On 2017 May 26, Kenneth Witwer commented:

This article has now been retracted:

https://www.nature.com/articles/srep46826

The authors also repeated some of their experiments with appropriate methods and reported, "we were unable to confirm specific amplification of these miRNAs in human blood. Thus, we were not able to validate the central hypothesis of this paper."

On 2016 Nov 02, Kenneth Witwer commented:

Following the previous comments, tweets on this subject raise a few more perceived issues:

https://twitter.com/ProfParrott/status/792472109834498049

https://twitter.com/ProfParrott/status/792472735427461120

Importantly, the manufacturer of the qPCR kit used in this study states that it is not for use with plant miRNAs:

http://bit.ly/2f0QWYL

On 2016 Oct 26, Kenneth Witwer commented:

It appears to me that this report includes PCR design errors that may invalidate the findings. In the hopes that I had made a mistake or overlooked something, I consulted with two colleagues at different academic institutions who also came to the conclusion that there are consequential errors in the assay designs. I would encourage the authors and editors to double-check what I say below and take appropriate steps if the observations are correct.

To amplify a mature miRNA, the miScript universal reverse primer used in this study must be paired with a forward primer with identity to part or all of the mature miRNA sequence. A forward primer that is the reverse complement of the mature miRNA would not amplify a specific product. However, all but one of the mature miRNA forward primers reported in the supplement, including the human miR-21 primers, are reverse complementary to the indicated miRNAs (or do not match known miRNAs, e.g., the putative MIR1508, MIR917, and MIR477 primers). Therefore, any signal obtained from these reactions would have been non-specific. The exception is MIR824; however, this miRNA does not appear to have contributed to the conclusions of the article, namely, that plant miRNAs are taken up into human circulation and affect gene expression.

Proof of the PCR design error is supplied by Supplementary Table 5, showing the sequences of PCR products of two reactions (MIR160 and MIR2673) that were cloned into a sequencing vector. Had the reactions amplified actual miScript cDNA, two features of the sequenced product should be evident: 1) mature miRNA sequence and reverse primer sequence would be separated by a poly(A) sequence (or poly(T), depending on the sequenced strand); 2) the mature miRNA sequence would come before (5' to) the poly(A) and reverse primer. In Supplementary Table 5, there is no intervening poly(A) or (T) sequence, and the mature miRNA sequence of both MIR160 and MIR2673 follows the reverse primer. It is thus clear that these sequences are not products of specific amplification of mature miRNA sequences, but rather the result of spurious amplification or cloning of the incorrectly stranded mature miRNA primers and the kit reverse primer.

Incidentally, other, less important PCR primer design and reporting errors are apparent in the supplement. The human ACTB primers do match the ACTB transcript, but are also not ideally specific, as they would amplify sequences on numerous human chromosomes. Also, several primers are designed to the minus genomic strand, not a transcript, and thus seem to have the forward and reverse labels switched.

It should also be noted that, even if the miRNA qPCR assays had been correctly designed, miR2673 is not specific to Brassica or plants, and matches low complexity sequences in organisms from human to yeast. miRBase indexes MIR2673 sequences of Medicago trunculata derived from hairpins designated MIR2673 and MIR2673a that are transcribed from chromosomes 3 and 5. The 22-nt mature sequence for both is CCUCUUCCUCUUCCUCUUCCAC, a low-complexity sequence beginning with three repeats of "CCUCUU". MIR2673 has previously been reported in pineapple (Yusuf NH, 2015), potato (Yang J, 2013), and cucumber (Wen CL, 2016). Additionally, at least one 100% match to the mature MIR2673 sequence is found on every human chromosome...along with many human transcriptome matches of 100% identity for stretches of 20 of 22 consecutive bases. To complicate matters, the curated miRBase miR2673 sequences are not used; instead, the report relies on two predicted 21-nt mature miRNA sequences at the "miRNEST 2.0" site, a site that emphasizes that neither of these putative miRNAs is supported by miRBase.

Quite possibly, transfecting massively non-physiologic amounts of plant miRNA mimics into human cells, as done in Figure 3 of this study and in another cited study (Chin AR, 2016), will elicit effects. However, these effects should not be taken as evidence of physiologic function of xenomiRs, which, assuming they are not contaminants (Tosar JP, 2014, Witwer KW, 2015), appear to reach only subhormonal (zeptomolar to attomolar) levels in human (Witwer KW, 2016).

In sum, I would conclude from these observations that no plant mature miRNA sequences were amplified from human blood, and that there was therefore no basis for the nonphysiologic transfection or gene expression studies.

