2 Matching Annotations
- Jul 2018
-
europepmc.org europepmc.org
-
On 2014 May 07, Conrad Schoch commented:
The PCR protocols published as Table S1 in this paper has 2 errors:
The elongation steps of 1.5s at 72 C should all be changed to 1.5 min at 72 C.
The 2 ITS primers names were in the wrong order. It should be: ITS5: GGAAGTAAAAGTCGTAACAAGG ITS4: TCCTCCGCTTATTGATATGC
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
- Feb 2018
-
europepmc.org europepmc.org
-
On 2014 May 07, Conrad Schoch commented:
The PCR protocols published as Table S1 in this paper has 2 errors:
The elongation steps of 1.5s at 72 C should all be changed to 1.5 min at 72 C.
The 2 ITS primers names were in the wrong order. It should be: ITS5: GGAAGTAAAAGTCGTAACAAGG ITS4: TCCTCCGCTTATTGATATGC
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-