24,814 Matching Annotations
  1. Feb 2022
    1. SciScore for 10.1101/2022.02.17.22271138: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Thirty-two samples were randomly selected from each plate to measure the library size distribution.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">All SPR experiments were performed twice, and the researchers performing the assay were blinded to sample identity.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were collected on subjects from three groups: 1) those with a prior history of symptomatic SARS-CoV-2 infection (defined as a history positive nasal PCR test and positive Food and Drug Administration (FDA) Emergency Use Authorization (EUA) SARS-CoV-2 antibody test at the time of protocol screening), 2) those with a history of asymptomatic SARS-CoV-2 infection (defined as a positive FDA EUA SARS-CoV-2 antibody test at the time of protocol exam but no history of COVID-like symptoms), and 3) individuals with no history of SARS-CoV-2 infection (defined as a negative FDA EUA SARS-CoV-2 antibody test at the time of the protocol screening).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Influenza microneutralization titers: Virus-neutralizing titers of pre- and post-vaccination sera were determined in a microneutralization assay based on the methods of the pandemic influenza reference laboratories of the Centers for Disease Control and Prevention (CDC) using low pathogenicity vaccine viruses and MDCK cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDCK</div><div>suggested: CLS Cat# 602280/p823_MDCK_(NBL-2, RRID:CVCL_0422)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirions were produced by co-transfection of Lenti-X 293T cells with psPAX2(gag/pol),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: KCB Cat# KCB 200744YJ, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The supernatants were harvested at 48h post transfection and filtered through 0.45-µm membranes and titrated using 293T-ACE2 cells (HEK293T cells that express ACE2 protein).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: KCB Cat# KCB 200744YJ, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the neutralization assay, 50 µL of SARS-CoV-2 S pseudovirions were pre-incubated with an equal volume of varying dilutions of serum at room temperature for 1 h, then virus-antibody mixtures were added to 293T-ACE2 cells in a 96-well plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 pseudovirus production and neutralization assay3–5: Human codon-optimized cDNA encoding SARS-CoV-2 S glycoprotein (NC_045512) was cloned into eukaryotic cell expression vector pcDNA 3.1 between the BamHI and XhoI sites.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA 3.1</div><div>suggested: RRID:Addgene_20407)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirions were produced by co-transfection of Lenti-X 293T cells with psPAX2(gag/pol),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>psPAX2</div><div>suggested: RRID:Addgene_12260)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Surveys were sent via email to the participants and responses were transferred from the REDCap system to the NIH Clinical Research Information Management System (CRIMSON) system by the study team.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div><div style="margin-bottom:8px"><div>NIH Clinical Research Information Management System</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lymphocyte (T cell, B cell, NK cell) flow cytometry quantification was performed using the BD FACSCanto™ II flow cytometer (BD Biosciences, Franklin Lakes, NJ).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD FACSCanto™</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Limitations of this study include most study subjects were younger than 65 and thus these findings may not apply to the elderly, an important population of COVID-19 recoverees. Additionally, our findings are largely associative in nature and the study design does not allow the linking of acute response phenotypes to the long-term imprints in the same individuals. Some of the imprints we considered as stable given lack of association with TSD may still be evolving slowly (or could be limited by statistical power for detecting association with TSD). And while there was no clear difference in disease severity or duration between the COVID-19-recovered males and females in our study (and no subjects were hospitalized), it is possible that our sex-specific findings reflect unappreciated clinical factors. It is possible that some of the post-vaccination reversal towards the healthy, pre-vaccination state by day 28 may also in part be due to ongoing disease resolution. However, this is unlikely the case for the vaccine-induced elevation in the expression of the reset genes towards the healthy state because those changes were clearly detectable on day 1 after vaccination and persisted through day 28, especially in females, indicating that this reversal was driven (or at least accelerated) by vaccination and could not be attributed to the “natural” resolution process alone. While it would be informative to further assess our findings in follow up cohorts, given our observation that va...


      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04025580</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Suspended</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Systems Analyses of the Immune Response to the Seasonal Infl…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 43, 45 and 23. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.19.22271215: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: All studies were approved by the Institutional Review Board of FAH-SYSU and written consent was obtained from all participants.<br>Consent: All studies were approved by the Institutional Review Board of FAH-SYSU and written consent was obtained from all participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All cell lines were passaged less than 15 generations and examined the mycoplasma by PCR and fluorescence labeling methods.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed 5 times by PBST, and incubated with 100 μl/well goat HRP conjugated anti-human IgG antibody (2040-05, SouthernBiotech, 1:3000) in PBST at room temperature for 30 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (SouthernBiotech Cat# 2040-05, RRID:AB_2795644)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Jurkat-Lucia™ NFAT-CD16 Cells (jktl-nfat-cd16, InvivoGen) was cultured in IMDM (BL312A, Biosharp) supplemented with 10% FBS, NEAA, 100 U/ml penicillin and 100 μg/ml streptomycin, 100 μg/ml Zeocin (ST-1450, Beyotime) and 10</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NFAT-CD16</div><div>suggested: RRID:CVCL_A7ZT)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the generation of the B.1.1.529 Omicron-variant spike pseudovirus, pcDNA3.1(+)-Omicron-spike, pSPAX2 and pLenti-CMV-puro-Luc (168w-1) were co-transfected to HEK293T using Lipo8000.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plasmid pcDNA3.1-2019-nCoV-Spike is a gift from Dr. Lu Lu at Fudan University, encoding the spike protein from an ancestral SARS-CoV-2 reference strain (Wuhan-Hu-1) which is called as wild type (WT) throughout the manuscript.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1-2019-nCoV-Spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plasmid pcDNA3.1(+)-Envelope encodes envelope protein from WT was full-genome synthesized by Genewiz China according to the reference sequence NC_045512.2 in NCBI.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids pSPAX2 and pLenti-CMV-Puro-Luc (168w-1) were a gift from Dr. Jianping Guo and purchased from MiaolingBio (P1216), respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSPAX2</div><div>suggested: RRID:Addgene_12260)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate WT SARS-CoV-2-Spike (Wuhan-Hu-1) pseudovirus, pcDNA3.1-2019-nCoV-Spike, pSPAX2 and pLenti-CMV-puro-Luc (168w-1) were co-transfected to HEK293T using Lipo8000 (C0533, Beyotime) according to the manufacturer’s instruction.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLenti-CMV-puro-Luc</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The 50% pseudovirus neutralization titer (PVNT50) was determined by a four-parameter nonlinear regression curve (GraphPad Prism).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analysis was performed using Graphpad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Our study has several limitations. First, the result came from a cohort of young HCWs. The effect of the 4th dose on very young and elderly populations may be different. Second, only a pseudovirus neutralization assay was used in the current study 13. Nevertheless, our neutralization results regarding the ratio of NAb titers between WT and Omicron are in line with results from pseudovirus neutralization assay or authentic virus neutralization assay from other groups 8,16,20. Third, we did not assess other aspects of humoral immune responses such as antibody-dependent cellular cytotoxicity (ADCC) or the cellular arm of immunity. They may contribute to disease prevention even in the absence of NAbs. In conclusion, our study demonstrated that the 4th dose of inactivated SARS-CoV-2 vaccine is safe but the ability to further strengthen the protection against Omicron is compromised by suppression of RBD-NAbs and a further shift of humoral response away from RBD. Updated vaccines based on VOC sequences that take the advantage of RBD, NTD, and other antigenic domains would be an ideal alternative for future boosters.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.17.22270679: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Samples were shipped to the University of Pennsylvania within one week of collection and stored at -80°C until RNA extraction.<br>IRB: For most samples, the University of Pennsylvania Institutional Review Board (IRB) reviewed the research protocol and deemed the limited data elements extracted to be exempt from human subject research per 45 CFR 46.104, category 4 (IRB #848605).<br>Consent: For hospitalized subjects, following informed consent (IRB protocol #823392), patients were sampled by collection of saliva, oropharyngeal and/or nasopharyngeal swabs, or endotracheal aspirates if intubated, as previously described 18.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Chi-squared tests were performed using R Statistical software (v4.0.5)15 (R Core Development Team 2021) to test for differences in proportions of positive deer by gender, age, source of deer (i.e., from volunteer compared to technician collectors as well as between hunter harvested, road-killed, or all other causes of death).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>R Statistical</div><div>suggested: (R Project for Statistical Computing, RRID:SCR_001905)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BWA aligner tool (v0.7.17) was used to align subject sequences to the Wuhan reference sequence (NC_045512.2)19.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA</div><div>suggested: (BWA, RRID:SCR_010910)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samtools package (v1.10) was used to filter alignments20.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mutation Analysis: 108 deer-derived SARS-CoV-2 genomes were downloaded from GISAID and compared with the 7 deer sequenced in this publication and the human dataset.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Mutation Analysis</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IQ-TREE (v1.6.12) was used to infer a tree using maximum-likelihood methods using 1,000 bootstrap replicates27.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IQ-TREE</div><div>suggested: (IQ-TREE, RRID:SCR_017254)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Visualization of the inferred tree was performed using FigTree (v.1.4.4)28.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FigTree</div><div>suggested: (FigTree, RRID:SCR_008515)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.12.22270748: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: One Cohort 2 patient withdrew consent on day 4 and was replaced with a new patient to have a total of 6 patients evaluable for response.<br>IRB: The study protocol was approved by the WCG-Central Institutional Review Board (IRB) (OHRP/FDA Parent Organization number: IORG0000432; OHRP/FDA IRB registration number: IRB00000533).<br>IACUC: The study was approved by the Animal Care and Use Committee of Firat University (Number: 420629).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Thirteen hospitalized adult patients with severe or critical COVID-19, including 8 males and 5 females with a median age of 46 years (Range: 24-72 years) of whom 11 were White (Hispanic or Latino) and 2 were Asian (not Hispanic or Latino) were enrolled in one of the 2 cohorts of the clinical study within 0-11 days (Median: 4 days; Mean ± SE=4.5±1.0) days after initial COVID-19 diagnosis (Table S2).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study Design and Eligibility Criteria: The safety, tolerability, and feasibility of using RJX in combination with clinical standard of care for hospitalized COVID-19 patients were evaluated in an open-label pilot study that was Part 1 of an ongoing double-blind, randomized, Phase 1/2 Study (ClinicalTrials.gov Identifier: NCT04708340).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">As in previous studies, we applied the concealment of treatment allocation and blind outcome assessment to reduce the risk of bias [26].</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">LPS-GalN model of fatal cytokine storm and sepsis: The therapeutic activities of RJX, DEX, and RJX plus DEX were compared side by side in the LPS-GalN model of fatal CRS, sepsis and ARDS using male BALB/c mice, as previously described [26].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis of Non-Clinical Data: Statistical analyses were performed using standard methods and the SPSS statistical program (IBM, SPPS Version 21), as previously reported [26].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT03680105</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Safety and Tolerability Study of RJX Drug Product in Healt…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04708340</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Tolerability and Efficacy of RJX in Patients With COVID-19</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.15.22271010: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Data was collected after permission was obtained.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: SPSS statistical software package version 25.0 (SPSS Inc., Chicago, IL, USA) was used for statistical analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.17.22271080: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Inclusion criteria were: age 16 and over, able to give informed consent, UK-resident, and choosing abortion for reasons other than fetal anomaly.<br>IRB: Ethical approval: Ethical approvals were obtained from the Research Ethics Committees of the British Pregnancy Advisory Service (reference 2021/02/WEL), the London School of Hygiene & Tropical Medicine (reference 22761) and the NHS (reference 21/LO/0236).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Sampling: A purposive sample of 30 women with recent (past 2-8 weeks) experience of abortion were recruited between July and December 2021 from six sites: three independent-sector services commissioned by the NHS (a telemedicine hub in the North of England and in-person clinics in London and South West England); and NHS sites in Scotland, Wales and England (London).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Strengths and limitations: Our study is unique in being the only Britain-wide study examining women’s views on the current COVID-related arrangements and policies for abortion with participants drawn from both independent providers of abortion care and NHS facilities. The methodological approach taken allowed women’s voices to be heard directly, providing access to their priorities and preferences, and so enhancing understanding of the meaning and significance of abortion experience for them. A weakness of this analysis is that it did not include women aged under 20, thereby missing the opportunity to understand specific challenges or benefits in this age group. Further, women volunteering for interview may have occupied more extreme ends of the satisfaction spectrum, introducing a bias towards more positive or more negative views and experiences. Contextualisation and interpretation: The COVID pandemic has been an impediment to sexual and reproductive health services but it has also provided the impetus to new ways of working, an effect described as the ‘COVID-19 silver lining’.(11) In the context of abortion provision it has served to provide what might be seen as a ‘natural experiment’ in which the merits of a new model of care can be observed in the general population. Evaluation of the use of mifepristone as well as misoprostol at home pre-dates the COVID pandemic and is based on earlier experimental and quasi-experimental studies, and those based on selective samples su...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.17.22271030: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.17.22269742: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Patients with suspected or confirmed SARS-CoV-2 infection were approached for informed consent with an aim to recruit within 72 hours of hospital admission.<br>IRB: Study protocols were approved by the Malawi National Health Science Research Committee (NHSRC, 20/02/2518 and 19/08/2246) and Liverpool School of Tropical Medicine Research Ethics Committee (LSTM REC, 20/026 and 19/017).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Clinical data were analysed using Stata V15.1 (StataCorp, Stata Statistical Software:</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Univariable and multivariable logistic regression analyses were fitted using the STATA “logistic” command to generate odds ratios and confidence intervals (data and code available in supplementary materials).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequencing was carried out with the Oxford Nanopore Technologies MinION sequencer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Oxford Nanopore</div><div>suggested: (Oxford Nanopore Technologies, RRID:SCR_003756)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis of SARS-CoV-2 sequencing data: Raw FAST5 data produced by the MinION were processed with Guppy v5.0.7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MinION</div><div>suggested: (MinION, RRID:SCR_017985)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Our study has several limitations. Firstly, we produced a relatively small number of sequences. This was partly due to the limited number of patients recruited into the study during each wave but also because patients frequently presented with Ct values that were too high to produce good quality sequence data. Secondly, our observations are limited to a single centre in the Southern region of Malawi, however they appear to be broadly consistent with the national picture. Finally, we may not be capturing the full diversity of SARS-CoV-2 circulating in the community, as our sampling of hospitalised patients represents a considerable bias towards people with severe disease, and there is likely to be significant under ascertainment nationally (21). This inequity in the availability of clinical and preventative interventions was mirrored by the lack of timely sequencing data available to inform national public health measures and to contribute to international databases. The recent Omicron VOC was first described in South Africa in November 2021 because facilities were available to link clinical and laboratory observations – despite the barriers we faced, at the start of the fourth wave, we were able to confirm the presence of Omicron VOC within 4 weeks of its first detection globally and within three days of the swab being taken.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.19.22271221: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">On January 14, 2022 (to allow ≥45 days of follow-up), we extracted all data of the official vaccination, COVID-19, demographic, hospital and co-pay exemption datasets of the National Healthcare System, merging individual information through encrypted fiscal code 3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>National Healthcare</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.18.22271179: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.


      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      The most important limitation of the present study – in addition to every intrinsic limitation of the screening method itself, especially its particular susceptibility to confounding – is the lack of case-based vaccination data on the receipt of the third those, therefore the inability to control for it. The second most important limitation is the unavailability of vaccine coverage statistics by more specific risk factors that would allow for more stratification of VE. Selection bias (e.g. enhanced testing for COVID-19 among people with underlying chronic conditions), observer bias (e.g. vaccinated cases might be less likely swabbed) or underreporting also cannot be ruled out in the national surveillance data collection. Moreover, potential confounders such as chronic underlying diseases are not reported, so adjusting for them is not possible. To reduce the impact of uncontrolled confounding, we calculated VE in an age-specific manner, as age is correlated with the presence of comorbidities. As for any VE study, results might be influenced by the fact that part of the unvaccinated are protected due to prior infection which is not accounted for. This would result in an underestimation of VE, mitigated by the fact that vaccinated also partly gain protection from prior infection. We had no information on the completeness of linkage between the database on infections and on vaccinations (i.e., how often a missing vaccination data indicates failure to link and not true unvaccinate...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.18.22271199: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: We then converted the copy number to copies/µl based on the VTM volume in which nasal swab specimens were collected.<br>Consent: Study approval: Informed consent was obtained from the participants in the UIUC cohort.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: For each sample, Poisson statistics were used to calculate the total copy numbers of N sgRNA and gRNA (along with 95% CI) using Bio-Rad QuantaSoft Analysis Pro software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bio-Rad QuantaSoft Analysis Pro</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>QuantaSoft</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      There are several limitations to our study. The sensitivity of RNA detection in NP samples may not reflect the presence of RNA in deeper and more sequestered compartments of the body. However, by using ddPCR to improve our sensitivity by at least an order of magnitude, and by quantifying human RNA using housekeeping genes, we have at least addressed sensitivity in clinically relevant specimens. A related limitation, however, is that we did not perform a comprehensive analysis of human RNAs in clinical samples, which may have revealed which cells were infected or contributing to COVID-19 pathology, as has been done previously (28). With regards to viral culture, it is well-appreciated that there are limits to its sensitivity. Indeed, as we speculate above, culture negativity does not reveal whether virions are replication incompetent or are adsorbed to antibodies and thus neutralized in the culture experiment. Unfortunately, samples for antibody testing were not available, but it is possible that antibody testing may have explained why some culture samples were negative despite deriving from NP swabs that had abundant amounts of sgRNA, gRNA, and total viral RNA. Nevertheless, culture negativity does correspond well with when COVID-19 patients are no longer likely to transmit to others, and thus is still a useful tool for research, if challenging to implement for widespread clinical use. In addition, we note here that while there was considerable homogeneity in our findings in ...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.16.22271042: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics approval for the study was obtained from the Clinical Research Ethics Committee of the Ramón y Cajal University Hospital (Ref. 127/21).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      A requirement and limitation of the proposed system is the correct acquisition of the image (acquisition error in the field studies <0.8%). In conclusion, the use of TiraSpot (Figure 1) is a useful tool for reporting, real-time monitoring and quality control, as the results can be reviewed by specialists when needed. This is especially important in contexts where massive testing is to be done and the likelihood of subjectivity and errors in the interpretation of the result is higher. It is also important in the validation of self-diagnostic tests performed by untrained users, as it avoids the loss of information in case it is not notified by the user and provides an efficient system to confirm and report data, which has been a key challenge during the Omicron wave (4).


