On 2016 Aug 25, Theodore I Lidsky commented:

Keller (1) comments on the paper “ Is the aluminum hypothesis dead?” (2) that “Lidsky points out that the clinical presentation of dementia caused by elevated aluminum levels in dialysis patients is clearly distinct from that of true Alzheimer-type dementia.” Keller continues, however viz: “ As a primary-care physician who must answer patients' questions about the risks of dietary aluminum, that distinction truly makes no difference to patients or to myself.”

The kidneys are the primary route of elimination of aluminum. The aluminum-induced dementia described in my paper was observed, and is only observed, in patients with renal insufficiency. Brain concentrations of aluminum of the levels described in cases of dialysis encephalopathy (3) are not found in individuals with normal renal function exposed to dietary aluminum.

1. Keller D. Dementia caused by elevated aluminum levels in dialysis is not Alzheimer's disease: a distinction without a difference. 2016 Aug 07.

2. Lidsky TI. Is the aluminum hypothesis dead? J Occup Environ Med. 2014;56(5)(suppl): S73-S79.

3. Alfrey AC, LeGengre GR, Kaehny WD. The dialysis encephalopathy syn-drome. New Eng J Med. 1976;294:184–188.

On 2015 Feb 11, Marco Ventura commented:

I do not understand what is the novelty of this study. Very similar studies have been already published about the comparative genomics of the genus Bifidobacterium. Just as a remark for the authors and for the potential readers that are not from this field: see the following papers published in August 2014:

• Milani, C., Lugli, G.A., Duranti, S., Turroni, F., Bottacini, F., Mangifesta, M., Sanchez, B., Viappiani, A., Mancabelli, L., Taminiau, B., Delcenserie, V., Barrangou, R., Margolles, A., van Sinderen, D., and Ventura, M. 2014. Genome encyclopaedia of type strains of the genus Bifidobacterium. Appl. Environ. Microbiol. 80(20):6290-302.

• Lugli, G.A., Milani, C., Turroni, F., Duranti, S., Ferrario, C., Viappiani, A., Mancabelli, L., Mangifesta, M., Taminiau, B., Delcenserie, V., van Sinderen, D. and Ventura, M. 2014. Investigation of the evolutionary development of the genus Bifidobacterium by comparative genomics. Appl. Environ. Microbiol. 80(20):6383-94.

Enjoy the reading

On 2015 Sep 25, Kenneth Witwer commented:

As stated in a letter to the editor (Witwer KW, 2015), monocot-specific MIR528 was the apparently most abundant and best-absorbed miRNA in this study, more abundant than all other detected plant miRNAs combined. Watermelon--the only material ingested by the study volunteers--is a dicot. No sequences identical to mature or precursor MIR528 are found in watermelon sequences in public databases, nor in any currently available dicot genomes. In response to this observation and as evidence for the existence of dicot MIR528, the authors refer to Lin Y, 2013, in which a putative MIR528 relative was identified in an RNA sequencing library prepared from the dicot Dimocarpus longan. This sequence, CTGGAAGTGGATGCAGAGGG, has no fewer than five nucleotide differences from monocot MIR528, gUGGAAGGGGCAUGCAGAGGAGc (lower case letters are precursor nts surrounding the mature miRNA). No such sequence appears to be found in the public genomes or transcriptomes of watermelon or other dicots. The putative longan sequence matches better to various sequences with a common 18-nt stretch found in dicots, but also in animals, than to MIR528. Even if the putative dicot MIR528 sequence were a microRNA, the two differences from monocot at the 3' end would interfere with stem-loop reverse transcription by the monocot-specific assay used by the authors. In any case, for a dicot plant to express an otherwise monocot-specific miRNA, the sequence would first have to be present in the genome of the dicot. Unless and until genomic evidence is provided, MIR528 detected in watermelon or watermelon-fed humans must be presumed to be a contaminant or other artifact.

On 2016 Jan 22, Stefan Hofmann commented:

Stefan G. Hofmann, Nora Esser, and Giovanbattista Andreoli:

The study by Leichsenring and colleagues highlights the importance of considering the quality of the studies that are included in a meta-analysis when evaluating the results. The Cochrane Collaboration’s Tool (Higgins et al., 2011) is a commonly-used instrument to quantify the risk of bias using the following criteria: allocation sequence concealment, blinding of participants and personnel, blinding of outcome assessment, incomplete outcome data, and selective outcome reporting. We analyzed the 64 randomized controlled trials of manual-guided PDT for specific mental disorders that were used in the review by Leichsenring et al (see Table 1). Thirty studies showed risk biases in sequence generation, 54 in allocation concealment, and 31 in the blinding conditions. Only one of the studies showed no obvious biases. Our results suggest that the studies included in Leichsenring’s meta-analysis were of poor quality, essentially invalidating the authors’ results and making the findings meaningless. Table 1: http://issuu.com/gvand/docs/quality_ratings_of_studies_in_leich/1 Table 2: http://issuu.com/gvand/docs/description_and_results_of_studies/1 References: Higgins, J.P., Altman, D.G., Gøtzsche, P.C., Jüni, P., Moher, D., Oxman, A.D., Savovic, J., Schulz, K.F., Weeks, L., Sterne, A.C., Cochrane Bias Methods Group, Cochrane Statistical Methods Group (2011). The Cochrane Collaboration´s tool for assessing risk of bias in randomised trials. RESEARCH METHODS & REPORTING, 343.)

On 2016 Aug 23, David Keller commented:

Results are misleadingly presented; mortality is reduced with moderate alcohol consumption

The Results section of the above abstract misleadingly states:

"The hazard ratio and 95% confidence interval in fully adjusted analyses was 1.02 (0.94-1.11) for <7 drinks/week, 1.14 (1.02-1.28) for 7 to <14 drinks/week, 1.13 (0.96-1.35) for 14 to <21 drinks/week, and 1.45 (1.16-1.81) for ≥ 21 drinks/week."

The above quote falsely implies that all amounts of alcohol consumption increased mortality, either with statistical significance, or at least by trend (depending on whether the confidence interval for a Hazard Ratio crosses 1.0).

These results are from line 5 of Table 2 of this paper, which gives the fully-adjusted results for all study participants. They are misleading, as presented, for two reasons. First, they are normalized by the Hazard Ratio of a newly-defined category called "occasional drinkers", which is a flawed and erroneously defined category of drinkers, for reasons I detail elsewhere [1]. Second, a very important data point has been omitted from these Results, namely the Hazard Ratio for non-drinkers, which is 1.19 (1.11-1.27). Why is the Hazard Ratio for non-drinkers elevated? Because it is normalized by the Hazard Ratio for "occasional drinkers", a statistical maneuver which introduces errors and obscures the true relationship of mortality with alcohol intake.

Thus informed, we see that the non-drinker can lower his Hazard Ratio for all-cause mortality from 1.19 (1.11-1.27) to 1.02 (0.94-1.11) by starting the light consumption of alcohol, drinking <7 standard alcoholic beverages per week. The confidence intervals for the Hazard Ratios of non-drinkers and light drinkers touch at 1.11, but do not overlap, so this is a significant reduction of mortality.

Again, an average non-drinker can significantly lower their risk of all-cause mortality by adding one standard 14 gram serving of ethanol per day, preferably in a dilute form such as beer (to avoid carcinogenic effects on the upper aerodigestive tracts [2]).

References

1: Keller DL, Goulden's data actually confirms that minimum mortality occurs with light-to-moderate alcohol intake, PubMed Commons, accessed on 8/22/2016 at the following URL:<br> http://www.ncbi.nlm.nih.gov/pubmed/27453387#cm27453387_26107

2: Keller DL. Dose-response relationship observed between concentration of ingested alcohol and cancer rate. Comment on PMID 26386538. In PubMed Commons [Internet]. National Library of Medicine; 2015 Sept 26 [cited 2015 Oct 12] at: http://www.ncbi.nlm.nih.gov/pubmed/26386538#cm26386538_11980 The above comment is also posted on the following Annals of Internal Medicine web page: http://annals.org/article.aspx?articleid=2456121

On 2017 Dec 13, Evgenia V Dueva commented:

Release active form of antibodies or other substances is not an accepted scientific concept and the term appears only in the articles involving the commercial products of «MATERIA MEDICA HOLDING». According to Avogadro's law, 12 or more centesimal dilutions of compound lead to a lack of any active substance in any amount of solution that a mouse can drink. It seems that commercial products of «MATERIA MEDICA HOLDING» (including Anaferon, Subetta etc.) is a disguised version of homeopathy and the authors have confused the reviewers and readers with their vague descriptions of their "drugs" and hiding concentrations of the initial compounds.

Given the fact that there is no accepted mechanism of action for any treatment with such dilutions as in the case of Anaferon, Subetta, etc. the simpler explanation for the observed biological effects is bias introduced by lack of proper randomization and blinding.

The critical comment on initial paper was published and can be found here: http://onlinelibrary.wiley.com/doi/10.1002/jmv.24761/full

On 2014 Dec 10, Kath Wright commented:

Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home

On 2013 Jun 16, John Quackenbush commented:

In my opinion, this is one of the foundational papers in modern systems biology and essential reading for anyone interested in the field. The goal of the authors is to create a logical circuit model in lambda phage, one of the most widely studied organisms that exists. The difficulties that are described, the role of stochastic events, and the failure of "rational" design principles in biological pathways lays out many problems that the systems biology community continues to wrestle with today.

On 2015 Dec 03, FREDERICK DOMANN commented:

Here is a link to the pdf: https://dl.dropboxusercontent.com/u/21339133/Cloning_Discs.pdf

On 2015 Dec 03, FREDERICK DOMANN commented:

None

On 2015 Dec 03, FREDERICK DOMANN commented:

None

On 2014 Nov 16, EDWARD BERRY commented:

This is beautiful work, and really answered the question about the Three Core Proteins. But it would have been nice to put it in context of previous work. Something like: ". . . as concluded by Berry et al. 1991 based on heme/protein ratio of the isolated complex, and contrary to the conclusion of Braun and Schmitz 1992 (Eur. J. Biochem. 208,761 -767) based on size estimated by gel filtration".

