had immigrated to America around 1670. The following report is a 2011 updated pedigree on the previously reported Tisherman kindred. At the time of this study, 43/49 patients have undergone mutational analysis revealing the VHL familial mutation (Y112H) and 35/49 patients have clinical VHL manifestations. Phenotypic cumulative lifetime risk was 71% for Pheo/PGL, 15% for hemangioblastoma, 33% for retinal angioma, 3% for renal cell carcinoma, and 3% for pancreatic cysts. 6 members of the family (all deceased; 4 males, 2 females) had suspected VHL and 2 (males) of these were suspected to have had Pheo/PGL.

CasePresentingHPOs: HP:0002666; HP:0002668 (Pheochromocytoma, Paraganglioma)

CaseHPOFreeText: Phenotype noted as: Pheo/PGL (unclear which of the two or if both apply to this patient).

CaseNotHPOs: HP:0005584; HP:0009711 (Renal cell carcinoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 9201016; 8239848 (no genetic information; only phenotypes)

SupplementalData: N/A

Variant: p.Y112H (c.334T>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2222, https://www.ncbi.nlm.nih.gov/clinvar/variation/2222/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: Y112H (c.334T>C)

MultipleGeneVariants: N/A

PatientID: V-8

KindredID: 1

Case: F, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Family’s roots were traced to the German town of Leipzig in Saxony, from whence the original 11 siblings had immigrated to America around 1670. The following report is a 2011 updated pedigree on the previously reported Tisherman kindred. At the time of this study, 43/49 patients have undergone mutational analysis revealing the VHL familial mutation (Y112H) and 35/49 patients have clinical VHL manifestations. Phenotypic cumulative lifetime risk was 71% for Pheo/PGL, 15% for hemangioblastoma, 33% for retinal angioma, 3% for renal cell carcinoma, and 3% for pancreatic cysts. 6 members of the family (all deceased; 4 males, 2 females) had suspected VHL and 2 (males) of these were suspected to have had Pheo/PGL.

CasePresentingHPOs: HP:0009711 (Retinal capillary hemangioma)

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0005584; HP:0002666; HP:0002668 (Renal cell carcinoma, Pheochromocytoma, Paraganglioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 9201016; 8239848 (no genetic information; only phenotypes)

SupplementalData: N/A

Variant: p.Y112H (c.334T>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2222, https://www.ncbi.nlm.nih.gov/clinvar/variation/2222/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: Y112H (c.334T>C)

MultipleGeneVariants: N/A

PatientID: N/A (brother of index case)

KindredID: 1

Case: M, 45Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: The patient's sister was the index case in this VHL family, as she was diagnosed with bilateral pheochromocytoma at age 23 and underwent bilateral adrenalectomy. Genetic screening revealed the VHL variant, which prompted screening of family members. DNA sequencing from blood of consenting family members confirmed the presence of the VHL variant in seven family members (three generations) (see figure 1 for familial pedigree). This included the sister (index case), two nephews, mother, and two daughters. The patient's two daughters both had the mutation. One of which was found to have pheochromocytoma at age 15 due to routine screening. The other 8 year old daughter has not had any manifestations. The patient’s nephew was asymptomatic until age 7, where an abdominal ultrasound revealed a left adrenal mass. A total adrenalectomy was performed and at age 1 another mouse was found in the right adrenal gland, which was also removed. 6 years later he was asymptomatic. The patient’s other nephew presented with an adrenal mass at 11Y0M, which required total adrenalectomy and remains well 2.5 years later. No phenotype was noted for the patient’s mother.

CasePresentingHPOs: HP:0006748;HP:0010797; HP:0005584 (adrenal pheochromocytoma; Hemangioblastoma; Renal cell carcinoma)

CaseHPOFreeText: Patient developed hemangioblastoma, multiple bilateral renal cell carcinomas, bilateral pheochromocytomas, and succumbed to his disease at age 45.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.V170G (c.509T>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351756196, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.509T%3EG

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; tranversion

CivicName: V170G (c.509T>G)

MultipleGeneVariants: N/A

PatientID: None

KindredID: A

Case: Gender Unknown, Age Unknown, Welsh

DiseaseAssertion: Asymptomatic

FamilyInfo: The patient had two sons and a daughter; of these three children, one son carried the mutation and presented with bilateral pheochromocytoma at 11Y, and one daughter carried the mutation and presented with bilateral pheochromocytoma at 17Y.

CasePresentingHPOs: Asymptomatic

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.V84L(c.250G>T)

LegacyVariant: p.V155L(c.463G>T)

CaseProblemVariantFreeText: bandshift in exon 1 and genomic sequencing indicated a G>T transversion at nucleotide 463, substituting a valine for leucine at codon 155 (V155L). Leading to NM_000551.3:p.V84L(c.250G>T)

ClinVarID: 2236, http://www.ncbi.nlm.nih.gov/clinvar/variation/2236

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: V84L(c.250G>T)

MultipleGeneVariants: N/A

PatientID: None

KindredID: A

Case: F, 17Y0M, Welsh

DiseaseAssertion: Pheochromocytoma

FamilyInfo: The patient had a brother that presented with bilateral pheochromocytoma at 11Y. The patient also had an asymptomatic parent.