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.17.22271142: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was deemed non-human subjects research and approved by the Mass General Brigham Institutional Review Board (protocol 2021P003604).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Assays were run in duplicate for each RADT and results were evaluated after a 15 minute incubation period by two independent readers blinded to the variant status and Ct value of the sample.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      The major limitation of our study is the sample size, which limits drawing statistically significant conclusions regarding small differences in test performance. A larger study is warranted to further investigate the differences seen between our RADTs, as even small differences can have a large impact when scaled to the population level. Another limitation is our use of frozen samples in universal transport media rather than direct testing from a patient, but we would not expect there to be a major impact from one to two freeze-thaws on assay performance and the volume of analyte used in each assay was optimized in an earlier study for mimicking real-world performance12. A major strength of this study was the ability to compare three different RADTs using identical clinical samples, which allows for a robust comparison of performance. In summary, the analytic sensitivity versus Omicron remains stable in our head-to-head comparison of three of the most common RADTs in use in the United States. However, there were differences in inter-assay performance that warrant further study. Our findings will provide a degree of assurance that at-home testing should perform as expected compared to prior waves and also sets a baseline for comparison with future SARS-CoV-2 variants.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.17.22269638: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Search strategy: We will search the MEDLINE (PubMed) and APA PsycINFO (via OVID) databases from 1st January 2020 until the search date, inclusive, using search strings that are relevant to the COVID-19 pandemic and MDD and searching within record titles and abstracts.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEDLINE</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Screening & data extraction: All studies will be imported into EndNote reference manager software, after which duplicates will be automatically removed using EndNote’s duplicate identification tool.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EndNote</div><div>suggested: (EndNote, RRID:SCR_014001)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.16.480703: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To test for the association of factor 2 with the co-occurrence of lupus nephritis and anti-dsDNA autoantibodies, we first removed any donor scores for donors that did not have anti-dsDNA autoantibodies present.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-dsDNA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, the trimmed-mean of M values (TMM) method in edgeR (Robinson et al., 2010) is used to adjust library sizes of the pseudobulked counts and the data are normalized and log-transformed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>edgeR</div><div>suggested: (edgeR, RRID:SCR_012802)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">When the CellChat database listed multiple receptor components as required for a specific LR interaction, we required all components of the receptor complex to be expressed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CellChat</div><div>suggested: (CellChat, RRID:SCR_021946)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the B_m1 enrichment tests, we included gene sets from GOBP, KEGG, and Reactome databases.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div><div style="margin-bottom:8px"><div>Reactome</div><div>suggested: (Reactome, RRID:SCR_003485)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GC content from each gene was retrieved using the EDASeq package in R (Risso et al., 2011).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EDASeq</div><div>suggested: (EDASeq, RRID:SCR_006751)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 22. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.18.22270995: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following antibodies were used: Anti-SARS-CoV-2 nucleoprotein (NP) antibody (clone ID: 019, dilution 1:100, rabbit IgG; Sino Biological, Beijing; detection-system: Dako REAL TM EnVision TM HRP rabbit/mouse Dako K5007); CD68 (Ventana anti-CD68 (KP-1) monoclonal mouse 790-2931; detection-system: Ventana Ultra View DAB); TTF1 (Cell marque 343M-96 Clone 8G7G3/1 monoclonal mouse 1:200; detection-system: Dako K5007); TGFß1 (Santacruz polyclonal rabbit AB; clone SC-146 1:50; detection-system: Ventana Ultra View DAB); LAG3 (Abcam polyclonal rabbit; clone ab180187 1:5000; detection-system: Dako K5007); C1q (Dako polyclonal rabbit, clone A0136 1:5000; detection-system: Dako K5007); CD163 (Ventana monoclonal mouse, clone MRQ-26 1:50; detection-system: Ventana Ultra View DAB).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 nucleoprotein (NP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD68</div><div>suggested: (LSBio (LifeSpan Cat# LS-C88159-200, RRID:AB_1792428)</div></div><div style="margin-bottom:8px"><div>KP-1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>AB</div><div>suggested: (Abcam Cat# ab180187, RRID:AB_2888645)</div></div><div style="margin-bottom:8px"><div>LAG3</div><div>suggested: (Abcam Cat# ab180187, RRID:AB_2888645)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, the membranes were incubated with antibodies against C1q (Dako Denmark A/S 1:5000), TGFß1 (Cell Signaling Technology, 1:1000), and GAPDH (Cell Signaling Technology, 1:1000) overnight at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C1q</div><div>suggested: (LSBio (LifeSpan Cat# LS-C20978-5000, RRID:AB_10638452)</div></div><div style="margin-bottom:8px"><div>GAPDH</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Thereafter, membranes were washed and incubated with the appropriate HRP-conjugated secondary antibody (Amersham, ECL Anti-Rabbit IgG, 1:5000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1500 rcf) the supernatants were filtered through a 0.45µm membrane filter (Millipore) and inoculated on Vero CCL-81 cells with OptiPro SFM medium with 4mM L-Glutamine and 1% penicillin-streptomycin in T25 flasks (ThermoFisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero CCL-81</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RNAs from VeroE6 cell cultures were isolated by using the QIAamp Viral RNA Mini Kit (Qiagen) without addition of carrier RNA and transcribed into cDNA with the High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Applied Biosystems) according to manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Amplification data was downloaded and processed using the qpcR package of the R project (https://www.r-project.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.r-project.org/</div><div>suggested: (R Project for Statistical Computing, RRID:SCR_001905)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequences were aligned to the SARS-CoV-2 reference genome (acc. no.: NC_045512.2) using TMAP (v5.10.11) and variants were called with the Torrent Variant Caller (v5.10-12).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TMAP</div><div>suggested: (TMAP, RRID:SCR_000687)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Libraries were pooled in two pools of 13 samples each by concentration measured with Qubit (ThermoFisher), followed by a bead-cleanup step and an additional QC with Qubit (ThermoFisher) and BioAnalyzer (Agilent).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher</div><div>suggested: (ThermoFisher; SL 8; Centrifuge, RRID:SCR_020809)</div></div><div style="margin-bottom:8px"><div>BioAnalyzer</div><div>suggested: (BioAnalyzer 2100, RRID:SCR_019715)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Read counts on plus-/minus-strand were counted using custom python scripts.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Exact positioning of the reads on plus-/minus-strand was done splitting the bam files aligned to NC_045512.2 using samtools -f 0×10 and samtools -F 0×10 (v0.1.19-44428cd) and bedtools genomecov -ibam BAM NC_045512.2 -d (bedtools v2.17.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div><div style="margin-bottom:8px"><div>bedtools</div><div>suggested: (BEDTools, RRID:SCR_006646)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RNA profiling: Gene counts were determined using HTSeq (v0.12.4) and normalized as fragments per kilobase per million (FPKM) after TMM correction.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HTSeq</div><div>suggested: (HTSeq, RRID:SCR_005514)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differential gene expression was conducted using edgeR (https://doi.org/doi:10.18129/B9.bioc.edgeR) [77].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>edgeR</div><div>suggested: (edgeR, RRID:SCR_012802)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Clustering of differentially expressed genes was performed using hclust hierachical clustering and subsequent cutting of the gene tree at R function cutree with h=0.25.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>hclust</div><div>suggested: (HCLUST, RRID:SCR_009154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Microbiome analysis based on RNAseq: Microbiome analysis was performed with the following steps using all reads from STAR alignment not mapping to the human reference: quality filtering using fastx -q 30 -p 26 -Q33 (v0.0.13, http://hannonlab.cshl.edu/fastx_toolkit/), cleaning of the fasta file using seqclean-x86_64 -N -M -A (https://sourceforge.net/projects/seqclean/), realigning to the human reference using blastn against all databases and removal of all reads with 94% similarity.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_004463)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Remaining reads were annotated using MetaPhlAn2 (v2.6.0) [80] and Pathseq (GATK v4.1.0.0) [81] with default settings.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MetaPhlAn2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GATK</div><div>suggested: (GATK, RRID:SCR_001876)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quality control and preprocessing of sequences was performed using FastQC (version 0.7), MultiQC (version 1.7) and trimmomatic (version 0.36.5) using following parameters: LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:200.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FastQC</div><div>suggested: (FastQC, RRID:SCR_014583)</div></div><div style="margin-bottom:8px"><div>MultiQC</div><div>suggested: (MultiQC, RRID:SCR_014982)</div></div><div style="margin-bottom:8px"><div>trimmomatic</div><div>suggested: (Trimmomatic, RRID:SCR_011848)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">16S-based analysis was performed with the latest SILVA 138 taxonomy and the Naive Bayes classifier trained on Silva 138 99% OTUs full-length sequences.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SILVA</div><div>suggested: (SILVA, RRID:SCR_006423)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For ITS-based analysis a classifier was trained on the UNITE reference database (ver8-99-classifier; 04.02.2020) according to John Quensen (http://john-quensen.com/tutorials/training-the-qiime2-classifier-with-unite-its-reference-sequences/; assessed 20/08/2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UNITE</div><div>suggested: (UNITE, RRID:SCR_006518)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For metagenomic biomarker discovery taxonomic feature-tables were introduced to LEfSe (linear discriminant analysis effect size) method (Galaxy version 1.0; p<0.05, LDA>2, All-against-all) [84].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Galaxy</div><div>suggested: (Galaxy, RRID:SCR_006281)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plots were generated with R (version 3.6.2)6 in RStudio (1.1.463)7 using following packages: tidyverse (1.3.0)8, qiime2r (0.99.6)9, ggplot2 (3.3.3)10, dplyr (1.0.6)11 and ggpubr (0.4.0.999)12 and GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RStudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The graphical abstract was created with BioRender (www.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioRender</div><div>suggested: (Biorender, RRID:SCR_018361)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GAPDH was used as loading control to determine protein abundance and band density was quantified and compared by using ImageJ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      The limitations of our descriptive study are that causalities cannot be directly inferred and that the relatively small cohort cannot show the entire picture of severe covid-19 and associated secondary infections. Varying clinical courses and different comorbidities might also have influenced our findings. In addition, treatment of covid-19 has changed since the early pandemic, thus, current severe courses and developing sequels might also have changed. We also cannot be sure whether the two described forms of DAD might represent just a spectrum of pathophysiological states or are specific pathotypes. Moreover, post-mortem effects like RNA degradation might have introduced additional noise in our investigation. Nevertheless, we found autopsy complemented with microbiology and molecular measures as a powerful tool to gain relevant clues about covid-19 pathophysiology. Importantly, there exists an obvious knowledge gap in the understanding of the molecular mechanisms driving the development of secondary infections on top of in viral lung diseases. This should initiate further studies to understand the molecular pathways in more detail and to unravel chronological phases of immuno-suppression which could also lead to development of rational therapies counteracting this sequel not only in covid-19. For these investigations, autopsy specimens and associated molecular data might serve as a valuable resource.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.16.22271033: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The ethics committee of the Istanbul Medipol University approved this study (No: 10840098-604.01.01-E.14713).<br>Consent: Ethics committee waived obtaining informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SPSS (ver. 23)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.16.22270690: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Each interview lasted approximately 45 minutes and was recorded with the verbal consent of the participants.<br>IRB: The thematic axes are summarised in the next table: The study was approved by the specific research ethics committee for COVID-19 of the Institute for Health Technology Assessment and Research of EsSalud (IETSI - EsSalud), on December 19, 2020.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Limitations: The study was conducted with donors who were able to complete the donation process. Therefore, we did not collect testimonies of those who initiated the enrolment and who, for various reasons, either directly related to the requirements of the study or personal nature, did not complete the procedure. Likewise, health personnel involved in convalescent plasma donation were not interviewed.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.18.480994: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animal procedures were performed under the approval of the Institutional Animal Care and Use Committee (DSUA-2021-006-008) of Duksung Women’s University (Seoul, Korea).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Human embryonic kidney cells (HEK293T) is a female human embryonic kidney cell line (ATCC) and the HEK-ACE2 (derived from HEK293T cells) adherent cell line was obtained through BEI Resources, NIAID,</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pathology and immunohistochemistry: For histopathological examination, mouse lung samples harvested at 5 dpi were fixed in 10% formalin neutralization buffer (Sigma Aldrich) and stained with H&E. Additionally, IHC staining was performed to detect the viral antigen with primary antibodies, rabbit SARS-CoV-2 nucleocapsid pAb (40589-T62, Sinobiological, Beijing, China), at a dilution of 1:10,000 and HRP-conjugated secondary antibodies, using the Ventana discovery ULTRA system (Roche, Indianapolis, IN, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 nucleocapsid pAb ( 40589-T62 , Sinobiological , Beijing , China)</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines and animals: Expi293F cells derived from the 293F cell line (Life Technologies, Carlsbad, CA, USA) were grown in Expi293 expression medium (Life Technologies), cultured at 37°C with 8% CO2 and shaking at 150</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293F</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T expressing human angiotensin-converting enzyme 2 (hACE2), HEK293T-hACE2 cell line (NR-52511).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HEK293T-hACE2</div><div>suggested: RRID:CVCL_A7UK)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T and HEK-ACE2 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco, Texas, USA) supplemented with 10% fetal bovine serum (FBS) (Atlas Biologicals, Colorado, USA) and 1% penicillin-streptomycin (P/S) (Hyclone, Waltham, MA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 cells were maintained in DMEM containing 10% FBS, 4.0 mM L-glutamine, 110 mg/L sodium pyruvate, 4.5 g/L D-glucose and 1% antibiotic-antimycotic at 37°C and 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Six-week old female B6.Cg-Tg(K18-ACE2)2Prlmn/J mice were obtained from Jackson Laboratory (Bar Harbor, Maine, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B6.Cg-Tg(K18-ACE2)2Prlmn/J</div><div>suggested: RRID:IMSR_JAX:034860)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fusion proteins, SARS-CoV-2 RBD-SD1 WT-PCNA1-SARS-CoV RBD-SD1, MERS-CoV RBD-SD1-PCNA2-SARS-CoV-2 RBD-SD1 VAR, and hCoV 229E RBD-SD1-PCNA3-hCoV HKU1 RBD-SD1, were constructed with SGG linker sequences by overlapping PCR, which were termed S-PCNA1, M-PCNA2, and H-PCNA3, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 RBD-SD1 WT-PCNA1-SARS-CoV RBD-SD1 , MERS-CoV RBD-SD1-PCNA2-SARS-CoV-2 RBD-SD1 VAR</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>RBD-SD1-PCNA3-hCoV HKU1 RBD-SD1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids encoding each antigen were amplified in E. coli strain DH5α, which were prepared in high purity and concentration using the PureLink HiPure plasmid kit (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DH5α</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse immunizations: Female BALB/c mice aged five weeks old were purchased from Koatech (Pyeongtaek, Kyunggi-do, Korea).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate HEK293T cell line stably expressing hACE2, HEK293T cells were transfected with pCEP4-myc-hACE2 and cells were selected using 100 μg/mL of hygromycin B (Invitrogen, Logan, Utah, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCEP4-myc-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For 6RBD-SD1 proteins, residues from 319 to 592 for SARS-CoV-2 WT and variant (VAR), 306 to 578 for SARS-CoV S, 367 to 657 for MERS-CoV S, 284 to 499 for hCoV 229E S, and 313 to 674 for hCoV HKU1 spike proteins as well as PCNA1, PCNA2, PCNA3_S170V were amplified from the pSecTag2A vector (Addgene) using the primers described in Extended Data Table 2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSecTag2A</div><div>suggested: RRID:Addgene_17839)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All sequences were confirmed by automated sequencing (Macrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Macrogen</div><div>suggested: (Macrogen, RRID:SCR_014454)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The IC50 values were calculated with non-linear regression using GraphPad Prism 8 (GraphPad Software, Inc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.17.480939: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Four antibodies are examined as binding partners: LyCoV016 (10), LyCoV555 (11), REGN10933 (12, 13), REGN10987 (12, 13).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REGN10933</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.17.480845: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sequence was subcloned into pETDuet-1 expression vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pETDuet-1</div><div>suggested: RRID:Addgene_170280)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Restraints were obtained from ligand builder in Coot 19.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis: The final model was analyzed and the graphics was prepared using PyMOL (Schrödinger, LLC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.17.480904: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All virus stocks were confirmed to be mycoplasma-free.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The LRP1 α-chain (515 kDa) and β-chain (85 kDa) were detected using antibodies 8G1 (2µg/mL) (Merck-Millipore) and 5A6 (2µg/mL) (Merck-Millipore) respectively, and a horseradish peroxidase (HRP)-conjugated goat anti-mouse antibody (1:20,000) (Thermo Fisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>α-chain</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The RVFV N was detected by the 10A7 antibody at 1.2ng/µL (kindly provided by A. Brun, INIA, Spain), and a horseradish peroxidase (HRP)-conjugated goat anti-mouse antibody (1:20,000) (Thermo Fisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Brun , INIA , Spain) ,</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV-2 N was detected by the anti-SARS-CoV nucleocapsid antibody (Biomol, ref 200-401-A50), and a horseradish peroxidase (HRP)-conjugated goat anti-rabbit antibody (1:20,000) (Thermo Fisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV nucleocapsid antibody ( Biomol , ref 200-401-A50) ,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Loading controls were performed by using an anti-tubulin antibody (1:4.000) (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-tubulin</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">LACV), Encephalomyocarditis virus strain FA (EMCV), and Vesicular Stomatitis Virus (VSV) were propagated in BHK cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK</div><div>suggested: RRID:CVCL_HA32)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant RVFV (strain ZH548), Severe Acute Respiratory Syndrome Coronavirus 1 (SARS-CoV-1, strain SARS-FRA1), and Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2 strain München-1.2/2020/984) were propagated in Vero E6 cells, the Middle East Respiratory Syndrome virus (MERS-CoV strain EMC2012) in HuH-7 cells, and the Sandfly Sicilian virus (SFSV, strain Sabin) in Vero B4 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Vero B4</div><div>suggested: CCLV Cat# CCLV-RIE 1146, RRID:CVCL_1912)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Only conditions with more than 1,000 acquired events were taken into account for final analysis. siRNA knockdown: A549 or Calu-3 cells were seeded in 6-well plates and reverse-transfected with LRP1 siRNAs Hs_LRP1_1 (SI00036190), Hs_LRP1_2 (SI00036197), Hs_LRP1_3 (SI00036204), and Hs_LRP1_5 (SI03109400) (FlexiTube GeneSolution, Qiagen) using Lipofectamine RNAiMAX reagent (Life Technologies), according to the supplier’s protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A second reverse-transfection was done 2 days later, and the cells seeded in 12-well plates before infection on the following day Generation of CRISPR-hSpCas9 knockout of HuH-7 cells: HuH-7 cells with a knockout in genes of interest were generated using the CRISPR-hSpCas9 strategy from the Zhang lab (30, 31).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HuH-7</div><div>suggested: CLS Cat# 300156/p7178_HuH7, RRID:CVCL_0336)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">incubated in trypsin-EDTA for 10 min (A549, Calu-3) or 3 min (HuH-7) to remove residual attached viral particles, and then washed 3 times in PBS with centrifugations (5 min at 10,000 g).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Raw reads were trimmed to 50 nt and processed as in the NCBI Gene Expression Omnibus entry GSM2227065 (28).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene Expression Omnibus</div><div>suggested: (Gene Expression Omnibus (GEO, RRID:SCR_005012)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In short, reads were aligned to the genome (mm10) with bowtie (v1.2.2) (29).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>bowtie</div><div>suggested: (Bowtie, RRID:SCR_005476)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The initial ratios between GFP and mCherry-labelled cells were confirmed, followed over-time by flow-cytometry (BD FACS LSR Fortessa, with HTS) and analysed with the FlowJo software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.18.481028: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Various SARS-CoV2 mutants such as SARS-CoV2 (K417N), SARS-CoV2 (E484K), SARS-CoV2 (N501Y), SARS-CoV2 (E484Q), SARS-CoV2 (L452R), SARS-CoV2 double-mutant (E484Q and L452R), SARS-CoV2 triple-mutant (K417N, E484K, and N501Y) were introduced in silico through PyMol software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Electrostatic potential of wild-type SARS-CoV2 and its mutants were generated through PyMol software Protein◻Protein</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Protein◻Protein</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04348396</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Clinical and Biological Predictors of COVID-19 Disease in Ol…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04366089</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Oxygen-Ozone as Adjuvant Treatment in Early Control of COVID…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 15. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.17.480826: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The National Institute of Health’s Internal Review Board accepted the study design, and the datasets were anonymised and free of personally identifiable information.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were sequenced for 72 hours using FLO-MIN106 flowcells on MinION MK1b sequencing equipment with high sequence basecalling enabled using MinKNOW (Version 4.2.8, Oxford Nanopore Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MinION</div><div>suggested: (MinION, RRID:SCR_017985)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Read length filtering and reference alignment to the Wuhan-Hu-1 genome were used to test variant polishing in Nanopolish v0.13.2, Medaka v0.11.5, and samtools 1.9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Nanopolish</div><div>suggested: (Nanopolish, RRID:SCR_016157)</div></div><div style="margin-bottom:8px"><div>samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Genomic dataset and Phylogenetic classification: For phylogenetic tree NCBI BLAST search of the study isolates were performed in order to get closely related sequence of SARS-CoV-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For multiple sequence alignment MAFFT software was used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For substitution model prediction jModelTest was used, Maximum Likelihood (ML) phylogenetic tree was build using IQtree (http://www.iqtree.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IQtree</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>http://www.iqtree.org/</div><div>suggested: (IQ-TREE, RRID:SCR_017254)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The tree was edited and visualized using Figtree software (http://tree.bio.ed.ac.uk/software/figtree/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Figtree</div><div>suggested: (FigTree, RRID:SCR_008515)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.17.480819: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: The study participants received a written informed consent letter consistent with the experiment.<br>Field Sample Permit: The collected samples were placed in sample collection vial containing normal saline.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">In this study, 68.0% and 32.0% of the selected people were male and female, respectively, and their mean age was 41.86 (ranged from 22 to 72) years.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The Healthy control subjects were randomly selected and these people did not show any signs and symptoms of respiratory illness.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The good quality reads from COVID-19, Recovered and Healthy samples (n = 22) were analyzed using two different bioinformatics tools: the IDSeq (an open-source cloud-based pipeline to assign taxonomy) [66] and the MG-RAST (release version 4.1) (MR) and both use mapping and assembly-based hybrid method [67].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MG-RAST</div><div>suggested: (MG-RAST, RRID:SCR_004814)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For this pipeline, we employed the ‘‘Best Hit Classification’’ option to determine taxonomic abundance using the NCBI database as a reference with the following set parameters: maximum e-value of 1×10-30; minimum identity of 90% using a minimum alignment length of 20 as the set parameters.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NCBI</div><div>suggested: (NCBI, RRID:SCR_006472)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For these statistical analyses, pairwise non-parametric Wilcoxon test was performed using the Phyloseq and Vegan (package 2.5.1 of R 3.4.2) programs [72].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phyloseq</div><div>suggested: (phyloseq, RRID:SCR_013080)</div></div><div style="margin-bottom:8px"><div>Vegan</div><div>suggested: (vegan, RRID:SCR_011950)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After filtering, 11 taxa remained for which Spearman’s correlation analysis between KEGG pathways and SEED functions pathways was done in Hmisc’s rcorr function [73] and the corrplot function [74] of the corrplot R package as mentioned in the previous section.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In addition, Kruskal-Wallis test was also applied at different KEGG and SEED subsystems levels through IBM SPSS (SPSS, Version 23.0, IBM Corp.,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.18.480872: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.17.480954: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Crystal structures visualization: To highlight inter-positioning of B and CD4 dominant epitopes in 3D structures, above-mentioned PDB files were modified using Pymol (2.3.5).