On 2014 Nov 23, Harri Hemila commented:

The published version is available at DOI.

A manuscript version of the paper is available at the Helsinki University institutional repository: https://helda.helsinki.fi/handle/10138/42358

On 2014 Oct 28, Harri Hemila commented:

With the permission of the editor and the first author, a scanned version of the paper is available at: http://www.mv.helsinki.fi/home/hemila/CP/Hunt_1994_ch.pdf

On 2014 Dec 10, Kath Wright commented:

Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home

On 2015 Dec 05, S A Ostroumov commented:

Full text online free: Biological Filtering and Ecological Machinery for Self-Purification and Bioremediation in Aquatic Ecosystems: Towards a Holistic View: https://www.researchgate.net/publication/13429633

On 2016 Jan 04, S A Ostroumov commented:

Review, opinion paper. A new theory of ecological machinery, function of aquatic biological community toward water purification, improvement of water quality. Full text online: https://www.researchgate.net/publication/13429633

On 2015 May 18, Salzman Lab Journal Club commented:

This very provocative article provides one of the first explorations of the biological function of a circular RNA in vivo. Interestingly, the current annotation of the FMN1 gene does not include exon 4, which is included in their circle and is knocked out in their study. Circular RNAs containing exon 4 are reported as 70% of their detected transcripts. Despite claims that the protein levels are not grossly perturbed, a western blot would have been very useful to allow the reader to assess their claims. It is interesting to note that deleting exon 5 abolishes circular RNA, while maintaining the diagnostic circular junctional sequence and sequences flanking the circle-forming exons.

On 2015 Feb 01, Joe Newton commented:

These findings are interesting as they are consistent with "increased action potential conduction velocity differentials" as defined in (Newton, Joe Ray Medical Hypotheses 1999 Manic -depression neural conduction speeds and action potential event dyscorrelation.) Many later additional genetic studies support this physiologpathology in a broad ranges of neuropsychiatric disorders. The 1999 hypothesis is testable by several different physical methods.<br> Best wishes, Joe Ray Newton

On 2016 Mar 29, Jonathan Wren commented:

New URL is: http://genome-www.stanford.edu/cellcycle/

On 2016 May 23, Daniel Schwartz commented:

Calculate the Sequential Organ Failure Assessment (SOFA) score online or using a mobile app at https://www.qxmd.com/calculate/calculator_268/sequential-organ-failure-assessment-sofa

Conflict of interest: Medical Director, QxMD

On 2016 Oct 31, Pierre Vabres commented:

In hindsight, one of these children more likely had constitutional mismatch repair deficiency rather than neurofibromatosis type 1.

On 2018 Feb 01, Jonathan Eisen commented:

I note - the web site linked to in Figure 1 regarding data used for the trees - http://crab2.berkeley.edu/pacelab/176.htm is no longer available. However, it is available at the Internet Archive at https://web.archive.org/web/19990224012002/crab2.berkeley.edu/pacelab/176.htm.

On 2015 May 17, Prof.Dr.Jogenananda Pramanik commented:

Invited co-authors: Dr.Myo Wint Zaw, Dr.Lwin Lwin Cho and Dato'Dr.Mahmood bin Abd Yusof, Universiti College Shahputra UCSA, Pahang, Malaysia and Dr. Samik Hazra, Brig.Dr.Soumitra Chatterjee, The Calcutta Medical Research Institute,Kolkata-27,India.

Despite rigorous screening tests, early institution of DOT and individualized patient care, multi-drug resistant tuberculosis is emerging as a dreaded killer disease in developing and developed countries.(1) Diagnostic efficacy of real time PCR assay is widely accepted but it is not cost-effective.Therefore, we need to look for other inexpensive solid media culture methods and immunodiagnostic methods for screening and follow up for suspected cases ( 2-5 ). On the other hand, we may also look for fast acetylator status of isoniazid metabolism before deciding about drug resistance.In recent years a group of advanced research laboratories from several western universities are welcoming outsourcing of patients' samples for diagnostic purpose and willing to support physicians in South East Asian countries to detect various diseases at an early stage.

1. Farmer P1, Kim JY. BMJ. 1998 Sep 5;317(7159):671-4. Community based approaches to the control of multidrug resistant tuberculosis: introducing "DOTS-plus". 2.Prof.Dr.J.Pramanik.BMJ.2003.http://www.bmj.com/rapid-response/2011/10/30/delays-diagnosis-tuberculosislet-us-use-thyroxine-supplemented-culture-med: Delays in diagnosis of tuberculosis? Let us use thyroxin supplemented culture medium for early lab-diagnosis. 3.Prof.Dr.J.Pramanik. BMJ: 2004.http://www.bmj.com/rapid-response/2011/10/30/early-diagnosis-tuberculosis-reported-third-world-country Early diagnosis of tuberculosis-reported from third world country:A research letter from India.
2. Dr.J.Pramanik et al.,Ind. J. Tub.1997,44, 185-190. Increased yield of excretory-secretory antigen with thyroxine supplementation in in vitro culture of tubercle bacilli.
3. Dr.J.Pramanik et al.,Ind.J.Clin.Bioch.2000.,5(1),22-28. Detection of tubercular antibody and antigen in sera of bone and joint tuberculosis.

On 2016 May 11, Daniel Haft commented:

This crystallography paper, from 1998, reports a structure for an aminoglycoside-(3)-N-acetyltransferase whose sequence is shown in GenBank record AAB20441.1. It’s interesting to compare AAB20441.1 to a very different aminoglycoside-modifying enzyme, CAG34229.1, the nucleotidyltransferase ANT(2'')-Ia. These two translations are identical over the first twenty amino acids, MLRSSNDVTQQGSRPKTKLG, but are otherwise unrelated. As is readily apparent from examining AJ746361, the source nucleotide record for the latter protein, both these antibiotic resistance genes occur integrated into integrons of the same family, called class 1.

The N-terminal sequence shared by otherwise unrelated antibiotic resistance genes, starting with a plausible-looking ATG-encoded Met in the appropriate reading frame, raises the question of whether this region might actually be translated, and what its contribution to protein structure might be. This crystallography paper is interesting because the extended region was included (along with an additional engineered N-terminal prefix that aided in protein purification) when the enzyme was expressed for the crystallography study, and therefore was studied experimentally. The authors found the N-terminal region to contain sites “that are exquisitely sensitive to trypsin (Arg-3, Arg-14, Lys-16, and Lys-18), suggesting that the N terminus of the enzyme is … disordered.” The N-terminal extension clearly did not participate in forming an ordered crystal structure, and seemed to neither help nor hinder enzymatic activity.

A number of additional unrelated antibiotic resistance genes occur in class 1 integrons and appear in public sequence databases with (probably faulty) translations that start from the same integron-derived candidate start site, resulting in similar N-terminal sequence extensions. Examples include a class A beta-lactamase (BAE71359.1), a trimethoprim-resistant dihydrofolate reductase (BAD07295.1), and a rifampin ADP-ribosyltransferase (CAR63501.1). Readers of this paper may enjoy knowing that the N-terminal sequence extensions shared by these translations reflect integration of unrelated genes at equivalent sites, not conservation of some structural element that would be visible in solved crystal structures.

On 2015 Jul 10, Bill Cayley commented:

A great example of when "less" is "more": https://lessismoreebm.wordpress.com/2015/07/10/primary-care-physicians-and-specialists-as-personal-physicians-health-care-expenditures-and-mortality-experience/

On 2015 Jun 04, Andrea Messori commented:

Gains in life expectancy from medical interventions: a bibliography of 6 references on this topic published between 1998 and 2014

Andrea Messori, HTA Unit, Tuscany Region, 50100 Firenze (Italy)

The main merit of the paper published by Wright and Weinstein (“Gains in life expectancy from medical interventions--standardizing data on outcomes”. N Engl J Med. 1998 Aug 6;339:380-6) is that, for the first time, the study of gains in life expectancy has been proposed as a method to systematically quantify health-care benefits. One interesting question is how often this method has been used thereafter. According to an empirical literature search, we have identified the following 6 studies published between 1998 and 2014 in which the approach described by Wright and Weinstein has been employed to determine health-care benefits:

1. Messori A, Trippoli S, Tendi E. Gains in life expectancy from medical interventions. N Engl J Med. 1998 Dec 24;339(26):1943-4
2. Messori A, Santarlasci B, Trippoli S. Guadagno di sopravvivenza dei nuovi farmaci. Pharmacoeconomics – Italian Research Articles 2004;6:95-104. http://www.osservatorioinnovazione.net/papers/guadagnios.pdf
3. Fojo T, Grady C. How much is life worth: cetuximab, non-small cell lung cancer, and the $440 billion question. J Natl Cancer Inst. 2009 Aug 5;101(15):1044-8. doi: 10.1093/jnci/djp177. Epub 2009 Jun 29.
4. Fadda V, Maratea D, Trippoli S, Messori A. Comparison between real prices and value-based prices of innovative drugs eBMJ, Part1 and Part2 published 6 December 2010, http://www.bmj.com/rapid-response/2011/11/03/comparison-between-real-prices-and-value-based-prices-innovative-drugs-0 and http://www.bmj.com/rapid-response/2011/11/03/comparison-between-real-prices-and-value-based-prices-innovative-drugs-par
5. Messori A, Fadda V, Trippoli S. A uniform procedure for reimbursing theoff-label use of antineoplastic drugs according to the value-for-money approach. J Chemother. 2011 Apr;23(2):67-70. Review. PubMed PMID: 21571620.
6. Martone N, Lucioni C, Mazzi S, Fadda V. New oncological drugs: analysis of survival gain. GRHTA 2014; 1(1): 3 – 15. DOI: 10.5301/GRHTA.2014.12359

On 2013 Oct 23, Pierre Lindenbaum commented:

!MOVED https://github.com/lindenb/cloneit/tree/master/c

The program has been removed from the INRA server: I saved the sources on github: https://github.com/lindenb/cloneit/tree/master/c

On 2015 Feb 09, GUAN ZHU commented:

Acetyl-C0A should Acetyl-CoA. Must be an OCR error...

