PatientID: 4

KindredID: 4

Case: F, 41Y0M, Ethnicity unknown

DiseaseAssertion: VHL

FamilyInfo: Familial VHL mutation - This one index case and their 4 relatives harbored p.Arg161X mutation - all with the same phenotypes hemangioblastoma, renal cell carcinoma and pancreatic cysts

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0001737 (hemangioblastoma; renal cell carcinoma; pancreatic cysts)

CaseHPOFreeText: With an age of diagnosis of VHL at 41

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: Patients with clinical manifestations suggestive of VHL or MEN2 were first screened for VHL or RET mutation, respectively. Possible screening of RET, SDHB and SDHD as well

PreviouslyPublished: N/A

SupplementalData: Yes

Variant: p.R161* (c.481C>T)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 2217 https://www.ncbi.nlm.nih.gov/clinvar/variation/2217/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: R161* (c.481C>T)

MultipleGeneVariants: N/A

PatientID: II:3

KindredID: 1

Case: F, 48Y0M, Spanish

DiseaseAssertion: assumed VHL

FamilyInfo: Spanish family of 15 members studied, over 2 generations. 6 members had VHL presentations, 1 was a carrier, and 4 others had the mutation, while 2 were not sequenced. This patient’s 2 children presented with the VHL mutation, and her brother and 3 of his children presented with VHL symptoms

CasePresentingHPOs: HP:0002666; HP:0009711 (pheochromocytoma, retinal capillary hemangiomas)

CaseHPOFreeText: First studied at 43Y, this patient had a right accumulation of pheos at 6cm, and retinal angiomas

CaseNotHPOs: HP:0006880 (cerebellar hemangioblastoma)

CaseNotHPOFreeText: Brain MRI and CT-scans were normal.

CasePreviousTesting: RET

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167W (c.499C>T)

LegacyVariant: p.R238T, C>T

CaseProblemVariantFreeText: N/A

ClinVarID: 2218, https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: N/A

gnomAD: 0.000007954, https://gnomad.broadinstitute.org/variant/3-10191506-C-T

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

PatientID: 85

KindredID: 85

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Family history of VHL but no details provided.

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Patient information pulled from Supplemental Table 1. There is additional tumour specific information in Supplemental Table 2.

Variant: p.P138P (c.414A>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223206, https://www.ncbi.nlm.nih.gov/clinvar/variation/223206/

CAID: N/A

gnomAD: N/A

VariantEvidence: Functionally validated by mRNA analysis, which showed a splicing alteration (data not shown). Membrane CA9 immunostaining was observed (supplemental table 1).

MutationType: missense_variant;transition; synonymous_variant

CivicName: P138= (c.414A>G)

MultipleGeneVariants: N/A

PatientID: 57

KindredID: 57

Case: Sex Unknown, 16Y0M, Ethnicity Unknown

DiseaseAssertion: Pheochromocytoma

FamilyInfo: N/A

CasePresentingHPOs: HP:0002666 (pheochromocytoma)

CaseHPOFreeText: The patient had a single pheochromocytoma.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Patient information pulled from Supplemental Table 1. There is additional tumour specific information in Supplemental Table 2.

Variant: p.R167Q (c.500G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2216 https://www.ncbi.nlm.nih.gov/clinvar/variation/2216/

CAID: N/A

gnomAD: 0.000003977 https://gnomad.broadinstitute.org/variant/3-10191507-G-A

VariantEvidence: Carbonic anhydrase 9 (CA9) mRNA level of 25.67 was detected. Membrane CA9 immunostaining was observed (supplemental table 1).

MutationType: missense_variant;transition

CivicName: R167Q (c.500G>A)

MultipleGeneVariants: N/A

PatientID: V5

KindredID: 3

Case: M, 47Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Sister presented with the same germline mutation and at least one cerebellar hemangioblastoma at the age of 29.

CasePresentingHPOs: HP:0006880(Cerebellar hemangioblastoma)

CaseHPOFreeText: Presented with at least two brainstem hemangioblastoma at the age of 35 and and 47.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.H110P (c.329A>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351751310, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_canonicalid?canonicalid=CA351751310

gnomAD: N/A

VariantEvidence: The c.329A>C variant was not genetically confirmed to be germline but was found in samples from both tumors presented by this patient.

MutationType: missense_variant;transversion

CivicName: H110P (c.329A>C)

MultipleGeneVariants: N/A

PatientID: 29

KindredID: 372

Case: Sex unknown, Age unknown, French

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0002666; HP:0030405 (pheochromocytoma, pancreatic endocrine tumour)

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0005584 (renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167Q (c.500G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVar: 2216 https://www.ncbi.nlm.nih.gov/clinvar/variation/2216/

CAID: N/A

gnomAD: 0.000003977 https://gnomad.broadinstitute.org/variant/3-10191507-G-A

VariantEvidence:N/A

MutationType: missense_variant;transition

CivicName: R167Q (c.500 G >A)

MultipleGeneVariants: N/A

PatientID: 15

KindredID: 503

Case: Sex unknown, Age unknown, French

DiseaseAssertion: VHL

FamilyInfo: One other member belonging to family 503 was mentioned (Patient: 7). This patient was found to have a pancreatic endocrine tumour, pheochromocytoma and renal cell carcinoma.

CasePresentingHPOs: HP:0030405 (pancreatic endocrine tumour)

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0002666; HP:0005584 (pheochromocytoma, renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.P86S (c.256C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 178692 https://www.ncbi.nlm.nih.gov/clinvar/variation/178692/

CAID: N/A

gnomAD: N/A

VariantEvidence:N/A

MutationType: missense_variant;transition

CivicName: P86S (c.256C>T)

MultipleGeneVariants: N/A

PatientID: 14

KindredID: 12

Case: Sex unknown, Age unknown, French

DiseaseAssertion: VHL

FamilyInfo: None

CasePresentingHPOs: HP:0030405; HP:0002666; HP:0005584 (pancreatic endocrine tumour, pheochromocytoma, renal cell carcinoma)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R82P (c.245G>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 193118 https://www.ncbi.nlm.nih.gov/clinvar/variation/193118/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: R82P (c.245G>C)

MultipleGeneVariants: N/A

PatientID: 3

KindredID: 1

Case: F, 14Y0M, Japanese

DiseaseAssertion: assumed VHL

FamilyInfo: Mother (39Y) with retinal angiomas and cerebellar hemangioblastoma, and her older sister (P1) with cerebellar hemangioblastoma, retinal capillary hemangioma, pancreatic cysts and a hearing impairment both had the p.P86L VHL mutation. Father did not.

CasePresentingHPOs: HP:0006880; HP:0010302; HP:0009711; HP:0001737; HP:0000107 (cerebellar hemangioblastoma; spinal cord tumor; retinal capillary hemangioma; Pancreatic cysts; renal cyst)

CaseHPOFreeText: at age 14 had 3 small inter cranial tumors (not removed) and by at 19 years had obstructive hydrocephalus caused by enlargement of the cerebellar tumors (hemangioblastomas). Retinal angiomas were found in the right eye, cystic lesions in the pancreas and the left kidney, and a cystic tumor in the cervical cord

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.P86L (c.257C>T)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 182977 https://www.ncbi.nlm.nih.gov/clinvar/variation/182977/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: P86L (c.257C>T)

MultipleGeneVariants: N/A

PatientID: None

KindredID: 2

Case: age, sex, ethnicity unknown

DiseaseAssertion: pheochromocytoma

FamilyInfo: N/A

CasePresentingHPOs: HP:0002666 (pheochromocytoma)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.V84L (c.250G>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2236 https://www.ncbi.nlm.nih.gov/clinvar/variation/2236/

CAID: N/A

gnomAD: N/A

VariantEvidence:N/A

MutationType: missense_variant; transversion

CivicName: V84L (c.250G>T)

MultipleGeneVariants: N/A

PatientID: None

KindredID: 13

Case: age, sex, ethnicity unknown

DiseaseAssertion: Unknown

FamilyInfo: N/A

CasePresentingHPOs: N/A

CaseHPOFreeText: Described as a positive control but not stated anything further

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: Likely previously published - not clear where the controls came from/ how they were used.