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pymol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Prism software (GraphPad 9.0.1) was used for all statistical analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.17.480940: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.18.481058: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies (anti-Flag-HRP or anti-Human Fc-HRP) were prepared with the same 5% milk at a dilution of 1:1000. 50 μL of secondary antibody was added into each well and incubated at room temperature for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Flag-HRP</div><div>suggested: (Shanghai Genomics Technology Cat# GNI4310-FG, RRID:AB_2885081)</div></div><div style="margin-bottom:8px"><div>anti-Human Fc-HRP </div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VH-Fc ab8, F6-ab8-Fc, and RBD-Fc were expressed with Expi293 cells as previously described[48, 62]</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells (ATCC, cat#CRL-3216) were used to produce pseudotyped retroviral particles as described previously[79].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: ATCC Cat# CRL-3216, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T-ACE2-TMPRSS2 cells (BEI Resources cat# NR-55293) were seeded in 384-well plates at 20 000 cells for neutralization assays.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">One day before the assay, the Vero E6 cells (3 × 105 cells) were seeded in 24-well tissue culture plates per well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Evaluation of F6-ab8-Fc Prophylactic and Therapeutic Efficacy with SARS-CoV-2 mouse Models: Eleven to twelve-month old female immunocompetent BALB/c mice (Envigo, stock# 047) were used for SARS-CoV-2 in vivo Prophylactic and Therapeutic experiments as described previously[51].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus Neutralization Assay: SARS-CoV-2 spike Wuhan-Hu-1 (+D614G), Alpha, Beta, Gamma, Delta, and Omicron protein genes were synthesized and inserted into pcDNA3.1 (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The ELISA results were analyzed using GraphPad Prism 9.0.2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">On-the-fly data pre-processing including patch mode motion correction (EER upsampling factor 1, EER number of fractions 40), patch mode CTF estimation, reference free particle picking, and particle extraction were carried out in cryoSPARC live.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">0.9.3[69], followed by iterative rounds of refinement in COOT and Phenix v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1.1.1[72], and PyMOL (v.2.2 Schrodinger, LLC)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All MD simulations were performed using NAMD (version 2.13)[76] with the protocol adopted from earlier work[77].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NAMD</div><div>suggested: (NAMD, RRID:SCR_014894)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 7. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.15.480592: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Multiple sequence alignment (MSA) was performed using Clustal Omega [26], and the mutations were identified based on the RefSeq Wuhan (wild-type) sequence.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Clustal Omega</div><div>suggested: (Clustal Omega, RRID:SCR_001591)</div></div><div style="margin-bottom:8px"><div>RefSeq</div><div>suggested: (RefSeq, RRID:SCR_003496)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Jalview V.2 [27] was used to visualize the MSA results.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Jalview</div><div>suggested: (Jalview, RRID:SCR_006459)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For antigenic property analysis, amino acid sequences of each of these proteins from each variant were used, and the VaxiJen v2.0 server [32] with the threshold of 0.4 was applied.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VaxiJen</div><div>suggested: (VaxiJen, RRID:SCR_018514)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Identification of immune-associated human proteins that interact with ORF8, M, and N of SARS-CoV-2: The interacting human protein partners of ORF8, M, and N proteins of SARS-CoV-2 as described by Gordon et al. [38] and Enrichr-based Gene set enrichment analysis (GSEA) [39] were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene set enrichment analysis</div><div>suggested: (Gene Set Enrichment Analysis, RRID:SCR_003199)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To investigate the immune-modulating pathway for each of these SARS-CoV-2 proteins, we used the corresponding interacting human proteins in Enrichr.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Enrichr</div><div>suggested: (Enrichr, RRID:SCR_001575)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For human Stomatin (hSTOM) (UniProtKB: P27105), AlphaFold based structure AF-P27105-F1 available in UniProt was used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UniProt</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The 3D models of M and N were obtained by using the RaptorX server [42], followed by the GalaxyRefine server [43].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GalaxyRefine</div><div>suggested: (GalaxyRefine, RRID:SCR_018531)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SAVES v6.0 server (https://saves.mbi.ucla.edu</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAVES</div><div>suggested: (SAVES, RRID:SCR_018219)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The UCSF Chimera X program [47] was used for 3D structure analysis and protein-protein 2D interaction maps were generated using LigPlot+ v.2.2 [48].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>LigPlot+</div><div>suggested: (LigPlot+, RRID:SCR_018249)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We also used the commercial version of Schrödinger Platform (https://www.schrodinger.com) for a second line validation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.schrodinger.com</div><div>suggested: (Schrodinger, RRID:SCR_014879)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.16.22271055: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Diagnoses were primarily by PCR (N=3,424), with a small proportion of samples diagnosed through antigen testing (N=9), or antibody testing (N=6), and 57 samples with a missing diagnosis type.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen testing ( N=9) ,</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">When a study participant is recruited, their entire medical record is linked into the FinnGen database and not just subsequent healthcare provider visits, allowing a detailed understanding of their medical history.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FinnGen</div><div>suggested: (Open Targets Genetics Portal, RRID:SCR_021701)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were genotyped using Illumina and Affymetrix chip arrays (Illumina Inc., San Diego, and Thermo Fisher Scientific, Santa Clara, CA, USA) and imputed to GRCh38/hg38 using Beagle v4.153 with the SISu v3.0 reference panel, consisting of 3,775 whole genome-sequenced Finnish individuals54 (see https://dx.doi.org/10.17504/protocols.io.nmndc5e for the complete imputation and QC protocol).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Beagle</div><div>suggested: (BEAGLE, RRID:SCR_001789)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These GWA analyses were performed using REGENIE55 v2.0.2 and in the model-building step (step 1) were adjusted for age at follow-up end (2019/12/31) or death, sex, genotyping batch and the first 10 genetic principal components.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REGENIE55</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We performed this analysis using the Python module “lifelines” (v0.26.0)56 with Python (v3.8.11 for FinnGen, v3.7.11 for UK Biobank).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      We note the following limitations, welcome feedback from the scientific community and will aim to address some of these issues in future studies in this line of research. First of all, FinnGen endpoints were identified using hospital records only, and consequently results of survival analyses are biased towards more serious cases of the prior (insomnia) endpoint. In comparison, in the UK Biobank diagnoses were captured in hospital and primary care data. It is therefore possible that the differences in hazard ratio we see between the two cohorts represent a) greater statistical power due to more severe insomnia diagnosis, b) a real difference in effect of insomnia on more severe (FinnGen) and less severe (UK Biobank) respiratory infections, c) differences between the cohort demographics or d) a combination of these factors. Confounding this issue is that the UK Biobank suffers from ascertainment bias, resulting in a cohort that is, on average, healthier and less socioeconomically deprived than the general UK population48 and it is likely, though not yet reported, that the FinnGen study also suffers from this bias. The insomnia prevalence that we observed (0.9% in FinnGen and 3.8% in UKB; Supp Table 5) point to low ascertainment in these cohorts compared to estimates of insomnia prevalence (7.9% in the UK49 and up to 11.7% in Finland50). While ascertainment bias has been shown to exaggerate the effects of a prior endpoint on survival time51, it is not currently known how this a...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.17.22271057: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Measurements of anti-SARS-CoV-2 antibody and autoantibodies linked to autoimmune diseases: All collected sera were tested for IgG anti-SARS-CoV-2 antibody using the ZEUS SARS-CoV-2 ELISA Test System according to the manufacturer’s instructions (ZEUS Scientific, New Jersey, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum IgG autoantibodies against nuclear antigen (ANA), extractable nuclear antigen (ENA), double-stranded DNA (dsDNA), actin, mitochondrial M2, and rheumatoid factor (RF) were measured using commercial ELISA kits obtained from INOVA Diagnostics (San Diego, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen ( ANA) , extractable nuclear antigen ( ENA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>dsDNA) , actin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed and the serum samples from healthy controls and the SARS-CoV-2 patients were diluted at 1:50 for the determination of IgA antibody, and 1:100 for the determination of IgG antibody in serum diluent buffer or 1% BSA in PBS containing 0.05% Tween 20 was added to the wells of ELISA plates, which were then incubated for one hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgA</div><div>suggested: (LSBio (LifeSpan Cat# LS-C21944-6, RRID:AB_900131)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differences in autoantibody levels: Box plots showing differences in autoantibodies from COVID-19 patient groups (mild, moderate and severe) and healthy controls were generated using the R version 4.0.5 (The R Project for Statistical Computing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>R Project for Statistical</div><div>suggested: (R Project for Statistical Computing, RRID:SCR_001905)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We trained the random forest model using the functionalities of the R package randomForest (version 4.6.14)65.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>randomForest</div><div>suggested: (RandomForest Package in R, RRID:SCR_015718)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In addition, circle plots of autoantibody correlation were built using the R packages qgraph, ggplot2, psych, inlmisc to visualize the patterns of Spearman’s rank correlation coefficients between autoantibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      There are limitations of our worlk that need consideration. For instance, our study did not have longitudinal data to analyze the pharmacokinetics of the IgG and IgA autoantibodies, from disease onset to convalescence or post-acute COVID-19 syndrome. Our study cohort did not include asymptomatic patients. Moreover, we cannot exclude the possibility that at least some of our patients had high levels of autoantibodies prior to SARS-CoV-2 infection, or that autoantibodies to some antigens (e.g., heparin) could have been induced by anticoagulant therapy with heparin. In addition, we did not assess alterations in the number of circulating B lymphocytes and whether this could explain the higher serum levels of autoantibodies. In addition, future studies are required to clarify the role of virus and host genetics in the production of autoantibodies. On the other hand, our work raises new questions such as whether the dysregulated levels of autoantibodies remain after COVID-19 remission and these levels are in patients with post-COVID-19 syndrome. Taken together, our work provides a comprehensive view of the spectrum of autoantibodies linked with autoimmune diseases that are induced by SARS-CoV-2 infection. This work maps the intersection of COVID-19 and autoimmunity93–95, demonstrating the dysregulation of multiple autoantibodies that are linked to autoimmune diseases during SARS-CoV-2 infections, and the altered correlation signatures according to disease severity and anosmia. The ...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.17.22271126: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.16.480801: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The separated proteins were transferred onto the PVDF membrane and probed using mouse anti-Flavivirus envelope 4G2 primary antibody and anti-mouse-HRP conjugated secondary antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Flavivirus envelope 4G2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For IFA, Anti-mouse Influenza virus NP (HT103) was used as the primary antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 (Invitrogen, A11001) was used as the secondary antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Mouse IgG</div><div>suggested: (Thermo Fisher Scientific Cat# A-11001, RRID:AB_2534069)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibody incubation for western blot was done with Anti-mouse Influenza virus NP (HT103) and secondary antibody with Goat Anti-Mouse IgG - H&L Polyclonal Antibody, HRP conjugated (Abcam, ab6789).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HT103</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibodies used for IFA include SARS-CoV-2 spike primary antibody (GTX632604, GeneTex) and goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GTX632604</div><div>suggested: (GeneTex Cat# GTX632604, RRID:AB_2864418)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After a 15 min chase, cells were fixed with 4% PFA, labeled with anti-influenza virus HA antibody (PY102) followed by anti-mouse Alexa 488 secondary antibody to label the virus particles.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-influenza virus HA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression levels of VP1 protein were detected by western blot using monoclonal mouse anti-enterovirus primary antibody Clone 5-D8/1 (Dako, M7064,) and anti-mouse antibody-HRP (Sigma Aldrich, A4416)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-enterovirus</div><div>suggested: (Agilent Cat# M7064, RRID:AB_2118128)</div></div><div style="margin-bottom:8px"><div>M7064</div><div>suggested: (Agilent Cat# M7064, RRID:AB_2118128)</div></div><div style="margin-bottom:8px"><div>anti-mouse antibody-HRP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A4416</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 12hr, cells were fixed with 4% formalin and immunolabeled with primary mouse anti VP6, and anti-mouse secondary Alexa Fluor 488 antibodies to detect virus-infected cells by IFA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti VP6,</div><div>suggested: (Acris Antibodies Cat# AM10217SU-N, RRID:AB_11216263)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DMEM containing 2% FBS was used for infection in Vero E6 cells and complete DMEM was used for HEK293T-ACE2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6, Calu-3, and HEK293T-ACE2 cells were seeded in 24-well cell culture dishes to reach 80% confluency post 24hr.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IAV plaque assay: MDCK cells were seeded in 12-well plates to reach complete confluency after 24hr.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDCK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flavivirus infection: Confluent A549 cells in a 24-well cell culture plate were pre-treated for 3hr with 2 mM PA and infected with 100 µL per well DMEM containing 0.1 MOI JEV clinical strain P20778 or ZIKV Cambodia.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Influenza polymerase Assay: HEK293293T cells were seeded in a poly-L-lysine (Sigma Aldrich, P915</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293T cells were seeded in 2 X T75 flasks to reach 50-60% confluency the next day.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infection with AAV6 particles: HEK293 293T cells were seeded in a poly-L-lysine coated 24-well dish to reach 60-70% confluency the next day.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Adenovirus 5 infection: For infection studies, HEK293 cells were pre-treated for 3hr with 2mM PA and infected with 10 MOI AAV5-eGFP in the presence of the drug.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The infectious RNA was transfected in HeLa cells and the cell culture supernatant was harvested after 48hr.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plaque assay: Vero E6 cells were seeded in a 12-well plate at a confluency of approximately 90% and infected with serially diluted CVB3-containing cell culture supernatant and incubated at 37℃ for 1hr with gentle swirling of the medium at every 10-15 min interval.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For each flask, the following plasmids were transfected using Lipofectamine 2000 transfection reagent (Invitrogen, 11668019) as per manufacturer instructions: 17.7 μg pAdDeltaF6(Addgene 112867), 7.9 μg pRepCap6 (Addgene 110770), and 5.9 μg pAAV-CAG-GFP (Addgene 37825).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pAdDeltaF6</div><div>suggested: RRID:Addgene_112867)</div></div><div style="margin-bottom:8px"><div>pRepCap6</div><div>suggested: RRID:Addgene_110770)</div></div><div style="margin-bottom:8px"><div>pAAV-CAG-GFP</div><div>suggested: RRID:Addgene_37825)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, pCB3/T7 DNA was linearized using SalI-HF enzyme (R3138S, NEB) and CVB3 RNA was produced by in vitro transcription reaction.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCB3/T7</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The fluorescence intensity of Tf-647 labeled vesicles was then measured along this distance using ImageJ/Fiji.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ/Fiji</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The number of GFP positive cells was analyzed using a Cytoflex (Beckman Coulter) flow cytometer and results were analyzed using CytExpert software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CytExpert</div><div>suggested: (CytExpert Software, RRID:SCR_017217)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 54, 55, 56, 57 and 60. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.16.480759: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Once the nucleotide sequences were translated into protein, Jalview, Clustal Omega and Blast (https://blast.ncbi.nlm.nih.gov/Blast.cgi)28,42,43 were used to perform multiple alignments to compare the various sequences to the reference sequence of the SARS-CoV-2 virus (QHR63290.2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Jalview</div><div>suggested: (Jalview, RRID:SCR_006459)</div></div><div style="margin-bottom:8px"><div>Clustal Omega</div><div>suggested: (Clustal Omega, RRID:SCR_001591)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Molecular Graphics System (PyMOL) Version 1.80 LLC</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      The main limitation of this study is that the B cell epitopes prediction tools we used does not predict conformational epitopes. As well as the case of S protein, immunodominant epitopes have also been reported for SARS-CoV-2 M and N proteins. In patients with severe disease treated at the Intensive Care Unit (ICU), it has been found high IgG titers specific to S protein linear B cell epitopes TESNKKFLPFQQFGRDIA, PSKPSKRSFIEDLLFNK and N protein epitope NNAAIVLQLPQGTTLPKG59. Additionally, the N protein epitope mentioned above, has been associated with lymphopenia in patients with COVID-1989. These S and N epitopes have a low mutation rate (<2%) and could be used as markers for COVID-19 induced immunopathology89. Even though neutralizing antibody responses are involved in protection against COVID-19 induced by SARS-CoV-2 infection or vaccination, T cell immune responses have been identified as an extremely important component of immunity against COVID-19. A study in patients with mild and severe COVID-19 showed the presence of effector and central memory SARS-CoV-2-specific T cells, in particular, mild cases generated higher frequencies of cytokine-producing CD8+ T cells90. Strong memory-specific T cell responses to SARS-CoV-2 have also been detected in individuals who had mild and asymptomatic infections, in some cases in the absence of antibody responses91. Another study reported T cell responses specific to SARS-CoV-2 peptide stimulation in pre-pandemic samples, which sugges...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 29. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.17.480751: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Animal protection studies were carried out under the animal permit PROEX-146.6/20, approved by the Community of Madrid (Spain), and performed in biosafety level 3 facilities at CISA-INIA (Madrid).<br>Euthanasia Agents: Antibody injection, with challenge virus and euthanasia were performed under isoflurane anesthesia.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Both female and male H2L2 mice were used.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">During the evaluation, the pathologist was blinded regarding the treatment groups and used virus strains.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Cell lines tested negative for mycoplasma.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antigen specific antibody titres were monitored during immunization by taking blood samples from the mice and performing antigen-specific ELISA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific ELISA .</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene blocks encoding the variable heavy (VH) and light (VL) chain sequences of 87G7 and of benchmark monoclonal antibodies REGN10933, REGN10987 (PDB ID: 6XDG) (43), S309 (PDB ID: 6WPS) (44), CR3022 (GenBank accession numbers: DQ168569.1 and DQ168570.1) (45), 47D11 (GenBank accession numbers: MW881223.1 and MW881224.1) (41) were synthesized.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 8 h of infection, the cells were fixed with formalin, permeabilized with 70% ethanol, washed in PBS and stained using rabbit anti-SARS-CoV nucleocapsid (SinoBiological, 1:2000 in 0.1% bovine serum albumin (BSA) in PBS) followed by goat anti-rabbit Alexa Fluor 488 antibody (Invitrogen, 1:2000 in 0.1% BSA in PBS).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV nucleocapsid</div><div>suggested: (Creative Diagnostics Cat# DMAB8869, RRID:AB_2392503)</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">87G7 or a non-SARS-CoV-2 human IgG control antibody were injected intraperitoneally in a volume of 500 µl.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In this case, after 5 day incubation, cells were fixed with 4% PFA and stained using an anti-SARS-CoV-2 nucleocapsid antibody (Sinobiological).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 nucleocapsid antibody (Sinobiological).</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant human antibodies were expressed in HEK-293T cells following transient transfection with pairs of the IgG1 heavy and light chain expression plasmids.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In the virus neutralization assay, 3-fold serially diluted mAbs were pre-incubated with an equal volume of virus at RT for 1 h, and then inoculated on VeroE6 cells, and further incubated at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Omicron samples were titrated in Calu-3 cells due to the low infectivity of Omicron in Vero cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: BCRJ Cat# 0264, RRID:CVCL_0609)</div></div><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse challenge experiment: In vivo prophylactic and therapeutic efficacy of mAb 87G7 against challenge with SARS-CoV-2 and four variants of concern, was evaluated in heterozygous K18-hACE2 C57BL/6J mice (strain: 2B6.Cg-Tg(K18-ACE2)2Prlmn/J) obtained from The Jackson Laboratory.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: RRID:MGI:3589388)</div></div><div style="margin-bottom:8px"><div>2B6.Cg-Tg(K18-ACE2)2Prlmn/J</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All proteins were expressed transiently in HEK-293T (ATCC® CRL-11268™) cells from pCAGGS expression plasmids, and secreted proteins were purified from culture supernatants using streptactin beads (IBA) following the manufacturer’s protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_127347)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VH and VL sequences were separately cloned into the expression plasmids with human IgG1 heavy chain and human kappa chain constant regions, respectively using the HBM vectors pHBM 000254 (VH into pTT5-mIGK-hIgG1_HCv2) and HBM 000265 (VK into pTT5mIgK-hIgG_KCv2)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pTT5-mIGK-hIgG1_HCv2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pTT5mIgK-hIgG_KCv2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed using ImageQuantTL 8.2 image analysis software (GE Healthcare).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageQuantTL</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The PRNT titer was calculated using Graphpad Prism 9, calculating a 50% reduction in infected cells counts based on non-linear regression with bottom constraints of 0% and top constraints of 100%.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Particles were imported into Relion 3.1 and, using the “relion_particle_symmetry_expand” tool, each particle from the C3-symmetry–imposed reconstruction was assigned three orientations corresponding to its symmetry related views.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Relion</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Iterative rounds of manual fitting in Coot and real space refinement in Phenix (57) were carried out to improve non-ideal rotamers, bond angles and Ramachandran outliers.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">During refinement with Phenix, secondary structure and non-crystallographic symmetry restraints were imposed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phenix</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The final model was validated with MolProbity (58), EMRinger (59) and Privateer (glycans) (60, 61).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MolProbity</div><div>suggested: (MolProbity, RRID:SCR_014226)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 35. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.10.479891: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">n. 5.2.4 Implementation using differentiable programming: Our Python software implementation uses automatic differentiation in order to efficiently optimize the variational objective function (Kucukelbir et al., 2017; Bradbury et al., 2018).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.17.479764: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of HEK293T cells with stable expression of human ACE-2: HEK293T cells were transduced with a lentiviral vector (pHAGE2-EF1aInt-ACE-2-WT) that expresses human ACE-2 under an EF1a promoter.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of (SARS-CoV-2) S protein Pseudotyped Lentivirus: PVs were prepared by co-transfecting 293T cells with plasmids for (1) lentiviral backbone containing fluorescent reporter (pHAGE2-CMV-ZsGreen-W), (2) HIV virion formation proteins under CMV promoters (HDM-Hgpm2, pRC-CMV-Rev1b, and HDM-tat1b; and (3) viral entry proteins SARS-CoV-2 S protein (WT, D614G mutant) or VSV G as a positive control for infectivity.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 cells were maintained in EMEM (with EBSS and L-glutamine, BioWhittaker, Lonza) supplemented with 20% FBS (heat-inactivated, Gibco), 0.1 mM MEM non-essential amino acids (Gibco), and 10 mM HEPES (Gibco) at pH 7.4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE-2 HEK 293T cells were cultured in DMEM + GlutaMax™-I medium (Gibco) supplemented with 10% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE-2 HEK 293T</div><div>suggested: RRID:CVCL_A7UK)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids for lentiviral backbone expressing fluorescent reporter under CMV promoter (pHAGE2-CMV-ZsGreen-W) or human ACE-2 gene (GenBank ID NM_021804) under an EF1a promoter (pHAGE2-EF1aInt-ACE-2-WT) were obtained from BEI resources as NR-52520 and NR52512, respectively [35].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHAGE2-EF1aInt-ACE-2-WT</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The envelope vector expressing VSV-G (vesicular stomatitis virus glycoprotein) was obtained from Cell Biolabs (pCMV-VSV-G, Part No. RV-110).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VSV-G</div><div>suggested: RRID:Addgene_138479)</div></div><div style="margin-bottom:8px"><div>pCMV-VSV-G</div><div>suggested: RRID:Addgene_8454)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of (SARS-CoV-2) S protein Pseudotyped Lentivirus: PVs were prepared by co-transfecting 293T cells with plasmids for (1) lentiviral backbone containing fluorescent reporter (pHAGE2-CMV-ZsGreen-W), (2) HIV virion formation proteins under CMV promoters (HDM-Hgpm2, pRC-CMV-Rev1b, and HDM-tat1b; and (3) viral entry proteins SARS-CoV-2 S protein (WT, D614G mutant) or VSV G as a positive control for infectivity.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHAGE2-CMV-ZsGreen-W</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pRC-CMV-Rev1b</div><div>suggested: RRID:Addgene_164443)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The ZsGreen expression area was quantified and normalized to the cell area estimated from the DRAQ5 staining using a custom ImageJ script.