On 2017 Dec 16, Mohammed AlJasser commented:

Labelled as "Free full text" but it does not seem to be the case.

Any advises?

On 2013 Nov 24, John Sotos commented:

Because it emphasized a bedside approach rather than millisecond dissections of electronic catheter tracings, I found Drs. Zimetbaum and Josephson’s discussion of symptoms and circumstances associated with palpitations refreshing (1). They did not mention, however, the tachycardia-polyuria syndrome.

As described in the 1960s, polyuria occurs in approximately half of patients with paroxysmal supraventricular arrhythmias faster than 110 beats per minute lasting for 20 or more minutes when left ventricular failure and stenotic valvular lesions are absent (2,3). Why the syndrome is so underreported to physicians is unclear. Diuresis typically begins 20 to 60 minutes after the onset of the arrhythmia, is most intense in the first 1 to 2 hours, and may last as long as 8 hours if the arrhythmia lasts that long (2,3,4). It is unusual for polyuria to occur before the palpitation or with ventricular arrhythmias.

The syndrome’s physiology is incompletely known, but seems, in part, to depend on a rise in atrial pressure causing release of atrial natriuretic peptides. Of note, in a recent series of 13 patients with atrioventricular nodal reentrant tachycardia (AVNRT), 12 had associated diuresis (5). Compared to other atrial arrhythmias, the rise in atrial pressure was greatest in AVNRT, as might be expected from symptoms typical of this disorder: cannon A waves and a sensation of pounding in the neck (1).

Thus, the tachycardia-polyuria syndrome is probably a useful indicator of a supraventricular tachycardia, and perhaps AVNRT in particular.

(1) Zimetbaum P, Josephson ME. Evaluation of patients with palpitations. N Engl J Med. 1998;338:1369-73.

(2) Wood P. Polyuria in paroxysmal tachycardia and paroxysmal atrial flutter and fibrillation. Br Heart J. 1963;25:273-82.

(3) Luria MH, Adelson EI, Lochaya S. Paroxysmal tachycardia with polyuria. Ann Int Med. 1966;65:461-70.

(4) Zullo MA. Atrial regulation of intravascular volume: observations on the tachycardia-polyuria syndrome. Am Heart J. 1991;122:188-194.

(5) Abe H, Nagamoto T, Kobayashi H, Miura Y, Araki M, Kuroiwa A, Nakashima Y. Neurohumoral and hemodynamic mechanisms during atrioventricular nodal reentrant tachycardia. Pacing Clin Electrophysiol. 1997;20:2783-2788.

On 2014 Jan 07, Brett Snodgrass commented:

Dear Reader,

Dr. Grollman's excellent article helped me recognize the ambiguous nomenclature of the myocardial vasculature with reference to the Thebesian veins.

The Thebesian veins are distinct from the "vessels of Wearn." Dr. Grollman sagaciously reported this. Unfortunately, there was no pronoun applied to the vessels. Thus, the term "Thebesian veins" was frequently applied to the vessels.

For more information, please see https://twitter.com/BrettSnodgrass1/status/417294264343601152

Comments and suggestions welcome.

Thank you kindly.

On 2013 Oct 28, DAVID SANDERS commented:

From Science 30 October 1998: Vol. 282 no. 5390 p. 843 DOI: 10.1126/science.282.5390.843a TECHNICAL COMMENTS "Ebola Virus, Neutrophils, and Antibody Specificity" "Thus, we conclude that Ebola sGP does not bind FcγRIIIb (CD16) or any other receptor on neutrophils and that the rabbit IgG against sGP used for detection bound to FcγRIIIb through its Fc moiety as an immune complex with sGP."

On 2016 Oct 18, Morten Oksvold commented:

This review is citing Bezwoda WR et al., J Clinical Oncology, 1995, a study which was retracted in 2001 due to fraud. The retracted JCO article represented one of the worst cases of research fraud ever The review article is highlighting the fraudulent research data, and it is therefore surprising that the article is still not retracted.

On 2014 May 20, Iffat Sumia commented:

Now there's a game-changing paper.

On 2014 Nov 26, Harri Hemila commented:

The paper which is commented on is available at DOI.

The comments and reply are available at DOI

On 2014 Nov 26, Harri Hemila commented:

The paper which is commented on is available at DOI.

The comments and reply are available at DOI

On 2017 Nov 16, Anne Niknejad commented:

Figure 2 ' GenBank accession no. Z46796x5'

should be

' GenBank accession no. Z46796'

On 2014 Nov 23, Harri Hemila commented:

The paper is available at the University of Helsinki institutional repository: http://hdl.handle.net/10250/7980

On 2013 Oct 27, David Basanta commented:

In a way I am just testing the Pubmed commons system but this paper is the first one I am aware of that explore the idea of using game theory in order to understand the dynamics between different subpopulations of tumour cells. A couple of very simple game theoretical models highlight how even a very simple mathematical formulation can shed light on the evolutionary mechanisms behind tumour progression toward increasingly more malignant phenotypes.

On 2016 Feb 05, James Murray commented:

The superoxide dependent nitrogenase described in this (Ribbe M, 1997) paper is extremely unlikely to exist.

The paper describes the purification of the components of an oxygen-tolerant nitrogenase, not homologous to the known nif,vnf, or anf-type, from Streptomyces thermoautotrophicus UBT1, a thermophilic carboxydotroph.

Results published in February 2016 (MacKellar D, 2016) show that three independent isolates of S. thermoautotrophicus, including the original UBT1 strain, do not grow in the absence of combined nitrogen and are incapable of incorporating isotopically labelled dinitrogen into biomass, nor do they contain the claimed superoxide dependent nitrogenase genes. The N-terminal sequences assigned to nitrogenase components in Ribbe M, 1997, and the full DNA gene sequences in the PhD thesis of Carla Hofmann-Findeklee (2000, KF951061.1, KF951060.1, KF951059.1, KF956113.1) are found at near-identity in Bacillus schlegelii DSM9132 (recently renamed to Hydrogenibacillus schlegelii, "SdnMSL-like" sequences in KT861421.1), a non-diazotrophic thermophilic carboxydotrophic organism isolated in the Meyer lab (Krüger & Meyer, 1984) and known to be cultured in the Meyer laboratory in 1994 (Hänzelmann, 1994). The independently isolated B. schlegelii DSM2000 strain also has these sequences at near-identity. The closest relatives to these sequences are to Firmicutes and not Actinomycetes like S. thermoautotrophiucs. The four "nitrogenase" sequences are easily identified as encoding a superoxide dismutase ("st2", sdnO), and a three-subunit aerobic carbon monoxide dehydrogenase ("st1", sdnMSL).

Ribbe M, 1997 relies on an ammonia production assay to determine the nitrogenase activity. This assay is known to have a high background due to environmental ammonia and protein deamination. Incorporation of isotopically labelled dinitrogen is usually considered the gold standard for the identification of a nitrogenase enzyme. No incorporation of isotopically labelled nitrogen into ammonia is shown using the claimed biochemical nitrogenase preparation. The cells were grown in media with 1.5 g/l ammonium chloride, so there was no selection for diazotrophy. No published demonstration of the superoxide dependent nitrogenase has occurred outside the Meyer laboratory.

The nitrogenase scheme described in Ribbe M, 1997 is chemically and biologically implausible. There is no known ATPase domain, as required by the proposed reaction scheme, in any of the described proteins. The known nitrogenase types require the highly reducing ferredoxin or flavodoxin as reductants. Superoxide is an unlikely electron donor for a nitrogenase, as it is not as reducing as even NADPH or NADH, and is reactive and toxic. No other biologically productive use of superoxide as an electron donor is known. An aerobic reduction of nitrogen to ammonia is unknown, and unlikely, as under the highly reducing conditions, oxygen would most probably be reduced in preference to nitrogen. The rate of activity described is too low to be that of a biological enzyme supporting diazotrophic growth, as it would take the proposed nitrogenase over 100 hours just to replace the nitrogen in the enzyme itself, which is also incompatible with the claimed rate of diazotrophic growth of S. thermoautotrophicus (Gadkari D, 1992).

To summarize:

• Recent evidence suggests that three independently isolated strains of S. thermoautotrophicus are not diazotrophic.

• If the Meyer laboratory did contaminate their S. thermoautotrophicus culture with a strain of B. schlegelii (such as the DSM9132 strain), we would observe the N-terminal sequences presented here and the DNA gene sequences also produced in the Meyer laboratory.

• The extremely low activity "nitrogenase" was described based on a problematic ammonia production assay.

• A superoxide-dependent aerobic nitrogenase is chemically and biologically implausible.

Declaration: I am an author on the MacKellar D, 2016 paper, but this comment is entirely my own.

References:

Bernd Krüger and Ortwin Meyer. Thermophilic bacilli growing with carbon monoxide. Archives of Microbiology, 139(4):402–408, 1984.

Petra Hänzelmann. Isolierung und Charakterisierung von Kohlenmonoxid-Dehydrogenase aus dem obligat thermophilen Bakterium Bacillus schlegelii. Diplomarbeit thesis, University of Bayreuth, 1994.