SupplementalData: N/A

Variant: p.R167W (c.499C>T)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 2218, https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: N/A

gnomAD: 0.000007954, https://gnomad.broadinstitute.org/variant/3-10191506-C-T

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

PatientID: None

KindredID: 1

Case: age, sex, ethnicity unknown

DiseaseAssertion: pheochromocytoma

FamilyInfo: N/A

CasePresentingHPOs: HP:0002666 (pheochromocytoma)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.V84L (c.250G>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2236 https://www.ncbi.nlm.nih.gov/clinvar/variation/2236/

CAID: N/A

gnomAD: N/A

VariantEvidence:N/A

MutationType: missense_variant; transversion

CivicName: V84L (c.250G>T)

MultipleGeneVariants: N/A

PatientID: 4

KindredID: 2

Case: F, 14Y0M, Brazilian (Latino/Admixed American)

DiseaseAssertion: VHL

FamilyInfo: None

CasePresentingHPOs: HP:0002666; HP:0030405 (pheochromocytoma, pancreatic endocrine tumor)

CaseHPOFreeText: The patient developed bilateral pheo (as large as L = 6.0cm and R = 5.5cm) at 8Y of age. These recurred after 24months. They later presented with multiple PNET (largest 1.5cm) at 14Y.

CaseNotHPOs: HP:0002668; HP:0005584; HP:0001737; HP:0010797; HP:0009711; HP:0000107 (paraganglioma, renal cell carcinoma, pancreatic cyst, hemangioblastoma, retinal capillary hemangioma, renal cyst)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.G114S (c.340G>A)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 583094 https://www.ncbi.nlm.nih.gov/clinvar/variation/583094/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: G114S (c.340G>A)

MultipleGeneVariants: N/A

PatientID: None

KindredID: 5

Case: F, 58Y0M, Ethnicity Unknown

DiseaseAssertion: Clear Cell Renal Cell Carcinoma

FamilyInfo: N/A

CohortInfo: The National Cancer Institute has a frozen tumour bank of ccRCC tumours that have been removed from VHL patients. We selected six patients, three males and three females, with at least five tumours from a single surgery from one kidney.

CasePresentingHPOs: HP:0006770 (clear cell renal cell carcinoma)

CaseHPOFreeText: The patient presented with ccRCC at age 58.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.T105Rfs*54(c.314delC)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA432420540 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.314delC

gnomAD: N/A

VariantEvidence: N/A

MutationType: minus_1_frameshift_variant

CivicName: T105Rfs*54(c.314delC)

MultipleGeneVariants: N/A

PatientID: 15

KindredID: 15

Case: F, 24Y0M, Ethnicity Unknown

DiseaseAssertion: Adrenal pheochromocytoma

FamilyInfo: N/A

CasePresentingHPOs: HP:0006748 (adrenal pheochromocytoma)

CaseHPOFreeText: The patient was found to have multiple benign tumour 7 cm in size in her adrenal gland.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET/SDHC/SDHB/SDHD

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.L178Q(c.533T>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 625260 https://www.ncbi.nlm.nih.gov/clinvar/variation/625260/

CAID: N/A

gnomAD: N/A

VariantEvidence: The patient had LOH of SDHC as indicated in Table 1.

MutationType: missense_variant;transversion

CivicName: L178Q(c.533T>A)

MultipleGeneVariants: N/A

PatientID: 16

KindredID: 16

Case: M, 20Y0M, Ethnicity Unknown

DiseaseAssertion: Adrenal pheochromocytoma

FamilyInfo: N/A

CasePresentingHPOs: HP:0006748 (adrenal pheochromocytoma)

CaseHPOFreeText: The patient was found to have multiple benign tumour 1 cm in size in his adrenal gland.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET/SDHC/SDHB/SDHD

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.*214G(c.640T>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351756720 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.640T%3EG

gnomAD: N/A

VariantEvidence: The patient had LOH of VHL, SDHB, SDHC, and SDHD as indicated by Table 1.

MutationType: stop_lost

CivicName: *214G(c.640T>G)

MultipleGeneVariants: Somatic, RET, c.2307T>G

PatientID: V81

KindredID: V81

Case: Sex Unknown, Age Unknown, French

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: N/A

CaseHPOFreeText: Diagnosed with VHL Type 1.

CaseNotHPOs: HP:0002666 (Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: Likely 15300849

SupplementalData: N/A

Variant: p.V170G (c.509T>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351756196, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.509T%3EG

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: V170G (c.509T>G)

MultipleGeneVariants: N/A

PatientID: V87

KindredID: V87

Case: Sex Unknown, Age Unknown, Sex Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CohortInfo: 92 unrelated patients with VHL disease.

CasePresentingHPOs: HP:0002666 (pheochromocytoma)

CaseHPOFreeText: This family was classified as VHL type 2B meaning they had a pheochromocytoma and presence of renal and pancreatic manifestations.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.Y156D(c.466T>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351756043 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.466T%3EG

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName:Y156D(c.466T>G)

MultipleGeneVariants: N/A

GroupID: V8

DiseaseAssertion: VHL

GroupSize: 14

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: French

GroupAgeRange: N/A

GroupInfo: Patients are grouped by family.

FamilyInfo: 14/27 members of this family that underwent genetic testing had the same mutation.

GroupPresentingHPOs: N/A

GroupHPOFreeText: Diagnosed with VHL Type 1.

GroupNotHPOs: HP:0002666 (Pheochromocytoma)

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.T105P (c.313A>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 496055, https://www.ncbi.nlm.nih.gov/clinvar/variation/496055/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: T105P (c.313A>C)

MultipleGeneVariants: N/A

PatientID: V233

KindredID: V233

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: One unaffected family members were tested and found to be negative. No other family history was available.

CohortInfo: 92 unrelated patients with VHL disease.

CasePresentingHPOs: HP:0002666 (pheochromocytoma)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.N131K(c.393C>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 420074 https://www.ncbi.nlm.nih.gov/clinvar/variation/420074/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName:N131K(c.393C>A)

MultipleGeneVariants: N/A

PatientID: 23

KindredID: 23

Case: Age, Sex, Ethnicity unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; HP:0009711 (hemangioblastoma, retinal capillary hemangioma)

CaseHPOFreeText: patient was recorded with a CNS hemangioblastoma, and a retinal hemangioblastoma

CaseNotHPOs: HP:0030421; HP:0030405; HP:0006770; HP:0100634 (epididymal tumour, pancreatic endocrine tumour, clear cell renal cell carcinoma, neuroendocrine neoplasm)

CaseNotHPOFreeText: patient was not recorded to have an epididymal tumor, a pancreatic endocrine tumour (pancreatic neuroendocrine neoplasm), CCRCC, nor a neuroendocrine neoplasm (pheochromocytoma/paraganglioma)

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Yes; see table S1 for VHL subject genetic and manifestation information.

Variant: c.341-2A>G

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 223194 https://www.ncbi.nlm.nih.gov/clinvar/variation/223194/

CAID: N/A

gnomAD: N/A

VariantEvidence: Recorded in paper as: IVS1-2A>G; contacted author for confirmation.

MutationType: splice_site_variant

CivicName: Splice Site (c.341-2A>G)

MultipleGeneVariants: N/A

PatientID: 14

KindredID: 14

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; HP:0006770; HP:0100634 (hemangioblastoma; clear cell renal cell carcinoma; Neuroendocrine neoplasm)

CaseHPOFreeText: patient had CNS hemangioblastoma, ccRCC and a neuroendocrine neoplasm reported as pheochromocytoma/paraganglioma.

CaseNotHPOs: HP:0030405; HP:0009711; HP:0030421 (pancreatic neuroendocrine neoplasm, retinal capillary hemangioma, Epididymal neoplasm)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Yes; see table S1 for VHL subject genetic and manifestation information.

Variant: p.V130Wfs*30 (c.385_386dup)

LegacyVariant: N/A

CaseProblemVariantFreeText: p.Leu128fs (c.385_386dupCT) does not verify. Contacted authors for clarification and confirmation of c.385_386dup; p.Val130Trpfs*30 as the correct mutation

ClinVarID: N/A

CAID: CA2573130306 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.385_386dup

gnomAD: N/A

VariantEvidence: N/A

MutationType: plus_1_frameshift_variant

CivicName: V130Wfs*30 (c.385_386dup)

MultipleGeneVariants: N/A

GroupID: None

DiseaseAssertion: VHL

GroupSize:2

GroupNumberMales:N/A

GroupNumberFemales:N/A

GroupEthnicity: N/A

GroupAgeRange: ≥12

GroupInfo: The two patients were grouped by mutation.