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical differences were analyzed using GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.17.22271099: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      The slow reporting of SARS-CoV-2 seroprevalence studies overall emphasizes limitations in their relevance for public health action. The landscape of infection and immunity can change drastically in the median 154 days from the end of sampling to results release, particularly in an era of rapidly spreading SARS-CoV-2 variants and mass vaccination.18 Notably, some of the results from these studies are made available to public health agencies directly before being released publicly — for example, many studies of blood donors and residual sera in Canada. While this improves the ability of the agency in question to act on the data, the closed sharing of results hinders interpretation and action by other stakeholders. Firstly, public health agencies who the data has not been shared with (e.g., federal authorities, for studies done at a state/province level), which limits the coordination between levels of government that is crucial in a pandemic setting.19 Secondly, academic research groups, who have done secondary analysis and modeling that has generated key information during the pandemic.20 Finally, global synthesis and comparison initiatives: where this has been carried out for seroprevalence, these delays have caused limitations in the synthesis that can be done.3 We show that peer-reviewed manuscripts are released particularly slowly, with a median time-to-publication of about seven months. While many medical journals have expedited publication processes for COVID-19 research...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.17.22271116: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the Ethics Committees of the Friuli Venezia Giulia Region (CEUR-OS156) and University Hospital of Cagliari (PG 2021/7118).<br>Consent: Informed consent was obtained for telephone interviews.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      This study has the following limitations. First, hospitalized patients were not included in the study. Although this made our cohort more homogeneous, studies evaluating the impact of chemosensory dysfunction in more severe Omicron driven COVID-19 are needed. Symptoms were self-reported and based on telephone interview. Although we tried to perform a comprehensive symptoms assessment, some symptoms may have been undetected. Furthermore, a more precise evaluation of the chemosensory function by psychophysical assessment was lacking. Another limitation may be the heterogeneity in the vaccine status across participants. Some of them having one dose of vaccine, while other completed the 3 doses at different times before the conduction of the study. Ultimately, patient inclusion in the proxy omicron period was based on epidemiological data from small samples sequenced regionally. We are therefore unable to estimate to what extent the sample is contaminated by non-Omicron cases. However, to reduce this bias, we decided to limit the analysis to cases of SARS-CoV-2 infection diagnosed after January 17, 2022 when the Omicron variant was estimated to be above 95%.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.17.480851: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was part of an ongoing study and was reviewed by the Institutional Review Board (0278-18-HMO).<br>Consent: All the participants provided written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Eligible participants were both male and female adults prior to or after receiving the BNT162b2 vaccine.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sandwich ELISA for total IgG or IgA: MAXISORB 96 wells plates were coated ON with secondary anti-IgG or anti-IgA antibodies, blocked as for direct ELISA and incubated for 30 min with sera and saliva samples, serially diluted in blocking buffer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>total IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IgA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: Vero E6 and HEK293T cell lines were obtained from the American Type Culture Collection (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: KCB Cat# KCB 200744YJ, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 and 293T cells were grown in DMEM medium supplemented with 10% (v/v</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">P0 generation was produced according to the original Michael Whitt(Whitt, 2010) protocol with minor modification, using co-transfection of the 5 plasmids (pVSV-ΔG-GFP, pBS-N-Tϕ, pBS-P-Tϕ, pBS-L-Tϕ and pBS-G) into HEK293 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Constructs and plasmids: The following plasmids were used for VSV-pseudovirus production: pVSV-ΔG-GFP, pCAGGS-G or pBS-N-Tϕ, pBS-P-Tϕ, pBS-L-Tϕ and pBS-G(Whitt, 2010).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pVSV-ΔG-GFP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCAGGS-G</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pBS-L-Tϕ</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pBS-G(Whitt</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plasmids for expression of the Receptor Binding Domain of SARS-CoV2 spike (RBD) and full-length spike (SARS-CoV-2 S (Δ19 aa) were cloned into the pcDNA3.4 backbone (Thermo).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.4</div><div>suggested: RRID:Addgene_131198)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">P0 generation was produced according to the original Michael Whitt(Whitt, 2010) protocol with minor modification, using co-transfection of the 5 plasmids (pVSV-ΔG-GFP, pBS-N-Tϕ, pBS-P-Tϕ, pBS-L-Tϕ and pBS-G) into HEK293 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBS-N-Tϕ</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pBS-P-Tϕ</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pBS-G</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">P1 generation of VSV-G pseudotyped VSVdeltaG-GFP particles was generated by transfection of pCAGGS-VSV(G), followed by infection with P0 particles.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS-VSV(G</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The images were captured from several fields of each well and the green cells were calculated by using automated image analysis by ImageJ (NIH).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The graphs were plotted to get the 50% neutralization titer (NT50), in GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.15.480603: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The applied procedures were approved by the Local Ethical Committee of the UP MS (Certificate No. 8549-PTE2020).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">During the experimental procedure we used a Hungarian SARS-CoV-2 isolate (isolated on Vero E6 cells, GISAID accession ID: EPI_ISL_483637).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.14.22270925: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The primary outcome of the workshop was a causal DAG (in the GeNIe BN software) that a high proportion of experts agreed captured the most important underlying pathophysiological processes. 6.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GeNIe</div><div>suggested: (GENIE, RRID:SCR_009197)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Limitations of our models: While there are still unknowns and competing hypotheses in the literature, the differences are not profound enough to require presentation as competing DAGs; our list of issues is sufficient to indicate which structural components would differ. Some disagreements only concern the degree of impact of alternative pathways, which corresponds to differing numerical parameterizations of the BNs, and no parameterizations are included here. Both our BNs do not include important background factors such as age, comorbidities and vaccination status, that strongly influence the probability of more serious COVID-19 outcomes (and each other). Knowledge about their role in the COVID-19 process was too limited: although they are known to directly influence some of our variables (e.g., vaccination reduces the chance of initial infection), not all of their direct influences are clear (e.g., vaccination also decreases the chance of infection developing into severe COVID-19, probably by influencing multiple variables along these pathways). Fortunately, these theoretical models are useful and valid without them. According to our experts’ assessment, the distinctive COVID-19 causal structure depicted is unlikely to change for any particular specification of background factors. Rather, such factors will affect the parameters, e.g., how strongly some variables influence others. When adequate data is available to adjust these parameters depending on background factors, the...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.15.480166: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells: 293T, ACE2.293T and Vero cells were grown in Dulbecco’s Modified Eagle’s Medium with 10% fetal bovine serum at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 spike proteins lentiviral pseudotypes: SARS-CoV-2 spike protein pseudotyped lentivirus stocks were produced by cotransfection of 293T cells with pMDL Gag/Pol vector, plenti.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: KCB Cat# KCB 200744YJ, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids: The SARS-CoV-2 spike expression vector (Omicron BA.2) was generated by overlap extension PCR with the two fragments amplified with external primers containing a Kpn-I and Xho-I sites and cloned into pcDNA6.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA6</div><div>suggested: RRID:Addgene_134280)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike expression vectors with the individual mutations of the Omicron BA.2 RBD were generated by overlap PCR mutagenesis using the D614G spike expression vector pcCOV2.Δ19.D614G as a template.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcCOV2.Δ19.D614G</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 spike proteins lentiviral pseudotypes: SARS-CoV-2 spike protein pseudotyped lentivirus stocks were produced by cotransfection of 293T cells with pMDL Gag/Pol vector, plenti.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMDL Gag/Pol</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed using GraphPad Prism 8 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses of the structures of the SARS-CoV-2 spike protein with antibody Fabs was performed with the PyMOL Molecular Graphics System, v2.1.1 (Schrödinger, LLC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.16.22271068: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In September 2021, we searched PubMed, Google and Google Scholar to assess if each preprint had been published in a peer-reviewed journal, using the title and the first author in the search string.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div><div style="margin-bottom:8px"><div>Google</div><div>suggested: (Google, RRID:SCR_017097)</div></div><div style="margin-bottom:8px"><div>Google Scholar</div><div>suggested: (Google Scholar, RRID:SCR_008878)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.16.22270842: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Briefly, following informed consent, in-patients with PCR-confirmed COVID-19 infection within the last 14 days, were recruited at the University Hospital of Wales, the Royal Glamorgan Hospital and Betsi Cadwalader University Health Board in Wales UK.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Clinical study design: A four-arm, randomised controlled trial was conducted to study the effectiveness of anti-microbial mouthwashes in vivo.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Clinical and research staff involved in sample collection and laboratory analysis were blinded as to which product was which.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Original sample size was calculated based on reported mouthwash activity against enveloped herpes virus; designed with a >80% power to detect a 2-fold reduction in viral load(58).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies were all diluted in blocking buffer, and were rabbit anti-actin (A2066, Sigma-aldrich 1:2,000) and mouse anti-SARS-CoV2 Spike (Clone 1A9, Insight; 1:2,000), as well as anti-mouse HRP or anti-rabbit HRP (GE Healthcare; 1:2,000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-actin</div><div>suggested: (Sigma-Aldrich Cat# A2066, RRID:AB_476693)</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse HRP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit HRP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and viruses: Virucidal assays utilised VeroE6 or A549 cells, a gift from the University of Glasgow/MRC Centre for Virology, UK.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The England2 strain of SARS-CoV2 was provided by Public Health England, and amplified in VeroE6 cells before being harvested from the supernatant.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus was titrated by plaque assay; serial dilutions were used to infect VeroE6/ACE2/TMPRSS2 cells for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6/ACE2/TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Harvest of virus particles and lipid extraction for lipidomics profiling: Cells were infected with SARS-CoV2 at MOI=0.01, when cells were 70% confluent, in either serum-free media (Vero cells) or at 2% FCS (A549).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Prior to feature analysis the data was processed using the Waters compression tool to reduce the noise, changed to centroid using MassLynx and converted to .</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MassLynx</div><div>suggested: (MassLynx , RRID:SCR_014271)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MZxml by the MSconvert module in Proteowizard.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Proteowizard</div><div>suggested: (ProteoWizard, RRID:SCR_012056)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Feature analysis was carried out using the HPLC/QTOF parameters in XCMS online(37).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>XCMS</div><div>suggested: (XCMS, RRID:SCR_015538)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The two resulting feature lists (positive and negative) were further processed using the Python program LipidFinder 2.0 in its default configuration(36).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div><div style="margin-bottom:8px"><div>LipidFinder</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Membranes were washed, incubated with secondary antibody for 1 h at room temperature, washed, developed with Supersignal West Pico (Thermo), and imaged using a G:Box Chemi XX6 (Syngene).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo</div><div>suggested: (Thermo Xcalibur, RRID:SCR_014593)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies were all diluted in blocking buffer, and were rabbit anti-actin (A2066, Sigma-aldrich 1:2,000) and mouse anti-SARS-CoV2 Spike (Clone 1A9, Insight; 1:2,000), as well as anti-mouse HRP or anti-rabbit HRP (GE Healthcare; 1:2,000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GE Healthcare</div><div>suggested: (GE Healthcare, RRID:SCR_000004)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      As a caveat of the method, membrane proteins or sugars could in theory hinder derivatisation of aPL, and so this value may be a lower-level estimate. In primary cells, energy-dependent processes maintain asymmetry of plasma membranes. This ensures that very low mol% of PE and PS are exposed on the surface, for example, only 3 - 4 % is present on platelets following thrombin activation (40). This is because PE and PS promote coagulation, complement binding and uptake of apoptotic cells through their electronegative interactions with Ca2+ ions and various proteins (3, 20, 40). Although the overall amounts of PS appear to be rather low in virions, PE levels are similar to plasma membrane (Table 1). Thus, exposure of 50 % of aPL on the surface will result in levels of external PE that are around 12-fold-higher than activated platelets(40). Indeed, in line with this, we found that purified virions significantly accelerate plasma coagulation in vitro (Figure 4 B). In addition, a recent study showed (using a less specific ELISA) that levels of PS on the surface of SARS-CoV2 are sufficient to support PS-receptor dependent viral entry (17). Our work extends this significantly by reporting on the ng amounts of PS and PE present, the proportions of PE and PS that are externalised, and the specific molecular species of PE and PS in the membrane. In addition to SARS-CoV2, PS has been implicated in the cellular uptake of several other viruses, thus knowing how much and which molecular spec...


      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">ISRCTN25647404</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.16.480524: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.17.22270551: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the Washington University Institutional Review Board (IRB#202004146).<br>Consent: Individuals meeting inclusion criteria were sent an electronic consent form; consenting participants were asked to complete a survey including demographic and clinical information.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Scores are classified into the five clinical categories of normosmia (≥34 for males and ≥35 for females), mild hyposmia (30-33 for males and 31-34 for females), moderate hyposmia (26-29 for males and 26-30 for females), severe hyposmia (19-25), and anosmia (≤18).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">18,19 REDCap is a secure, web-based application designed to support data capture for research studies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was performed using SPSS (version 28).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      However, as a caveat, there is no strong evidence supporting the efficacy for most proposed interventions, including oral and intranasal corticosteroids, alpha-lipoic acid, and caroverine.24,25 Although we identified a similar inflection point at month two, participants in our cohort had some, albeit slower, rates of recovery beyond this timepoint. This disparity in findings is most likely attributable to baseline differences in the two study cohorts. The authors studied a cohort of patients in whom 47% had anosmia (complete loss of smell) on chemosensory testing at baseline, as compared to 14% in our cohort. We also found that patients with anosmia and severe hyposmia experienced an early plateau in recovery. This study has the strength of incorporating both validated objective and subjective measures of olfaction. Moreover, participants were identified within two weeks of initial COVID-19 infection, allowing us to accurately capture the initial and six-month recovery of COVID-19 olfactory loss. We collected intermediate measurements at regular intervals each month for six months allowing us to establish the trajectory of improvement over time. Limitations of this study include the potential for ascertainment bias. Participants who subjectively recovered their sense of smell may have felt less inclined to complete the following month’s olfactory assessment and subsequently be censored in the analysis. Another limitation is the absence of measures of parosmia and phantosmia, ...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.15.22271016: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: The study was conducted in accordance with the STROBE guidelines for observational research (13), and received ethics approval from the Research Ethics Board at the University of Toronto.<br>IRB: The study was conducted in accordance with the STROBE guidelines for observational research (13), and received ethics approval from the Research Ethics Board at the University of Toronto.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      As with that earlier work, an important limitation here is the inability to ensure that the effects we observe are not at least in part due to residual confounding. This is a potential limitation of any cohort study; and is one that will be the focus of future work. The relatively recent emergence of the Omicron variant, and the lags associated with critical illness and death, results in the lack of statistical power to estimate Omicron-specific protections as noted above. Unfortunately, ongoing high rates of SARS-CoV-2 hospitalizations, critical illnesses, and deaths in Ontario mean that we will be able to address this potential limitation in the months ahead. In summary, we identified a decrease in the risk of ICU admission and death in hospitalized, vaccinated individuals compared to hospitalized, unvaccinated individuals, matched for infection timing, in Ontario, Canada. Our analysis further emphasizes the critical importance of high rates of vaccination for protection of community health and reducing the impacts of SARS-CoV-2 on ICU capacity during the pandemic.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.17.22271122: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Each patient provided signed written informed consent for the use of their blood-derived products for future research.<br>IRB: The study was approved according to the ethical standards of the institutional research committee – the Ethics Committee of the Motol University Hospital in Prague (EK-346/21), and performed in compliance with the 1964 Helsinki declaration and its later amendments or comparable ethical standards.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Determination of the serum levels of anti-SARS-CoV-2 antibodies: The patients’ sera were analyzed for the presence of anti-SARS-CoV-2 antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-SARS-CoV-2-spike glycoprotein receptor-binding domain (RBD) IgA and IgG antibodies were determined using IVD EIA COVID-19 RBD IgA or IgG (TestLine Clinical Diagnostics, Brno, Czech Republic).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2-spike glycoprotein receptor-binding domain (RBD) IgA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG antibodies</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-SARS-CoV-2 nucleocapsid protein (NCP) IgG antibodies were determined using CLIA COVID-19 NP IgG (TestLine Clinical Diagnostics).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 nucleocapsid protein (NCP) IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the stimulation, the cells were stained with fixable live/dead stain, fixed, permeabilized, and stained with fluorescent-tagged CD3-, CD4-, CD8-, IFN-γ-, and TNF-α-specific antibodies as described (40).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD8-</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IFN-γ-</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>TNF-α-specific</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FlowJo software (Tree Star, Ashland, OR) was used to analyze the acquired flow cytometry data.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: The values were calculated from the indicated sample size (n) using GraphPad Prism 6 (GraphPad Software, La Jolla, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.16.22271093: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.16.22271096: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Assay’s Sensitivity in Detecting SARS-CoV-2 Wuhan/WH01/2019 and B.1.1.529: The partial N gene sequences of SARS-CoV-2 Wuhan/WH01/2019 (wild-type) and B.1.1.529 (Omicron) were generated and cloned into pUC57 at EcoRV/BamHI site (Genscript Biotech Corporation).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pUC57</div><div>suggested: RRID:Addgene_40306)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: The statistical analysis was conducted with a statistics computer software, GraphPad Prism 9.3.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.14.22270109: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT05226546</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Effectiveness and Safety of Platelet Rich Plasma (PRP) on Pe…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.15.22270954: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Clinical samples: This cross-sectional, observational study was approved by the Institutional Ethics Committee of the National Institute of Genomic Medicine (INMEGEN) (CEI / 1479/20 and CEI 2020/21).<br>Consent: After signing the informed consent, nasopharyngeal swab samples were collected from 984 patients and collected in a 15 ml conical tube with 3 ml of sterile viral transport medium (VTM).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Other statistical analyzes were performed using GraphPad Prism 7.0 software and IBM SPSS Statistics version 24.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      This is why it’s important to underline that “bad but cheap” tests can be diagnostically useful, assuming that the tests’ limitations are carefully evaluated (70, 71). In our study, however, the specificity of RT-LAMP was 98.9% for the S1 oligonucleotide set and 97.1 % for the S3 oligonucleotide set, indicating that the test is an excellent method for detecting SARS-CoV-2 despite the presence of other interfering molecules isolated during RNA extraction from nasopharyngeal swab samples. Furthermore, based on the positive and negative predictive value of our data, the RT-LAMP assay could be used for massive COVID-19 screening. As a consequence, the strong positive predictive value (99.1 % for set S1 and 97.6 % for set S3, respectively) indicates that patients who have a positive RT-LAMP test actually have the condition; whereas the negative predictive value for both oligonucleotide sets was modest, this suggests that even if the test was negative, there is still a risk of infection. As a result, we suggest that using a ROC curve analysis to directly compare the cost/benefit of the RT-LAMP assay and other diagnostic procedures is appropriate for making diagnostic decisions. Although, other study describes greater sensitivity results for the RT-LAMP assay (20 RNA copies per reaction), comparable to RT-qPCR test (72). In this regard, we suggest that the small number of samples and the design of primers based on only 130 fully aligned SARS-CoV-2 genomes are important limiting fact...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.15.22271001: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Secondary attack rates from routinely-collected contact tracing data are likely to be lower bounds due to limitations of data completeness and quality caused by variation in testing behaviour and engagement with contact tracing. Our assessment of impact of vaccine dosing on risk of transmission did not consider the timing of the vaccinations received, and as such, we could not distinguish the effect of multiple doses from recency of the vaccination. Conclusion: In summary, our study identified increased risk of transmission from Omicron compared to Delta, in part explained by an attenuated impact of vaccination on reducing transmission for Omicron compared to Delta. As such, Omicron’s worldwide success may be more attributable to immune escape and a milder symptom profile than increased infectivity. Our findings underscore the value of assessing growth advantage of new variants as they emerge to inform potential public health interventions such as the roll-out of the booster vaccinations and other non-pharmaceutical public health interventions.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.15.480585: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.14.22270937: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Sample environment included the following: i) the geographical location (i.e., country and city where the study was performed); ii) sampling location within a wastewater system (i.e., samples were taken from the sewage collection systems, at the wastewater treatment plant after screens and before sedimentation, or at the primary sedimentation tank); iii) sample processing prior to viral concentration (whether a sample was filtrated, centrifuged or left untreated); iv) viral concentration method; v) the associated COVID case incidence or prevalence as provided in the publication; vi) serviced population as provided in the publication, and vii) the date of collection of each wastewater sample.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.16.22269810: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We then identified Single Nucleotide Polymorphisms (SNPs) and insertions/deletions (Indels) from BAM files using samtools (v1.13, (Danecek et al. 2021)) and VarScan (v2.4.4, P < 0.05, all other settings default, (Koboldt et al. 2012)) on 100,000 sequencing reads with an alignment score > 10.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div><div style="margin-bottom:8px"><div>VarScan</div><div>suggested: (VARSCAN, RRID:SCR_006849)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1.4.1717 (RStudio Team 2021) and R version 4.1.1 (R Core Team 2021) for all statistical analyses and ggplot2 (Wickham 2016) for visualisations.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      The software developers have acknowledged this limitation, and the design of primers to create appropriate co-occurrence amplicons for relevant sequencing schemes is suggested as a workaround (Jahn et al. 2021). It is important to note that even in cases where co-occurrence analysis is applicable, our fine-scale local data highlighted that wastewater monitoring sometimes detects new variants earlier than clinical testing, but not always. The reasons for this are yet unclear. It is likely that the inherent variability of wastewater detections, due to variations in viral shedding rates and dilution from rainfall, etc (Polo et al. 2020)), and the increasing stochasticity of clinical detection with decreasing population size play a role. Certainly the relationships between population size, wastewater flow variation and SARS-CoV-2 variant detection warrant further investigation. This mixed pattern of wastewater Alpha detections preceding confirmed clinical cases in some parts of Liverpool, yet vice versa in others, highlights the complementarity of the approaches. Wastewater monitoring has the notable advantages of being more cost-effective per unit of population and is less biased by testing frequencies in different communities (Polo et al. 2020), while sequencing of clinical samples provides greater specificity and the opportunity for contact tracing. Indeed, our finding that Alpha was detected in wastewater in North Liverpool much earlier than clinical cases had indicated, corr...