On 2016 Oct 26, Kenneth Witwer commented:

It appears to me that this report includes PCR design errors that may invalidate the findings. In the hopes that I had made a mistake or overlooked something, I consulted with two colleagues at different academic institutions who also came to the conclusion that there are consequential errors in the assay designs. I would encourage the authors and editors to double-check what I say below and take appropriate steps if the observations are correct.

To amplify a mature miRNA, the miScript universal reverse primer used in this study must be paired with a forward primer with identity to part or all of the mature miRNA sequence. A forward primer that is the reverse complement of the mature miRNA would not amplify a specific product. However, all but one of the mature miRNA forward primers reported in the supplement, including the human miR-21 primers, are reverse complementary to the indicated miRNAs (or do not match known miRNAs, e.g., the putative MIR1508, MIR917, and MIR477 primers). Therefore, any signal obtained from these reactions would have been non-specific. The exception is MIR824; however, this miRNA does not appear to have contributed to the conclusions of the article, namely, that plant miRNAs are taken up into human circulation and affect gene expression.

Proof of the PCR design error is supplied by Supplementary Table 5, showing the sequences of PCR products of two reactions (MIR160 and MIR2673) that were cloned into a sequencing vector. Had the reactions amplified actual miScript cDNA, two features of the sequenced product should be evident: 1) mature miRNA sequence and reverse primer sequence would be separated by a poly(A) sequence (or poly(T), depending on the sequenced strand); 2) the mature miRNA sequence would come before (5' to) the poly(A) and reverse primer. In Supplementary Table 5, there is no intervening poly(A) or (T) sequence, and the mature miRNA sequence of both MIR160 and MIR2673 follows the reverse primer. It is thus clear that these sequences are not products of specific amplification of mature miRNA sequences, but rather the result of spurious amplification or cloning of the incorrectly stranded mature miRNA primers and the kit reverse primer.

Incidentally, other, less important PCR primer design and reporting errors are apparent in the supplement. The human ACTB primers do match the ACTB transcript, but are also not ideally specific, as they would amplify sequences on numerous human chromosomes. Also, several primers are designed to the minus genomic strand, not a transcript, and thus seem to have the forward and reverse labels switched.

It should also be noted that, even if the miRNA qPCR assays had been correctly designed, miR2673 is not specific to Brassica or plants, and matches low complexity sequences in organisms from human to yeast. miRBase indexes MIR2673 sequences of Medicago trunculata derived from hairpins designated MIR2673 and MIR2673a that are transcribed from chromosomes 3 and 5. The 22-nt mature sequence for both is CCUCUUCCUCUUCCUCUUCCAC, a low-complexity sequence beginning with three repeats of "CCUCUU". MIR2673 has previously been reported in pineapple (Yusuf NH, 2015), potato (Yang J, 2013), and cucumber (Wen CL, 2016). Additionally, at least one 100% match to the mature MIR2673 sequence is found on every human chromosome...along with many human transcriptome matches of 100% identity for stretches of 20 of 22 consecutive bases. To complicate matters, the curated miRBase miR2673 sequences are not used; instead, the report relies on two predicted 21-nt mature miRNA sequences at the "miRNEST 2.0" site, a site that emphasizes that neither of these putative miRNAs is supported by miRBase.

Quite possibly, transfecting massively non-physiologic amounts of plant miRNA mimics into human cells, as done in Figure 3 of this study and in another cited study (Chin AR, 2016), will elicit effects. However, these effects should not be taken as evidence of physiologic function of xenomiRs, which, assuming they are not contaminants (Tosar JP, 2014, Witwer KW, 2015), appear to reach only subhormonal (zeptomolar to attomolar) levels in human (Witwer KW, 2016).

In sum, I would conclude from these observations that no plant mature miRNA sequences were amplified from human blood, and that there was therefore no basis for the nonphysiologic transfection or gene expression studies.

On 2016 Nov 02, Kenneth Witwer commented:

Following the previous comments, tweets on this subject raise a few more perceived issues:

https://twitter.com/ProfParrott/status/792472109834498049

https://twitter.com/ProfParrott/status/792472735427461120

Importantly, the manufacturer of the qPCR kit used in this study states that it is not for use with plant miRNAs:

http://bit.ly/2f0QWYL

On 2017 May 26, Kenneth Witwer commented:

This article has now been retracted:

https://www.nature.com/articles/srep46826

The authors also repeated some of their experiments with appropriate methods and reported, "we were unable to confirm specific amplification of these miRNAs in human blood. Thus, we were not able to validate the central hypothesis of this paper."