GroupPresentingHPOs: HP:0001732 (abnormality of the pancreas)

GroupHPOFreeText: N/A

GroupNotHPOs:N/A

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished:N/A

SupplementalData: N/A

Variant: p.L101G(c.301_302delinsGG)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID:CA915940707 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.301_302delinsGG

gnomAD: N/A

VariantEvidence: N/A

MutationType: delins

CivicName:L101G (c.301_302delCTinsGG)

MultipleGeneVariants: N/A

PatientID: 10

KindredID: 10

Case: F, 44Y0M, Korean

DiseaseAssertion: VHL

FamilyInfo: Patient had a positive family history: Her father was died of RCC (no mutation availible), and her younger sister presented with medullary HB at the age of 37 and multiple RCC in both kidneys at the age of 38, harbored the same exon deletion

CasePresentingHPOs: HP:0009713; HP:0001737; HP:0000107 (spinal hemangioblastoma, pancreatic cysts, renal cyst)

CaseHPOFreeText: patient had CNS hemangioblastoma (of multiple spinal hemangioblastomas), and multiple cysts in pancreas and both kidneys were identified by abdomen-pelvis CT.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: Previously reported, HGMD (Human Gene Mutation Database) [Refer to table 2].

SupplementalData: N/A

Variant: Exon 1-3 deletion (c.1-?_642+?del)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVar: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: Exon 1-3 Deletion

MultipleGeneVariants: N/A

GroupID: 30a

DiseaseAssertion: VHL

GroupSize: 4

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: a retrospective cohort study from an eye centre in Germany involved 148 VHL patients and their genetic data involved in retinal capillary hemangiomas.

GroupPresentingHPOs: HP:0009711 (retinal capillary hemangioma)

GroupHPOFreeText: These 4/5 patients with a R107H (c.320G>A) mutation had retinal capillary hemangiomas. Other VHL manifestations were discussed but not per- variant.

GroupNotHPOs: N/A

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R107H (c.320G>A)

LegacyVariant: N/A

GroupProblemVariantFreeText: N/A

ClinVarID: 223184 https://www.ncbi.nlm.nih.gov/clinvar/variation/223184/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: R107H (c.320G>A)

MultipleGeneVariants: N/A

GroupID: 41

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

CohortInfo: a retrospective cohort study from an eye centre in Germany involved 148 VHL patients and their genetic data involved in retinal capillary hemangiomas.

CasePresentingHPOs: HP:0009711 (retinal capillary hemangioma)

CaseHPOFreeText: This individual patient was the only one discussed with this mutation. They had retinal hemangiomas; Other VHL manifestations were discussed but not per- variant.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Yes - Supplementary Table S1

Variant: p.R167W (c.499C>T)

LegacyVariant: N/A

GroupProblemVariantFreeText: N/A

ClinVarID: 2218 https://www.ncbi.nlm.nih.gov/clinvar/variation/2218

CAID: N/A

gnomAD: 0.000007954, https://gnomad.broadinstitute.org/variant/3-10191506-C-T?dataset=gnomad_r2_1

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

PatientID: 12

KindredID: 6

Case: M, 12Y0M, Ethnicity Unknown

DiseaseAssertion: Hemangioblastom

FamilyInfo: A family pedigree is provided in figure 1. The patient’s father carried the same mutation as patient 12, but the father’s occurred de novo, as neither of the father’s parents carried the mutation. The patient’s father had cerebellar, retinal and bulbar hemangioblastomas, and retinal detachment. The patient’s 14-year-old brother (patient 11) was asymptomatic.

CasePresentingHPOs: HP:0010797 (hemangioblastoma)

CaseHPOFreeText: Patient had a CNS hemangioblastoma.

CaseNotHPOs: HP:0009711 (retinal capillary hemangioma)

CaseNotHPOFreeText: Patient did not have Retinal capillary hemangiomas.

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: c.341+1_341–1(463*1_?)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: delins

CivicName: Null (c.341+1_341–1)

MultipleGeneVariants: N/A

PatientID: 8

KindredID: 4

Case: M, 14Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: A family pedigree is provided in figure 1. The parents of patient 8 were molecularly tested and neither possessed the mutation; thus, the mutation was identified as de novo. Neither parent had VHL syndrome characterized by retinal capillary hemangiomas (RCHs).

CasePresentingHPOs: HP:0006880; HP:0009711 (Cerebellar hemangioblastoma; Retinal capillary hemangioma)

CaseHPOFreeText: In 2019, a 14-year-old boy was diagnosed with visual impairment, due to visual acuity of 20/20 in the right eye and 20/640 in the left eye. Four peripheral RCHs were detected in the right eye. The visual impairment of the left eye was due to the severe exudative process involving the macula. Moreover, numerous microhemangioblastomas were revealed by fluorescein angiography. Laser therapy was performed in both eyes, but vitreous hemorrhage occurred in the left eye. Bevacizumab was given three times, as well simultaneous cryotherapies were performed under general anesthesia. Many laser sessions were performed for regression of the RCHs to occur. Further testing revealed a cerebellar hemangioblastoma.

CaseNotHPOs: N/A

CaseNotHPOFreeText: Patient did not have other known tumours.

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R113* (c.337C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 220414, https://www.ncbi.nlm.nih.gov/clinvar/variation/220414/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: R113* (c.337C>T)

MultipleGeneVariants: N/A

PatientID: 4

KindredID: 4

Case: M, 55Y0M, Korean

DiseaseAssertion: VHL

FamilyInfo: No family history of VHL.

CohortInfo: 26 Korean patients with more than one HAB in the CNS or eye, a single HAB in the CNS or retina plus a visceral manifestation (multiple renal, pancreatic or hepatic cysts, pheochromocytoma and RCC) and positive family history plus any one of the above manifestations.

CasePresentingHPOs: HP:0010797 (Hemangioblastoma)

CaseHPOFreeText: Multiple or bilateral CNS hemangioblastoma. Diagnosed with VHL Type 1.

CaseNotHPOs: HP:0002666; HP:0009711; HP:0005584 (Pheochromocytoma, Retinal capillary hemangioma, Renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.E70K (c.208G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 43598, https://www.ncbi.nlm.nih.gov/clinvar/variation/43598/

CAID: N/A

gnomAD: 0.000004365, https://gnomad.broadinstitute.org/variant/3-10183739-G-A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: E70K (c.208G>A)

MultipleGeneVariants: N/A

PatientID: 22

KindredID: 22

Case: F, 26Y0M, Korean

DiseaseAssertion: VHL

FamilyInfo: No family history of VHL.

CohortInfo: 26 Korean patients with more than one HAB in the CNS or eye, a single HAB in the CNS or retina plus a visceral manifestation (multiple renal, pancreatic or hepatic cysts, pheochromocytoma and RCC) and positive family history plus any one of the above manifestations.

CasePresentingHPOs: HP:0010797 (Hemangioblastoma)

CaseHPOFreeText: Multiple or bilateral CNS hemangioblastoma. Other phenotypes presented but not specified (one or more of: pancreatic cyst or tumor, renal or hepatic cyst). Diagnosed with VHL Type 1.

CaseNotHPOs: HP:0009711; HP:0005584; HP:0002666 (Retinal capillary hemangioma, Renal cell carcinoma, Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.L101R (c.302T>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351751004, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_canonicalid?canonicalid=CA351751004

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: L101R (c.302T>G)

MultipleGeneVariants: N/A

PatientID: 101

KindredID: 34

Case: F, 51Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 99) presented with a CNS hemangioblastoma, retinal angioma, renal cell carcinoma, multiple pancreatic cysts/tumors, and pheochromocytoma at age 40. Their mother (patient 100) presented with a CNS hemangioblastoma at age 50 and multiple pancreatic cysts/tumors at age 63, but passed away before diagnosis/ genetic testing. Their sister (patient 101) had the mutation and presented with a CNS hemangioblastoma and a retinal angioma at age 51. Their second sister (sister 2, patient 102) passed away before diagnosis/genetic testing but presented with a CNS hemangioblastoma at 40, renal cell carcinoma at 43 and multiple pancreatic cysts/tumors at 43. Their brother (patient 103), who also passed away before diagnosis/genetic testing, presented with a CNS hemangioblastoma and retinal angioma at age 47.

CasePresentingHPOs: HP:0010797, HP:0009711 (Hemangioblastoma, Retinal capillary hemangioma)

CaseHPOFreeText: The sister (patient 101) presented with a CNS hemangioblastoma and a retinal angioma at age 51.

CaseNotHPOs: HP:0005584; HP:0001737; HP:0001732; HP:0002666 (Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas, Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This cohort was also published in an earlier paper by Wang et al., 2014 (PMID 24581539) as well as a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.Y98N (c.292T>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351750883, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.292T%3EA

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: Y98N (c.292T>A)

MultipleGeneVariants: N/A

PatientID: 163

KindredID: 63

Case: F, 37Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 163) had a brother and niece who were both confirmed with the mutation. The brother (patient 164) had a CNS hemangioblastoma at 27, retinal angioma at 26, and pheochromocytoma at 8 years old. The niece (patient 165) was asymptomatic at the time of analysis. The proband also had a mother (patient 166) who had multiple pancreatic cysts/tumors and a pheochromocytoma at age 56, but for whom no DNA sample was available for analysis.