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.15.480527: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Withdrawal of blood samples from healthy humans and cell isolation were conducted with approval of the local ethics committee (Ethical review committee of Charité Berlin, votes EA4/166/19 and EA4/167/19).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Cell lines were routinely monitored for absence of mycoplasma and paramyxovirus simian virus 5.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human ACE2 was detected using a polyclonal goat anti-human ACE2 antibody (1:500, R&D Systems), a horseradish peroxidase (HRP)-labeled donkey anti-goat antibody (1:5000, Dinova) and Super Signal West Femto Chemiluminescence Substrate (Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-goat</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As a loading control, samples were analyzed for ꞵ-Actin expression using a mouse anti-ꞵ-actin antibody (1:5000, Sigma Aldrich) and a HRP-labeled goat anti-mouse antibody (1:10000, Dianova).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ꞵ-actin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were multiplexed using TotalSeq-A Antibodies purchased from BioLegend (A0256, A0258 and A0259)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TotalSeq-A</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A0256</div><div>suggested: (ABclonal Cat# A0256, RRID:AB_2757069)</div></div><div style="margin-bottom:8px"><div>A0259</div><div>suggested: (ABclonal Cat# A0259, RRID:AB_2757072)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow Cytometry Analysis: PBS-washed cells were PFA-fixed and immunostained for individual surface protein expression using the following antibodies: Anti-CD3-FITC (#561807; BD Biosciences), anti-CD4-APC (#555349; BD Biosciences), anti-CD14-PE (#561707; BD Biosciences), anti-CD19-FITC (#21270193; ImmunoTools), anti-NRP1/CD304-APC-R700 (#566038, BD Biosciences), anti-PD-1/CD279-PE (#21272794; ImmunoTools) and anti-TIM-3/CD366-FITC (#345022; Biolegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-CD3-FITC</div><div>suggested: (Sigma-Aldrich Cat# F0522, RRID:AB_476959)</div></div><div style="margin-bottom:8px"><div>anti-CD4-APC</div><div>suggested: (Sigma-Aldrich Cat# SAB4700557, RRID:AB_10896237)</div></div><div style="margin-bottom:8px"><div>anti-CD14-PE</div><div>suggested: (Sigma-Aldrich Cat# SAB4700101, RRID:AB_10897597)</div></div><div style="margin-bottom:8px"><div>anti-CD19-FITC</div><div>suggested: (Sigma-Aldrich Cat# SAB4700112, RRID:AB_10896899)</div></div><div style="margin-bottom:8px"><div>anti-NRP1/CD304-APC-R700</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-PD-1/CD279-PE</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-TIM-3/CD366-FITC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To determine ACE2 cell surface expression, cells were immunostained with a goat anti-human ACE2 antibody (#AF933, R&D Systems) followed by immunostaining with a secondary antibody donkey anti-goat Alexa Fluor 488 (#A-11055, Thermo Fisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell Lines and Primary Cells: Vero E6 (ATCC CRL-1586) cells, Calu-3 (ATCC HTB-55) cells and HEK293T (ATCC CRL-3216) cells were cultivated in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% heat-inactivated fetal calf serum, 1% non-essential amino acids (Thermo Fisher Scientific) and 1% sodium pyruvate (Thermo Fisher Scientific) in a 5% CO2 atmosphere at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: ATCC Cat# HTB-55, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus was grown on Vero E6 cells and concentrated using Vivaspin® 20 concentrators with a size exclusion of 100 kDa (Sartorius Stedim Biotech) in order to remove cytokines of lower molecular weight, including IFNs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells inoculated with culture supernatants from uninfected Vero cells mixed with OptiPro serum-free medium supplemented with 0.5% gelatine and PBS, served as mock-infected controls.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2-positive HEK293T cells were generated by transduction of cells with retroviral vectors generated by transfection of HEK293T cells with MLV gag-pol (Bartosch, Dubuisson, and Cosset 2003), pCX4bsrACE2 (Kamitani et al. 2006) and pVSV-G (Stewart et al. 2003).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2-positive HEK293T cells were generated by transduction of cells with retroviral vectors generated by transfection of HEK293T cells with MLV gag-pol (Bartosch, Dubuisson, and Cosset 2003), pCX4bsrACE2 (Kamitani et al. 2006) and pVSV-G (Stewart et al. 2003).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCX4bsrACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pVSV-G</div><div>suggested: RRID:Addgene_138479)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis was performed using LightCycler Software 4.1 (Roche).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>LightCycler</div><div>suggested: (LightCycler Software, RRID:SCR_012155)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein concentration was determined with the Thermo Scientific’s Pierce™</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo Scientific’s</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quality control of the libraries were performed with the KAPA Library Quantification Kit and Agilent TapeStation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Agilent TapeStation</div><div>suggested: (Agilent TapeStation Laptop, RRID:SCR_019547)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(10X Genomics) and further analysed using the Seurat v3.1.4 package (Butler et al. 2018) in R v3.6 (https://www.r-project.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Seurat</div><div>suggested: (SEURAT, RRID:SCR_007322)</div></div><div style="margin-bottom:8px"><div>https://www.r-project.org/</div><div>suggested: (R Project for Statistical Computing, RRID:SCR_001905)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical significance was calculated by performing Student’s t-test using GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.14.22270965: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: We obtained informed written consent from the survey participants and ethical clearance from the ethical review committee of the Dhaka Medical College. (ERC.DMC-ECC/2021/399) Participants: We recruited physicians of all ranks and both gender who had worked or are working in the Dhaka Medical College Hospital, COVID-19 unit.<br>IRB: We obtained informed written consent from the survey participants and ethical clearance from the ethical review committee of the Dhaka Medical College. (ERC.DMC-ECC/2021/399) Participants: We recruited physicians of all ranks and both gender who had worked or are working in the Dhaka Medical College Hospital, COVID-19 unit.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: We analyzed the data using IBM SPSS Statistics for Windows, version 20.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We analyzed hospital admission trends and positivity rates in the Excel datasheet.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      This study had several limitations. It was done in a single-center, so it is not representative of the scenario of the whole country. It was a retrograde study, so there might have been some recall bias. The hospital admission and the test capacity are bed or slot limited. So, the hospital admission rate and the number of tests in different surges might not be the actual representation of the nation’s scenario. A multi-center study is required to get a representative picture.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.13.22270901: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.15.480546: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Since there was no antibody-hCoV229E spike protein complex in the training set of ScanNet, we used all the 55 networks trained for antibody binding site prediction (including the 11 used elsewhere that were not trained on SARS-CoV-1/2 data).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-hCoV229E</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plate was washed by the washing buffer to remove the unbound hACE2. 1:5,000 diluted Pierce™ High Sensitivity NeutrAvidin™-HRP (Thermo Fisher cat# 31030) or 1:7,500 diluted T7-tag polyclonal antibody-HRP (Thermo Fisher, cat# PA1-31449) were incubated with the plate for 1 hr at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-HRP</div><div>suggested: (Thermo Fisher Scientific Cat# PA1-31449, RRID:AB_1960906)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudotyped SARS-CoV-2 neutralization assay: The 293T-hsACE2 stable cell line (Integral Molecular, cat# C-HA101, Lot# TA060720MC) and pseudotyped SARS-CoV-2 (Wuhan-Hu-1 strain D614G and Omicron) particles with luciferase reporters were purchased from the Integral Molecular.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-hsACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The isotonic regression fit was performed using scikit-learn (sklearn.isotonic.IsotonicRegression, default parameters)32. Mice: 8 weeks old female C57BL/6 mice were ordered from The Jackson Laboratory and housed in pathogen-free conditions at the core animal facility at the University of Pittsburgh Medical Center with the approval from the University of Pittsburgh Institutional Animal Care and Use Committee.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Construction of the MSA: Homologs of the WT RBD were first searched in the UniprotKB using BLAST.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UniprotKB</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The isotonic regression fit was performed using scikit-learn (sklearn.isotonic.IsotonicRegression, default parameters)32. Mice: 8 weeks old female C57BL/6 mice were ordered from The Jackson Laboratory and housed in pathogen-free conditions at the core animal facility at the University of Pittsburgh Medical Center with the approval from the University of Pittsburgh Institutional Animal Care and Use Committee.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>scikit-learn</div><div>suggested: (scikit-learn, RRID:SCR_002577)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The raw data were processed by Prism 9 (GraphPad) to fit into a 4PL curve and to calculate IC50/logIC50.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.14.22270940: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">For computational efficiency, we included all individuals who died of any cause during the analysis period and a random sample (selected by simple random sampling without replacement) of those who did not, with sampling rates of 1% for the White British ethnic group and 10% for every other ethnic group; case weights equal to the inverse probability of selection were included in the analysis, following previously published methods [3].</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Strengths and limitations: The main strength of our study derives from using the ONS Public Health Data Asset, a nationwide large-scale population-wide data source combining the 2011 Census, mortality records, the General Practice Extraction Service (GPES) Data for Pandemic Planning and Research (GDPPR), Hospital Episode Statistics (HES) and vaccination data from the National Immunisation Management System (NIMS). Unlike studies based only on electronic health records, our study relies on self-identified ethnicity, limiting the potential for exposure misclassification bias. The PHDA also contains both detailed socio-demographic characteristics, such as household composition, housing quality, and occupational exposure, and extensive information on pre-pandemic health based on primary care and hospital records. To our knowledge, our study is the first to use nationally representative population-based linked data to examine the association between ethnicity and COVID-19 mortality in the third wave of the pandemic and explore the role of differences in vaccination uptake as a potential additional explanatory factor for the differences in COVID-19 mortality. The main limitation is that most socio-demographic characteristics included in our models reflect the situations of individuals as they were in 2011, not necessarily those at the start of the COVID-19 pandemic. To mitigate this, we excluded people aged less than 30 years old, whose circumstances are the most likely to have cha...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.14.480394: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants provided written informed consent before participation in the study and the study was conducted in accordance with Good Clinical Practice.<br>IRB: The study was performed in compliance with all relevant ethical regulations and the protocol (DRO-1006) for studies with human participants was approved by the Institutional Review Board of the Rockefeller University.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed 6 times with washing buffer and then incubated with anti-human IgG, IgM or IgA secondary antibody conjugated to horseradish peroxidase (HRP) (Jackson Immuno Research</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The half-maximal neutralization titers for plasma (NT50) or half-maximal and 90% inhibitory concentrations for monoclonal antibodies (IC50 and IC90) were determined using four-parameter nonlinear regression (least squares regression method without weighting; constraints: top=1, bottom=0) (GraphPad Prism).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IC90</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The enriched B cells were incubated in Flourescence-Activated Cell-sorting (FACS) buffer (1× PBS, 2% FCS, 1 mM ethylenediaminetetraacetic acid (EDTA)) with the following anti-human antibodies (all at 1:200 dilution): anti-CD20-PECy7 (BD Biosciences, 335793), anti-CD3-APC-eFluro 780 (Invitrogen, 47-0037-41)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD20-PECy7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD3-APC-eFluro 780</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For B cell phenotype analysis, in addition to above antibodies, B cells were also stained with following anti-human antibodies (all at 1:200 dilution): anti-IgD-BV650 (BD, 740594), anti-CD27-BV786 (BD biosciences, 563327), anti-CD19-BV605 (Biolegend, 302244), anti-CD71-PerCP-Cy5.5 (Biolegend, 334114), anti-IgG-PECF594 (BD, 562538), anti-IgM-AF700 (Biolegend, 314538), anti-IgA-Viogreen (Miltenyi Biotec, 130-113-481)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human</div><div>suggested: (Abnova Cat# H00007360-A01, RRID:AB_563327)</div></div><div style="margin-bottom:8px"><div>anti-IgD-BV650</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD27-BV786</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD19-BV605</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD71-PerCP-Cy5.5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IgM-AF700 ( Biolegend , 314538) , anti-IgA-Viogreen ( Miltenyi Biotec , 130-113-481)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The frequency distributions of human V genes in anti-SARS-CoV-2 antibodies from this study was compared to 131,284,220 IgH and IgL sequences generated by41 and downloaded from cAb-Rep42, a database of human shared BCR clonotypes available at https://cab-rep.c2b2.columbia.edu/.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T (CRL-11268) cells were obtained from ATCC, and the cells were transfected with pNL4-3ΔEnv-nanoluc and pSARS-CoV-2-SΔ19, particles were harvested 48 hours post-transfection, filtered and stored at −80°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: ATCC Cat# CRL-11268, RRID:CVCL_1926)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T (CRL-11268) cells were obtained from ATCC, and the cells were transfected with pNL4-3ΔEnv-nanoluc and pSARS-CoV-2-SΔ19, particles were harvested 48 hours post-transfection, filtered and stored at −80°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNL4-3ΔEnv-nanoluc</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pSARS-CoV-2-SΔ19</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The average of its signal was used for normalization of all the other values on the same plate with Excel software before calculating the area under the curve using Prism V9.1(GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For monoclonal antibodies, the ELISA half-maximal concentration (EC50) was determined using four-parameter nonlinear regression (GraphPad Prism V9.1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">3,000 units/ml RNasin Ribonuclease Inhibitors (Promega, N2615) per well using a FACS Aria III and FACSDiva software (Becton Dickinson) for acquisition and FlowJo for analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FACSDiva</div><div>suggested: (BD FACSDiva Software, RRID:SCR_001456)</div></div><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For B cell phenotype analysis, in addition to above antibodies, B cells were also stained with following anti-human antibodies (all at 1:200 dilution): anti-IgD-BV650 (BD, 740594), anti-CD27-BV786 (BD biosciences, 563327), anti-CD19-BV605 (Biolegend, 302244), anti-CD71-PerCP-Cy5.5 (Biolegend, 334114), anti-IgG-PECF594 (BD, 562538), anti-IgM-AF700 (Biolegend, 314538), anti-IgA-Viogreen (Miltenyi Biotec, 130-113-481)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Biolegend , 314538) , anti-IgA-Viogreen ( Miltenyi Biotec</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Miltenyi</div><div>suggested: (Miltenyi Biotec, RRID:SCR_008984)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence analysis was performed using MacVector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MacVector</div><div>suggested: (MacVector, RRID:SCR_015700)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.15.22270931: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">YF will check for accuracy and completeness through random double-extraction of 10% of included studies.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">: Cochrane CENTRAL, MEDLINE, Embase and PsycInfowill be searched for from 2019 to the present.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cochrane CENTRAL</div><div>suggested: (Cochrane Central Register of Controlled Trials, RRID:SCR_006576)</div></div><div style="margin-bottom:8px"><div>MEDLINE</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div><div style="margin-bottom:8px"><div>Embase</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.14.22270845: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics statement: Human sera were obtained from the COVIDsortium Healthcare Workers bioresource [(8–10, 12, 13)] which is approved by the ethical committee of UK National Research Ethics Service (20/SC/0149) and registered on ClinicalTrials.gov (NCT04318314).<br>Consent: The study conformed to the principles of the Helsinki Declaration, and all subjects gave written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">This included 25 HCW (mean age 44yr, 60% male) with previous laboratory defined evidence of WT SARS-CoV-2 infection and twenty-six HCW (mean age 41y, 54% male) with no laboratory evidence of SARS-CoV-2 infection throughout the initial 16-week longitudinal follow up.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody ratios >1.1 were considered test positive for the EUROIMMUN SARS-CoV-2 ELISA and >1 was considered test positive for the ROCHE Elecsys anti-SARS-CoV-2 ECLIA following Public Health England evaluation (8–11, 31) The previously reported13,14 cross-sectional, case-controlled vaccine sub-study (n=51) collected samples at a mean/median timepoint of 22d and 20d after administration of the first and second dose of the mRNA vaccine, BNT162b2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VeroE6 cells were seeded in 96-well plates 24h prior to infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Ethics statement: Human sera were obtained from the COVIDsortium Healthcare Workers bioresource [(8–10, 12, 13)] which is approved by the ethical committee of UK National Research Ethics Service (20/SC/0149) and registered on ClinicalTrials.gov (NCT04318314).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COVIDsortium Healthcare</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Raw LC-MS/MS data was analysed using Skyline open source software (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Skyline</div><div>suggested: (Skyline, RRID:SCR_014080)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Exported data were analysed using Microsoft Excel and Graphpad Prism v9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      One of the limitations with our assay is that we are not able to determine functional complement activation, although precise quantitative detection may be able to funnel further investigation. Our approach using multiplex LC-MS/MS could provide a valuable platform to better enable research in this area. Whilst the LC-MS/MS multiplex assay is a research standard assay, it was designed so it can be easily translated for use in a clinical laboratory setting (7). Simply, by changing the bait to a VoC spike protein, our test can be easily modified to determine antibody mediated immune response for current and emerging VoC. The information obtained will allow us to understand in greater detail an individual’s antibody protection or be used in vaccine design. Furthermore this ‘Bait, Capture and Mass Spec’ approach, can also have applications beyond SAR-CoV-2 for other infectious diseases, or even immune response to novel treatments and autoimmunity.


      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04318314</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">COVID-19: Healthcare Worker Bioresource: Immune Protection a…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.13.22270913: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study design and setting: The “efficacy of Lactococcus lactis strain PLasmA To EAse symptoms in patients with coronavirUs disease 2019 (PLATEAU) study: a multicenter, double-blinded, randomized placebo-controlled trial” was initiated in December 2021 following approval by the Clinical Research Review Board of Nagasaki University in November, 2021 (approval number: CRB20-027).<br>Consent: As shown in Figure 1, eligible patients will be asked to participate in this study, and informed consent will be obtained prior to registration/randomization.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study design and setting: The “efficacy of Lactococcus lactis strain PLasmA To EAse symptoms in patients with coronavirUs disease 2019 (PLATEAU) study: a multicenter, double-blinded, randomized placebo-controlled trial” was initiated in December 2021 following approval by the Clinical Research Review Board of Nagasaki University in November, 2021 (approval number: CRB20-027).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">All parties are blinded, including investigators, participants, the manufacturer of test capsules, core laboratories, and biostatisticians.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Sample size calculation: The severity score was used in a case series study to estimate the patients’ subjective symptoms.[21] When the total severity score from this previous study was translated using a calculation method mentioned in the outcomes section of the present study, the total score on days 0 and 14 was 11 ± 5.3 and 1.7 ± 2.3, respectively, and the change from day 0 to day 14 was –9.3 ± 6.0.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subjects who meet any of the following exclusion criteria will be excluded from participation: 1) obese (body mass index (BMI) ≥30 kg/m2), 2) subjects with strong dyspnea, chest pain, or hemosputum, 3) previous history of COVID-19, 4) being treated or planning to be treated with neutralizing antibody drugs for SARS-CoV-2, 5) being treated with immunosuppressive agents, antirheumatic agents, corticosteroids, or immunoglobulin preparations, 6) subjects administered oral intestinal regulators, 7) taking one or more beverage or food containing LC-Plasma or yogurt that contains Lactobacillus delbrueckii subsp. bulgaricus daily, 8) who are pregnant, possibly pregnant, or breastfeeding, 9) participating in other clinical trials, 10) requiring legal representation for giving consent, or 11) with other conditions that the responsible investigator or sub-investigators deem inappropriate for study participation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BMI ) ≥30 kg/m2) , 2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The observation items are as follows: 1) subjects’ background characteristics (sex, height, weight, BMI, presence or absence of onset of COVID-19, estimated infection day, onset day of COVID-19 if symptomatic, SARS-CoV-2 vaccination status (timing, number of vaccinations, vaccine type, last day of vaccination), 2) Severity of COVID-19 assessed by severity classification according to COVID-19 infectious disease treatment guidelines published by the Ministry of Health, Labor and Welfare in Japan [20] (mild: SpO2 ≥ 96%, no respiratory symptoms or only coughing without dyspnea, and without pneumonia findings, moderate I: 93% < SpO2 < 96%, with dyspnea, and with pneumonia findings, moderate II: SpO2 ≤ 93% and oxygen administration required, and severe: admission to intensive care unit or ventilator required), 3) Blood Test 1 (differential count of leukocytes (neutrophil, lymphocyte, eosinophil, monocyte, and basophil), platelet, aspartate aminotransferase, alanine aminotransferase, gamma-glutamyl transpeptidase, blood urea nitrogen, serum creatinine, lactate dehydrogenase, C-reactive protein, ferritin, and HbA1c), 4) Blood Test 2 (pDCs activation markers (human leukocyte antigen DR and CD86), cytokines (interleukin-6 and monocyte chemoattractant protein-1), SARS-CoV-2 specific antibodies (immunoglobulin M and G), expression of interferon and interferon-inducible antiviral effector genes in PBMC, and immune cell analysis (T cells and B cells), 4) real-time polymerase chain reaction test for SARS-CoV-2 by nasopharyngeal swabs, 5) medication information, 6) vital signs (body temperature, pulse, SpO2, and frequency of breath), 7) adherence of test capsules, 8) patients’ subjective symptoms measured by the severity score [21]</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>lactate dehydrogenase , C-reactive protein , ferritin ,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD86</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>interleukin-6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary endpoints are as follows: 1) change or percent change in viral load of SARS-CoV-2, 2) change or percent change in biomarkers for pDC activation (HLA-DR, CD86), 3) change or percent change in SARS-CoV-2-specific antibodies (immunoglobulin G and M), 4) change or percent change in blood cytokines (IL-6, MCP-1), 5) change or percent change in IFN-or IFN-inducible antiviral effectors, and 6) proportion of subjects who visit the emergency room and are hospitalized.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HLA-DR, CD86), 3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IL-6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antiviral effectors, and 6</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      This study has several limitations. First, this is an exploratory study due to the lack of previous clinical evaluation of the effects of LC-Plasma intake in patients with COVID-19. The target number of enrolled patients in this study was calculated from results of a case series study estimating subjective symptoms in non-hospitalized patients with COVID-19 treated with the histamine-2 receptor antagonist famotidine.[21] Since this case series evaluated subjective symptoms in only 10 patients, the calculated mean and standard deviation of the results might not reflect the actual patients’ subjective symptoms. Second, the primary endpoint in this study is patients’ subjective symptoms as reported by subjects themselves. Therefore, biases such as responder bias, non-responder bias, and volunteer bias cannot be completely avoided. However, the effect of bias is minimized using a double-blinded study design. Third, this study will be conducted in medical institutions in Japan and will enroll only Japanese patients. These constraints could limit the generalizability of this study. Further larger-scale, international clinical trials are required in the future. Ethics and dissemination: This study and its protocol were approved by the Clinical Research Review Board of Nagasaki University (Approval No. CRB20-027) in accordance with the Clinical Trials Act of Japan. The study will be conducted in accordance with the Declaration of Helsinki, Clinical Trials Act, and other current legal...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.13.22270900: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.11.22270784: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.11.22270859: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cost Calculator: Base case costs included drug acquisition and administration for lenzilumab and remdesivir and hospital resource costs based on the level of care required.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cost</div><div>suggested: (COST, RRID:SCR_014098)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      As with extrapolation of any clinical trial results, this study had several limitations. The analysis used data from the LIVE-AIR Phase 3 clinical trial that may have been subject to selection bias and that was predominantly conducted in US hospitals. Consequently, the findings from the trial may not be fully generalizable to a UK population and/or UK hospital setting based on potential differences in treatment patterns (eg, length of hospital stay) for hospitalized patients with COVID-19 between the US and UK. It should also be noted that the LIVE-AIR trial was conducted earlier in the pandemic and thus, prior to vaccinations and the emergence of new COVID-19 variants, both of which have been reported to affect hospital length of stay.11,63,64 As a result, time to recovery inputs derived from the clinical trial may differ from current real-world values. However, it is anticipated that the ongoing ACTIV-5/BET-B trial, which has completed the enrollment of over 400 patients in the primary analysis population, will provide data on the use of lenzilumab for hospitalized patients infected with different COVID-19 variants and with differing vaccination statuses.46,47 Additionally, the Black subgroups from the LIVE-AIR trial that were assessed in the per-patient calculator were limited by small sample sizes and will require further validation using the results from the upcoming ACTIV-5/BET-B trial. Consideration should also be given to the fact that the current analyses were conduc...