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: The patient presented with bilateral pheochromocytoma at 17Y.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.V84L(c.250G>T)

LegacyVariant: p.V155L(c.463G>T)

CaseProblemVariantFreeText: bandshift in exon 1 and genomic sequencing indicated a G>T transversion at nucleotide 463, substituting a valine for leucine at codon 155 (V155L). Leading to NM_000551.3:p.V84L(c.250G>T)

ClinVarID: 2236, http://www.ncbi.nlm.nih.gov/clinvar/variation/2236

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: V84L(c.250G>T)

MultipleGeneVariants: N/A

PatientID: None

KindredID: VHL2

Case: M, 33Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CohortInfo: A total of 190 patients recruited by the COMETE network over 15 years were included in the study.

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: The patient had one benign pheochromocytoma.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET/SDHB/SDHC/SDHD

PreviouslyPublished: N/A

SupplementalData: Table 1 of Supplementary

Variant: p.S80I (c.239G>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 625229, https://www.ncbi.nlm.nih.gov/clinvar/variation/625229/

CAID: N/A

gnomAD: N/A

VariantEvidence: The patient had LOH found in the BAC array CGH data.

MutationType: missense_variant;transversion

CivicName: S80I (c.239G>T)

MultipleGeneVariants: N/A

PatientID: IV:8

KindredID: 1

Case: M, Age Unknown (deceased), Chinese

DiseaseAssertion: VHL

FamilyInfo: A 5-generation family with VHL in 15 members. Both second generation children (presumed), 5 third generation, and 8 further generation individuals were affected and haplotyping was conducted using three polymorphic microsatellite markers. All of the 5th generation children (9 total at time of publication) had been sequenced and haplotyped as unaffected.

CasePresentingHPOs: N/A

CaseHPOFreeText: unknown phenotype, however they were said to be affected

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167W (c.499C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2218, https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: N/A

gnomAD: 0.000007954, https://gnomad.broadinstitute.org/variant/3-10191506-C-T?dataset=gnomad_r2_1

VariantEvidence: Death before genetic diagnostic, however presumed by authors due to extensive family history (See pedigree).

MutationType: missense_variant;transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

PatientID: 8

KindredID: AD

Case: F, 34Y0M, Indian

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0001737 (Pancreatic cysts)

CaseHPOFreeText: Multi-cystic pancreatic lesions.

CaseNotHPOs: HP:0005584; HP:0002666; HP:0030393; HP:0009711; HP:0010797 (Renal cell carcinoma, Pheochromocytoma, Endolymphatic sac tumor, Retinal capillary hemangioma, Hemangioblastoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.G114D (c.340+1G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223190, https://www.ncbi.nlm.nih.gov/clinvar/variation/223190/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: splice_site_variant; missense_variant;transition

CivicName: G114D (c.340+1G>A) and c.340+5G>C

MultipleGeneVariants: N/A

PatientID: 22

KindredID: P

Case: F, 25Y0M, Indian

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0001737; HP:0009711; HP:0010797 (Pancreatic cysts, Retinal capillary hemangioma, Hemangioblastoma)

CaseHPOFreeText: Multi-cystic pancreatic lesions, retinal angioma and CNS hemangioblastoma.

CaseNotHPOs: HP:0030393; HP:0002666; HP:0005584 (Endolymphatic sac tumor, Pheochromocytoma, Renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: Exon 3 Deletion (c.464-?_642+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: Exon 3 Deletion

MultipleGeneVariants: N/A

PatientID: 14

KindredID: AD

Case: F, 50Y0M, Indian

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; HP:0001737; HP:0005584 (Hemangioblastoma, Pancreatic cysts, Renal cell carcinoma)

CaseHPOFreeText: Multi-cystic pancreatic lesions, RCC and CNS hemangioblastoma.

CaseNotHPOs: HP:0009711; HP:0002666; HP:0030393 (Retinal capillary hemangioma, Pheochromocytoma, Endolymphatic sac tumor)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.G114D (c.340+1G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223190, https://www.ncbi.nlm.nih.gov/clinvar/variation/223190/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: splice_site_variant; missense_variant;transition

CivicName: G114D (c.340+1G>A) and c.340+5G>C

MultipleGeneVariants: Germline, VHL, c.340+5G>C

PatientID:18

KindredID: D

Case: M, 46Y0M, Indian

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0009711, HP:0002666 (retinal capillary hemangioma, pheochromocytoma)

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0001737, HP:0010797, HP:0005584, HP:0030393 (pancreatic cyst, hemangioblastoma, renal cell carcinoma, endolymphatic sac tumor)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167W (c.499C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2218 https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: N/A

gnomAD: 0.000007 https://gnomad.broadinstitute.org/variant/3-10191506-C-T?dataset=gnomad_r2_1

VariantEvidence: N/A

MutationType: missense_transition

CivicName: R167W(c.499C>T)

MultipleGeneVariants: N/A

PatientID: 9 (Grandmother)

KindredID: 13

Case: F, 67Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: 5 members of this family were found to harbour the deletion of one VHL allele. The proband (ID 1), sister (ID 2) and uncle (ID 5) were all asymptomatic. The father (ID 3) presented with CNS hemangioblastoma (34Y).