CasePresentingHPOs: HP:0001737; HP:0001732; HP:0010797; HP:0002666; HP:0005584 (Pancreatic cysts, Abnormality of the pancreas, Hemangioblastoma, Pheochromocytoma, Renal cell carcinoma)

CaseHPOFreeText: The proband presented with a pheochromocytoma at 37, and at age 37 presented with a CNS hemangioblastoma, renal cell carcinoma, and multiple pancreatic cysts/tumors.

CaseNotHPOs: HP:0009711 (Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.R161Q (c.482G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 182983, https://www.ncbi.nlm.nih.gov/clinvar/variation/182983/?new_evidence=true

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: R161Q (c.482G>A)

MultipleGeneVariants: N/A

PatientID: 94

KindredID: 31

Case: F, 56Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 31) has a son who has also genetically confirmed with the mutation. The proband's son presented at age 29 with retinal angioma, renal cell carcinoma, multiple pancreatic cysts/tumors, and pheochromocytoma.

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0001737; HP:0001732 (Hemangioblastoma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas)

CaseHPOFreeText: The proband presented with renal cell carcinoma and multiple pancreatic cysts/tumors at 51, and CNS hemangioblastoma at age 56.

CaseNotHPOs: HP:0002666; HP:0009711 (Pheochromocytoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.E94* (c.280G>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 584477; https://www.ncbi.nlm.nih.gov/clinvar/variation/584477/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: E94* (c.280G>T)

MultipleGeneVariants: N/A

PatientID: 3

KindredID: 2

Case: M, 22Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: His father also had this mutation and presented with renal cell carcinoma and pancreatic cysts at age 48. His father's mother (his grandmother) presented with a CNS hemangioblastoma at age 61, and his father's brother (his uncle) presented with a CNS hemangioblastoma at age 33. His grandmother passed away before diagnosis, and there was no DNA sample available for his uncle.

CasePresentingHPOs: HP:0010797 (Hemangioblastoma)

CaseHPOFreeText: The patient presented with a CNS hemangioblastoma at the age of 22.

CaseNotHPOs: HP:0009711; HP:0002666; HP:0005584; HP:0001737 (Retinal Capillary Hemangioma, Pheochromocytoma, Renal cell carcinoma, Pancreatic cysts)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This cohort was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.S65W (c.194C>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 43597, https://www.ncbi.nlm.nih.gov/clinvar/variation/43597/

CAID:

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: S65W (c.194C>G)

MultipleGeneVariants: N/A

PatientID: 230

KindredID: 86

Case: F, 40Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 229) had a sister (patient 230) who was genetically confirmed with the mutation, and presented with a CNS hemangioblastoma at age 40. The proband's brother 1 (patient 231) was also confirmed with the mutation and had a retinal angioma at 25, and renal cell carcinoma at 54. The proband's brother 2 passed away before they could be diagnosed/ confirmed with the mutation, but they had a CNS hemangioblastoma at 35. Finally, the proband's nephew (son of brother 2) was genetically confirmed with the mutation and presented with renal cell carcinoma at age 30.

CasePresentingHPOs: HP:0010797 (Hemangioblastoma)

CaseHPOFreeText: The proband's sister (patient 230) had a CNS hemangioblastoma at age 40.

CaseNotHPOs: HP:0002666; HP:0001737; HP:0001732; HP:0005584; HP:0009711 (Pheochromocytoma, Pancreatic cysts, Abnormality of the pancreas, Renal cell carcinoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.L178R (c.533T>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 625261, https://www.ncbi.nlm.nih.gov/clinvar/variation/625261/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: L178R (c.533T>G)

MultipleGeneVariants: N/A

PatientID: 127

KindredID: 47

Case: F, 28Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0001737; HP:0001732; HP:0009711 (Hemangioblastoma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas, Retinal capillary hemangioma)

CaseHPOFreeText: The proband presented at age 25 with a CNS hemangioblastoma, retinal angioma, and renal cell carcinoma, and presented with multiple pancreatic cysts/tumors at age 28.

CaseNotHPOs: HP:0002666 (Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This kindred was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.E134_V142del (c.402_428del)

LegacyVariant: N/A

CaseProblemVariantFreeText: Variant listed in the paper as c.402-428delATTATTTGTGCCATCTCTCAATGTTGA, p.Glu134Aspfs*72. Listed protein change does not match deletion. Deletion is in-frame and should not lead to a frame shift. Variant updated in this annotation based on protein change listed in ClinGen/ listed on Variant Validator for c.402-428del.

ClinVarID: N/A

CAID: CA2573320387, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2573320387

gnomAD: N/A

VariantEvidence: N/A

MutationType: inframe_deletion

CivicName: E134_V142del (c.402_428del)

MultipleGeneVariants: N/A

PatientID: 175

KindredID: 69

Case: F, 35Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The male proband, patient 143, was diagnosed with renal cell carcinoma and multiple pancreatic cysts/tumors at age 33. His mother, who was not confirmed with the mutation, had a CNS hemangioblastoma at 30, retinal angioma at 54, and renal cell carcinoma at 50. His sister had a CNS hemangioblastoma at 28, and renal cell carcinoma/ multiple pancreatic cysts/tumors at 35. His niece, who was not confirmed with the mutation, had a CNS hemangioblastoma at age 12. His aunt had a CNS hemangioblastoma at 37, retinal angioma at 45, and renal cell carcinoma at 53. The son of his aunt was asymptomatic at the time of analysis.

CasePresentingHPOs: HP:0005584; HP:0001737; HP:0001732; HP:0010797 (Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas, Hemangioblastoma)

CaseHPOFreeText: The proband's sister presented with a CNS hemangioblastoma at age 28 and renal cell carcinoma and multiple pancreatic cysts/tumors at age 35.

CaseNotHPOs: HP:0002666; HP:0009711 (Pheochromocytoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.C162W (c.486C>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223227; https://www.ncbi.nlm.nih.gov/clinvar/variation/223227/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: C162W (c.486C>G)

MultipleGeneVariants: N/A

PatientID: 18 (tumour samples 18a, 18b)

KindredID: 14

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CohortInfo: A total of 42 CNS haemangioblastoma samples were obtained from 31 patients, who were consecutively treated between 1993 and 1997 at the Department of Neurosurgery of the Freiburg University Medical Centre.

CasePresentingHPOs: HP:0006880; HP:0009713 (cerebellar hemangioblastoma, spinal hemangioblastoma)

CaseHPOFreeText: Patient presented with 2 VHL-related tumors, one in the spinal chord region T7/8, and one in the cerebellum (a,b). Tumors a and b presented with LOH positive somatic information but negative methylation.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.W88R (c.262T>A)

CaseProblemVariantFreeText: N/A

LegacyVariant: p.W88R (c.475T>A)

ClinVarID: 456577 https://www.ncbi.nlm.nih.gov/clinvar/variation/456577/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: W88R (c.262T>A)

MultipleGeneVariants: N/A

GroupID: 4339

DiseaseAssertion: VHL

GroupSize: 4

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: Each group represents a family.

GroupPresentingHPOs: HP:0010797; HP:0002666; HP:0005584; HP:0009711 (Hemangioblastoma, Pheochromocytoma, Renal cell carcinoma, Retinal capillary hemangioma)

GroupHPOFreeText: 1/4 members with pheochromocytoma, 1/4 members with CNS hemangioblastoma, 4/4 with renal carcinoma, 1/4 with retinal angioma and 1/4 with cysts. Diagnosed as a VHL Type 2B family.

GroupNotHPOs: N/A

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R176Gfs*26 (c.526del)

LegacyVariant: c.739delA

CaseProblemVariantFreeText: N/A

ClinVarID: 625257, https://www.ncbi.nlm.nih.gov/clinvar/variation/625257/

CAID: N/A

gnomAD: N/A

VariantEvidence: Variant reported as 739 del A (Frameshift), assumed to be reported in legacy nomenclature (AF010238.1) and mapped to c.526del, p.Arg176Glyfs*26 (NM_000551.3).

MutationType: deletion; minus_1_frameshift_variant

CivicName: R176Gfs*26 (c.526del)

MultipleGeneVariants: N/A

GroupID/KindredID: 6105

DiseaseAssertion:VHL

GroupSize: 6

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: This group is a family of six people with the same mutation.