Carla Hofmann-Findeklee. Molekularbiologische Untersuchung der Strukturgene des aeroben N2-fixierenden Systems von Streptomyces thermoautotrophicus sowie funktionelle Charakterisierung von rekombinantem SdnO. PhD thesis, University of Bayreuth, 2000.

On 2018 Jan 24, Jean-Michel Claverie commented:

A brand new version of the above statistical test is now available: ACD 2.0

When the initial version of this test was published, transcriptome data was painfully obtained from "Expressed sequenced tags (EST)" library sequencing, resulting in low counts for each detected transcript. Thanks to the evolution in sequencing technologies ("NGS"), transcriptomes are now investigated using several hundred millions of reads, with every transcripts been detected up to several thousands of times.

A new (free) web service is now available that can handle all levels of counts, from a handful to millions, without approximation and without loosing the mathematical simplicity and universality of the original Audic-Claverie Distribution (ACD) test.

ACD 2.0 now proposes three tools:

1) the simple "one item /2 counts" --> p-value of the null hypothesis (i.e. no change in proportions)

2) "an array of items/ 2 or more counts" --> generate a ranked list of the most discriminant items

3) "an array of items /2 or more counts" --> generate a pairwise distance matrix of the whole samples

A full documentation describes the mathematical details and the computational algorithms used in ACD 2.0. It also explains how the above tools can be used in many more contexts than just transcriptome analysis. These include the comparison of metagenomic/barcoding or ChIP-Seq experiments, or non-biological applications simply involving arrays of items and their cognate counts. A formal publication will follow soon. Keep posted in PubMed!

Without further delay you can start using ACD 2.0 (beta) from the following the link:

http://www.igs.cnrs-mrs.fr/acdtool

On 2013 Jun 23, Hilda Bastian commented:

This trial bears the predominant weight for safety concerns about single-session debriefing in a subsequent influential systematic review (Rose S, 2002, of which the lead trialist here is an author). Its results are potentially affected by multiple serious biases.

The trial had a high attrition rate (>22%): 23 lost to follow-up (p78 - participants) and 7 who left hospital before intervention (p78 - results). The number of events was low.

This trial report does not include an intention-to-treat analysis (ITT). ITT was imputed in the systematic review (Rose S, 2002), without description of the additional data or reporting the methods used, and whether or not sensitivity analyses were conducted.

The intervention group was at higher risk of the event at baseline (25% of the intervention arm had others involved in the trauma vs 4% in the control arm, p=0.01; percentage of the body burned, life threat and past significant trauma were also higher, although not significantly so).

There was a disproportionately large number in the intervention group (64 vs 46), due to the method of randomization and having stopped the trial early.

On 2014 Nov 23, Harri Hemila commented:

A manuscript version of the paper is available at the University of Helsinki institutional repository: http://hdl.handle.net/10250/8159. The analysis of the same studies was extended in Cochrane review Hemilä H, 2007 and Hemilä H, 2013.

On 2013 Oct 23, Pedro Mendes commented:

Gepasi is now hosted at http://www.gepasi.org . However this software has been succeeded by COPASI Hoops S, 2006 which is at http://www.copasi.org

On 2016 Feb 16, Bernard Baars commented:

This article is one of the most important neuroscience contributions in recent history.

Mircea Steriade published brain recording studies, in both single-cell and population oscillations in cortex. (The cortico-thalamic system).

Because animal researchers were able to perform direct intracranial recordings long before similar human studies appeared, they published many discoveries that other neuroscientists and psychologists are now seeing in their own data.

Steriade's central finding is that "The cerebral cortex and thalamus constitute a unified oscillatory machine displaying different spontaneous rhythms that are dependent on the behavioral state of vigilance."

This was at a time of extreme skepticism about human scalp EEG, which suffers a thousand-fold loss of voltage due to the attenuating effects of the cranium, scalp muscles, and other protective tissue layers. Direct brain recordings are measured in millivolts, while scalp recordings show up in microvolts, with corresponding vulnerability to electrical noise from the eyes, scalp muscles, and stray EM fields.

Animal researchers solved those problems by learning how to insert electrodes directly into the brain, in species where it was ethically allowable to do so.

Today we are now seeing similar results in humans, using surgical implants prior to epileptic surgery. (See about 200 articles in PubMed under "iEEG" or "ECog". Surprisingly, iEEG has the highest temporal and spatial resolution of any brain imaging technique today.)

On 2014 Nov 26, Matthew Katz commented:

Both this EORTC trial and the RTOG trials 85-31 and 86-10 established the role of androgen deprivation for improved prostate cancer outcomes with radiation therapy. Long-term followup has confirmed the survival benefit in locally advanced patients Bolla M, 2002.

We are still trying to find the optimal balance of hormone therapy with radiation for both intermediate and locally advanced prostate cancer. Higher radiation doses are now given than in these trials, but there still appears to be a role for androgen deprivation (ADT) for many men with prostate cancer that is higher in stage, grade or PSA. ADT isn't without side effects but worth discussion if considering radiation therapy.

http://www.ncbi.nlm.nih.gov/pubmed/12126818

On 2014 Dec 10, Kath Wright commented:

Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home

On 2014 Dec 10, Kath Wright commented:

Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home

On 2015 Jun 06, thomas samaras commented:

Since this paper was published, a lot of research relating anthropomorphic characteristics to longevity has been published. See below:

Samaras TT. Evidence from eight different types of studies showing that smaller body size is related to greater longevity. Journal of Scientific Research & Reports. 2014: 3 (16): 2150-2160, 2014; article no. JSRR.2014.16.003.

Samaras TT. Human Scaling and Body Mass Index. In: Samaras TT (ed): Human Body Size and the Laws of Scaling: Physiological Performance, Growth, Longevity and Ecological Ramifications. New York: Nova Science Pub; 2007: pp 17-32.

He Q, Morris BJ, Grove JS, Petrovitch H, Ross W, Masaki KH, et al. Shorter men live longer: Association of height with longevity and FOXO3 genotype in American men of Japanese ancestry. Plos ONE 9(5): e94385. doi:10.1371/journal.pone.0094385.

Salaris L, Poulain M, Samaras TT. Height and survival at older ages among men born in an inland village in Sardinia (Italy), 1866-2006. Biodemography and Social Biology, 58:1, 1-13.

Bartke A. Healthy Aging: Is Smaller better? A mini-review. Gerontology 2012; 58:337-43.

Samaras TT. Shorter height is related to lower cardiovascular disease risk—A narrative review. Indian Heart Journal 2013; 65: 66-71.

Samaras, TT. Is short height really a risk factor for coronary heart disease and stroke mortality? A review. Med Sci Monit 2004; 10(4): RA63-76.

On 2014 Jan 23, Gerhard Nebe-von-Caron commented:

Sytox green is not suitable for the detection of membrane integrity as it can label cells negative to propidium iodide that are verified as being able to form colonies.

See figure 2 and 3 in http://onlinelibrary.wiley.com/doi/10.1111/j.1574-6976.2010.00214.x/full

The characterisation of functional cell stains works best in competitive labeling situations were they can be directly compared in their interaction. This is similar to the experience with Bis-oxonol which was also described as a staining for cell death but dis-proven by showing those cells to be culturable.

On 2015 Mar 16, Donald Forsdyke commented:

NEUTRAL THEORY NOT SUPPORTED. As a reviewer of this paper I recommended acceptance but was unhappy with the conclusion that it supported neutral theory explanations. On the advice of reviewers, my subsequent Letter to the Editor was declined by the Editor (see http://post.queensu.ca/~forsdyke/bioinfor.htm ). The abstract of the letter read:

"Galtier and Lobry compared the optimum growth temperatures of various prokaryotes with the G+C content of their genomic DNA and of various non-mRNA RNA species (e.g. ribosomal RNAs). Since GC bonds confer greater stability on nucleic acid secondary structure than AT bonds, their data strongly suggest that an increase of G+C content is needed for the stabilization at high temperature of rRNA secondary structure (stem-loops), but not of DNA secondary structures.

The authors propose that "any secondary structure that must endure at high temperatures requires a high G+C content", so that "a high proportion" of stem-loop "secondary structures in bacterial genomes is unlikely". Thus, the fact that Chargaff's parity rule (%A=%T, %G=%C) applies to single-stranded DNA (as to single-stranded RNA), is held to be "poorly explained" on the basis of an evolutionary pressure on DNA to form stem-loops (as proposed by Forsdyke 1995; J Mol Evol 41:573-581). Rather the parity rule would be explained by "neutral directional mutational pressure" (Lobry, 1995; J Mol Evol 40:326-330).

However, "any secondary structure" includes the classical duplex DNA secondary structure. This is likely to exist at high temperatures, and presumably requires "other physiological adaptations" than an increase in G+C content. Such adaptations might also apply to DNA stem-loop secondary structure. Thus, in this context selectionist arguments are no less probable than neutralist arguments."

Subsequently the Editor himself (2000; Gene 241: 3-17) came to agree:

"The low GC levels of some thermophilic bacteria do not contradict, as claimed (Galtier and Lobry, 1997), the selectionist interpretation ... . Indeed, different strategies were apparently developed by different organisms to cope with long-term high body temperatures. It is now known that the DNAs of such thermophilic bacteria are very strongly stabilized by particular DNA-binding proteins (Robinson et al., 1998) and that, in turn, their proteins can be stabilized by thermostable chaperoninins (Taguchi et al., 1991)."

For more please see my textbook Evolutionary Bioinformatics (2nd edition 2011, Springer, New York).

On 2014 Jan 08, Brett Snodgrass commented:

Thank you for an excellent article.

The fistula between the right ventricle and right coronary artery is probably consistent with a vessel of Wearn.

http://bit.ly/JTWearn

http://www.ncbi.nlm.nih.gov/pubmed/23332812

If you disagree or agree, please share and why. Comments or suggestions are welcome.