      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04351152</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Phase 3 Study to Evaluate Efficacy and Safety of Lenzilumab …</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.14.22270958: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.13.22270904: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Individuals who sleep 3 or more nights per week within the defined study area, are aged 2 years or older, and who provide consent (parental consent for minors) were eligible to participate.<br>IRB: This project was approved by the Human Research Ethics Committee of the Instituto Gonçalo Moniz, Fundação Oswaldo Cruz (FIOCRUZ), the National Research Ethics Council (CONEP) and the Yale University Research Ethics Committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Threshold for antibody detection: For the Euroimmun anti-S IgG ELISA, the manufacturer recommends that samples with normalized OD values <0.8 are considered negative, those with values >=0.8 and <1.1 considered borderline, and those with values >=1.1 considered positive.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG ELISA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Interpolated titers were computed using the software GraphPad Prism (Version 5.01, GraphPad software, San Diego, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.15.480515: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics and biosafety: The generation of SARS-CoV-2 MA10 was approved for use under BSL3 conditions by the University of North Carolina at Chapel Hill Institutional Review Board (UNC-CH IBC) and by a Potential Pandemic Pathogen Care and Oversight committee at the National Institute of Allergy and Infectious Diseases (NIAID).<br>IACUC: All animal work was approved by Institutional Animal Care and Use Committee at University of North Carolina at Chapel Hill according to guidelines outlined by the Association for the Assessment and Accreditation of Laboratory Animal Care and the U.S. Department of Agriculture.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">At indicated harvest time points, randomly assigned animals were euthanized by an overdose of isoflurane and samples for analyses of titer (caudal right lung lobe) and histopathology (left lung lobe) were collected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Disease incidence scoring: Profibrotic disease incidence was scored by a blinded veterinary pathologist using serial H&E and Picrosirius Red stained slides.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After pretreatment, slides were incubated with primary antibodies (see Key Resources Table) for 1h followed with Novolink Polymer (RE7260-K) secondary.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RE7260-K</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A large working stock of SARS-CoV-2 MA10 was generated by passaging the plaque purified clonal isolate sequentially on Vero E6 cells at 37°C (passage 3, SARS-CoV-2 P3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In vivo infection: All BALB/c mice used in this study were purchased from Envigo (BALB/cAnNHsd; strain 047) and housed at the University of North Carolina at Chapel Hill until the start of the experiment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were viewed with ImageJ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pre-ranked gene set enrichment analysis (GSEA) was performed using the Bioconductor R package, fgsea (84), with gene set collections obtained from Gene Ontology Biological Process (85), and Reactome pathways (86).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bioconductor</div><div>suggested: (Bioconductor, RRID:SCR_006442)</div></div><div style="margin-bottom:8px"><div>Reactome</div><div>suggested: (Reactome, RRID:SCR_003485)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plots and hierarchical clustering heatmaps were generated using the R package, ggplot2 (87), and ComplexHeatmap (88).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ComplexHeatmap</div><div>suggested: (ComplexHeatmap, RRID:SCR_017270)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Preliminary analysis of the log2 transformed and scaled Q3 normalized data identified a putative batch effect between two runs as identified using the PCA in the R package FactoMineR.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FactoMineR</div><div>suggested: (FactoMineR, RRID:SCR_014602)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sets of differentially expressed genes were tested for overrepresentation of the genes in the databases (GO: Biological Process, GO: Molecular Function, GO: Cellular Components, KEGG, and Reactome) using R package enrichR (93).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GO: Biological</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div><div style="margin-bottom:8px"><div>enrichR</div><div>suggested: (Enrichr, RRID:SCR_001575)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Various plots and heatmaps were generated using the R packages ggplot2 and heatmap3 (94).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Stained areas of Sirius Red and SMA detected by IHC in the alveolar regions were quantitated using Fiji software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical significance was evaluated with the R lmerTest package(92), using the Satterthwarte’s degrees of freedom method.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>lmerTest</div><div>suggested: (R package: lmerTest, RRID:SCR_015656)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Supplemental Table 1: Cytokine and chemokine protein levels in SARS-CoV-2 MA10 infected young and old mice Supplemental Table 2: Gene lists in heat maps Supplemental Table 3: Mouse whole transcriptome GeoMx data Supplemental Table 4: Mouse GeoMx differential gene expression analysis Supplemental Table 5: Mouse GeoMx pathway enrichment analysis Supplemental Table 6: Human donor demographics Supplemental Table 7: Human whole transcriptome GeoMx data Supplemental Table 8: Reagent and Resource descriptions References and Notes:</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Notes</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.14.480430: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-dsRNA antibody was obtained from Millipore (identifier MABE1134); anti-mouse IgG AlexaFluor 647 was obtained from Invitrogen (Identifier A32628); anti-llama secondary HRP, goat IgG was obtained from Novus (identifier NB7242).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-llama secondary HRP, goat IgG</div><div>suggested: (Thermo Fisher Scientific Cat# A16060, RRID:AB_2534733)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were stained overnight with an anti-dsRNA antibody diluted 1:50 in blocking buffer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-dsRNA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed three times with PBS and then stained with an A647 secondary antibody for 1 hr.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A647</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were permeabilized in perm buffer (0.1% saponin, 0.1% BSA in PBS) for 30 minutes, then incubated with 50 μL primary antibody (alpaca anti-SARS-CoV-2 serum, diluted 1:5,000 in perm buffer) for either 2hr room temperature or overnight at 4 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were incubated with 50 μL secondary antibody (anti-llama HRP, goat IgG) for either 2hr room temperature or overnight at 4 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-llama HRP, goat IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Materials: Cell lines: Cell lines (HEK293T, HEK293T-ACE2, Vero-E6, and Caco2) were obtained from ATCC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral strains: SARS-CoV-2 viral strains (isolate USA-WA1/2020: Identifier #NR-52281; isolate USA/CA_CDC_5574/2020: Identifier #NR-54011; isolate hCoV-19/South Africa/KRISP-K005325/2020: Identifier #NR-54009; hCoV-19/Japan/TY7-503/2021: Identifier #NR54982; isolate hCoV-19/USA/PHC658/2021: Identifier # NR-55611) were obtained from BEI resources and propagated in Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Media for Vero-E6 cells, 293T (wt) and 293T-ACE2 cells was supplemented with 10% FBS while media for Caco2 cells was supplemented with 20% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Wild-type 293T cells were seeded in 6cm dishes and transfected with varying amounts viral plasmids (based on optimal expression for each plasmid, see Table S1), as well as a PLVX empty vector control, using Lipofectamine 3000 (ThermoFisher Scientific) as per manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lipid droplet immunofluorescence — Infection: 293T-ACE2 or Caco2 cells were seeded at 70% cell density in 24-well plates and allowed to grow overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco2</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.10.22270607: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All the participants provided written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alkaline phosphatase conjugated goat anti-human IgG, IgM and IgA detector antibodies (Jackson ImmunoResearch Laboratories) were diluted 1:2000 in 2% non-fat dry milk and added to the plates (50 ul/well) and incubated for one hr at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">- plasmids into HEK 293 T cells, to produce the CoV2 psV.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HuACE2-HeLa cells were infected with the CoV2 psV in DMEM media supplemented with polybrene (10 ug/ml) and infectivity was determined by reading luciferase activity in the cell-lysate after 72 hrs post-infection upon adding luciferase substrate (Britelite, PE).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HuACE2-HeLa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To determine the neutralization potency of the plasma psV dilutions giving ∼100,000 RLU were used to infect Hu-ACE2-HeLA cells in the presence of titrated plasma.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Hu-ACE2-HeLA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, a gene fragment of the CoV2-Spike gene encoding the RBD was synthesized commercially (IDT) and cloned at the 3’ end of a gene expressing the N-terminal fragment of the Friend ectotropic MuLV (Fr-MuLV) surface protein (SU) gp70 gene in the expression vector pcDNA3.4 (Addgene, Watertown, MA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.4</div><div>suggested: RRID:Addgene_131198)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CoV2 Pseudovirus (psV) preparation and ACE2-HeLa cell-based neutralization Assay: Codon optimized D614G, Alpha, Beta, Gamma, Delta, Kappa and Lambda spike gene sequences with 18 aa C-terminal truncations were cloned into the pCAGGS vector40.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_127347)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A280 measurements of purified proteins were acquired via Nanodrop and the final concentrations were derived with the molecular weight and extinction coefficient calculated online by ExPASy.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ExPASy</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.5 Statistics: GraphPad Prism 8.0 software was used to calculate the mean, median, interquartile range (IQR) and determine suitable parametric or nonparametric tests to be applied for statistical analyses of the data.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pearson’s coefficient and Spearman r value were calculated to identify positive and negative correlations and the neutralization potency of plasma, defined as the plasma dilution, required to reduce viral signal by 50% (IC50), were calculated using One-Site Fit LogIC50 regression in GraphPad Prism 8.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.14.480353: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Participants were included through informed consent.<br>IRB: The ethics committee of the AUMC approved the study.<br>IACUC: Blood samples were collected after obtaining written informed consent under the local ethics board–approved protocols 19-019(A) and 20-123 (Ethics Committee of the University of Lübeck, Germany).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">No other selection criteria were used and participants were selected at random.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-Receptor Binding Domain (RBD) and anti-Nucleocapsid (N) antibody levels were measured as by an RBD and N-based bridging assay, respectively, as described previously (50, 51).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Nucleocapsid ( N</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IL-6 levels in the supernatant were measured by enzyme-linked immunosorbent assay (ELISA) using IL-6 CT205-c and CT205-d antibody pair (U-CyTech, Utrecht, the Netherlands) as described previously (1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CT205-d</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow Cytometry Standard (FCS) 3.0 files were analyzed with FlowJo software version X 0.7 (BD Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Other statistical analyses were performed using GraphPad Prism v6.0 (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(GraphPad, La Jolla, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      A second limitation of our study is the uneven sample size for naive and antigen-experienced vaccine recipients after the first and second dose of BNT162b2. This is largely due to lack of an accessible, high-throughput serological assay to measure antigen-specific IgG glycosylation to study both transient and stable glycosylation features in disease settings. In summary, our data demonstrate a qualitatively and quantitatively distinct IgG immune response between BNT162b2 mRNA vaccinated SARS-CoV-2 naive and antigen-experienced individuals. Transient afucosylated IgG1 responses were induced in naive individuals upon the first dose, which correlated with increased titer after the second vaccination. In contrast, antigen-experienced vaccinees had low levels of afucosylated anti-S, which slightly increased upon vaccination. The qualitatively distinct IgG1 glycosylation patterns might further mediate differences in protection between these two groups. Future efforts focused on inducing and studying antigen-specific, afucosylated IgG1 responses are needed to investigate their protective capacity and inflammatory potential in anti-viral and vaccine-induced immunity.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 52, 13 and 54. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.14.480335: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To construct the plasmids expressing anti-SARS-CoV-2 monoclonal antibodies (Casirivimab, Imdevimab or Sotrovimab), the sequences of the variable regions of these antibodies were obtained from KEGG Drug Database (https://www.genome.jp/kegg/drug/) and were artificially synthesized (Fasmac).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To measure the surface expression level of S protein, effector cells were stained with rabbit anti-SARS-CoV-2 S S1/S2 polyclonal antibody (Thermo Fisher Scientific, Cat# PA5-112048, 1:100).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Normal rabbit IgG (SouthernBiotech, Cat# 0111-01, 1:100) was used as negative controls, and APC-conjugated goat anti-rabbit IgG polyclonal antibody (Jackson ImmunoResearch, Cat# 111-136-144, 1:50) was used as a secondary antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 111-136-144, RRID:AB_2337987)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">6c), HEK293-ACE2 cells and HEK293-ACE2/TMPRSS2 cells were stained with rabbit anti-TMPRSS2 polyclonal antibody (BIOSS, Cat# BS-6285R, 1:100).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-TMPRSS2</div><div>suggested: (Bioss Cat# bs-6285R, RRID:AB_11102333)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For protein detection, the following antibodies were used: mouse anti-SARS-CoV-2 S monoclonal antibody (clone 1A9, GeneTex, Cat# GTX632604, 1:10,000), rabbit anti-beta actin (ACTB) monoclonal antibody (clone 13E5, Cell Signalling, Cat# 4970, 1:5,000), horseradish peroxidase (HRP)-conjugated donkey anti-rabbit IgG polyclonal antibody (Jackson ImmunoResearch, Cat# 711-035-152, 1:10,000) and HRP-conjugated donkey anti-mouse IgG polyclonal antibody (Jackson ImmunoResearch, Cat# 715-035-150, 1:10,000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-beta actin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ACTB</div><div>suggested: (Cell Signaling Technology Cat# 4970, RRID:AB_2223172)</div></div><div style="margin-bottom:8px"><div>HRP)-conjugated donkey anti-rabbit IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HRP-conjugated donkey anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The deparaffinized sections were exposed to EnVision FLEX target retrieval solution high pH (Agilent, Cat# K8004) for 20 m at 97°C to activate, and mouse anti-SARS-CoV-2 N monoclonal antibody (R&D systems, Clone 1035111, Cat# MAB10474-SP, 1:400) was used as a primary antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 N</div><div>suggested: (Leinco Technologies Cat# LT7000, RRID:AB_2893978)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293-ACE2/TMPRSS2 cells [HEK293 cells (ATCC CRL-1573) stably expressing human ACE2 and TMPRSS2]22 were maintained in Dulbecco’s modified Eagle’s medium (DMEM) (high glucose) (Wako, Cat# 044-29765) containing 10% foetal bovine serum (FBS) and 1% penicillin-streptomycin (PS).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293-ACE2/TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VeroE6/TMPRSS2 cells (VeroE6 cells stably expressing human TMPRSS2; JCRB1819)29 were maintained in DMEM (low glucose) (Wako, Cat# 041-29775) containing 10% FBS, G418 (1 mg/ml; Nacalai Tesque, Cat# G8168-10ML) and 1% PS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div><div style="margin-bottom:8px"><div>JCRB1819)29</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3/DSP1-7 cells [Calu-3 cells (ATCC HTB-55) stably expressing DSP1-7]40 were maintained in EMEM (Wako, Cat# 056-08385) supplemented with 20% FBS and 1% PS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: ATCC Cat# HTB-55, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expi293 cells (Thermo Fisher Scientific, Cat# A14527) were maintained in Expi293 expression medium (Thermo Fisher Scientific, Cat# A1435101).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the pCAGGS vectors containing the sequences encoding the immunoglobulin heavy and light chains were cotransfected into HEK293T cells using PEI Max (Polysciences, Cat# 24765-1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the immunisation, mice were subcutaneously immunized with the freeze-thawed S-expressing B16F10 cells in complete Freund’s adjuvant (50%) (Sigma-Aldrich, Cat# F5881).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B16F10</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To produce chimeric recombinant SARS-CoV-2, the CPER products were transfected into HEK293-C34 cells using TransIT-LT1 (Takara, Cat# MIR2300) according to the manufacturer’s protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293-C34</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 infection: One day before infection, Vero cells (10,000 cells), VeroE6/TMPRSS2 cells (10,000 cells), Calu-3 cells (20,000 cells), HEK293-ACE2 cells (10,000 cells), HEK293-ACE2/TMPRSS2 cells (10,000 cells), were seeded into a 96-well plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>VeroE6/TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Target HEK293 cells in selected wells were cotransfected with pC-TMPRSS2 (40 ng) in addition to the plasmids above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VeroE6/TMPRSS2 cells, Calu-3 cells, HEK293-ACE2 cells and HEK293-ACE2/TMPRSS2 cells were transfected with pDSP1-7 (400ng).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">On day 3 (24 h posttransfection), 16,000 effector cells were detached and reseeded into 96-well black plates (PerkinElmer, Cat# 6005225), and target cells (HEK293, VeroE6/TMPRSS2 or Calu-3/DSP1-7 cells) were reseeded at a density of 1,000,000 cells/2 ml/well in 6-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3/DSP1-7</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BALB/c mice (female, 7 weeks old) were purchased from Japan SLC Inc. (Shizuoka, Japan).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The obtained coding sequences of the variable regions of the heavy and light chains were cloned into the pCAGGS vector containing the sequences of the human immunoglobulin 1 and kappa constant region [kindly provided by Dr. Hisashi Arase (Osaka University, Japan)].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_127347)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To prepare effector cells, HEK293 cells were cotransfected with the S-expression plasmids (500 ng) and pDSP8-11 (500 ng) using PEI Max (Polysciences, Cat# 24765-1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pDSP8-11</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To prepare target cells, HEK293 and HEK293-ACE2/TMPRSS2 cells were transfected with pDSP1-7 (500 ng).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pDSP1-7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To prepare target cells, HEK293 cells were cotransfected with pC-ACE2 (200 ng) and pDSP1-7 (400 ng).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pC-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Target HEK293 cells in selected wells were cotransfected with pC-TMPRSS2 (40 ng) in addition to the plasmids above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pC-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An enhanced yeast display platform for SARS-CoV-2 RBD [wild-type (B.1.1), residues 336-528] yeast surface expression was established using Saccharomyces cerevisiae EBY100 strain and pJYDC1 plasmid (Addgene, Cat# 162458) as previously described22, 24, 47.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pJYDC1</div><div>suggested: RRID:Addgene_162458)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Paired-end, 76-bp sequencing was performed using MiSeq (Illumina) with MiSeq reagent kit v3 (Illumina, Cat# MS-102-3001).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MiSeq</div><div>suggested: (A5-miseq, RRID:SCR_012148)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequencing reads were trimmed using fastp v0.21.028 and subsequently mapped to the viral genome sequences of a lineage A isolate (strain WK-521; GISAID ID: EPI_ISL_408667)29 using BWA-MEM v0.7.1730.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA-MEM</div><div>suggested: (Sniffles, RRID:SCR_017619)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Variant calling, filtering, and annotation were performed using SAMtools v1.931 and snpEff v5.0e32.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAMtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div><div style="margin-bottom:8px"><div>snpEff</div><div>suggested: (SnpEff, RRID:SCR_005191)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The alignment sites with >50% sequences having a gap or undetermined/ambiguous nucleotide were trimmed using trimAl v1.234.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>trimAl</div><div>suggested: (trimAl, RRID:SCR_017334)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The tree reconstruction was performed by RAxML v8.2.1235 under the GTRCAT substitution model.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RAxML</div><div>suggested: (RAxML, RRID:SCR_006086)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A time-calibrated tree of each lineage was constructed by BEAST2 v.2.6.636.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BEAST2</div><div>suggested: (BEAST2, RRID:SCR_017307)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Parameter estimation was performed by MCMC implemented in CmdStan v2.28.1 (https://mc-stan.org) with cmdstanr v0.4.0 (https://mc-stan.org/cmdstanr/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CmdStan</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To construct the plasmids expressing anti-SARS-CoV-2 monoclonal antibodies (Casirivimab, Imdevimab or Sotrovimab), the sequences of the variable regions of these antibodies were obtained from KEGG Drug Database (https://www.genome.jp/kegg/drug/) and were artificially synthesized (Fasmac).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nucleotide sequences were determined by DNA sequencing services (Eurofins), and the sequence data were analyzed by Sequencher v5.1 software (Gene Codes Corporation).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sequencher</div><div>suggested: (Sequencher, RRID:SCR_001528)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The assay of each serum was performed in triplicate, and the 50% neutralisation titre (NT50) was calculated using Prism 9 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Information on the unexpected mutations detected is summarized in Supplementary Table 6, and the raw data are deposited in Gene Expression Omnibus (accession number: GSE196649).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene Expression Omnibus</div><div>suggested: (Gene Expression Omnibus (GEO, RRID:SCR_005012)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The background binding subtracted fluorescent signal was fitted to a standard noncooperative Hill equation by nonlinear least-squares regression using Python v3.7 (https://www.python.org) as previously described47.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div><div style="margin-bottom:8px"><div>https://www.python.org</div><div>suggested: (CVXOPT - Python Software for Convex Optimization, RRID:SCR_002918)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Surface expression level of TMPRSS2 was measured using FACS Canto II (BD Biosciences) and the data were analysed using FlowJo software v10.7.1 (BD Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bands were visualized using an Amersham Imager 600 (GE Healthcare), and the band intensity was quantified using Image Studio Lite v5.2 (LI-COR Biosciences) or Fiji software v2.2.0 (ImageJ).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The state of oxygenation was examined by measuring SpO2 using pulse oximeter, MouseOx PLUS (STARR).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STARR</div><div>suggested: (Starr, RRID:SCR_001071)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These analyses were performed in v4.1.2 (https://www.r-project.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.r-project.org/</div><div>suggested: (R Project for Statistical Computing, RRID:SCR_001905)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.11.480177: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These multiple sequences were aligned by MAFFT [16] to extract the sequence fragment encoding for receptor-binding domain of spike protein (T333 – G526).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) (ab initio and homology-based hybrid methodology) [24]; Modeller (version 10.1)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Modeller</div><div>suggested: (MODELLER, RRID:SCR_008395)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We employed the standalone versions of PRODIGY [33] and PISA [34] on the most reliable RBD-hACE2 and RBD-NAbs complexes to estimate these distinct matrices.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PISA</div><div>suggested: (PISA, RRID:SCR_015749)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We employed MedCalc® statistical software version 20.026 to calculate weight Kappa statistic.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MedCalc®</div><div>suggested: (MedCalc, RRID:SCR_015044)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The graphs were generated using GraphPad Prism 7.01 (GraphPad Software, San Diego, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.11.480131: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.13.22270662: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants remained anonymous, and written consent was given by the patients or a legal representative.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cortical thickness (Th) and volumetric segmentation were performed with the FreeSurfer-6.0 image analysis suite (http://surfer.nmr.mgh.harvard.edu/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>http://surfer.nmr.mgh.harvard.edu/</div><div>suggested: (FreeSurfer, RRID:SCR_001847)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The statistical analysis was performed using the JASP-software (https://jasp-stats.org/) and MATLAB-software for the partial-correlation analysis (‘partialcorri.m’) (https://www.mathworks.com/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://jasp-stats.org/</div><div>suggested: (JASP, RRID:SCR_015823)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04472013</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Systematic Assessment of SARS-CoV-2 Neurotropic Capacity in …</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.15.22270974: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants provided written informed consent prior to study enrollment.<br>IRB: Institutional review board of Faculty of Medicine, Thammasat University (MTU-EC-PE1-182/64) and Faculty of Medicine, Chulalongkorn University (IRB No. 600/64) approved this study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">This is a double-blinded, randomized, controlled trial.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Therefore, the participants and blinded study team were not aware of the randomization arms.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">2.5 Statistical analysis: The sample size was calculated using a non-inferiority criterion for the geometric mean ratio (GMR) of sVNT against wild type and delta variant, and anti-S-RBD IgG, comparing LD to SD.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Correlation between the levels of anti-S-RBD IgG and receptor-blocking antibodies as measured by sVNT was analyzed for both wild type and delta strains by non-linear regression fit in GraphPad Prism 9 (GraphPad software, San Diego, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S-RBD IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Correlation between the levels of anti-S-RBD IgG and receptor-blocking antibodies as measured by sVNT was analyzed for both wild type and delta strains by non-linear regression fit in GraphPad Prism 9 (GraphPad software, San Diego, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      The limitation included the interval from last vaccination was only 2-3 months after completion of 2-dose CoronaVac. Though in the real world, the booster might be given at longer interval from last CoronaVac, in which we expected to have at least similar or even higher immunogenicity. Secondly, this study included healthy adults, and have no data among high-risk groups, such as the elderly or the immunocompromised patients. Thirdly, the follow up of the participants are ongoing to observe the kinetic of antibody decline and risk of breakthrough infection if any occurred. Lastly, this study did not perform sVNT for recently emerged variants e.g., Omicron, however, the comparable T cell responses between standard and low dose AZD1222 booster could likely prevent severe symptoms of COVID-19 caused by these variants.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.11.22270504: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Investigators obtained verbal consent as well as verbal confirmation of participants being at least 18 years of age prior to survey completion.<br>IRB: All procedures were approved as exempt by the Institutional Review Board of Geisinger.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">The ages of the participants ranged from 18 to over The sample population contained nearly equal amounts of men and women.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Procedures: This study was modeled after previously used surveys found on PubMed and the data was collected using SurveyMonkey.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data analysis was conducted using IBM SPSS Statistics 28.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Figures were developed using GraphPad Prism 9.3.1 for Windows.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Data collection through self-report reflects another limitation as self-assessment of COVID-19 knowledge can introduce biases. Another limitation was access to unvaccinated individuals. Most of the population surveyed had already received the vaccine or were receptive to getting it. We can not discount that some participants holding strong anti-vaccine beliefs [15] were less likely to participate in this voluntary study. Another limitation was the few native Spanish-speaking participants in our sample. Future studies should seek to include sizable proportions of unvaccinated individuals [15] along with the addition of bilingual research assistants and interpreters to their team. Future investigations that include an appreciable number of unvaccinated participants may further clarify the overall profile of unvaccinated minorities, allowing for the development of a more nuanced strategy to address their concerns and encourage vaccine and booster acceptance among all ages [19].


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.14.22270930: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Participants in the cohort were invited via email to participate in post-vaccination antibody studies and to give additional consent for these.<br>IRB: COVIDENCE UK was sponsored by Queen Mary University of London and approved by Leicester South Research Ethics Committee (ref 20/EM/0117).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The primary analysis presented here includes data from all participants for whom a serology result was available following administration of two doses of ChAdOx1 or BNT162b2; an additional antibody test following administration of a third booster dose of vaccine was offered to all participants who were seronegative after two vaccine doses, and a randomly selected subset of positive controls who were seropositive after two vaccine doses.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Statistical analysis: Full details of the sample size calculation and statistical analysis are provided in Supplementary Material.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Once returned, the samples were logged by the study team and sent in batches to the Clinical Immunology Service at the Institute of Immunology and Immunotherapy of the University of Birmingham (Birmingham, UK) for semi-quanttative determination of combined IgG, IgM and IgA anti-spike antibody titres using a commercially available ELISA that measures combined IgG, IgA, and IgM (IgGAM) responses to the SARS-CoV-2 trimeric spike glycoprotein (product code MK654; The Binding Site [TBS], Birmingham, UK).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-spike</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgM (IgGAM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2 trimeric spike glycoprotein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Outcomes: Study outcomes were presence vs absence of antibodies against SARS-CoV-2 (analysed as a binary outcome) and antibody titres (continuous outcome restricted to the individuals who were seropositive after receiving two vaccine doses).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Given reports that peri-vaccination use of antipyretic analgesics may attenuate vaccine immunogenicity,26 we also conducted an exploratory analysis to determine the influence of taking paracetamol or non-steroidal anti-inflammatory drugs (NSAIDs) to treat post-vaccination symptoms on post-vaccination antibody titres.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-inflammatory drugs</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To produce participant-level covariates for each class of medications investigated, questionnaire responses were mapped to drug classes listed in the British National Formulary (BNF) or the DrugBank and Electronic Medicines Compendium databases if not explicitly listed in the BNF, as previously described.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DrugBank</div><div>suggested: (DrugBank, RRID:SCR_002700)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Our study also has some limitations. We did not study cellular responses to vaccination, and these may be discordant with humoral responses.10,27 We also studied responses at an early time point only; a high early peak in antibody titres following vaccination is not necessarily an indicator of durable response.36 As with any observational study, we cannot exclude the possibility that some of the associations we report might be explained by residual or unmeasured confounding. However, we have minimised the risk of this by adjusting for a comprehensive list of putative determinants of vaccine immunogenicity. COVIDENCE UK is also a self-selected cohort, and thus certain demographics—such as people <30 years old, people of lower socioeconomic status, and non-White ethnic groups—are under-represented. This may have limited our power to investigate antibody responses in some sub-groups, such as participants of Black ethnicity (who are at higher risk of SARS-CoV-2 infection39-41 and adverse outcomes42 than White people). In conclusion, this large population-based study reports on the influence of a comprehensive range of potential sociodemographic, behavioural, clinical, pharmacological and nutritional determinants on antibody responses to two major SARS-CoV-2 vaccines. Importantly, we also show that booster doses of mRNA vaccines are highly effective in achieving seroconversion in healthy people who fail to mount antibody responses to SARS-CoV-2 trimeric spike glycoprotein after re...