CasePresentingHPOs: HP:0010797 (Hemangioblastoma)

CaseHPOFreeText: This patient presented with CNS hemangioblastoma (57Y).

CaseNotHPOs: HP:0002666; HP:0005584; HP:0009711; HP:0000077; HP:0001732 (Pheochromocytoma, Renal cell carcinoma, Retinal capillary hemangioma, Abnormality of the kidney, Abnormality of the pancreas)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplementary Table 1.

Variant: Complete Deletion

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: Reported as “del one vHL allele”.

MutationType: deletion

CivicName: Null (del one VHL allele)

MultipleGeneVariants: N/A

PatientID: 8 (Cousin)

KindredID: 17

Case: F, 4Y0M, Ethnicity Unknown

DiseaseAssertion: Asymptomatic

FamilyInfo: 6 members of this family tested positive for the c.496_506del germline variant of the VHL gene. ID 4 presented with CNS hemangioblastoma, retinal angioma and renal and pancreatic abnormalities. ID 1 and 25 were asymptomatic.ID 22 presented with CNS hemangioblastoma. ID 5 presented with retinal angioma. 2 members were assumed to have the variant but were not genetically confirmed (ID 20 and ID 11). ID 11 and 20 presented with CNS hemangioblastoma.

CasePresentingHPOs: N/A

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0005584; HP:0002666; HP:0010797; HP:0000077; HP:0001732; HP:0009711 (Renal cell carcinoma, Pheochromocytoma, Hemangioblastoma, Abnormality of the kidney, Abnormality of the pancreas, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplementary Table 1.

Variant: p.V166Sfs*4 (c.496_506del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223229, https://www.ncbi.nlm.nih.gov/clinvar/variation/223229/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/AVariantEvidence: It is unclear from the publication if this variant is reported according to legacy (AF010238.1) or NM_000551.3 reference sequence. Clinical notes from the case confirm the reference sequence to be NM_000551.3.

MutationType: deletion; minus_2_frameshift_variant

CivicName: V166SFS*4 (c.496_506del)

MultipleGeneVariants: N/A

GroupID: 14b

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

CohortInfo: a retrospective cohort study from an eye centre in Germany involved 148 VHL patients and their genetic data involved in retinal capillary hemangiomas.

CasePresentingHPOs: N/A

CaseHPOFreeText: This was 1 of 3 patients discussed with this mutation. The individual did NOT have retinal hemangiomas; Other VHL manifestations were discussed but not per- variant.

CaseNotHPOs: HP:0009711 (retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Yes - Supplementary Table S1

Variant: p.Q164* (c.490C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223228 https://www.ncbi.nlm.nih.gov/clinvar/variation/223228/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: Q164* (c.490C>T)

MultipleGeneVariants: N/A

GroupID: 30a

DiseaseAssertion: VHL

GroupSize: 4

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: a retrospective cohort study from an eye centre in Germany involved 148 VHL patients and their genetic data involved in retinal capillary hemangiomas.

GroupPresentingHPOs: HP:0009711 (retinal capillary hemangioma)

GroupHPOFreeText: These 4/5 patients with a R107H (c.320G>A) mutation had retinal capillary hemangiomas. Other VHL manifestations were discussed but not per- variant.

GroupNotHPOs: N/A

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R107H (c.320G>A)

LegacyVariant: N/A

GroupProblemVariantFreeText: N/A

ClinVarID: 223184 https://www.ncbi.nlm.nih.gov/clinvar/variation/223184/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: R107H (c.320G>A)

MultipleGeneVariants: N/A

GroupID: 41

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

CohortInfo: a retrospective cohort study from an eye centre in Germany involved 148 VHL patients and their genetic data involved in retinal capillary hemangiomas.

CasePresentingHPOs: HP:0009711 (retinal capillary hemangioma)

CaseHPOFreeText: This individual patient was the only one discussed with this mutation. They had retinal hemangiomas; Other VHL manifestations were discussed but not per- variant.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Yes - Supplementary Table S1

Variant: p.R167W (c.499C>T)

LegacyVariant: N/A

GroupProblemVariantFreeText: N/A

ClinVarID: 2218 https://www.ncbi.nlm.nih.gov/clinvar/variation/2218

CAID: N/A

gnomAD: 0.000007954, https://gnomad.broadinstitute.org/variant/3-10191506-C-T?dataset=gnomad_r2_1

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

PatientID: 46

KindredID: 46

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: Assumed VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: Bilateral pheochromocytoma.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Patient information pulled from Supplemental Table 1b.

Variant: p.Y156H (c.466T>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351756040

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: Y156H (c.466T>C)

MultipleGeneVariants: N/A

PatientID: 85

KindredID: 85

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Family history of VHL but no details provided.

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Patient information pulled from Supplemental Table 1. There is additional tumour specific information in Supplemental Table 2.