For additional commentary, please see the following link:

https://twitter.com/BrettSnodgrass1/status/412943028790124544

Thank you kindly.

On 2014 Nov 25, Harri Hemila commented:

A secondary analysis of this study has been published in Hemilä H, 2013, DOI. The secondary analysis calculated that vitamin C reduced the proportion of participants suffering from exercise-induced bronchoconstriction by 50 percentage points (95% CI 23 to 68), from 100% (20/20) on the placebo day to 50% (10/20) on the vitamin C day.

On 2014 Nov 23, Harri Hemila commented:

The paper is available at DOI and at handle and homepg. The comments and reply are available at DOI and at handle and homepg

On 2016 Feb 03, Daniel Schwartz commented:

The Vasculitis Damage Index can be easily calculated using an online tool or mobile app:

https://qxmd.com/calculate/vasculitis-damage-index-vdi

Conflict of interest: Medical Director, QxMD

On 2016 Mar 11, Daniel Haft commented:

This paper reports an N-terminal sequence of ASEPAVIYDTAGKYDKSFNEAVFYNGD for the carbapenem-hydrolying metallo-beta-lactamase AsbM1, and notes the very low similarity of this sequence fragment to a known metallo-beta-lactamase with similar properties, CphA. Inspection of several genomic sequences that have since become available from closely related strains of Aeromonas showed each has a subclass B2 metallo-beta-lactamases closely related to CphA. In each of those same genomes there is a full-length protein that aligns to the sequence fragment with just one or two mismatches, and that is related to the lipoprotein PnrA (purine nucleoside receptor A) described in PMID:16418175 rather than to any known beta-lactamase. This observation suggests that the carbapenemase AsbM1 studied in this article is an allele of the CphA family, but that a PnrA family protein was the source of the N-terminal sequence shown.

On 2014 Dec 10, Kath Wright commented:

Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home

On 2014 Nov 23, Harri Hemila commented:

The published version is available at http://dx.doi.org/10.1016/S0899-9007(96)00223-7.

A manuscript version is available at handle

On 2014 Dec 03, Harri Hemila commented:

Fulltext is available at DOI

On 2015 Jun 22, MARQUIS VAWTER commented:

As first author of this 1996 paper, I wanted to clarify that we were growing olfactory ensheathing cells and other cell types.

"Our immunocytochemistry findings can be partially explained by the presence of ONEC (olfactory nerve ensheathing cells). This interpretation is supported by the finding that 33–66% of ONC are CD401 by flow cytometry. Low-affinity nerve growth factor receptor is used as a marker for ONEC (23, 54, 57) and is also localized to olfactory neurons (4) and olfactory basalcells."

Further in this paper,we concluded that: "Based on expression of CD40, NCAM, and intermediate filaments, the composition of ONC cultures is likely a combination of ONEC, basal cells, and immature olfactory receptor neurons."

The ONEC was defined as olfactory nerve ensheathing cells.

On 2014 Jan 23, Gerhard Nebe-von-Caron commented:

please see http://onlinelibrary.wiley.com/doi/10.1111/j.1574-6976.2010.00214.x/full fig 2/3 for Sytox green labeling depolarised live cells

On 2014 Nov 23, Harri Hemila commented:

A manuscript version is available at handle

On 2014 Nov 23, Harri Hemila commented:

A manuscript version is available at handle. The paper was commented on by Thomas Chalmers http://dx.doi.org/10.1016/0895-4356(96)00190-4 to which a response was published http://dx.doi.org/10.1016/0895-4356(96)00191-6, which is also available at handle

On 2014 Nov 23, Harri Hemila commented:

None

On 2014 Aug 10, Matthew Katz commented:

Organ preservation as a treatment strategy effectively demonstrated chemoradiation as the standard of care for anal canal cancer. RTOG proved the point in 83-14 [Sischy B, 1989]. The RTOG phase III trial above confirmed the importance of mitomycin-C as part of the treatment regimen, which remains the standard in 2014.

With the rising incidence of HPV+ anal cancer, which may have a better prognosis, an important question will be whether we should lessen treatment intensity. Further trials will be needed to see if it's possible to lessen treatment toxicity without compromising cancer control.

On 2013 Jun 13, Karl Broman commented:

This is the first paper to consider interval mapping for binary traits in experimental crosses. Somewhat surprisingly, genetic mapping in humans focused on binary traits and not quantitative ones, while mapping in experimental crosses focused on quantitative traits and not binary ones. The method is developed in the context of marker covariates, and so it is a bit more technically challenging to understand than it might be, but this paper had a lot of influence on my understanding of QTL mapping.

On 2015 Oct 21, Jeff Bertrand commented:

Looking for a full text version of this article.

On 2014 Jan 07, Brett Snodgrass commented:

Dear Reader,

The myocardial sinusoids are not a phantom regardless of whether knowledge about them is.

Arteriosinusoidal vessels described by Wearn connect to myocardial sinusoids. The myocardial sinusoids are often pathologically altered and readily apparent on microscopy in pulmonary atresia with intact ventricular septum.

Dr. Wearn's work: http://bit.ly/JTWearn The myocardial sinusoids are not phantom as they connect to the arteriosinusoidal vessels. The vessels of Wearn include the arteriosinusoidal and the arterioluminal vessels of the heart. Wearn's distinguished Harvey lecture of 1940 describes the difference between the "Thebesian veins" and the "AL & AS" vessels (vessels of Wearn). Related references: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1933738/ http://www.ncbi.nlm.nih.gov/pubmed/22704295 http://www.ncbi.nlm.nih.gov/pubmed/23332812 https://twitter.com/BrettSnodgrass1/status/419324443068874752

On 2015 Aug 21, Robert P O'Shea commented:

The PubMed title of this paper is incorrect. It should be "The extraordinarily rapid disappearance of entoptic images" with two ts in "entropic", as in the paper itself. Entopic is a medical term meaning in the usual place, as opposed to ectopic, which means in the wrong place (e.g., ectopic pregnancy). "Entoptic" means in the eye, requiring the Greek root "optic".

On 2015 Sep 11, Bill Cayley commented:

More evidence that "less-medical" primary care can actually be MORE cost-effective (and perhaps better in other ways: https://lessismoreebm.wordpress.com/?s=primary

On 2014 Dec 10, Kath Wright commented:

Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home

On 2013 Nov 24, John Sotos commented:

[Written in 1996] Speculations regarding Creutzfeldt-Jakob disease (CJD) acquired from beef containing the infectious agent that causes bovine spongiform encephalopathy [1] have resulted in dramatic health policy measures and serious concerns in the lay public about dietary beef intake in Britain. We believe these concerns are out of proportion to the actual risk of CJD, especially when compared to other established risks of beef consumption, such as the development of coronary heart disease (CHD). We therefore sought to estimate a beef-eater’s risk of CJD and CHD based on currently available data.

The ten cases of CJD became manifest over a 20 month span in 1994-1995 [1]. If we suppose a uniform incubation period of 10 years for CJD, then all 10 cases were infected during a 20 month period in 1984-1985, when the mean beef intake among the 56 million Britons was 181.5 g/person/week [2] (roughly equivalent to two hamburgers per week). Assuming the attack rate remains constant, an average Briton would have a 1 in 933,000 chance of developing CJD from 10 years of beef-eating. The risk per hamburger is roughly 1 in one billion.

To determine the beef-attributable risk of CHD, we first calculate the change in serum cholesterol that results when the fat and cholesterol in lean beef [3] are consumed in place of isocaloric carbohydrate or protein. Using the average daily caloric intake in Britons (2040 kcal) [2], the Hegsted equation [4] predicts a 2.1 mg/dl increase in serum cholesterol when 181.5 g beef/week are consumed. For a 30 year-old non-smoking, non-diabetic man with a total cholesterol of 150 mg/dl, an HDL cholesterol of 45 mg/dl, and a systolic blood pressure of 120 mmHg, the Framingham equation [5] predicts that a 2.1 mg/dl increase in serum cholesterol sustained over 10 years raises the risk of CHD during this period by 1 chance in 5300. Thus the CHD/CJD relative risk is approximately 175!

Although our calculations are approximations at best, they clearly show that the risk from fat and cholesterol in beef is, for most of the adult population, orders of magnitude greater than the risk from neurotropic particles contained therein. Other diseases linked to fat intake, such as stroke and colon cancer, have not been considered here. Based on these data we believe that beef-eaters should care for their coronaries, rather thsn perseverate on prions.

[1] Will RG, Ironside JW, Zeidler, et al. A new variant of Creutzfeldt-Jakob disease in the UK. Lancet. 1996;347:921-925.

[2] Ministry of Agriculture, Fisheries and Food. National Food Survey 1994. London: Her Majesty’s Stationery Office, 1995.

[3] American Heart Association Cookbook. Ballantine Books. New York, NY, 1986.

[4] Hegsted OM. Serum-cholesterol response to dietary cholesterol: a re-evaluation. Am J Clin Nutr. 1986;44:299-305.

[5] Anderson KM, Wilson PWF, Odell PM, et al. An updated coronary risk profile: a statement for health professionals. Circulation. 1991; 83:356-362.

On 2016 Jul 23, Jonathan Eisen commented:

I am posting some materials associated with this paper on Figshare (alignments, trees, color figures, etc).

See https://figshare.com/projects/1995_Eisen_RecA_Evolution_JME/15035

Jonathan Eisen

On 2014 Dec 02, Robert Eibl commented:

I worked at that time in that lab and I completed the very first isogenic SV129 K.O. constructs for the planned partial K.O of the CD44 gene. Part of my work contributed to the paper above and was acknowledged within the article: "The sizes of the PCR products derived from the phage clones allows an estimate of the intron sizes. These results have been indepentently confirmed by mapping the restriction sites for more than twenty restriction enzymes on (lambda) phage inserts(R.Eibl, unpublished results)."