      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04330599</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Longitudinal Population-based Observational Study of COVID-1…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04579640</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Trial of Vitamin D to Reduce Risk and Severity of COVID-19 a…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.14.22270934: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Where there were multiple estimates per study unrelated to time, estimates were prioritised based on adjustment, antibody isotypes, test type, and antibody targets (full details: Supplement S3.1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>test type</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We searched MEDLINE, Embase, Web of Science, and Europe PMC for published articles, preprints, grey literature, and media reports.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEDLINE</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div><div style="margin-bottom:8px"><div>Embase</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Strengths and limitations: Previous assessments of COVID-19 seroprevalence studies highlight methodological heterogeneity as a key barrier to synthesising data.[33–35] The distinctive dataset described here is standardised, representative and granular, enabling unique insights into seroprevalence in Africa. Recently, in part via WHO’s UNITY Studies Initiative, more seroprevalence data has become available, disaggregated by demographic groups (age, sex), place (e.g. sub-region, country) and time (quarterly periods). In line with the equity principles of the UNITY Studies Initiative, our dataset 0 included a broad range of studies in low-income countries (62%, n=95), lower-middle-income countries (LMIC) (22%, n=33) and vulnerable HRP countries (41%, n=62). Around one quarter of studies were conducted at the national level, which is unique to this analysis. UNITY study collaborators shared timely evidence, facilitating geographic coverage and reducing publication bias. Additionally, standardised epidemiological and serological methods (including the supply of a well-performing assay to LMIC) enabled through the UNITY Studies Initiative means that the estimates included in our meta-analysis are robust and comparable. Finally, recognizing that assay performance is a key determinant of seroprevalence, we linked our data to independent test kit evaluations[27,28] of serological assay performance to correct seroprevalence estimates in a sensitivity analysis, helping ensure the robust...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.14.22270941: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.15.22270948: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The national and the institutional review board approved the protocol and the consent forms.<br>Consent: The national and the institutional review board approved the protocol and the consent forms.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 IgG II Quant (Abbott, IL, USA), (ii) SARS-CoV-2 pseudovirus neutralization assay using a vesicular stomatitis virus (VSV) backbone coated with SARS-CoV-2 spike (S) protein (ref), (iii) Live microneutralization of different strains; Wu-1 as well as Alpha, Delta and Omicron VOCs 15</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Our study has several limitations. First, this was not a randomized placebo-controlled trial, since it was primarily designed to assess immunogenicity, which should not be affected by our study design. However, generating potential biases in assessing vaccine efficacy. To overcome these, we compared each intervention group separately to an age-matched 2:1 control group. Second, the two intervention arms were initiated with a one week difference, leading to two potential biases; time dependent, due to the rapid surge during the study period, and minor difference in the population baseline characteristics of each arm (e.g., slightly younger in the mRNA1273 cohort). These potential biases were addressed by using a Poisson model accounting for calendar time and age. While we did not find a significant difference between the two mRNA vaccines, this is an interim report, and differences in durability of the vaccine effects may be identified only with future follow up. Finally, our study is relatively small, and thus wide confidence intervals for vaccine efficacy are reported. Our data provides evidence that an mRNA fourth vaccine dose is immunogenic, safe and somewhat efficacious, apparently more against symptomatic disease. Four to five months after the third dose, the fourth dose increases immunogenicity and restores it to levels comparable to peak antibody levels after the third vaccine dose. Thus, while mRNA vaccines seem to be highly potent and protective against severe diseas...


      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT05231005</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Fourth BNT162b2 COVID-19 Vaccine Dose</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT05230953</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Fourth COVID-19 Vaccine Dose- mRNA1273</td></tr></table>


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.13.22270890: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The pushshift.io Reddit API was used for searching Reddit comments and submissions.[11] Reddit’s official API (Reddit 2021) was used to collect posts and associated metadata (date) from r/STD and r/sexualhealth from March 2019 to July 2021 resulting in 24,311 posts.[10] Only English posts were included in the analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Reddit</div><div>suggested: (reddit, RRID:SCR_011983)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After data preprocessing was complete, each string was passed to the WordCloud function in Python to generate a wordcloud.[18] For WordCloud visualization, we chose three etiologic terms (chlamydia, gonorrhea, syphilis) and three of the most common terminologies from topic search: herpes/HSV/HPV (as a single topic, due to correlations), diagnosis/testing, STI/STD.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plots were created using ggplot2 package in R.[19] For spline regression, we used cubic B-spline basis with two boundary knots and one interior knot placed at the median of the observed data values.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.14.480338: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The protocol was reviewed and approved by the Institutional Animal Care and Use Committee of Hokkaido University (approval no. 20-0060).<br>Euthanasia Agents: Virus infection and treatment of hamsters: Five-week old male Syrian hamsters (Japan SLC) were intranasally inoculated with 5,000 pfu of SARS-CoV-2 in 200 μl of PBS under anesthesia with isoflurane inhalation.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Pharmacokinetics studies: Five-week old male Syrian hamsters (Japan SLC) were orally administered at 10, 30, and 100 mg/kg of S-217622 under the non-fasting conditions (n = 3, each).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero-TMPRSS2 cells at 24 hpi and Calu-3 cells at 72 hpi were fixed with 3.7% formaldehyde in PBS, followed by permeabilization with 0.5% Triton X-100 in PBS for 5 min and staining with anti-SARS-CoV-2 nucleocapsid rabbit monoclonal antibody (GTX635679, GeneTex) in 25% Block Ace (KAC) in PBS for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 nucleocapsid</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GTX635679</div><div>suggested: (GeneTex Cat# GTX635679, RRID:AB_2888553)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alexa Fluor 488-conjugated anti-rabbit IgG antibody (Invitrogen; Thermo Fisher Scientific) was used as the secondary antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Alexa Fluor 488-conjugated anti-rabbit IgG antibody</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tissues were further incubated for 4 days with secondary antibody staining solution; Alexa Fluor Plus 647-conjugated anti-rabbit IgG (A32795, Invitrogen) diluted in PBSBT with 0.1% saponin and filtrated though a 0.45 μm syringe filter.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A32795</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero-TMPRSS2 cells [Vero E6 cells (ATCC, CRL-1586</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T (RIKEN BRC, RCB2202) cells were maintained in high glucose DMEM containing 10% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>RCB2202</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T-ACE2-TMPRSS2 cells stably expressing human TMPRSS2 and ACE2 were established by a lentiviral vector transduction system as previously described35 and maintained in high glucose DMEM containing 10%</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero-TMPRSS2 cells at 24 hpi and Calu-3 cells at 72 hpi were fixed with 3.7% formaldehyde in PBS, followed by permeabilization with 0.5% Triton X-100 in PBS for 5 min and staining with anti-SARS-CoV-2 nucleocapsid rabbit monoclonal antibody (GTX635679, GeneTex) in 25% Block Ace (KAC) in PBS for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fluorescent images were captured using IX73 fluorescence microscope (Olympus). qRT-PCR: Vero-TMPRSS2 and Calu-3 cells were inoculated with SARS-CoV-2 at MOIs of 0.01 or 0.1, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: BCRJ Cat# 0264, RRID:CVCL_0609)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Biosensor assay for viral protease activity: The DNA fragments encoding SARS-CoV-2 NSP3 or NSP4, NSP5, N-terminal NSP6 (NSP4/5/6N) were cloned into pCMV-derivative pCXSN vector to generate pSARS-CoV-2 PLpro and pSARS-CoV-2 Mpro, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV-derivative pCXSN</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pSARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The amino acid sequence AVLQS (for the cleavage by Mpro) or RLKGG (for the cleavage by PLpro) were inserted into pGloSensor-30F vector backbone (CS182101, Promega) to generate firefly luciferase-based biosensor expressing plasmid pGS-AVLQS or pGS-RLKGG, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pGloSensor-30F</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T cells on 96-well plate were co-transfected with a set of pGS-AVLQS and pSARS-CoV-2 Mpro or a set of pGS-RLKGG and pSARS-CoV-2 PLpro using TranIT-LT1</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pGS-AVLQS</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pGS-RLKGG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pSARS-CoV-2 PLpro</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">At 24 h post transfection, the luminescence signals of biosensors and renilla luciferase (an internal control reporter) from pGS vectors were measured by Dual-Glo Luciferase Assay System (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pGS</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The concentration achieving 50% inhibition of cytopathic effect (effective concentration; EC50) was defined in GraphPad Prism version 8.4.3 (GraphPad Software) with a variable slope (four parameters)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Image data was converted and processed into 3D reconstruction by Imaris software (Oxford Instruments).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Imaris</div><div>suggested: (Imaris, RRID:SCR_007370)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      We note some limitations of our study. First, therapeutic treatment with S-217622 was insufficient to control pneumonia in SARS-CoV-2-infected hamsters, although they regained lost body weight earlier compared to vehicle controls. We assume that the initial virus proliferation stimulated host immunity and subsequent inflammation31, 32, and combination with antiviral and anti-inflammatory medication may lead to better results and outcomes33. Second, this study was conducted using hamsters as a COVID-19 model and the efficacy in human patients cannot be inferred. However, S-217622 is currently under evaluation in a phase II/III clinical trial. Third, the development of a resistant viral clone against S-217622 and its virological properties will need to be investigated in future studies. In summary, our study has demonstrated the remarkable antiviral activity of S-217622 through in vitro and in vivo experiments. This scientific evidence will be invaluable when considering the application of S-217622 as a medication for COVID-19.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 41. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.10.22270728: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the Institutional Review Board at each site.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Eligible patients for this study were those included in the 4CE COVID-19 cohort: all hospitalized patients (pediatric and adult) with their first positive SARS-CoV-2 PCR test seven days before to 14 days after hospitalization.2 Chart Review: Each development site randomly sampled an equal number of admissions in each quarter (BIDMC, MGB) or month (NWU, UPITT) from their cohort of SARS-CoV-2 PCR positive patients over the period March 2020 until at least March 2021.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A trendline was fitted with loess regression using ggplot2 and was weighted by the number of chart reviews performed that month.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.13.22270911: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study population: This study complies with the Declaration of Helsinki, patients were prospectively enrolled in 4DCT data registry, approved by the Institutional Review Board IRB</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were performed using IBM SPSS Statistics version 25 (SPSS Inc, IL, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Although two-dimensional TEE has improved temporal resolution as compared with a gated cardiac CT, more pronounced in patients with elevated heart rates, we were able to obtain diagnostic quality imaging on patients with a mean HR of 97 bpm on the initial arterial acquisition, demonstrating that widening the R-R interval window helped counteract the inherent limitations in temporal resolution of cardiac CT. An interesting finding in our study is the association between the prior history of stroke and characteristics of the filling defects on the cardiac CT. Similar to LAA blood flow velocity interrogated on TEE with doppler (23), the presence of “slow flow” or definite thrombus on the cardiac CT was associated with prior stroke history. These 2 patient subgroups also had lower LVEF and increased prevalence of persistent atrial fibrillation, which highlights the interplay between LA and LAA function with thromboembolic risk. With the COVID-19 pandemic suddenly straining hospitals and healthcare resources without significant preparation beginning in March 2020, our system decided to implement cardiac CT driven cardioversion for patients with uncontrolled AF or AFL (24). Given the local and national shortages of PPE, and unclear modes of viral transmission, cardiac CT allowed diversion of essential resources and personnel toward other procedures instead of TEEs. This enabled us to treat patients who could not be managed with rate control strategies or failed anti-arrhythmic medi...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.14.480298: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.14.480460: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The protocol was approved by the Institutional Animal Care and Use Committee (IACUC) at UTMB.<br>IRB: The use of human COVID-19 sera was reviewed and approved by the UTMB Institutional Review Board (IRB#: 20-0070).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Hamster immunization and challenge assay: Four- to six-week-old male golden Syrian hamsters, strain HsdHan:AURA (Envigo, Indianapolis, IN), were immunized intranasally with 100 µl WT virus (106 PFU, n=20) or Δ3678 mutant virus (106 PFU, n=20)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Statistics: Hamsters and mice were randomly allocated into different groups.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">The blinded tissue sections were semi-quantitatively scored for pathological lesions.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">No statistical methods were used to predetermine sample size.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All cell lines were verified and tested negative for mycoplasma.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-STAT1 (14994S, 1:1,000), anti-pSTAT1 (Y701) (7649S, 1:1,000), anti-STAT2 (72604S, 1:1,000), anti-pSTAT2 (Y690) (88410S, 1:1,000) antibodies were from Cell Signaling Technology (Danvers, MA); anti-GAPDH (G9545, 1:1,000) antibodies were from Sigma-Aldrich; SARS-CoV-2 (COVID-19</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-STAT1</div><div>suggested: (Cell Signaling Technology Cat# 14994, RRID:AB_2737027)</div></div><div style="margin-bottom:8px"><div>anti-pSTAT1 ( Y701</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-STAT2</div><div>suggested: (Cell Signaling Technology Cat# 72604, RRID:AB_2799824)</div></div><div style="margin-bottom:8px"><div>anti-pSTAT2 ( Y690 ) ( 88410S , 1:1,000 ) antibodies were from Cell Signaling Technology ( Danvers , MA)</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-GAPDH</div><div>suggested: (Sigma-Aldrich Cat# G9545, RRID:AB_796208)</div></div><div style="margin-bottom:8px"><div>G9545</div><div>suggested: (Sigma-Aldrich Cat# G9545, RRID:AB_796208)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) nucleocapsid antibody (NB100-56576, 1:1000) were from Novus Biologicals (CO, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NB100-56576</div><div>suggested: (Novus Cat# NB100-56576, RRID:AB_838838)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antiviral testing: A549-hACE2 cells were used to evaluate the efficacy of a monoclonal antibody IgG14 and antiviral drug remdesivir.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antiviral drug remdesivir.</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero-E6-TMPRSS2 cells were purchased from SEKISUI XenoTech, LLC (Kansas City, KS) and maintained in 10% fetal bovine serum (FBS; HyClone Laboratories, South Logan, UT) and 1% P/S and 1 mg/ml G418 (Gibco).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human lung adenocarcinoma epithelial Calu-3 cells (ATCC, Manassas, VA, USA) were maintained in a high-glucose DMEM containing sodium pyruvate and GlutaMAX (Gibco) with 10% FBS and 1% penicillin/streptomycin at 37°C with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Suppression of STAT1 phosphorylation by ORF3a protein: A549-hACE2 cells were pre-treated with 1,000 units/ml IFN-α for 6 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-hACE2</div><div>suggested: RRID:CVCL_A5KB)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The diluted serum was incubated with 100-150 fluorescent focus units (FFU) of mNG SARS-CoV-2 at 37°C for 1 h (final dilution range of 1:20 to 1:20,480), after which the serum-virus mixtures were inoculated onto the pre-seeded Vero-E6 cell monolayer in 96-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">K18-hACE2 mice were purchased from the Jackson Laboratory (Bar Harbor,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BALB/c mice were purchased from Charles River Laboratories (Wilmington, MA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A nonlinear regression method with log (inhibitor) vs. response-variable slope (four parameters) model (bottom and top parameters were constrained to 0 and 100, respectively) was used to determine the dilution fold that neutralized 50% of mNG SARS-CoV-2 (defined as FFRNT50) in GraphPad Prism 9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The curves of the relative infection rates versus the concentration were plotted using Prism 9 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were performed in Prism version 9.0 (GraphPad, San Diego, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      One limitation of the current study is that we have not defined the attenuation mechanisms of the ORF 3b, 6, 7b, or 8 deletion, even though they reduced the lung viral loads in the K18- hACE2 mice (Fig. 5b). SARS-CoV-2 ORF8 protein was recently reported to contain a histone mimic that could disrupt chromatin regulation and enhance viral replication45. Truncations or deletions of ORF7b and ORF8 were reported in SARS-CoV-2 clinical isolates46, 47. Future studies are needed to understand the molecular functions of OFR 3b, 6, and 7b proteins. Nevertheless, our results indicate that Δ3678 virus could serve as a live-attenuated vaccine candidate and as an experimental system that can likely be performed at BSL-2 for COVID-19 research and countermeasure development.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.14.480449: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mouse vaccination: Vaccine immunogenicity study used 6 weeks old female C57BL/6Ncr (B6) mice purchased from Charles River.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Replication, randomization, blinding and reagent validations: Biological or technical replicate samples were randomized where appropriate.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Replication, randomization, blinding and reagent validations: Biological or technical replicate samples were randomized where appropriate.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All cell lines tested negative for mycoplasma.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed twice after the primary stain and incubated with PE–anti-human Fc antibody (Biolegend, 410708) in MACS buffer for 20 min on ice.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PE–anti-human Fc antibody ( Biolegend , 410708</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-mouse secondary antibody (Fisher, Cat# A-10677) at 1:2500 dilution in blocking buffer was incubated at room temperature for one hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-mouse</div><div>suggested: (Thermo Fisher Scientific Cat# A-10677, RRID:AB_2534060)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Validation of LNP-mRNA mediated spike expression in vitro and receptor binding capability of expressed Omicron HexaPro spikes: On day 1, HEK293T cells were seeded at 50% confluence in 24-well plate and mixed with 2 μg Omicron LNP-mRNA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293FT cells were seeded in 150 mm plates, and transfected with 21 μg pHIVNLGagPol, 21 μg pCCNanoLuc2AEGFP, and 7.5 μg of corresponding plasmids, in the presence of 198 μl PEI (1mg/ml, PEI MAX, Polyscience).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293FT</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To normalize pseudovirus tilter, 0.01 x106 293T-hACE2 cells were plated in each well of a 96-well plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-hACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse vaccination: Vaccine immunogenicity study used 6 weeks old female C57BL/6Ncr (B6) mice purchased from Charles River.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6Ncr</div><div>suggested: RRID:MGI:2160593)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The accessory plasmids for pseudovirus assay including pHIVNLGagPol and pCCNanoLuc2AEGFP were from Dr.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCCNanoLuc2AEGFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1.1.529 variant S protein (Omicron variant-Δ19) were made based on the pSARS-CoV-2-Δ19.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSARS-CoV-2-Δ19</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data was collected on BD FACSAria II Cell Sorter (BD) and analyzed using FlowJo software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The 50% inhibitory concentration (IC50) was calculated with a four-parameter logistic regression using GraphPad Prism (GraphPad Software Inc.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The statistical significance was labeled as follows: n.s., not significant; * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001. Prism (GraphPad Software) and RStudio were used for these analyses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Schematic illustrations: Schematic illustrations were created with Affinity Designer or BioRender.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioRender</div><div>suggested: (Biorender, RRID:SCR_018361)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      While a limitation of our study is that these are animal data, although the antibody responses to vaccination is highly conserved between mouse and human (and that the mouse is a widely used preclinical model by major vaccine makers36,37). In fact, a very recent report showed waning immunity in vaccinated individuals24 and that a booster shot using the original WA-1 based mRNA vaccine helps recover partial immunity. However, the neutralizing antibody titers even after the boost with a WA-1 based vaccine titer were still significantly lower against Omicron as compared to WA-1 and other variants, urging for development and testing of an Omicron-specific vaccine not studied before. We tested the Omicron-specific LNP-mRNA vaccine candidate in the context of WA-1 vaccinated animals. While animals almost completely lost antibody protection against Omicron even though they received two doses of WA-1 mRNA vaccine 3.5 months ago, our results showed that a single dose of Omicron mRNA vaccination boosted neutralizing antibody titers over 1000-fold against Omicron. In addition, the Omicron-specific vaccine also brought back neutralizing titers against WA-1 and Delta variants to a level comparable to peak titers by WA-1 mRNA vaccine. The Omicron booster shot provided superior protection against Omicron variant and comparable humoral defense against WA-1 and Delta variants. Such surge of antibody titer by Omicron booster shot, and the neutralization activities against WA-1 and Delta, two o...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 32. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.08.22270635: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Two physicians independently reviewed the identified patient records and applied the CDC myocarditis and pericarditis surveillance case definition to classify records as confirmed, probable or excluded based on the prior published definition. (2) KP’s institutional review board approved the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      (3) VAERS is passive system relying on patients or providers to report; but limitations include both over and under reporting. (4) Active surveillance by the VSD has not yet reported a risk of myopericarditis following booster vaccinations, although we would anticipate under-estimation due to limitations in their methodology. (1) Israel reported the risk of myopericarditis following booster dose as 4.7 cases per 100,000 in men age 20-24. (5) Myopericarditis occurs following booster doses and may be underreported by current surveillance methods. Completeness or high sensitivity of these case estimates are essential when modeling risk and benefit for wide-scale vaccine implementation and sequential COVID-19 vaccinations for the general population.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.10.22270797: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical review for this study was obtained by the Institutional Review Board of Clemson University.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.07.22270630: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Data and statistical analysis: Monthly male and female recorded live births, from the national birth registration system, were obtained from Statistics South Africa’s publicly available annual reports [17].</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.13.22270891: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.11.22270831: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">We considered cohort studies, nested cohort studies, case–control or cross-sectional studies, and randomized studies.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Search strategy: We performed a search of the databases PubMed</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, Web of Science, medRxiv, and bioRxiv.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>bioRxiv</div><div>suggested: (bioRxiv, RRID:SCR_003933)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.14.480317: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study approval: This study was approved by the Colorado Multiple Institutional Review Board (COMIRB# 20-1219) at the University of Colorado Anschutz Medical Campus.<br>Consent: All participants provided written informed consent prior to any study procedures.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry: Cells were analyzed using a LSRII flow cytometer (BD Immunocytometry Systems).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Immunocytometry Systems</div><div>suggested: (South Florida University College of Medicine Fred Wright Jr Flow Cytometry Core Facility, RRID:SCR_017901)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To ensure accuracy and precision of the measurements taken from day-to-day, quality control was performed on the LSRII daily using the Cytometer Setup & Tracking (CS&T) feature of the BD FACSDiva software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD FACSDiva</div><div>suggested: (BD FACSDiva Software, RRID:SCR_001456)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A manual quality control (QC) using rainbow beads was also performed daily to verify the laser delay and area scaling determined by CS&T. Statistics: Statistical analyses were performed using GraphPad-Prism (Graphpad, San Diego, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Both of these student T and permutation tests of the SPICE analysis were corrected for 21 concurrent comparisons(54).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPICE</div><div>suggested: (SPICE, RRID:SCR_016603)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 31. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.13.22270856: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: As part of a longitudinal study started in 2001, individuals who reside in the community (defined as sleeping 3 nights or more per week in Pau da Lima), aged 2 years or more and who consented (parental consent for minors) were recruited into an open cohort and participated in household and serological surveys conducted annually or biannually.<br>IRB: Ethical considerations: The study was approved by the Institutional Review Boards of the Gonçalo Moniz Institute, Oswaldo Cruz Foundation (Fiocruz) and the Brazilian National Commission for Ethics in Research (CAAE 35405320.0.1001.5030 and 17963519.0.0000.0040), and the Yale University Human Research Protection Program (2000031554).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">As we noted a higher seroprevalence among women compared to men, we conducted a similar analysis among the subset of adult participants (aged ≥18 years), to assess whether the association between gender and SARS-CoV-2 exposure was mediated by income, employment, and household structure in this population.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Ethical considerations: The study was approved by the Institutional Review Boards of the Gonçalo Moniz Institute, Oswaldo Cruz Foundation (Fiocruz) and the Brazilian National Commission for Ethics in Research (CAAE 35405320.0.1001.5030 and 17963519.0.0000.0040), and the Yale University Human Research Protection Program (2000031554).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Human Research Protection Program</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      We were able to collect detailed demographic and socioeconomic data at both individual and household levels and overcome the limitations of previous studies. Although a few studies have investigated COVID-19 risk in slum compared to non-slum areas, none to date has examined the gradients of risk within a slum community. Our findings suggest that even within an overall socioeconomically deprived environment, there is a gradient of risk associated with income, employment, and household composition. We found that children in this urban slum setting had high SARS-CoV-2 seroprevalence, significantly greater than observed in adults, which sharply contrasts with patterns of transmission in high-income countries and urban populations within these countries. Most studies to date have reported lower or similar seroprevalence of COVID-19 among children compared to adults during the early phase of the pandemic [21]. Serosurveys relying on residual clinical samples have reported higher prevalence among children, but may not be reflective of the general population of children who do not regularly undergo blood draws [22–24]. The community-based design of our study allows for better comparability of seroprevalence between children and adults. Prior studies of respiratory viruses such as influenza showed that school-aged children are reservoirs of transmission [25,26] but it remains unclear whether this is the case with SARS-CoV-2, particularly in densely populated and socially deprived envi...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.13.22270755: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.14.22268832: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.