GroupPresentingHPOs: HP:0002666; HP:0005584; HP:0010797; HP:0009711 (Pheochromocytoma, Renal cell carcinoma, Hemangioblastoma, Retinal capillary hemangioma)

GroupHPOFreeText: 4/6 family members had renal cell carcinoma. 3/6 family members had pheochromocytoma and hemangioblastoma. 2/6 family members had retinal angioma. One family member had cysts- not specified what type.

GroupNotHPOs: HP:0030405 (Pancreatic endocrine tumour)

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167Q (c.500G>A)

LegacyVariant: c.713G>A

CaseProblemVariantFreeText: N/A

ClinVar: 2216, https://www.ncbi.nlm.nih.gov/clinvar/variation/2216/

CAID: N/A

gnomAD: 0.000003977, https://gnomad.broadinstitute.org/variant/3-10191507-G-A

VariantEvidence: Variant reported as 713, G to A (Arg to Gln), assumed to be reported in legacy nomenclature (AF010238.1) and mapped to c.500G>A, p.Arg167Gln (NM_000551.3).

MutationType: missense_variant;transition

CivicName: R167Q (c.500 G>A)

MultipleGeneVariants: N/A

GroupID/KindredID: 5959

DiseaseAssertion:VHL

GroupSize: 2

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: These two patients were from the same family (5959) and both had the same VHL gene mutations.

GroupPresentingHPOs: HP:0002666; HP:0009711; HP:0030405 (Pheochromocytoma, Retinal capillary hemangioma, Pancreatic endocrine tumor)

GroupHPOFreeText: One patient in this family had a pheochromocytoma and cysts (type of cyst was not specified). Both patients had retinal angioma. It is unclear how many of the patients had pancreatic endocrine tumors.

GroupNotHPOs: HP:0005584; HP:0010797 (Renal cell carcinoma, Hemangioblastoma)

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.P81S (c.241C>T)

CaseProblemVariantFreeText: N/A

LegacyVariant: c.454C>T

ClinVarID: 2233, https://www.ncbi.nlm.nih.gov/clinvar/variation/2233/

CAID: N/A

gnomAD: 0.0002179, https://gnomad.broadinstitute.org/variant/3-10183772-C-T

VariantEvidence: Variant reported as 454, C to T (Pro to Ser), assumed to be reported in legacy nomenclature (AF010238.1) and mapped to c.241C>T, p.Pro81Ser (NM_000551.3).

MutationType: missense_variant;transition

CivicName: P81S (c.241C>T)

MultipleGeneVariants: Germline, VHL, c.562C>G (p.Leu188Val)

PatientID: None

KindredID: 3618

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0002666; HP:0010797; HP:0030405 (Pheochromocytoma, Hemangioblastoma, Pancreatic endocrine tumor)

CaseHPOFreeText: Diagnosed with CNS hemangioblastoma, pheochromocytoma, cysts and VHL Type 2B. Localized pancreatic neuroendocrine tumor is also associated with this family but the number of family members affected is not specified.

CaseNotHPOs: HP:0005584; HP:0009711 (Renal cell carcinoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 8956040; 7728151

SupplementalData: N/A

Variant: p.C162W (c.486C>G)

LegacyVariant: c.699C>G

CaseProblemVariantFreeText: N/A

ClinVarID: 223227, https://www.ncbi.nlm.nih.gov/clinvar/variation/223227/

CAID: N/A

gnomAD: N/A

VariantEvidence: Variant reported as 699, C to G (Cys to Trp), assumed to be reported in legacy nomenclature (AF010238.1) and mapped to c.486C>G, p.Cys162Trp (NM_000551.3).

MutationType: missense_variant;transversion

CivicName: C162W (c.486C>G)

MultipleGeneVariants: N/A

PatientID: N/A

KindredID: 11

Case: Sex, Age, Ethnicity Unknown

DiseaseAssertion: pheochromocytoma

FamilyInfo: N/A

CasePresentingHPOs: HP:0002666 (pheochromocytoma)

CaseHPOFreeText: Nonsyndromic pheochromocytoma.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET, SDHB, SDHD

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.A122I (c.364_365delinsAT)

CaseProblemVariantFreeText: N/A

LegacyVariant: p.A122L (c.577_578GC>AT)

ClinVarID: N/A

CAID: CA658820874 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.364_365delinsAT

gnomAD: N/A

VariantEvidence: N/A

MutationType: delins

CivicName: A122I (c.364_365GC>AT)

MultipleGeneVariants: N/A

PatientID: N/A

KindredID: 12

Case: Sex, Age, Ethnicity Unknown

DiseaseAssertion: pheochromocytoma

FamilyInfo: N/A

CasePresentingHPOs: HP:0002666 (pheochromocytoma)

CaseHPOFreeText: Nonsyndromic pheochromocytoma.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET, SDHB, SDHD

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.F136C (c.407T>G)

CaseProblemVariantFreeText: N/A

LegacyVariant: p.F136C (c.620T>G)

ClinVarID: 496065 https://www.ncbi.nlm.nih.gov/clinvar/variation/496065/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: F136C (c.407T>G)

MultipleGeneVariants: N/A

PatientID: N/A

KindredID: 2

Case: Sex, Age, Ethnicity Unknown

DiseaseAssertion: pheochromocytoma

FamilyInfo: N/A

CasePresentingHPOs: HP:0002666 (pheochromocytoma)

CaseHPOFreeText: Nonsyndromic pheochromocytoma.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET, SDHB, SDHD

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.S68W (c.203C>G)

CaseProblemVariantFreeText: N/A

LegacyVariant: p.S68W (c.416C>G)

ClinVarID: N/A

CAID: CA351748895 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.203C%3EG

gnomAD: N/A

VariantEvidence: PMID: 15611064 shows that S68W nearly completely abolishes the HIF1a hydroxylation dependent binding (Figure 6B) which disrupts HIF-2α degredation in 786-O (renal cell carcinoma) cells (Figure 6 D).

MutationType: missense_variant; transversion

CivicName: S68W (c.203C>G)

MultipleGeneVariants: N/A

PatientID: 16

KindredID: 16

Case: F, 20Y0M, Asian Indian

DiseaseAssertion: pheochromocytoma

FamilyInfo: positive family history

CasePresentingHPOs: HP:0002666 (pheochromocytoma)

CaseHPOFreeText: bilateral pheochromocytoma

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET/ SDHB/ SDHD/ NF1

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R161Q (c.482G>A)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 182983 https://www.ncbi.nlm.nih.gov/clinvar/variation/182983/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: R161Q (c.482G>A)

MultipleGeneVariants: N/A

PatientID: 17

KindredID: 17

Case: F, 6Y0M, Asian Indian

DiseaseAssertion: pheochromocytoma

FamilyInfo: positive family history

CasePresentingHPOs: HP:0002666 (pheochromocytoma)

CaseHPOFreeText: unilateral pheochromocytoma

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET/ SDHB/ SDHD/ NF1

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R161Q (c.482G>A)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 182983 https://www.ncbi.nlm.nih.gov/clinvar/variation/182983/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: R161Q (c.482G>A)

MultipleGeneVariants: N/A

PatientID: 31

KindredID: 31

Case: M, 21Y0M, Asian Indian

DiseaseAssertion: pheochromocytoma

FamilyInfo: None - apparently sporadic

CasePresentingHPOs: HP:0002666 (pheochromocytoma)

CaseHPOFreeText: patient had unilateral pheochromocytoma

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET/ SDHB/ SDHD/ NF1

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.L178Q (c.533T>A)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 625260 https://www.ncbi.nlm.nih.gov/clinvar/variation/625260/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: L178Q (c.533T>A)

MultipleGeneVariants: N/A

PatientID: 1

KindredID: 38

Case: Sex, Age, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0005584 (renal cell carcinoma)

CaseHPOFreeText: one RCC tumor was detected in this patient

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.Q73* (c.217C>T)

CaseProblemVariantFreeText: N/A

LegacyVariant: p.Q73* (c.430C>T)

ClinVarID: 223164 https://www.ncbi.nlm.nih.gov/clinvar/variation/223164/

CAID: N/A

gnomAD: N/A

VariantEvidence: Tested the RCC tumor for somatic mutations but did not detect any

MutationType: stop_gained

CivicName: Q73* (c.217C>T)

MultipleGeneVariants: N/A

PatientID: 1

KindredID: 152

Case: Sex, Age, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: None

CasePresentingHPOs: HP:0002894 (neoplasm of the pancreas)

CaseHPOFreeText: Patient presented with a pancreatic tumor.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167Q (c.500G>A)

CaseProblemVariantFreeText: N/A

LegacyVariant: p.R167Q (c.713G>A)

ClinVarID: 2216 https://www.ncbi.nlm.nih.gov/clinvar/variation/2216/

CAID: N/A

gnomAD: 0.000003977 https://gnomad.broadinstitute.org/variant/3-10191507-G-A

VariantEvidence: Loss of heterozygosity

MutationType: missense_variant; transition

CivicName: R167Q (c.500G>A)

MultipleGeneVariants: N/A

PatientID: 5654

KindredID: 266

Case: Sex Unknown, Age Unknown, French

DiseaseAssertion: VHL

FamilyInfo: N/A

CohortInfo: Families were recruited from the French VHL Registry. Enrolment in the study required identification of the germline VHL mutation (currently 85% of the families included in the French VHL Registry) and available data regarding renal phenotype. A total of 126 families fulfilled these criteria.