On 2014 Nov 16, Robert Eibl commented:

None

On 2018 Jan 21, Tom Kindlon commented:

References:

1 Chalder T, Berelowitz G, Pawlikowska T, Watts L, Wessely S, Wright D, Wallace EP: Development of a Fatigue Scale. J Psychosom Res 1993, 37:147-153.

2 Neu D, Hoffmann G, Moutrier R, Verbanck P, Linkowski P, Le Bon O. Are patients with chronic fatigue syndrome just 'tired' or also 'sleepy'? J Sleep Res. 2008 Dec;17(4):427-31. doi: 10.1111/j.1365-2869.2008.00679.x.

3 Goudsmit, EM., Stouten, B and Howes, S. Fatigue in myalgic encephalomyelitis. Bulletin of the IACFS/ME, 2008, 16, 3, 3-10. https://web.archive.org/web/20140719090603/http://www.iacfsme.org/BULLETINFALL2008/Fall08GoudsmitFatigueinMyalgicEnceph/tabid/292/Default.aspx

4 Goldsmith LP, Dunn G, Bentall RP, Lewis SW, Wearden AJ. Correction: Therapist Effects and the Impact of Early Therapeutic Alliance on Symptomatic Outcome in Chronic Fatigue Syndrome. PLoS One. 2016 Jun 1;11(6):e0157199. doi: 10.1371/journal.pone.0157199. eCollection 2016. https://doi.org/10.1371/journal.pone.0157199.s001 (CSV form: https://www.mediafire.com/file/rvh3brmgoaznude/Goldsmith+2015+FINE+data+journal.csv )

5 A dataset from the PACE trial. Released following a freedom of information request. https://sites.google.com/site/pacefoir/pace-ipd_foia-qmul-2014-f73.xlsx Readme file: https://sites.google.com/site/pacefoir/pace-ipd-readme.txt.

6 Morriss RK, Wearden AJ, Mullis R. Exploring the validity of the Chalder Fatigue scale in chronic fatigue syndrome. J Psychosom Res. 1998 Nov;45(5):411-7.

7 Loge JH, Ekeberg O, Kaasa S. Fatigue in the general Norwegian population: normative data and associations. J Psychosom Res 1998; 45: 53-65. CrossRef | PubMed

8 Van Kessel K, Moss-Morris R, Willoughby, Chalder T, Johnson MH, Robinson E, A randomized controlled trial of cognitive behavior therapy for multiple sclerosis fatigue, Psychosom. Med. 2008; 70:205-213.

On 2018 Jan 21, Tom Kindlon commented:

My feedback on content of Common Data Elements (Fatigue) - Myalgic Encephalomyelitis/Chronic Fatigue Syndrome (ME/CFS) CDE Public Review

I submitted this to the NIH and thought I would also post it here.

Suggested Change: Don't use the Chalder fatigue questionnaire

Rationale: The Chalder Fatigue questionnaire has two separate scoring systems, bimodal (0-11) and Likert (0-33) [1]. Some of the issues raised below are more significant with one system rather than the other.

(i) Doubts about the validity of two of the items in the questionnaire as means to measure fatigue:

The item “Do you have problems starting things” seems as though it could relate more to motivation or some other issue rather than fatigue specifically.

The item “Do you feel sleepy or drowsy” relates more to sleepiness than fatigue. Sleepiness and fatigue are not necessarily the same thing [2].

Most studies that used the Chalder fatigue scale do not give details of scores on individual items but one study [3] reported the following in participants with ME: “Focusing on the individual items revealed that 86.8% of the questions making up the physical fatigue subscale received near maximal or maximum scores. The items which received the greatest number of low scores were question 3 (‘do you feel sleepy or drowsy’) and question 4 (‘do you have problems starting things’).”

(ii) Ceiling effects are a significant issue when the Chalder fatigue questionnaire is used with patients with ME and CFS score, particularly with bimodal scoring:

A study of those with ME [3] found that “Fifty per cent of the patients recorded the maximum score using the bimodal method and 77% recorded the two highest scores [i.e. either 10 or 11].” In the FINE and PACE trials, 76% (147/193) and 65% (417/640) respectively of CFS participants reported the highest score [11] at baseline using bimodal scoring [4,5].

With regards to Likert scoring, a study of those with ME found that there was some evidence of a ceiling effect in those who were severely affected (more details were not reported but the average score for those severely affected was 30.55 (SD: 2.66)). In the FINE and PACE trials 29.1% (57/196) and 14.5% (93/640) of the participants with CFS respectively scored the maximum score of 33 at baseline.

There is also a 14-item version of the instrument with three extra items. A study of 136 individuals with CFS looking at Likert scoring found there was near-maximal scoring on 6 of the 8 physical fatigue items [6].

The authors of the ME study [3] noted with regards to bimodal scoring that there was a “marked overlap between those who rated themselves as moderately or severely ill. These findings are indications of a low ceiling.” This could lead to the questionnaire failing to detect patients moving from being severely to moderately affected and vice versa.

Furthermore, if patients are already at a ceiling score at the start of the intervention, the questionnaire cannot detect their getting worse. This could mean that evidence of harm would not be recorded. Also, this phenomenon could affect measures of efficacy: if a certain percentage of patients improved and the same percentage worsened to a similar level, this could show up as an average improvement because the scores for those who got worse would not change if they were already at the ceiling level.

This could also make interventions that caused a significant number of deteriorations seem better than those that caused fewer. For example, consider a scenario in which one intervention caused a certain percentage of patients to improve while the same percentage, who began at the maximum score, worsened by the same amount. If another intervention caused half the number of patients to both improve and worsen, the average numerical improvement for the first intervention would be twice that of the second, even though rationally the scores should be the same.

(iii) Discussion of the ability of respondents to mark symptoms as occurring “less than usual”:

The fact that participants can rate their fatigue symptoms as occurring “less than usual” can lead to some odd results with Likert scoring of the Chalder scale (it is not an issue with its bimodal scoring). People who have no fatigue problems should generally score 11/33, indicating that they had problems ‘no more than usual’. And, indeed, a study in Norway found that those in the category “No disease/current health problem” had a mean score of 11.2 [7].

However, a study found that people with "multiple sclerosis fatigue" after an intervention reported an average fatigue score of 7.80 – that is, lower than 11; this score also showed lower fatigue than that of a healthy, nonfatigued comparison group in the study [8]. It is very unlikely to be true that patients with multiple sclerosis fatigue at baseline ended the study with lower fatigue than healthy people. Scores of less than 11 were also reported by those with CFS in the FINE and PACE trial [4,5].

I will explore further now how pooling the scores of people who give scores of less than 11 with other scores can give odd results. Say 75% of participants gave a Likert score of 4 and 25% gave a score of 24. This would be an average score of 9 which is a better score than the score of 11 that healthy people report. However, it is likely that people who scored 4 on the scale were confused by the peculiar option on the Chalder questionnaire that allows them to rate themselves as having fewer problems with fatigue than when they were last well (choosing that option is the only way to get a score below 11). If they really meant to say that they had no more fatigue than when they were last well, then their score should really have been similar to that of the average healthy person, at 11.2. Substituting this score instead of 4 in this example would give an average score for the group of 14.4, a worse score than what healthy people score. The latter is, I believe, a better representation of what the average fatigue score for the group would be: that is, if a significant percentage still had significant fatigue, than the overall fatigue level should be worse on average than a healthy group, not better. This shows that the ability to have better scores than healthy people doesn’t just affect the validity of individual scores, it also affects the validity of overall mean scores.

[The references for this comment are in my reply below]

On 2014 Nov 23, Harri Hemila commented:

A manuscript version of the paper is available at the Helsinki University institutional repository: http://hdl.handle.net/10250/8076

On 2017 Aug 20, Daniel Weiss commented:

This is a paper which is often cited to tout the robust sensitivity of the Western blot for diagnosis of Lyme disease. However, a careful, critical reading of this paper reveals major flaws. The Western blot is, on the contrary quite insensitive for the diagnosis.

I will limit my comments to study patients without recent erythema migrans. Most workers agree that an erythema migrans rash is diagnostic on its own, and that serologic tests are unnecessary as well as unreliable at this stage of the disease. Dressler performed both a prospective and retrospective study to evaluate two-tier testing. Study subjects were recruited from the authors’ Lyme disease clinic from 1990-1991. To participate they had to live in “an area endemic for Lyme disease”. The G39/40 strain of B. burgdorferi was used to generate antigens for the ELISA assay.

Dressler’s prospective study included 54 highly-selected patients with Lyme disease. The prospective group included patients with Lyme arthritis and those with “inactive” Lyme disease. Many patients had a history of the EM rash. Neuroborreliosis was diagnosed in 39 patients; these patients had CSF pleocytosis, increased CSF protein or EMG evidence of an axonal polyneuropathy not caused by other known disease. Ten of the 39 with neuroborreliosis were declared to be “inactive” although this term was not clearly defined. Importantly, only 21 of the 39 were positive by ELISA—a sensitivity of 54%. Of those cases of “active Lyme disease” who had neuroborreliosis, the sensitivity was 58%.

There were 57 patients with an indeterminate ELISA. One third of those who were thought by the investigators to have “active Lyme disease” had a negative Western blot. Thus, the two-tier test performed poorly even in patients whom expert physicians (Dr. Steere and colleagues) were sure had “active Lyme disease”.

In the retrospective study of Dressler et. two-tiered testing was performed on a highly-selected patient cohort. ELISA was negative in two of 25 with Lyme encephalopathy or polyneuropathy; two more patients’ ELISAs were read as indeterminate. Western blot testing in four of the 25 showed a minimal or absent response. Thus, the sensitivity of the test in these patients chosen because the authors were convinced they had Lyme disease reached only 84%.