Variant: p.P138P (c.414A>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223206, https://www.ncbi.nlm.nih.gov/clinvar/variation/223206/

CAID: N/A

gnomAD: N/A

VariantEvidence: Functionally validated by mRNA analysis, which showed a splicing alteration (data not shown). Membrane CA9 immunostaining was observed (supplemental table 1).

MutationType: missense_variant;transition; synonymous_variant

CivicName: P138= (c.414A>G)

MultipleGeneVariants: N/A

PatientID: 57

KindredID: 57

Case: Sex Unknown, 16Y0M, Ethnicity Unknown

DiseaseAssertion: Pheochromocytoma

FamilyInfo: N/A

CasePresentingHPOs: HP:0002666 (pheochromocytoma)

CaseHPOFreeText: The patient had a single pheochromocytoma.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Patient information pulled from Supplemental Table 1. There is additional tumour specific information in Supplemental Table 2.

Variant: p.R167Q (c.500G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2216 https://www.ncbi.nlm.nih.gov/clinvar/variation/2216/

CAID: N/A

gnomAD: 0.000003977 https://gnomad.broadinstitute.org/variant/3-10191507-G-A

VariantEvidence: Carbonic anhydrase 9 (CA9) mRNA level of 25.67 was detected. Membrane CA9 immunostaining was observed (supplemental table 1).

MutationType: missense_variant;transition

CivicName: R167Q (c.500G>A)

MultipleGeneVariants: N/A

PatientID: None

KindredID: 127

Case: Age, sex ethnicity unknown

DiseaseAssertion: unknown; paper focused only on pheochromocytoma

FamilyInfo: No specific family info was present; although this was recorded as a family germline mutation belonging to Family ID 127

CasePresentingHPOs: N/A

CaseHPOFreeText: Unknown

CaseNotHPOs: HP:0002666 (pheochromocytoma)

CaseNotHPOFreeText: No presence of phaeochromocytoma in family

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.S111N (c.332G>A)

CaseProblemVariantFreeText: N/A

LegacyVariant: p.S111N (c.545G>A)

ClinVarID: 223186 https://www.ncbi.nlm.nih.gov/clinvar/variation/223186/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: S111N (c.332G>A)

MultipleGeneVariants: N/A

PatientID: None

KindredID: 39

Case: Age, sex ethnicity unknown

DiseaseAssertion: unknown; paper focused only on pheochromocytoma

FamilyInfo: No specific family info was present; although this was recorded as a family germline mutation belonging to Family ID 39

CasePresentingHPOs: N/A

CaseHPOFreeText: Unknown or unstated.

CaseNotHPOs: N/A

CaseNotHPOFreeText: Unknown evidence for pheochromocytoma (neither yes nor no was stated) in this family

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.S65W (c.194C>G)

CaseProblemVariantFreeText: N/A

LegacyVariant: S65W (c.407C>G)

ClinVarID: 43597 https://www.ncbi.nlm.nih.gov/clinvar/variation/43597/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: S65W (c.194C>G)

MultipleGeneVariants: N/A

PatientID: 5

KindredID: 5

Case: F, 50Y0M, Ethnicity Unknown

DiseaseAssertion: assumed VHL

FamilyInfo: Positive family history. Her mother suffered from blindness of one eye potentially due to retinal angiomatosis and was operated for a left adrenal pheochromocytoma. Her uncle died due to renal cell carcinoma and had spinal hemangioblastomas. All three of her sons are carriers of the mutation, one of whom was operated for a right adrenal pheochromocytoma at age 24 and a left adrenal pheochromocytoma at age 32. Screening of the 27-yr-old son revealed asymptomatic retinal and spinal hemangioblastomas.

CohortInfo: An international consortium registered patients with head and neck paragangliomas with VHL or RET gene mutations.

CasePresentingHPOs: HP:0002668; HP:0006748; HP:0009711; HP:0009713 (paraganglioma, adrenal pheochromocytoma, retinal capillary hemangioma, spinal hemangioblastoma)

CaseHPOFreeText: At 37Y she noted a mass at the left side of her neck. MRI disclosed a 3-cm carotid body tumor (paraganglioma). At age 50, the patient was operated for a left adrenal pheochromocytoma. Clinical screening for VHL showed asymptomatic retinal and spinal hemangioblastomas.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R107H (c.320G>A)

LegacyVariant: p.R107H

CaseProblemVariantFreeText: As the publication only provides the p., the mutation was deduced to p.R107H (c.320G>A)

ClinVarID: 223184 https://www.ncbi.nlm.nih.gov/clinvar/variation/223184/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: R107H (c.320G>A)

MultipleGeneVariants: N/A

PatientID: N/A (son 1)

KindredID: 12

Case: M, Age Unknown, Ethnicity Unknown

DiseaseAssertion: paraganglioma

FamilyInfo: His mother and two older brothers presented with the mutation. The brothers were asymptomatic, while his mother had pheo and paragangliomas

CasePresentingHPOs: HP:0002668 (paraganglioma)

CaseHPOFreeText: After findings of this mother, he was screened and his disclosed a 2.4cm abdominal paraganglioma

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.Y156C (c.467A>G)

LegacyVariant: p.Y156C

CaseProblemVariantFreeText: The publication only provides the p., the mutation was able to be deduced to p.Y156C (c.467A>G)

ClinVarID: 43600 https://www.ncbi.nlm.nih.gov/clinvar/variation/43600/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: Y156C (c.467A>G)

MultipleGeneVariants: N/A

PatientID: 23

KindredID: 23

Case: F, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Positive family history.