CasePresentingHPOs: HP:0005584 (Renal cell carcinoma)

CaseHPOFreeText: Mild renal disease (simple renal cyst, multicystic kidney[s], small lesion [less than 10 mm in size] of unknown significance, or small solid tumor without indication for surgical removal [less than 30 mm in size]). Individual RCC phenotype is noted as positive.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: Paper states that this patient is previously reported in PMIDs ​​12202531 and/or 9829912. Unclear if the patient reported in both these other papers is the same as he current patient.

SupplementalData: Phenotype and genotype information can be found in Supplementary Table S1.

Variant: p.W88S (c.263G>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2220, https://www.ncbi.nlm.nih.gov/clinvar/variation/2220/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: W88S (c.263G>C)

MultipleGeneVariants: N/A

PatientID: 6270

KindredID: 279

Case: Sex Unknown, Age Unknown, French

DiseaseAssertion: VHL

FamilyInfo: N/A

CohortInfo: Families were recruited from the French VHL Registry. Enrolment in the study required identification of the germline VHL mutation (currently 85% of the families included in the French VHL Registry) and available data regarding renal phenotype. A total of 126 families fulfilled these criteria.

CasePresentingHPOs: HP:0005584 (Renal cell carcinoma)

CaseHPOFreeText: Severe renal disease (any solid lesion before 25 years of age, five or more solid lesions within one or two kidneys, or metastasis of renal cell carcinoma). Individual RCC phenotype is noted as positive.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: Paper states that this family is previously reported in PMID 12202531 and/or 9829912, where 3 individuals and 3 families respectively with this mutation are reported. It is unclear if one or both of these previously reported groups are the same as the current family. These previously published individuals could alternatively correspond to family 60.

SupplementalData: Phenotype and genotype information can be found in Supplementary Table S1.

Variant: p.R161Q (c.482G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 182983, https://www.ncbi.nlm.nih.gov/clinvar/variation/182983/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: R161Q (c.482G>A)

MultipleGeneVariants: N/A

PatientID: VHL-11

KindredID: 11

Case: Sex Unknown, Age Unknown, Italian

DiseaseAssertion: VHL

FamilyInfo: None.

CohortInfo: Forty-three index cases were referred to the Service of Medical Genetics, Genova, for germline mutation analysis in the VHL gene between 1995 and 2008.

CasePresentingHPOs: HP:0010797, HP:0009711 (hemangioblastoma, retinal capillary hemangioma)

CaseHPOFreeText: The patient had multiple hemangioblastomas.

CaseNotHPOs: HP:0005584, HP:0001737, HP:0002666 (renal cell carcinoma, pancreatic cysts, pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.N78S(c.233A>G)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 93326 https://www.ncbi.nlm.nih.gov/clinvar/variation/93326/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType:missense_variant;transition

CivicName: N78S(c.233A>G)

MultipleGeneVariants: N/A

PatientID: VHL-16

KindredID: 16

Case: Sex Unknown, Age Unknown, Italian

DiseaseAssertion: VHL

FamilyInfo: Family history of VHL. No further details provided.

CohortInfo: Forty-three index cases were referred to the Service of Medical Genetics, Genova, for germline mutation analysis in the VHL gene between 1995 and 2008.

CasePresentingHPOs: HP:0010797; HP:0001732 (Hemangioblastoma, Abnormality of the pancreas)

CaseHPOFreeText: Multiple CNS hemangioblastomas. Clinical classification: A1.

CaseNotHPOs: HP:0005584; HP:0002666; HP:0009711 (Renal cell carcinoma, Pheochromocytoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.G114R (c.340G>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223193, https://www.ncbi.nlm.nih.gov/clinvar/variation/223193/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: G114R (c.340G>C)

MultipleGeneVariants: N/A

GroupID: 26

Case: 61Y0M, Sex Unknown, Ethnicity Unknown

DiseaseAssertion: assumed VHL

FamilyInfo: 1 of the 573 patients discussed in this paper were found to have this variant. This mutation was found in 1 VHL family with a single patient.

CasePresentingHPOs: HP:0006880; HP:0005584 (cerebellar hemangioblastoma; renal cell carcinoma)

CaseHPOFreeText: patient had cerebellar hemangioblastoma diagnosed at 61Y, and RCC diagnosed at 53Y

CaseNotHPOs: HP:0009711; HP:0002666 (retinal capillary hemangioma; pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplementary Table S1.

Variant: p.N141Mfs*18 (c.422delA)

LegacyVariant: p.N141Mfs*18 (c.421delA)

CaseProblemVariantFreeText: Written in supply. table as c.421delA, this automaps to c.422delA due to redundancy in code

ClinVarID: N/A

CAID: CA432421876 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.421delA

gnomAD: N/A

VariantEvidence: N/A

MutationType: minus_1_frameshift_variant

CivicName: N141fs (c.422del) 

MultipleGeneVariants: N/A

GroupID: 78

DiseaseAssertion: assumed VHL

GroupSize: 5

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: 5 of the 573 patients discussed in this paper were found to have identical variants. This mutation (c.496G>T) was found in 2 VHL families with 5 patients.

GroupPresentingHPOs: pheochromocytoma; retinal capillary hemangioma; cerebellar hemangioblastoma (HP:0002666; HP:0009711; HP:0006880)

GroupHPOFreeText: 2 patients had retinal angiomas with a mean age of diagnosis of 24Y, 2 patients had cHBs with a mean age of diagnosis of 23Y, and 4 patients had pheos with a mean age of diagnosis of 22Y,

GroupNotHPOs: HP:0005584 (renal cell carcinoma)

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplementary Table S1.

Variant: p.V166F (c.496G>T)

CaseProblemVariantFreeText: Paper (suppl. table) records this as c.498A>G, however this doesn't match the given protein change (p.V166F). As the Latif et al. 1993 (AFO10238) sequence given was c.709G>T, can deduce with high likelihood that this "c.498A>G" should have wrote "c.496G>T".

LegacyVariant: N/A

ClinVarID: 2224 https://www.ncbi.nlm.nih.gov/clinvar/variation/2224/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: V166F (c.496G>T)

MultipleGeneVariants: N/A

GroupID: 66

DiseaseAssertion: assumed VHL

GroupSize: 3

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: 3 of the 573 patients discussed in this paper were found to have identical variants. This mutation (c.346C>G) was found in 1 VHL family with 3 patients.

GroupPresentingHPOs: HP:0009711 (retinal capillary hemangioma)

GroupHPOFreeText: 3 patients had retinal capillary hemangioma (RH), with a mean age of diagnosis of 43Y (RH).

GroupNotHPOs: HP:0002666; HP:0006880; HP:0005584 (pheochromocytoma; cerebellar hemangioblastoma; renal cell carcinoma)

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplementary Table S1.

Variant: p.L116V (c.346C>G)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: N/A

CAID: CA351753642 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.346C%3EG

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: L116V (c.346C>G)

MultipleGeneVariants: N/A

GroupID: 69

DiseaseAssertion: VHL

GroupSize: 2

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: Japanese

GroupAgeRange: N/A

GroupInfo: 2 individuals from a single family (ID 69).

GroupPresentingHPOs: HP:0002666; HP:0005584; HP:0001732; HP:0010797 (Pheochromocytoma, Renal cell carcinoma, Abnormality of the pancreas, Hemangioblastoma)

GroupHPOFreeText: Pheochromocytoma (1/2), CNS hemangioblastoma (2/2), pancreatic cyst or tumor (unspecified) (2/2) and renal cell carcinoma (1/2).

