On 2018 Jan 17, Fernando Castro-Chavez commented:
Reader,
In this review I present the aspect of the hepatology based on my microarray findings, learning that both of the SCD genes (for the stearoyl CoA desaturases), while in the white adipose tissue were dramatically down-regulated: scd1 and scd2, in the perilipin knock out mice, however in the liver they remained normal, which means that "the liver of perilipin-/- mice was healthy and normal, even under high-fat diet when compared with the results published for the scd1-/- mice, which under high-fat diets had a darker liver, suggestive of hepatic steatosis. Scd1 is required for the biosynthesis of monounsaturated fatty acids and plays a key role in the hepatic synthesis of triglycerides and of very-low-density lipoproteins"; furthermore I make a remark on my findings of "increased expression for hemoglobin transcripts and other hemo related genes (hemo-like), and for leukocyte like (leuko-like) genes inside the white adipose tissue of the perilipin-/- mice", as well as my first report of the palindrome sequence that contaminates thousands of genes in the Genbank, and I mention this in the next terms within the body of the article: "I found with microarrays an artificial phenomenon of heterotranscription contaminating thousands of sequences in the Genbank nucleic acids database through the sequence CTCGTGCCGAATTCGGCACGAG or its derivatives".
With my regards,
Fernando Castro-Chavez From the Baylor College of Medicine.
Guadalajara, Jalisco, Mexico 01/17/2018.
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.