CasePresentingHPOs: HP:0002666, HP:0002864, HP:0009711, HP:0001737 (pheochromocytoma, paraganglioma of head and neck, retinal capillary hemangioma, pancreatic cysts)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 9880225

SupplementalData: N/A

Variant: p.Y98H (c.292T>C)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 2223 https://www.ncbi.nlm.nih.gov/clinvar/variation/2223/

CAID: N/A

gnomAD: 0.00001343 https://gnomad.broadinstitute.org/variant/3-10183823-T-C

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: Y98H (c.292T>C)

MultipleGeneVariants: N/A

PatientID: I-2

KindredID: 1

Case: M, Age Unknown (deceased), Ethnicity Unknown

DiseaseAssertion: Assumed VHL

FamilyInfo: 38 family members had been affected at the date of 1986, and 10 had passed away. Pheochromocytoma, cerebellar, spinal and retinal hemangioblastomas, and various cysts were clinical manifestations of VHL seen throughout the family. This male (I-2) appears to be the furthest traced relative with the presumed mutation, passing on to 3 of his 4 offspring, and dozens of kin thereafter. See Fig 1 for family pedigree.

CasePresentingHPOs: N/A

CaseHPOFreeText: Affected, although details are unknown.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167W (c.499C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: Although never given at the time of this publication, the germline mutation is confirmed in this family in later publications (PMID 7987306; 29437867) for this specific family. It can only be assumed this member had the VHL mutation.

ClinVarID: 2218, https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: N/A

gnomAD: 0.000007954, https://gnomad.broadinstitute.org/variant/3-10191506-C-T?dataset=gnomad_r2_1

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

PatientID: IV-23

KindredID: 1

Case: F, Age Unknown, Ethnicity Unknown

DiseaseAssertion: Assumed VHL

FamilyInfo: 38 family members had been affected at the date of 1986, and 10 had passed away. Pheochromocytoma, cerebellar, spinal and retinal hemangioblastomas, and various cysts were clinical manifestations of VHL seen throughout the family. This patient (IV-23) appears to have inherited this disease from her father. See Fig. 1 for family pedigree.

CasePresentingHPOs: HP:0009711 (retinal capillary hemangioma)

CaseHPOFreeText: This member had retinal angiomas which were not further described.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167W (c.499C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: Although never given at the time of this publication, the germline mutation is confirmed in this family in later publications (PMID 7987306; 29437867) for this specific family. It is only here assumed this member had the VHL mutation.

ClinVarID: 2218, https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: N/A

gnomAD: 0.000007954, https://gnomad.broadinstitute.org/variant/3-10191506-C-T?dataset=gnomad_r2_1

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

PatientID: IV-38

KindredID: 1

Case: M, Age Unknown, Ethnicity Unknown

DiseaseAssertion: Assumed VHL

FamilyInfo: 38 family members had been affected at the date of 1986, and 10 had passed away. Pheochromocytoma, cerebellar, spinal and retinal hemangioblastomas, and various cysts were clinical manifestations of VHL seen throughout the family. This patient (IV-38) appears to have inherited this disease from his mother, along with many of his siblings. See Fig. 1 for family pedigree.

CasePresentingHPOs: HP:0002666 (pheochromocytoma)

CaseHPOFreeText: This member was examined in St. Johns at the Memorial University of Newfoundland. He had pheochromocytoma which was not further described.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167W (c.499C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: Although never given at the time of this publication, the germline mutation is confirmed in this family in later publications (PMID 7987306; 29437867) for this specific family. It is only here assumed this member had the VHL mutation.

ClinVarID: 2218, https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: N/A

gnomAD: 0.000007954, https://gnomad.broadinstitute.org/variant/3-10191506-C-T?dataset=gnomad_r2_1

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

PatientID: 13

KindredID: 9

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Two other members of this family (patients 11 and 17) had the same VHL gene mutation. Patient 11 presented with cerebellar hemangioblastoma. Patient 17 presented with hemangioblastoma of the spinal cord and hemangioblastoma of the medulla oblongata.

CohortInfo: A total of 42 CNS haemangioblastoma samples were obtained from 31 patients, who were consecutively treated between 1993 and 1997 at the Department of Neurosurgery of the Freiburg University Medical Centre.

CasePresentingHPOs: HP:0006880 (cerebellar hemangioblastoma)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.Y98H (c.292T>C)

CaseProblemVariantFreeText: N/A

LegacyVariant: p.Y98H (c.505T>C)

ClinVarID: 2223 https://www.ncbi.nlm.nih.gov/clinvar/variation/2223/

CAID: N/A

gnomAD: 0.00001343 https://gnomad.broadinstitute.org/variant/3-10183823-T-C

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: Y98H (c.292T>C)

MultipleGeneVariants: N/A

PatientID: 18 (tumour samples 18a, 18b)

KindredID: 14

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CohortInfo: A total of 42 CNS haemangioblastoma samples were obtained from 31 patients, who were consecutively treated between 1993 and 1997 at the Department of Neurosurgery of the Freiburg University Medical Centre.

