2 Matching Annotations
  1. Jul 2018
    1. On 2013 Nov 19, Karl Clark commented:

      The crhr1 TALEN binding sites in the published manuscript contained sequence errors. The actual DNA sequence of the binding sites are: crhr1-Tal1a (left) GTCAACACTGAGCTCTGTAAACCT crhr1-Tal1b (right) CTGCTGCCGACTGGTCCCTGACCT


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

  2. Feb 2018
    1. On 2013 Nov 19, Karl Clark commented:

      The crhr1 TALEN binding sites in the published manuscript contained sequence errors. The actual DNA sequence of the binding sites are: crhr1-Tal1a (left) GTCAACACTGAGCTCTGTAAACCT crhr1-Tal1b (right) CTGCTGCCGACTGGTCCCTGACCT


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.