On 2014 Jan 08, Brett Snodgrass commented:

Dear Reader,

This excellent study of quail embryos by Poelmann et al. also identified the vessels of Wearn.

The impression was that the vessels of Wearn are only connected to the right ventricle. However, Wearn identified the arteriosinusoidal and arterioluminal connecting to each of the four heart chambers. http://bit.ly/JTWearn

The vessels of Wearn may be appear less significant in healthy individuals, but in disease states such has PAIVS, or AA/MS, they appear more significant.

For additional commentary, please see.

https://twitter.com/BrettSnodgrass1/status/404941362908241920/

My interest is in accurate medical terminology, and I ask that others collaborate towards this end.

Comments and suggestions are welcome.

Thank you kindly.

On 2017 May 21, Kay Dickersin commented:

We need to make sure this article and others are archived properly so that they can be accessed by others. This journal was ahead of its time, and contains important articles.

On 2013 Oct 23, Pedro Mendes commented:

Gepasi is now hosted at http://www.gepasi.org . However this software has been succeeded by COPASI Hoops S, 2006 which is at http://www.copasi.org

On 2013 Nov 21, Gary Ward commented:

This report describes a simple yet elegant series of experiments demonstrating that the T. gondii parasitophorous vacuole membrane (PVM) acts as a sieve, allowing small molecules (up to ~1300 Da) to pass from the cytosol into the vacuolar space. The researchers microinjected a panel of fluorescent probes either into the cytosol of infected cells or into the parasitophorous vacuole and observed bi-directional, passive transport across the PVM. These experiments provided an important new insight into the interface between the intracellular parasite and the host cell. The likely presence of nonselective membrane channels in the PVM is analogous to the outer membrane of Gram-negative bacteria, in which membrane porins allow passive transport of nutrients and metabolites into the bacterial periplasmic space.

These results from these experiments are consistent with characterization of the vacuole membrane in host cells infected with the related apicomplexan parasites, Plasmodium falciparum [Desai et al, Nature 362 (1993); Desai and Rosenberg, PNAS 94 (1997)] and Eimeria nieschulzi [Werner-Meier and Entzeroth, Parasitol Res 83 (1997)]. The obligate intracellular microsporidian Encephalitozoon cuniculi also resides within an intracellular vacuole capable of passive transport of fluorescent peptides up to 1100 Da while 10 kDa fluorescently-labeled dextrans are excluded [Rönnebäumer et al, Eukaryot Cell 7 (2008)]. The presence of non-selective membrane channels and the non-fusogenic nature of the parasitic vacuoles established by these phylogenetically distant organisms point to a similar adaptation to an intracellular parasitic lifestyle.

Posted by Gary Ward on behalf of the University of Vermont Toxoplasma Journal Club (UVM ToxoJC); members include Jenna Foderaro, Anne Kelsen, Shruthi Krishnamurthy, Jacqueline Leung, Pramod Rompikuntal, Luke Tilley & Gary Ward

On 2017 Mar 03, Md. Shahidul Islam commented:

An extensively updated review on this topic is available: M. S. Islam. Calcium signaling in the islets. In: Islets of Langerhans, edited by M. S. Islam, Dordrecht, Heidelberg, New York, London:Springer, 2014, p. 605-632. ISBN 978-9400766853

On 2017 May 26, Israel Hanukoglu commented:

Originally we had named this protein as LL5.

This protein has been named as Pleckstrin homology-like domain family B member 1 (Phldb1).

The Uniprot link for this protein is http://www.uniprot.org/uniprot/Q63312

On 2016 Aug 17, Lydia Maniatis commented:

Short version:

The authors say: "We hypothesize that how our stimuli are perceived depends on spatial frequency. Our hypothesis is confirmed. (P.S. The effect is size invariant.)"

Translation: "We hypothesize that how our stimuli are perceived depends on spatial frequency. How our stimuli are perceived DOES NOT depend on spatial frequency. Our spatial frequency hypothesis is falsified."

a + (-a) = 0

(The discrete addition of the phrase "at one size" into the abstract, as though this did not upend the entire position, is really quite extraordinary.)

On 2016 Apr 11, Lydia Maniatis commented:

It is worth asking why, on the one hand, Solomon and Pelli (1994) seem to be asking questions about initial steps in vision - asking about "visual filters," and, on the other, referring, not to "perception" of letters, but to "identification" or "recognition." In order to identify or recognise, we have to first perceive, but this step is skipped over not only by these researchers but by those contemporary investigators who consider themselves "psychophysicists" in general.

The reason is this: These investigators insist on treating perception as a problem of detection, such that they can recycle the signal detection models first developed by radar researchers.

Thus, they assume that identification/recognition would be perfect if it were not for “internal noise” in the system, which produces uncertainty in the outcome. This noise is the random firing of neurons, base rates etc. This claim about internal noise and perception has never been tested, nor (to my knowledge) have these researchers proposed a way to test or measure the claim, but it is assumed.

It is also assumed that we can add “external noise” to a stimulus and thus counterbalance the “internal noise.” This “external noise” can take the form of variance of the stimulus pool, splotches superimposed on the stimulus (as here), etc. Anything that can be described as “unpredictable.”

If we do this, then there is an equation that we can use that allows us to measure “performance” regardless of the task, as long as we have a value to plug in for our “noise” term.

If we can assume that the “external noise” is much bigger than the “internal noise” then we can use this equation whose output is labelled “E” for efficiency, by plugging in our “external noise” value.

Clear so far?

What is wrong with this story is also the reason researchers adopting it don't refer to “perception.”

The stimulus, which consists of retinal photoreceptors excited by disconnected photons pouring in from the environment does not contain “letters” or any other objects to be “detected.” Only photons are detected by the system. It is the response of the nervous system that organizes these points, based on rules (instantiated in the system) that have been selected for over evolutionary time to produce a good enough match between the objects out there and the objects we perceive. We can understand the importance of sophisticated rules if we consider how easy it is for humans to read the letters of “captchas” used by websites to ensure you're not a robot, but which programmers have a hard time beating. (This is actually a crude and somewhat misleading example, because even seeing the entire captcha without being able to recognize the letters it “contains” is a feat of perceptual organization). So the visual system creates a percept by adding structure to structureless data, and the number of these potential structurings is infinite. The limiting factors are the rules.

So to see a letter, even as a physical shape, implies an enormously complicated process of perceptual organization, based on inferences that constitute the output of the system. What we “identify” or “recognize” is the product of these processes. We are not “detecting” something that is there a priori, in the stimulus, the disconnected photons. Seeing splotches, or any other feature of the percept, is also the result of the same organizing processes. There's no principle justifying calling part of the percept “noise” and another part “signal” if what we are interested in are basic perceptual processes. It is relatedly a problem to overlook that some kinds of “noise” will, for organizational reasons, interfere more with the “signal” that we have in mind than other kinds, something that the makers of “captchas” know well.

But all of these facts are silently overlooked by investigators who choose to treat perception as a detection problem involving imaginary spatial filters and arbitrarily defined “noise”. Which is truly extraordinary.

On 2016 Mar 12, Lydia Maniatis commented:

Continuation of previous:

Translation: Forget everything we've assumed so far about spatial filters. We don't have special detectors sensitive to the frequency of light bands falling across the retina! Visual angle doesn't matter. The visual system has special detectors for detecting the number of light/dark cycles per (familiar) "letter" - (about 3), actually a range of cycles, since some letters are quite wide (e.g. m's) and others quite narrow (e.g. l's). The processes implicit in organizing points of light into letter shapes so that we can recruit the relevant letter-sensitive channels are not relevant. Our data plus assumptions prove it.

I think this front-page Nature article has zero credible content or face-validity.

On 2016 Mar 12, Lydia Maniatis commented:

The claims the authors make in this publication lack both empirical and logical support. To make what is perhaps the most clear point, the very tenuous assumptions underlying the project are themselves contradicted by the authors own statements. This is represented as a refinement of the fundamental assumption, but in fact it pulls the rug out from under it. Each step of the way, definite assertions are made which citations provided do not support.

The train of thought (with comments) is this:

Authors: “We hear periodic sounds, or tones, by means of parallel auditory filters, each tuned to a band of temporal frequency (Fletcher, 1940)”

From MIT online Encyclopedia of Cognitive Sciences: To account for the obtained data, Fletcher proposed a “critical band” that likened the ear to a bandpass filter (or, to encompass the entire frequency range, a set of contiguous, overlapping bandpass filters). The proposed “auditory filter” is a theoretical construct that reflects frequency selectivity present in the auditory system...”

Translation: The auditory system exhibits frequency selectivity. We could find no more convincing citations with respect to auditory filters between 1940 and 1994.

Authors: “...and we see periodic patterns, or gratings, by means of parallel visual filters (Campbell and Robson, 1968).”

From Robson and Campbell, 1968: “Thus, it seems that we cannot satisfactorily model the over-all visual system by a simple peak detector following a spatial filter...As a modification of this theory, we may assume...Thus, we may suppose that the visual system behaves not as a single detector mechanism preceded by a single broadband spatial filter but as a number of independent detector mechanisms each preceded by a relatively narrowband filter 'tuned' to a different frequency...Such a model could account for our findings...”

Translation: Robson and Cambell's (1968) results did not bear out their original predictions, and they speculated as to possible alternative accounts. Between 1968 and 1994, no firmer conclusions were apparently available.

Note also that the analogy between frequency of pressure waves and the “frequency of periodic patterns (gratings)” is very loose. What is being claimed, specifically, is that there is a class of visual neurons that are excited by stimuli with a specific, sine-wave-type luminance structure across a region of space (more specifically, across a region of the retina), and that they are sensitive to the frequency of these spatial luminance alterations. But frequency of pressure waves is a fundamental feature of the energy that interacts with our sensory system to initiate perception. Grating patterns, on the other hand, are just one of an infinite number of possible patterns of light impinging on our retinas. If assumptions about vision are to rest on analogy, then frequency of light waves would seem more appropriate.