CasePresentingHPOs: HP:0006880; HP:0009713 (cerebellar hemangioblastoma, spinal hemangioblastoma)

CaseHPOFreeText: Patient presented with 2 VHL-related tumors, one in the spinal chord region T7/8, and one in the cerebellum (a,b). Tumors a and b presented with LOH positive somatic information but negative methylation.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.W88R (c.262T>A)

CaseProblemVariantFreeText: N/A

LegacyVariant: p.W88R (c.475T>A)

ClinVarID: 456577 https://www.ncbi.nlm.nih.gov/clinvar/variation/456577/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: W88R (c.262T>A)

MultipleGeneVariants: N/A

PatientID: 4

KindredID: 4

Case: F, 41Y0M, Ethnicity unknown

DiseaseAssertion: VHL

FamilyInfo: Familial VHL mutation - This one index case and their 4 relatives harbored p.Arg161X mutation - all with the same phenotypes hemangioblastoma, renal cell carcinoma and pancreatic cysts

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0001737 (hemangioblastoma; renal cell carcinoma; pancreatic cysts)

CaseHPOFreeText: With an age of diagnosis of VHL at 41

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: Patients with clinical manifestations suggestive of VHL or MEN2 were first screened for VHL or RET mutation, respectively. Possible screening of RET, SDHB and SDHD as well

PreviouslyPublished: N/A

SupplementalData: Yes

Variant: p.R161* (c.481C>T)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 2217 https://www.ncbi.nlm.nih.gov/clinvar/variation/2217/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: R161* (c.481C>T)

MultipleGeneVariants: N/A

PatientID: II:3

KindredID: 1

Case: F, 48Y0M, Spanish

DiseaseAssertion: assumed VHL

FamilyInfo: Spanish family of 15 members studied, over 2 generations. 6 members had VHL presentations, 1 was a carrier, and 4 others had the mutation, while 2 were not sequenced. This patient’s 2 children presented with the VHL mutation, and her brother and 3 of his children presented with VHL symptoms

CasePresentingHPOs: HP:0002666; HP:0009711 (pheochromocytoma, retinal capillary hemangiomas)

CaseHPOFreeText: First studied at 43Y, this patient had a right accumulation of pheos at 6cm, and retinal angiomas

CaseNotHPOs: HP:0006880 (cerebellar hemangioblastoma)

CaseNotHPOFreeText: Brain MRI and CT-scans were normal.

CasePreviousTesting: RET

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167W (c.499C>T)

LegacyVariant: p.R238T, C>T

CaseProblemVariantFreeText: N/A

ClinVarID: 2218, https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: N/A

gnomAD: 0.000007954, https://gnomad.broadinstitute.org/variant/3-10191506-C-T

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

PatientID: V5

KindredID: 3

Case: M, 47Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Sister presented with the same germline mutation and at least one cerebellar hemangioblastoma at the age of 29.

CasePresentingHPOs: HP:0006880(Cerebellar hemangioblastoma)

CaseHPOFreeText: Presented with at least two brainstem hemangioblastoma at the age of 35 and and 47.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.H110P (c.329A>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351751310, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_canonicalid?canonicalid=CA351751310

gnomAD: N/A

VariantEvidence: The c.329A>C variant was not genetically confirmed to be germline but was found in samples from both tumors presented by this patient.

MutationType: missense_variant;transversion

CivicName: H110P (c.329A>C)

MultipleGeneVariants: N/A

PatientID: 29

KindredID: 372

Case: Sex unknown, Age unknown, French

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0002666; HP:0030405 (pheochromocytoma, pancreatic endocrine tumour)

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0005584 (renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167Q (c.500G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVar: 2216 https://www.ncbi.nlm.nih.gov/clinvar/variation/2216/

CAID: N/A

gnomAD: 0.000003977 https://gnomad.broadinstitute.org/variant/3-10191507-G-A

VariantEvidence:N/A

MutationType: missense_variant;transition

CivicName: R167Q (c.500 G >A)

MultipleGeneVariants: N/A

PatientID: 15

KindredID: 503

Case: Sex unknown, Age unknown, French

DiseaseAssertion: VHL

FamilyInfo: One other member belonging to family 503 was mentioned (Patient: 7). This patient was found to have a pancreatic endocrine tumour, pheochromocytoma and renal cell carcinoma.