GroupNotHPOs: HP:0009711 (Retinal capillary hemangioma)

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.L158V (c.472C>G)

LegacyVariant: c.685C>G

CaseProblemVariantFreeText: N/A

ClinVarID: 567944, https://www.ncbi.nlm.nih.gov/clinvar/variation/567944/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: L158V (c.472C>G)

MultipleGeneVariants: N/A

PatientID: II-1

KindredID: 1

Case: M, Age Unknown (deceased), Chinese

DiseaseAssertion: assumed VHL

FamilyInfo: The transversion mutation was found and confirmed in 4 patients (II-2, III-2, III-6, III-10, III-11) and 3 carriers (III-3, III-9, III-14). At least 5 additional members had VHL phenotypes, but had all passed away before genetic testing. Could be assumed and deduced their genetics due to pedigree showing future linear relations of this mutation all in generation III.

CasePresentingHPOs: HP:0010797; HP:0009726 (hemangioblastoma; renal neoplasm)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.S168T (c.503G>C) [assumed]

LegacyVariant: p.S168T (c.716G>C) [assumed]

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351756183 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.503G%3EC

gnomAD: N/A

VariantEvidence: No genetic testing was done prior to death, however family history and presentation leads to this deduction

MutationType: missense_variant;transversion

CivicName: S168T (c.503G>C)

MultipleGeneVariants: N/A

PatientID: II-1

KindredID: 3

Case: M, Age Unknown (deceased), Chinese

DiseaseAssertion: CNS Hemangioblastoma

FamilyInfo: The transition mutation was found and confirmed in 1 patient (II-3) and 2 carriers (III-7, IV-2). 5 members, including II-1, had hemangioblastomas of the CNS, but had all passed away before genetic testing. Could be assumed and deduced the genetics due to pedigree showing future linear relations of this mutation.

CasePresentingHPOs: HP:0010797 (hemangioblastoma)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.L116V (c.346C>G) [assumed]

LegacyVariant: p.L116V (c.559C>G) [assumed]

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351753642 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.346C%3EG

gnomAD: N/A

VariantEvidence: No genetic testing was done prior to death, however family history and presentation leads to this deduction

MutationType: missense_variant;transversion

CivicName: L116V (c.346C>G)

MultipleGeneVariants: N/A

PatientID: II-6

KindredID: 1

Case: M, Age Unknown (deceased), Chinese

DiseaseAssertion: pancreatic cancer

FamilyInfo: The transversion mutation was found and confirmed in 4 patients (II-2, III-2, III-6, III-10, III-11) and 3 carriers (III-3, III-9, III-14). At least 5 additional members had VHL phenotypes, but had all passed away before genetic testing. Could be assumed and deduced their genetics due to pedigree showing future linear relations of this mutation all in generation III.

CasePresentingHPOs: HP:0002894 (neoplasm of the pancreas)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.S168T (c.503G>C) [assumed]

LegacyVariant: p.S168T (c.716G>C) [assumed]

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351756183 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.503G%3EC

gnomAD: N/A

VariantEvidence: No genetic testing was done prior to death, however family history and presentation leads to this deduction

MutationType: missense_variant;transversion

CivicName: S168T (c.503G>C)

MultipleGeneVariants: N/A

PatientID: II-5

KindredID: 1

Case: M, Age Unknown (deceased), Chinese

DiseaseAssertion: pancreatic cancer

FamilyInfo: The transversion mutation was found and confirmed in 4 patients (II-2, III-2, III-6, III-10, III-11) and 3 carriers (III-3, III-9, III-14). At least 5 additional members had VHL phenotypes, but had all passed away before genetic testing. Could be assumed and deduced their genetics due to pedigree showing future linear relations of this mutation all in generation III.

CasePresentingHPOs: HP:0002894 (neoplasm of the pancreas)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.S168T (c.503G>C) [assumed]

LegacyVariant: p.S168T (c.716G>C) [assumed]

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351756183 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.503G%3EC

gnomAD: N/A

VariantEvidence: No genetic testing was done prior to death, however family history and presentation leads to this deduction

MutationType: missense_variant;transversion

CivicName: S168T (c.503G>C)

MultipleGeneVariants: N/A

PatientID: III-A

KindredID: 1

Case: M, 30Y0M, EthnicityUnknown

DiseaseAssertion: VHL

FamilyInfo: Multiple first- and second-degree relatives affected with similar phenotypes. Of these, he is genetically tested and found to share VHL mutations with his uncle (proband).

CasePresentingHPOs: N/A

CaseHPOFreeText: Paper asserts that this individual presented with VHL phenotypes but does not specify which.

CaseNotHPOs: NA

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Information obtained from Figure 1

Variant: p.L158Q (c.473T>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 376048, https://www.ncbi.nlm.nih.gov/clinvar/variation/376048/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: P86S (c.256C>T) and Splice Region (c.340+5G>C)

MultipleGeneVariants: Germline, VHL, c.340+5G>C

PatientID: 9

KindredID: 7

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0005584; HP:0001737; HP:0000107 (Renal cell carcinoma; pancreatic cyst; renal cyst)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: MEN1/ RET

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R161* (c.481C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2217 https://www.ncbi.nlm.nih.gov/clinvar/variation/2217/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: R161* (c.481C>T)

MultipleGeneVariants: N/A

PatientID: None

KindredID: 4410

Case: Sex, Age, Ethnicity Unknown

DiseaseAssertion: assumed VHL

FamilyInfo: Familial VHL stated; although only 1 family member recorded.

CasePresentingHPOs: HP:0010797; HP:0009711; HP:0005584 (hemangioblastoma, retinal capillary hemangioma, renal cell carcinoma)

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0002666 (Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.L129_V130insGlu (c.386_387insAGA)

CaseProblemVariantFreeText: N/A

LegacyVariant: p.200insE (c.599insAGA)

ClinVarID: N/A

CAID: CA16602182 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.386_387insAGA

gnomAD: N/A

VariantEvidence: N/A

MutationType: inframe_insertion

CivicName: L129Q (c.386insAGA)

MultipleGeneVariants: N/A

GroupID: 2612

DiseaseAssertion: assumed VHL

GroupSize: 7

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: Familial VHL stated; 7 family members recorded with this mutation.

GroupPresentingHPOs: HP:0010797; HP:0005584; HP:0009711 (hemangioblastoma, renal cell carcinoma, retinal capillary hemangioma)

GroupHPOFreeText: 5 members had an angioma (retinal hemangioma), 2 had RCC, and all 7 members had CNS hemangioblastoma

GroupNotHPOs: HP:0002666 (pheochromocytoma)

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: 19464396

SupplementalData: N/A

Variant: p.P86L (c.257C>T)

CaseProblemVariantFreeText: N/A

LegacyVariant: p.P86L (c.470C>T)

ClinVarID: 182977 https://www.ncbi.nlm.nih.gov/clinvar/variation/182977/

CAID: CA020186 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.257C%3ET

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: P86L (c.257C>T)

MultipleGeneVariants: N/A

GroupID: 4408

DiseaseAssertion: assumed VHL

GroupSize: 25

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: Familial VHL stated; 25 family members recorded with this mutation.

GroupPresentingHPOs: HP:0010797; HP:0005584; HP:0009711 (hemangioblastoma, renal cell carcinoma, retinal capillary hemangioma)

GroupHPOFreeText: 14 of the 25 members had an angioma (retinal hemangioma), 2 had RCC, and 16 members had CNS hemangioblastoma.

GroupNotHPOs: HP:0002666 (pheochromocytoma)

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.L158P (c.473T>C)

CaseProblemVariantFreeText: N/A

LegacyVariant: p.L158P (c.686T>C)

ClinVarID: 182980 https://www.ncbi.nlm.nih.gov/clinvar/variation/182980/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: L158P (c.473T>C)

MultipleGeneVariants: N/A

PatientID: None

KindredID: 3618

Case: Sex, Age, Ethnicity Unknown

DiseaseAssertion: assumed VHL

FamilyInfo: Familial VHL stated; although only 1 family member recorded.

CasePresentingHPOs: HP:0010797 (hemangioblastoma)

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0002666; HP:0009711; HP:0005584 (Pheochromocytoma, retinal capillary hemangioma, renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 8956040

SupplementalData: N/A

Variant: p.C162W (c.486C>G)

CaseProblemVariantFreeText: N/A

LegacyVariant: p.C233W (c.699C>G)

ClinVarID: 223227 https://www.ncbi.nlm.nih.gov/clinvar/variation/223227/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: C162W (c.486C>G)

MultipleGeneVariants: N/A

PatientID: III-19

KindredID: 1

Case: F, Age Unknown, Middle Eastern

DiseaseAssertion: VHL

FamilyInfo: Multigenerational Kuwaiti family with Arabian and Persian genetic admixture. Thirteen members of the family had been clinically diagnosed as having VHL. Patient 1-I had 6 children, 5 of which were found with VHL and the p.W117C mutation. 7/20 of her grandchildren also found to have VHL and the same mutation.

