2 Matching Annotations
  1. Jul 2018
    1. On 2014 May 07, Conrad Schoch commented:

      The PCR protocols published as Table S1 in this paper has 2 errors:

      The elongation steps of 1.5s at 72 C should all be changed to 1.5 min at 72 C.

      The 2 ITS primers names were in the wrong order. It should be: ITS5: GGAAGTAAAAGTCGTAACAAGG ITS4: TCCTCCGCTTATTGATATGC


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

  2. Feb 2018
    1. On 2014 May 07, Conrad Schoch commented:

      The PCR protocols published as Table S1 in this paper has 2 errors:

      The elongation steps of 1.5s at 72 C should all be changed to 1.5 min at 72 C.

      The 2 ITS primers names were in the wrong order. It should be: ITS5: GGAAGTAAAAGTCGTAACAAGG ITS4: TCCTCCGCTTATTGATATGC


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.