CasePresentingHPOs: HP:0030405 (pancreatic endocrine tumour)

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0002666; HP:0005584 (pheochromocytoma, renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.P86S (c.256C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 178692 https://www.ncbi.nlm.nih.gov/clinvar/variation/178692/

CAID: N/A

gnomAD: N/A

VariantEvidence:N/A

MutationType: missense_variant;transition

CivicName: P86S (c.256C>T)

MultipleGeneVariants: N/A

PatientID: 14

KindredID: 12

Case: Sex unknown, Age unknown, French

DiseaseAssertion: VHL

FamilyInfo: None

CasePresentingHPOs: HP:0030405; HP:0002666; HP:0005584 (pancreatic endocrine tumour, pheochromocytoma, renal cell carcinoma)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R82P (c.245G>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 193118 https://www.ncbi.nlm.nih.gov/clinvar/variation/193118/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: R82P (c.245G>C)

MultipleGeneVariants: N/A

PatientID: 3

KindredID: 1

Case: F, 14Y0M, Japanese

DiseaseAssertion: assumed VHL

FamilyInfo: Mother (39Y) with retinal angiomas and cerebellar hemangioblastoma, and her older sister (P1) with cerebellar hemangioblastoma, retinal capillary hemangioma, pancreatic cysts and a hearing impairment both had the p.P86L VHL mutation. Father did not.

CasePresentingHPOs: HP:0006880; HP:0010302; HP:0009711; HP:0001737; HP:0000107 (cerebellar hemangioblastoma; spinal cord tumor; retinal capillary hemangioma; Pancreatic cysts; renal cyst)

CaseHPOFreeText: at age 14 had 3 small inter cranial tumors (not removed) and by at 19 years had obstructive hydrocephalus caused by enlargement of the cerebellar tumors (hemangioblastomas). Retinal angiomas were found in the right eye, cystic lesions in the pancreas and the left kidney, and a cystic tumor in the cervical cord

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.P86L (c.257C>T)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 182977 https://www.ncbi.nlm.nih.gov/clinvar/variation/182977/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: P86L (c.257C>T)

MultipleGeneVariants: N/A

PatientID: None

KindredID: 2

Case: age, sex, ethnicity unknown

DiseaseAssertion: pheochromocytoma

FamilyInfo: N/A

CasePresentingHPOs: HP:0002666 (pheochromocytoma)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.V84L (c.250G>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2236 https://www.ncbi.nlm.nih.gov/clinvar/variation/2236/

CAID: N/A

gnomAD: N/A

VariantEvidence:N/A

MutationType: missense_variant; transversion

CivicName: V84L (c.250G>T)

MultipleGeneVariants: N/A

PatientID: None

KindredID: 13

Case: age, sex, ethnicity unknown

DiseaseAssertion: Unknown

FamilyInfo: N/A

CasePresentingHPOs: N/A

CaseHPOFreeText: Described as a positive control but not stated anything further

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: Likely previously published - not clear where the controls came from/ how they were used.

SupplementalData: N/A

Variant: p.R167W (c.499C>T)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 2218, https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: N/A

gnomAD: 0.000007954, https://gnomad.broadinstitute.org/variant/3-10191506-C-T

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

PatientID: 4

KindredID: 2

Case: F, 14Y0M, Brazilian (Latino/Admixed American)

DiseaseAssertion: VHL

FamilyInfo: None

CasePresentingHPOs: HP:0002666; HP:0030405 (pheochromocytoma, pancreatic endocrine tumor)

CaseHPOFreeText: The patient developed bilateral pheo (as large as L = 6.0cm and R = 5.5cm) at 8Y of age. These recurred after 24months. They later presented with multiple PNET (largest 1.5cm) at 14Y.

CaseNotHPOs: HP:0002668; HP:0005584; HP:0001737; HP:0010797; HP:0009711; HP:0000107 (paraganglioma, renal cell carcinoma, pancreatic cyst, hemangioblastoma, retinal capillary hemangioma, renal cyst)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.G114S (c.340G>A)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 583094 https://www.ncbi.nlm.nih.gov/clinvar/variation/583094/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: G114S (c.340G>A)

MultipleGeneVariants: N/A

PatientID: None

KindredID: 5

Case: F, 58Y0M, Ethnicity Unknown

DiseaseAssertion: Clear Cell Renal Cell Carcinoma

FamilyInfo: N/A

CohortInfo: The National Cancer Institute has a frozen tumour bank of ccRCC tumours that have been removed from VHL patients. We selected six patients, three males and three females, with at least five tumours from a single surgery from one kidney.

CasePresentingHPOs: HP:0006770 (clear cell renal cell carcinoma)

CaseHPOFreeText: The patient presented with ccRCC at age 58.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.T105Rfs*54(c.314delC)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA432420540 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.314delC

gnomAD: N/A

VariantEvidence: N/A

MutationType: minus_1_frameshift_variant

CivicName: T105Rfs*54(c.314delC)

MultipleGeneVariants: N/A

PatientID: 15

KindredID: 15

Case: F, 24Y0M, Ethnicity Unknown

DiseaseAssertion: Adrenal pheochromocytoma

FamilyInfo: N/A

CasePresentingHPOs: HP:0006748 (adrenal pheochromocytoma)

CaseHPOFreeText: The patient was found to have multiple benign tumour 7 cm in size in her adrenal gland.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET/SDHC/SDHB/SDHD

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.L178Q(c.533T>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 625260 https://www.ncbi.nlm.nih.gov/clinvar/variation/625260/

CAID: N/A

gnomAD: N/A

VariantEvidence: The patient had LOH of SDHC as indicated in Table 1.

