2 Matching Annotations
- Jul 2018
-
europepmc.org europepmc.org
-
On 2013 Nov 19, Karl Clark commented:
The crhr1 TALEN binding sites in the published manuscript contained sequence errors. The actual DNA sequence of the binding sites are: crhr1-Tal1a (left) GTCAACACTGAGCTCTGTAAACCT crhr1-Tal1b (right) CTGCTGCCGACTGGTCCCTGACCT
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-
- Feb 2018
-
europepmc.org europepmc.org
-
On 2013 Nov 19, Karl Clark commented:
The crhr1 TALEN binding sites in the published manuscript contained sequence errors. The actual DNA sequence of the binding sites are: crhr1-Tal1a (left) GTCAACACTGAGCTCTGTAAACCT crhr1-Tal1b (right) CTGCTGCCGACTGGTCCCTGACCT
This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.
-