Results: A novel in-frame duplication of the 21 base pairs at nucleotide 806 (the position of codon 198) of the VHL gene was found in our patient. The clinical phenotype of the patient included retinal hemangiomas associated with vitreous hemorrhage and traction retinal detachment, pheochromocytoma, and hemangioma-like lesions in the cerebellum which corresponded to those of VHL type 2A. Abnormal diffuse vascular leakage was observed in the apparently intact retina by fluorescein angiography.
PatientID: II:3 (case)
KindredID: 1
Case: F, 46Y0M, Japanese
DiseaseAssertion: VHL
FamilyInfo: Her elder brother (II:1) had died of hypertensive disease associated with pheochromocytoma and bilateral retinal hemangiomas. He, along with both of her parents had passed away before any testing. Both of her children (III:1, F, 13Y; III:2, M, 11Y) did not demonstrate any sign of VHL, however they were not yet tested.
CasePresentingHPOs: HP:0009711; HP:0001028; HP:0002666, HP:0006880 (retinal capillary hemangioma, hemangioma, pheochromocytoma, cerebellar hemangioblastoma)
CaseHPOFreeText: Originally complained of decreased vision in her left eye. On examination, three retinal hemangiomas were found in her left eye (one on the optic disc and the others in the peripheral regions of the superior and inferior nasal quadrants, respectively). Additionally, a macular hole, small peripheral hemangiomas, were observed. She had previously had been treated surgically for pheochromocytoma at age 17 years. Systemic examination further revealed hemangioma-like lesions in the cerebellum
CaseNotHPOs: HP:0005584 (renal cell carcinoma)
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: N/A
Variant: p.H191Qfs* (c.572_592dup)
LegacyVariant: p.160 (c.804dupACCCAAATGTGCAGAAAGACC)
CaseProblemVariantFreeText: This paper mentions that it used the Latif et al sequence to map its variants, and reports a 21 bp insertion at nucleotide '806' which converts to 593 (so the insertion is just before c.593.) This checks out on the NM_000551.3 sequence. The correct HGVS nomenclature would be c.572_592dup causing p.His191_Asp197dup. On the Latif sequence, this would be equivalent to c.785_805dup.
ClinVarID: N/A
CAID: CA2573106159 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2573106159
gnomAD: N/A
VariantEvidence: N/A
MutationType: inframe_insertion; duplication
CivicName: R197_L198ins7 (c.572_592dup)
MultipleGeneVariants: N/A