Authors: “Do these visual filters participate in everyday tasks such as reading and object recognition?”

Translation: We assume the existence of special, “low-level” mechanisms for detecting grating patterns of light on the retina. (Campbell and Robson, 1968 specified visual angle, i.e. extent on the retina, in defining their patterns). We wonder if these exist exclusively to detect grating patterns, or whether they are engaged in seeing other things as well. We're particularly interested in the perception of familiar objects that we can name upon seeing. The possibility that the visual system may possess “low-level” neurons interested only in ecologically irrelevant grating patterns but not in objects seems to us to be not only credible but testable and worth testing...

Authors: “After all, grating visibility only requires the distinguishing of pattern from blank, whereas object recognition, for example letter identification, requires classification by the observer into one of many learned categories.”

Translation: It's possible that letter identification doesn't implicate mechanisms used for seeing “pattern from blank,” or for seeing unfamiliar letters. To the extent that such mechanisms might, in fact, be implicated in letter recognition, we presume they consist of spatial filters.

Authors: “Here, we make use of results from hearing research (Patterson, 1974).”

Translation: An ad hoc model constructed on the basis of hearing experiments is an appropriate model for testing our conceptually confused variant of an assumption about the visual system based on another analogy to audition. (From Patterson, 1974: From Patterson (1974): “Threshold for a pulsed tone was measured as a function of its distance in frequency from the edge of a broad band of noise with very sharp skirts. Tone frequency was held constant at 0.5, 1.0, 2.0, 4.0, or 8.0 kHz while the position of the noise edge was varied about the frequency of the tone. The spectrum level of the noise was 40 dB. As expected, tone threshold decreased as the distance between the tone and the noise edge increased, and the rate of decrease was inversely related to tone frequency. The data were used in conjunction with a simple model of masking to derive an estimate of the shape of the auditory filter. A mathematical expression was found to describe the filter, and subsequently, this expression was used to predict the results reported by several other investigators.”)

Authors: We find that letter-identification and grating detection filters are identical, showing that the recognition of these objects at one size is mediated and constrained by a single visual filter, or 'channel.'

Translation: Our “single visual filter” conclusions contradict the speculations of Campbell and Robson (1968) (the authors we cited as support for the existence of filters to begin with) i.e. that “we may suppose that the visual system behaves not as a single detector mechanism preceded by a single broadband spatial filter but as a number of independent detector mechanisms each preceded by a relatively narrowband filter 'tuned' to a different frequency.” We don't know if our results on "letters" apply to other shapes. The varied shapes and proportions of "letters" have no bearing on the issue. For the visual system, "letters" is a special category of its own.

Authors: Surprisingly, our noise-masking paradigm shows that the same channel performs both low-level detection of narrow-band gratings and high-level identification of broad-band letters.

Translation: Uncorroborated assumptions inspired by analogies to electrical circuits and sound systems, which ignore the fact of neural inhibition and the principles of perceptual organisation, allowed us to show that hypothetical grating-detectors are responsible for the processes involved not only in perceiving, but also in recognizing letters. (Clearly a breakthrough for memory research as well as perception.) Also, we are arbitrarily splitting the part of the pattern we are showing observers into “noise” and “signal” terms, and assume that the visual system agrees with our analysis and segregates letters from splotches, without recourse to any organizing constraints (e.g. figure-ground rules). (Also, see again comment above re: single channel.)

Authors: (Blurb to Figure 1): Note that changes in viewing distance, from 3 to 60cm, hardly affect the visibility of any given letter, indicating that the channel scales with letter size. (cont'd in next comment).

On 2014 Nov 23, Harri Hemila commented:

A manuscript version of the paper is available at the Helsinki University institutional repository: http://hdl.handle.net/10250/8077

On 2016 May 03, Hugues BEDOUELLE commented:

For an unknown reason, this article is absent from the archives of "Protein Engineering Design and Selection". A pdf file of the article can be found at URL: http://hugues.bedouelle.free.fr

On 2015 Apr 15, Mick Watson commented:

The authors have simply (re)invented integration, a mathematical procedure taught to most high school students. See https://fliptomato.wordpress.com/2007/03/19/medical-researcher-discovers-integration-gets-75-citations/

On 2014 Nov 30, Harri Hemila commented:

Believing that the 2% average effect of vitamin E on mortality is valid for all ATBC participants is an example of ecological fallacy.

The ATBC Study, Alpha-Tocopherol, Beta Carotene Cancer Prevention Study Group., 1994 reported that the average mortality in participants administered vitamin E was not different from the non-vitamin E group with RR = 1.02 (95% CI 0.95, 1.09).

However, a subsequent subgroup analysis found that the effect of vitamin E was not uniform over all the ATBC Study participants. The combination of age and dietary vitamin C modified the effect of vitamin E so that there was strong evidence of heterogeneity in the effect of vitamin E over 6 subgroups (P = 0.0005) Hemilä H, 2009. Furthermore, given that baseline age modified the effect of vitamin E, a further analysis by the participants’ follow-up age was done and a significant difference in the effect of vitamin E on mortality was observed before and after the age of 71 years (P = 0.03) Hemilä H, 2011.

Ecological fallacy occurs where data about a group is used to conclude information about an individual. Thus, assuming that the +2% average effect of vitamin E on mortality in the ATBC Study is valid for all ATBC participants is an example of ecological fallacy. A substantial proportion of the ATBC Study participants are inconsistent with the average effect.

On 2017 May 29, Israel Hanukoglu commented:

The DOI address for the article is: http://dx.doi.org/10.1016/0960-0760(94)90266-6

On 2016 Jul 23, Jonathan Eisen commented:

I am posting some notes and other materials relating to this paper on Figshare. See https://figshare.com/account/home#/projects/15032.

On 2014 Oct 26, EDWARD BERRY commented:

The potato hinge protein has a perfect CX9CX3C----CX3CX9C motif which by homology with vertebrate structures should form a helix hairpin with disulfides holding the two arms together. This is the motif recognized by the MIA40/CHCHD4 disulfide relay import system. And like other MIA40 substrates, the hinge protein ends up in the inter-membrane space (attached to cyt c1 of the bc1 complex). I wonder if anyone has checked whether Hinge is imported by the MIA40 system.

In vertebrates one of the middle cysteines is lost, some residues are inserted, spoiling the perfect cannonical MIA40 import sequence. Only two disulfides are formed, and there is a short leader sequence although it is not a typical mitochondrial targeting sequence.

In Saccharomyces, all but two of the cysteines are lost, and the hairpin is clamped by a single disulfide. Could this represent a switch from one import mechanism to another over the course of evolution?

On 2014 Dec 10, Kath Wright commented:

Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home

On 2014 Sep 20, Dr Yasmin Momin commented:

mucoepidermoid carcinoma of ovary arising in dermoid is a rare case we reported

On 2017 Mar 23, Misha Koksharov commented:

There is a later paper on this topic with important critical comments: Dworak M, 2011

On 2017 May 30, Thomas Heston commented:

The data presented in this study do not support ageism but rather illustrate a primary feature of statistics: as the sample size increases, you are more likely to find a statistically significant p-value. First of all, look at admission rates to the coronary care unit (CCU). If there was a gender bias, then a greater proportion of men (or women) without acute myocardial infarction would be admitted to the CCU compared to the other sex. This study shows clearly that sexism in CCU admission rates is not present. In 1990, 53% of men admitted to the CCU did not have an infarction compared to 52% of women, i.e. over half of the people admitted to the CCU did not have a myocardial infarction yet received CCU level care. This difference is not statistically significant. Then, in 1992 it was found that 48% of men admitted to the CCU did not have infarction compared to 54% of women. This difference was statistically significant, indicating that a greater proportion of women vs men admitted for suspected myocardial infarction received CCU level care. If anything, this represents sexism against men, not against women. But if we look at the data closer, we find that quite a few more people were admitted for suspected infarction in 1992 compared to 1990. This larger sample size means that we are more likely to find statistically significant differences. So while no statistically significant difference was found with the lower sample size (n=1473) in 1990, the higher sample size in 1992 (n=1967) resulted in a statistically significant difference. This is not surprising, this is just how statistical analysis works: large sample sizes are much more likely than small sample sizes to show statistically significant differences. To highlight this further, look at when the authors broke down their data by age (see Table 4). When broken down by age, no significant differences were found, but when all ages were combined, a statistically significant gender difference was found in 1990 and in 1992 in terms of thrombolytic therapy. This does not indicate that the differences are explained by age, but rather indicates that small sample sizes are less likely to show statistically significant differences compared to large sample sizes. The data does show a difference in rate of thrombolysis that is interesting, with an associated difference in mortality rates. My interpretation of this data is that a higher percentage of men vs women with confirmed infarction received thrombolytic therapy, and a lower percentage of men vs women with confirmed infarction died. Unlike the CCU admission rates which are not very illuminating and do clear show gender or age bias, the rate of thrombolysis suggests a bias towards more aggressive treatment of men with infarction (likely starting with differences in their emergency room care Heston TF, 1992). Furthermore, the data also suggest that thrombolysis works, as a lower in-hospital mortality rate was seen for men vs women. However, mortality was not broken down by whether or not the patient had received thrombolysis, so a meaningful analysis of mortality by gender and thrombolytic therapy is not possible.

On 2013 Jun 13, Karl Broman commented:

The idea is obvious in retrospect, but it wasn't at the time; this paper made a big difference.

On 2017 Aug 31, Santosh Kondekar commented:

I request the authors to comment on the link below: https://www.ncbi.nlm.nih.gov/pubmed/511337#cm511337_73741 Please share your experience if you had come across any accidental single heavy dose of amikacin. Thank you.