CasePresentingHPOs: HP:0010797; HP:0006770 (hemangioblastoma; clear cell renal cell carcinoma)

CaseHPOFreeText: Member had clear cell renal carcinomas in addition to hemangioblastomas

CaseNotHPOs: HP:0002666 (pheochromocytoma)

CaseNotHPOFreeText: Lacked evidence of any pheos.

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.W117C (c.351G>T)

LegacyVariant: p.Trp117Cys (c.564G>T)

CaseProblemVariantFreeText: N/A

ClinVarID: 167827 https://www.ncbi.nlm.nih.gov/clinvar/variation/167827/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: W117C (c.351G>T)

MultipleGeneVariants: N/A

PatientID: III-18

KindredID: 1

Case: F, Age Unknown, Middle Eastern

DiseaseAssertion: VHL

FamilyInfo: Multigenerational Kuwaiti family with Arabian and Persian genetic admixture. Thirteen members of the family had been clinically diagnosed as having VHL. Patient 1-I had 6 children, 5 of which were found with VHL and the p.W117C mutation. 7/20 of her grandchildren also found to have VHL and the same mutation.

CasePresentingHPOs: HP:0010797; HP:0006770 (hemangioblastoma; clear cell renal cell carcinoma)

CaseHPOFreeText: Member had clear cell renal carcinomas in addition to hemangioblastomas

CaseNotHPOs: HP:0002666 (pheochromocytoma)

CaseNotHPOFreeText: Lacked evidence of any pheos.

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.W117C (c.351G>T)

LegacyVariant: p.Trp117Cys (c.564G>T)

CaseProblemVariantFreeText: N/A

ClinVarID: 167827 https://www.ncbi.nlm.nih.gov/clinvar/variation/167827/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: W117C (c.351G>T)

MultipleGeneVariants: N/A

PatientID: I-1

KindredID: 1

Case: F, Age Unknown (deceased), Persian

DiseaseAssertion: VHL

FamilyInfo: Multigenerational Kuwaiti family with Arabian and Persian genetic admixture. Thirteen members of the family had been clinically diagnosed as having VHL. Patient 1-I had 6 children, 5 of which were found with VHL and the p.W117C mutation. 7/20 of her grandchildren also found to have VHL and the same mutation.

CasePresentingHPOs: HP:0010797; HP:0006770 (hemangioblastoma; clear cell renal cell carcinoma)

CaseHPOFreeText: Member had clear cell renal carcinomas that were the main cause of mortality, in addition to hemangioblastomas

CaseNotHPOs: HP:0002666 (pheochromocytoma)

CaseNotHPOFreeText: Lacked evidence of any pheos.

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.W117C (c.351G>T)

LegacyVariant: p.Trp117Cys (c.564G>T)

CaseProblemVariantFreeText: N/A

ClinVarID: 167827 https://www.ncbi.nlm.nih.gov/clinvar/variation/167827/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: W117C (c.351G>T)

MultipleGeneVariants: N/A

PatientID: III-14

GroupID/ KindredID: 6

Case: 46Y0M, F, Chinese

DiseaseAssertion: assumed VHL

FamilyInfo: Positive - 22 family members were recorded with the given mutation. 18 had VHL manifestations while 4 were asymptomatic carriers. See pedigree (Fig 3.), or follow GroupID/KindredID: 6

CasePresentingHPOs: HP:0001732; HP:0005584; HP:0002666 (abnormality of the pancreas, Renal cell carcinoma, pheochromocytoma)

CaseHPOFreeText: CT of the abdomen demonstrates a cystic lesion in right adrenal and a solid tumor in right kidney. Pathological results confirm pheochromocytoma and clear cell carcinaoma

CaseNotHPOs: HP:0010797; HP:0009711 (hemangioblastoma, retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.N78S (c.233A>G)

CaseProblemVariantFreeText: N/A

LegacyVariant: p.N78S (c.446A>G)

ClinVarID: 93326 https://www.ncbi.nlm.nih.gov/clinvar/variation/93326/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: N78S (c.233A>G)

MultipleGeneVariants: N/A

GroupID/ KindredID: 3

DiseaseAssertion: assumed VHL

GroupSize: 6

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: Chinese

GroupAgeRange: N/A

GroupInfo: With a family history, 6 family members were recorded in this group with the given mutation.

GroupPresentingHPOs: HP:0010797; HP:0005584; HP:0001732 (hemangioblastoma; renal cell carcinoma; pancreatic lesion)

GroupHPOFreeText: 5 members had CNS hemangioblastomas, 1 member had RCC, and 1 had pancreatic cysts or tumors (an abnormality of the pancreas)

GroupNotHPOs: HP:0009711; HP:0002666 (retinal capillary hemangioma, pheochromocytoma)

GroupNotHPOFreeText: No family members appeared to have the above manifestation.

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.Q73* (c.217C>T)

CaseProblemVariantFreeText: N/A

LegacyVariant: p.Q73* (c.430C>T)

ClinVarID: 223164 https://www.ncbi.nlm.nih.gov/clinvar/variation/223164/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: Q73* (c.217C>T)

MultipleGeneVariants: N/A

GroupID: 202

DiseaseAssertion: VHL

GroupSize: N/A

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: VHL family found to have the c.712C>T (R167W) germline variant of the VHL gene. The number of family members included in this study is not specified.

GroupPresentingHPOs: HP:0002666 (Pheochromocytoma)

GroupHPOFreeText: Number of family affected members is not specified.

GroupNotHPOs: N/A

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167W (c.499C>T)

LegacyVariant: c.712C>T

CaseProblemVariantFreeText: N/A

ClinVarID: 2218, https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: N/A

gnomAD: 0.000007954, https://gnomad.broadinstitute.org/variant/3-10191506-C-T?dataset=gnomad_r2_1

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

GroupID: 152

DiseaseAssertion: VHL

GroupSize: N/A

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: VHL family found to have a germline rearrangement of the VHL gene. The number of family members included in this study is not specified.

GroupPresentingHPOs: N/A

GroupHPOFreeText: Patients within this family were found to have a clinical diagnosis of VHL disease, however, the presenting phenotypes were not specified.

GroupNotHPOs: HP:0002666 (Pheochromocytoma)

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167W (c.499C>T)

LegacyVariant: c.712C>T

CaseProblemVariantFreeText: N/A

ClinVarID: 2218, https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: N/A

gnomAD: 0.000007954, https://gnomad.broadinstitute.org/variant/3-10191506-C-T?dataset=gnomad_r2_1

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

GroupID: 103

DiseaseAssertion: VHL

GroupSize: N/A

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: VHL family found to have a germline rearrangement of the VHL gene. The number of family members included in this study is not specified.

GroupPresentingHPOs: N/A

GroupHPOFreeText: Patients within this family were found to have a clinical diagnosis of VHL disease, however, the presenting phenotypes were not specified.

GroupNotHPOs: HP:0002666 (Pheochromocytoma)

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.L101G (c.301_302delinsGG)

LegacyVariant: c.514_515CT>GG

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA915940707, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.301_302delinsGG

gnomAD: N/A

VariantEvidence: Variant reported as c.514_515CT>GG and mapped to c.301_302delinsGG.

MutationType: delins

CivicName: L101G (c.301_302delinsGG)

MultipleGeneVariants: N/A

PatientID: None

KindredID: Family C

Case: M, 54Y0M, Ethnicity Unknown

DiseaseAssertion: Assumed VHL

FamilyInfo: There was no family history of VHL disease or familial pheochromocytoma. Her parents (mother age 85, father age 79) were asymptomatic and were not available for DNA testing. A 58-year-old maternal half-brother was tested and did not carry the mutation.

CasePresentingHPOs: HP:0006748, HP:0000107, HP:0009713 (adrenal pheochromocytoma, renal cyst, spinal hemangioblastoma)

CaseHPOFreeText: The patient had bilateral pheochromocytoma. A small vascular lesion was identified by a screening MRI, which that authors of the papers assumed could possibly a spinal hemangioblastoma,

CaseNotHPOs: None

CaseNotHPOFreeText: No other central nervous system abnormalities were detected and her ophthalmologic examination was normal.

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.V84L (c.250G>T)

LegacyVariant: p.V84L (c.463G>T)

ClinVar: 2236 https://www.ncbi.nlm.nih.gov/clinvar/variation/2236/

CAID: CA020170 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.250G%3ET

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: V84L (c.250G>T)

MultipleGeneVariants: N/A