MutationType: missense_variant;transversion

CivicName: L178Q(c.533T>A)

MultipleGeneVariants: N/A

PatientID: 17

KindredID: 17

Case: M, 18Y0M, Ethnicity Unknown

DiseaseAssertion: Adrenal pheochromocytoma

FamilyInfo: N/A

CasePresentingHPOs: HP:0006748 (adrenal pheochromocytoma)

CaseHPOFreeText: The patient was found to have multiple benign tumours 2 cm in size in her adrenal gland.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET/SDHC/SDHB/SDHD

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: Exon 2 Loss

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: The patient had LOH of SDHC as indicated by Table 1.

MutationType: exon_loss_variant

CivicName: Exon 2 Deletion

MultipleGeneVariants: N/A

PatientID: 16

KindredID: 16

Case: M, 20Y0M, Ethnicity Unknown

DiseaseAssertion: Adrenal pheochromocytoma

FamilyInfo: N/A

CasePresentingHPOs: HP:0006748 (adrenal pheochromocytoma)

CaseHPOFreeText: The patient was found to have multiple benign tumour 1 cm in size in his adrenal gland.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET/SDHC/SDHB/SDHD

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.*214G(c.640T>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351756720 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.640T%3EG

gnomAD: N/A

VariantEvidence: The patient had LOH of VHL, SDHB, SDHC, and SDHD as indicated by Table 1.

MutationType: stop_lost

CivicName: *214G(c.640T>G)

MultipleGeneVariants: Somatic, RET, c.2307T>G

PatientID: V81

KindredID: V81

Case: Sex Unknown, Age Unknown, French

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: N/A

CaseHPOFreeText: Diagnosed with VHL Type 1.

CaseNotHPOs: HP:0002666 (Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: Likely 15300849

SupplementalData: N/A

Variant: p.V170G (c.509T>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351756196, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.509T%3EG

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: V170G (c.509T>G)

MultipleGeneVariants: N/A

PatientID: V87

KindredID: V87

Case: Sex Unknown, Age Unknown, Sex Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CohortInfo: 92 unrelated patients with VHL disease.

CasePresentingHPOs: HP:0002666 (pheochromocytoma)

CaseHPOFreeText: This family was classified as VHL type 2B meaning they had a pheochromocytoma and presence of renal and pancreatic manifestations.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.Y156D(c.466T>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351756043 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.466T%3EG

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName:Y156D(c.466T>G)

MultipleGeneVariants: N/A

GroupID: 16

DiseaseAssertion: VHL

GroupSize: N/A GroupNumberMales: N/A GroupNumberFemales: N/A GroupEthnicity: N/A GroupAgeRange: N/A

GroupInfo: 54 VHL deletion families from the Freiburg registry were selected in order to assist in the correlation of VHL deletions to clinical phenotypes.

GroupPresentingHPOs: HP:0000107; HP:0010797; HP:0009713; HP:0001737 (Renal cyst, Hemangioblastoma, Spinal hemangioblastoma, Pancreatic cysts)

GroupHPOFreeText: # of affected individuals: Renal cyst (1), Hemangioblastoma/brain/cerebellum (1), Spinal hemangioblastoma (1), Pancreatic cysts (1)

GroupNotHPOs: N/A

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplemental Table 2, Table 1, Table 3

Variant: Exon 2 Deletion (c.341-?-463+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: Exon 2 Deletion

MultipleGeneVariants: N/A

GroupID: 32

DiseaseAssertion: VHL

GroupSize: N/A GroupNumberMales: N/A GroupNumberFemales: N/A GroupEthnicity: N/A GroupAgeRange: N/A

GroupInfo: 54 VHL deletion families from the Freiburg registry were selected in order to assist in the correlation of VHL deletions to clinical phenotypes.

GroupPresentingHPOs: HP:0000107; HP:0009711; HP:0010797; HP:0009713; HP:0001737 (Renal cyst, Retinal capillary hemangioma, Hemangioblastoma, Spinal hemangioblastoma, Pancreatic cysts)

GroupHPOFreeText: # of affected individuals: Renal cyst (1), Retinal capillary hemangioma (1), Hemangioblastoma/brain/cerebellum (1), Spinal hemangioblastoma (1), Pancreatic cysts/single cyst (1)

GroupNotHPOs: N/A

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplemental Table 2, Table 1, Table 3

Variant: Exon 3 Deletion (c.464-?_642+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: Exon 3 Deletion

MultipleGeneVariants: N/A

GroupID: None

DiseaseAssertion: VHL

GroupSize:2

GroupNumberMales:N/A

GroupNumberFemales:N/A

GroupEthnicity: N/A

GroupAgeRange: ≥12

GroupInfo: The two patients were grouped by mutation.

GroupPresentingHPOs: HP:0001732 (abnormality of the pancreas)

GroupHPOFreeText: N/A

GroupNotHPOs:N/A

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished:N/A

SupplementalData: N/A

Variant: p.L101G(c.301_302delinsGG)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID:CA915940707 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.301_302delinsGG

gnomAD: N/A

VariantEvidence: N/A

MutationType: delins

CivicName:L101G (c.301_302delCTinsGG)

MultipleGeneVariants: N/A