      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Limitations: This study focuses on exploiting the textual information of Twitter but doesn’t extract any further metadata such as users’ information. However, a preliminary experience that we conducted earlier showed that the medical professionals seem to be excluded of the debate on social networks, except for a few personalities who are against a potential vaccine. This could lead to a better understanding of the observed dynamics. Another limitation relies on the performances of the sentiment analysis. The model could achieve better performances in the near future with better parameters’ optimization and further exploration of other approaches. Models that are unsupervised like zero-shot learning could be interesting for additional investigations. Related work: Mistrust about COVID-19 vaccine has spread widely across social media. Consequently, its influence was able to reach a large part of the population. This mistrust situation was causing concern for health authorities, including the WHO, which lists vaccine mistrust as one of the 10 biggest threats on global health in 2019 next to the threat of a pandemic [35]. According to [36], there are many reasons for this mistrust: One may be doubtful of the vaccine benefit, there may be concerns about long term unexpected side effects, marketing of vaccines may be considered as a mere commercial operation where vendors are profiteering from patients, and one may have a preference for natural immunity rather than getting immunit...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.11.22270833: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      It should be emphasized that the preselection of blood donors as study cohort is accompanied by limitations regarding representation of the population: Blood donors are between 18 and 65 years-old, young healthy adults are usually overrepresented and other groups (e.g. children, HIV/HCV/HBV-infected patients, older people with underlying conditions, institutionalised people) are excluded or underrepresented. Nevertheless, our findings suggest that there are a large number of unrecorded cases throughout the whole one-year study period. As mentioned in other studies [14], our data therefore reinforces, that longitudinal seroprevalence studies are helpful to better assess the actual incidence of infection within the respectively considered region.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.11.22270844: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.12.22270893: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical approval was taken from Institutional Review Board (IRB) of CMH Bogura.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data was compiled, presented and analyzed using Microsoft Excel 2007, and was expressed as percentage.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.10.22270733: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All donor provided informed consent to participate in the study.<br>IRB: The study of patients with COVID-19 and vaccinations against COVID-19 was approved by the ethics committee of the medical faculty of the Philipps-University Marburg (study number 40/21-12032021).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After discarding the supernatants, pellets were resuspended in 50 µL Brilliant Violet Staining Buffer (Biolegend) supplemented with antibodies including anti-CD4-PECy7 (1:400 dilution) for the detection of CD4 T cells, anti-CD8-BV570 (1:100 dilution), and anti-CD19/123/33-BV510 (all from Biolegend at 1:50,1:50, 1:400 dilution, respectively) for the exclusion of CD8 T cells, monocytes and other myeloid cells, B cells, basophils, and plasmacytoid dendritic cells, and incubated 30 minutes in the dark, at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD4-PECy7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD8-BV570</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD19/123/33-BV510</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell pellets were then washed twice in 200 µL permeabilization buffer (diluted using Millipore water from 10 x concentrated stock buffer, ThermoFisher, Waltham, MA), and finally resuspended in 50 µL permeabilization buffer supplemented with antibodies targeting CD40L (1:100 dilution conjugated to BV421, Biolegend), and intracellular molecules including anti-IFNγ-R718 (1:100 dilution BD Biosciences, San Jose, CA), and incubated for 30 minutes at room temperature in the dark.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD40L</div><div>suggested: (BioLegend Cat# 310823, RRID:AB_10933251)</div></div><div style="margin-bottom:8px"><div>BV421</div><div>suggested: (BioLegend Cat# 658709, RRID:AB_2563283)</div></div><div style="margin-bottom:8px"><div>anti-IFNγ-R718</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following incubation at 37 °C for 1 h, approximately 20,000 Vero C1008 cells (ATCC, Cat. no. CRL-1586, RRID: CVCL_0574) were added.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero C1008</div><div>detected: (IZSLER Cat# BS CL 87, RRID:CVCL_0574)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FlowJo version 10 (BD, Ashland, OR) and OMIQ.ai (Santa Clara, CA) were used for analyzing flow cytometry data.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantification of SARS-CoV-2-specific antibodies: Serum IgG antibodies against the receptor-binding domain (RBD) of the SARS-CoV-2 spike protein were quantified using the automated SARS-CoV-2-IgG-II-Quant-Assay on the Abbott Alinity i analyzer (Abbott, Wiesbaden, Germany), following the manufacturer’s protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis details: Prism version 9 (GraphPad software, San Diego, CA) was used to display data, and perform descriptive statistics and significance testing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.11.22270843: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      This study is subject to several limitations. First, students had only one opportunity to participate in TTR; some may have pre-tested or delayed TTR to ensure a negative school-administered test. If all persons meeting time and symptom criteria had tested on day 5 or 6, the positivity rate would likely have been higher. Second, the correlation between RAT and culture-positivity is not yet understood for the Omicron variant, although preliminary data suggests that RAT remains sensitive when viral load is high by RT-PCR.8 Implementation of TTR programs in schools has both advantages and costs. Compared to schools that allow return on day 6 without TTR, schools with TTR programs may have fewer school-associated transmissions, but more missed school days. However, as an alternative to isolation through day 10, TTR programs will reduce the number of missed school days. While TTR programs may identify those individuals who still carry replication-competent virus, spread in schools has been rare when masks are worn consistently; further, the risk of school-associated transmission during days 6-10 is not known. When return occurs prior to day 11 without TTR, districts should assume that some students could still be infectious. For students on days 6-10, strict adherence to masking (consistent with CDC guidance) and safe distance during unmasked periods, including lunchtime, are essential.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.14.22270857: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study approval: The procedures followed in the study were approved by the Careggi University Hospital Ethical Committee.<br>Consent: Written informed consent was obtained from recruited patients.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Evaluation of SARS-CoV-2-specific IgM and IgG: Evaluation of anti-Spike protein (in trimeric form) IgG (Diasorin); anti-Spike protein IgM (Abbot), anti-Nucleoprotein IgG (Abbott), neutralizing antibodies which block binding of Spike protein with the ACE2 receptorAb (Dia.Pro Diagnostic Bioprobes) was performed following manufacturers’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Spike protein (in trimeric form) IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Spike protein IgM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Nucleoprotein IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry experiments were performed using published guidelines (Cossarizza et al., 2021) Measurement of Human Anti-IFN-α antibodies: Titres of anti-IFN-α antibodies were measured via enzyme-linked immunosorbent assay (Invitrogen) on patients’ sera, according to manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-IFN-α</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were acquired on a BD LSR II flow cytometer (BD Biosciences) and analysed with FlowJo v10 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cultures were performed in medium alone (background, negative control), with a pool of Spike SARS-CoV-2 peptide pools (Prot_S1, Prot_S+ and Prot_S to achieve a complete sequence coverage of the Spike protein), or with a pool of peptide pools covering nucleoprotein and membrane protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prot_S</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.12.22270892: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.10.22270817: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was submitted and approved by Ethics Committee of Faculty of Medicine (Universidade Federal Fluminense) and Prontobaby Group, under number 4.100.232 dated from June 20, 2020.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A descriptive analyses of age, gender, lengh of stay, outcomes and vaccinal status was performed using Microsoft Excel.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.10.22270789: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics approval was received from the University of Pretoria, Human Research Ethics Committee (Medical) (247/2020).<br>Consent: Written informed consent was obtained from all participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody-dependent cellular phagocytosis (ADCP) assay: Avitagged SARS-CoV-2 spikes were biotinylated using the BirA biotin-protein ligase standard reaction kit (Avidity, LLC) and coated onto fluorescent neutravidin beads as previously described32.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antibody-dependent cellular phagocytosis (ADCP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody-dependent cellular cytotoxicity (ADCC) assay: The ability of plasma antibodies to cross-link and signal through FcγRIIIa (CD16) and spike expressing cells or SARS-CoV-2 protein was measured as a proxy for ADCC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD16</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 antigens: For ELISA and ADCP assays, SARS-CoV-2 original and Beta variant full spike (L18F, D80A, D215G, K417N, E484K, N501Y, D614G, A701V, 242-244 del), Delta (T19R, 156-157del, R158G, L452R, T478K, D614G, P681R and D950N) and Omicron (A67V, Δ69-70, T95I, G142D, Δ143-145, Δ211, L212I, 214EPE, G339D, S371L, S373P, S375F, K417N, N440K, G446S, S477N, T478K, E484A, Q493R, G496S, Q498R, N501Y, Y505H, T547K, D614G, H655Y, N679K, P681H, N764K, D796Y, N856K, Q954H, N969K, L981F) proteins were expressed in Human Embryonic Kidney (HEK) 293F suspension cells by transfecting the cells with the respective expression plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phagocytosis score was calculated as the percentage of THP-1 cells that engulfed fluorescent beads multiplied by the geometric mean fluorescence intensity of the population less the no antibody control.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>THP-1</div><div>suggested: CLS Cat# 300356/p804_THP-1, RRID:CVCL_0006)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For spike assays, HEK293T cells were transfected with 5μg of SARS-CoV-2 spike plasmids using PEI-MAX 40,000 (Polysciences) and incubated for 2 days at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Jurkat-Lucia™ NFAT-CD16 cells (Invivogen) (2×105 cells/well and 1×105 cells/well for spike and other protein respectively) were added and incubated for 24 hours at 37°C, 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NFAT-CD16</div><div>suggested: RRID:CVCL_A7ZT)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike plasmid and Lentiviral Pseudovirus Production: The SARS-CoV-2 Wuhan-1 spike, cloned into pCDNA3.1 was mutated using the QuikChange Lightning Site-Directed Mutagenesis kit (Agilent Technologies) and NEBuilder HiFi DNA Assembly Master Mix (NEB) to include D614G (original) or lineage defining mutations for Beta (L18F, D80A, D215G, 242-244del, K417N, E484K, N501Y, D614G and A701V), Delta (T19R, 156-157del, R158G, L452R, T478K, D614G, P681R and D950N), C.1.2. (P9L, P25L, C136F, Δ144, R190S, D215G, Δ242-243, Y449H, E484K, N501Y, L585F, D614G, H655Y, N679K, T716I, T859N) or Omicron (A67V, Δ69-70, T95I, G142D, Δ143-145, Δ211, L212I, 214EPE, G339D, S371L, S373P, S375F, K417N, N440K, G446S, S477N, T478K, E484A, Q493R, G496S, Q498R, N501Y, Y505H, T547K, D614G, H655Y, N679K, P681H, N764K, D796Y, N856K, Q954H, N969K, L981F)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Other pcDNA plasmids were used for the ADCC assay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA</div><div>suggested: RRID:Addgene_66792)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">THP-1 cells were used for both the ADCP and ADCT assays and obtained from the AIDS Reagent Program, Division of AIDS, NIAID, NIH contributed by Dr. Li Wu and Vineet N. KewalRamani.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AIDS Reagent Program</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">QUANTIFICATION AND STATISTICAL ANALYSIS: Analyses were performed in Prism (v9; GraphPad Software Inc, San Diego, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.10.22270772: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.11.22270848: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Ethics: Written informed consent was obtained from all participants.<br>IRB: The study protocols were approved by the Institutional Review Board of the University of Hong Kong.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      There are a number of limitations of our study. First, we did not measure neutralizing antibody against live SARS-CoV-2 but used a surrogate neutralization assay which has a high correlation with live virus neutralization titers [16]. We did not assess antibodies against variants such as Delta or Omicron, but expect antibody levels to be reduced against variants as reported in other studies [16, 17]. We did not assess T cell responses which could contribute to protection against severe disease and could be less affected by variants [18]. In conclusion, we identified weaker boosting and faster waning of antibodies against SARS- CoV-2 in recipients of CoronaVac compared to BNT162b2, and would expect this to correlate with lower levels of protection against symptomatic infection for CoronaVac. In individuals of any age or sex, BNT162b2 responses were stronger and more durable than responses to CoronaVac. The weaker and less durable responses following CoronaVac support earlier provision of third doses to persons who previously received two doses of this vaccine.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.13.22270825: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants gave informed consent, and the study was approved by the ethics committee of the University of Occupational and Environmental Health, Japan (reference No. R2-079 and R3-006).<br>IRB: All participants gave informed consent, and the study was approved by the ethics committee of the University of Occupational and Environmental Health, Japan (reference No. R2-079 and R3-006).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Finally, 6,486 individuals (2,779 men, 3,707 women) who were not married and who were not in a romantic relationship at baseline were included in the analysis.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">: Release 16; StataCorp LLC, TX, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      In the COVID-19 pandemic, various external stresses including economic problems, loneliness, employment instability, physical limitations, and limited social activities can make it difficult for couples to function in a complementary and supportive manner, and diminish romantic relationships. Working under a high perceived risk of infection can lead to negative attitudes toward one’s partner or potential partner and a decline in the relationship, as one’s self-regulatory capacity is depleted because of the effort required to avoid crisis. Adequate infection control measures in the workplace can alleviate the external stress and anxiety that COVID-19 brings to couples, including the anxiety that infection may be introduced to couples and families; they can help maintain good dyadic adjustment and psychological well-being, and thereby the quality of the relationship. We chose socioeconomic factors related to marriage as confounding factors in this study because romantic activities are in some ways similar to those of marriage, albeit that the sociodemographic drivers of romantic activities are not clear. Even after adjusting for factors such as age, income, and health status, we found an association between workplace infection control and romantic activity. This result implies that the mechanisms underlying the association of adequate workplace infection control with romantic activity may depend on factors other than socioeconomic ones. It has been reported that infection contr...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.13.22270896: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants provided written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PBMC were surface stained with fluorescently labeled antibodies to CD3 (FITC), CD19 (PE/Cyanine7), CD4 (PerCP/Cyanine5.5), CD8a (APC), CD56 (BV421), and CD16 (PE) in the dark at 4°C for 30 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD19</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD4</div><div>suggested: (BioLegend Cat# 391503, RRID:AB_2721611)</div></div><div style="margin-bottom:8px"><div>CD8a</div><div>suggested: (Meridian Life Science Cat# MAL16-154, RRID:AB_1070035)</div></div><div style="margin-bottom:8px"><div>CD56</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>BV421</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD16</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell Lines: HEK293T cells were purchased from Procell and cultured in DMEM supplemented with 10% fetal bovine serum (FBS).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Since SARS-CoV-2 uses the SARS-CoV receptor angiotensin-converting enzyme 2 (ACE2) for entry and the transmembrane serine protease 2 (TMPRSS2) for S protein priming, we co-transfected plasmids encoding ACE2 (pLV-ACE2-3xFLAG-IRES-puro, HedgehogBio Science and Technology Ltd.) and TMPRSS2 (pLV-TMPRSS2-GFP, Sino Biological) into 293T cells to generate a stable cell line.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: KCB Cat# KCB 200744YJ, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization assays were performed on 293T-ACE2-TMPRSS2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Since SARS-CoV-2 uses the SARS-CoV receptor angiotensin-converting enzyme 2 (ACE2) for entry and the transmembrane serine protease 2 (TMPRSS2) for S protein priming, we co-transfected plasmids encoding ACE2 (pLV-ACE2-3xFLAG-IRES-puro, HedgehogBio Science and Technology Ltd.) and TMPRSS2 (pLV-TMPRSS2-GFP, Sino Biological) into 293T cells to generate a stable cell line.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLV-ACE2-3xFLAG-IRES-puro</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pLV-TMPRSS2-GFP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">15 Statistical analysis: Data and statistical analyses were performed using GraphPad Prism 8.0.2 and SPSS 26.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry data were analyzed using FlowJo 10.4.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.11.22270775: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the Wales Research Ethics Committee 3 (Ref: 20/WA/0210) and all participants provided written, informed consent.<br>Consent: The study was approved by the Wales Research Ethics Committee 3 (Ref: 20/WA/0210) and all participants provided written, informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Female participants of childbearing potential were required to provide a negative pregnancy test before commencement of trial medication and on Day 14, and to use highly effective contraceptive measures during the trial; male participants with a female partner of childbearing potential were also required to use highly effective contraception.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The ITT population is composed of all randomised participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Trial medication kits, prepared by RenaClinical Ltd, were coded to maintain double blinding (investigators and participants)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Simulations showed a total of 216 participants would provide 90% power with two-sided alpha of 2.5% to detect a 0.9 log10 decrease in viral load of each active treatment on its own compared to placebo.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Kits contained favipiravir or colour and size matched placebo 200 mg tablets supplied by Fujifilm Toyama Chemical Co., Ltd and lopinavir-ritonavir 200mg/50 mg tablets (AbbVie Ltd) or colour and size matched placebos (RenaClinical Ltd).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AbbVie</div><div>suggested: (AbbVie, RRID:SCR_010484)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Our study has some limitations. The recruited cohort was relatively young and healthy with lower viral loads than many reported elsewhere in the literature. We were unable to perform viral culture or infectivity assays which may have provided useful additional information. For logistical reasons, we were unable to obtain samples for pharmacokinetics on every participant in the study. In conclusion, our results do not support routine usage or Phase 3 trials of favipiravir or lopinavir-ritonavir at the doses investigated. However, the results may indicate an effect of favipiravir when used for early treatment of COVID-19, especially in those with high baseline viral load, but further investigation is needed regarding dosing schedule or additive medication. Another relatively small study would be sufficient to establish this. We have conclusively demonstrated the ineffectiveness of lopinavir-ritonavir even in early disease and have identified a new drug interaction between favipiravir and lopinavir-ritonavir with the latter apparently lowering plasma levels of the former. These results have important implications for the global efforts against COVID-19.


      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04499677</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">FLARE: Favipiravir +/- Lopinavir: A RCT of Early Antivirals</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.14.22270927: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PubMed (https://pubmed.ncbi.nlm.nih.gov/) and Embase (https://www.embase.com/) were interrogated on January 21, 2021 using the search terms and criteria in Supplemental Table 1 to identify studies reporting on the sensitivity and specificity of commercially available sample-to-answer tests for RSV in patients with acute respiratory infection published between January 2005 and January 2021.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div><div style="margin-bottom:8px"><div>Embase</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div><div style="margin-bottom:8px"><div>https://www.embase.com/</div><div>suggested: (Embase Biomedical Answers, RRID:SCR_008498)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data Reporting: All data handling was carried out using Microsoft Excel 365 (Microsoft Corporation).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      An inherent limitation of scoping reviews is that the data synthesis is based on the values extracted from any given study; therefore, results may not be comparable in terms of methodology, limiting the meaningful conclusions that can be drawn from differences in the sensitivity and specificity between RSV tests from different studies. However, the purpose of this scoping review was not to analyze but to summarize the published data available. Future research should assess the sensitivity and specificity of RSV tests in adult populations and in outpatient and household settings. In addition, studies should control for selection bias and adjust for differences in settings where the RSV test was performed, seasonality, and staff utilization of RSV tests. The use of POC testing for influenza and RSV across four centers in Denmark resulted in a significant reduction in antibiotic prescription and median hospitalization time in adults (44.3 hours) and children (14.2 hours), there was also an increase in the use of antiviral treatment in adults only (18). These positive results indicate that further studies are warranted to explore the effects of testing for RSV on patient outcomes (43). In conclusion, different clinical situations (e.g., the clinical laboratory of a large hospital vs an outpatient clinic) will require different diagnostic solutions. Given the higher sensitivity and specificity of molecular-based testing over antigen-based modalities for RSV infection, rRT-PCR test...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.10.22270721: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used data on the proportion of the population with SARS-CoV-2 antibodies to the nucleocapsid by late April 2021 to compare with our excess death estimates at the end of April 2021, given a similar delay between infection and death and infection and rise in antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Our study is subject to several limitations. First, mortality counts below the minimum cut-off value of 10 were suppressed due to privacy regulations. As a result, our age-specific analyses are restricted to larger states, and we could not assess the role of race/ethnicity. Prior work has shown important disparities in COVID-19 impact by race/ethnicity and economic status (Mena et al., 2021; Rossen, 2021) in the US and abroad. Second, official coding practices may have changed between states and through time based on SARS-CoV-2 testing availability, location of death, demographic factors, and comorbidities. Third, we find periods of negative excesses in cancer (throughout the pandemic), cardiovascular, and heart diseases (fall 2020), possibly due to changes in ascertainment of underlying cause of death (e.g. a death in a cancer patient with COVID-19 is ascribed to COVID-19) or harvesting (Saha et al., 2013). As discussed earlier, harvesting could also have affected estimates in oldest age groups. Similarly, we can’t account for changes in baseline respiratory mortality due to depressed circulation of endemic pathogens other than influenza. Finally, our study ends in April 2021 and does not capture a recrudescence of COVID19-related deaths due to the more transmissible Delta variant, primarily in states with low vaccine coverage, nor do we estimate the impact of the Omicron immune escape variant. As a result, our excess mortality estimates should be deemed conservative. Pandem...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.13.480261: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Electrostatic potential surfaces of proteins: Electrostatic potential surfaces were computed using APBS v1.5 (at zero ionic concentration)12 and visualized using pymol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pymol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.12.480218: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The Institutional Animal Use and Care Committee approved these experiments (study protocol# 21702).<br>Field Sample Permit: Trachea collection and cell processing: Upon necropsy, tracheobronchial tissues were collected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">All animals were challenged through combined intratracheal (IT, 2.0 mL for dams, 1 ml for infants) and intranasal (IN, 0.2 5 mL per nostril) inoculation with an infectious dose of 2.5 × 10^6 PFU for the dams and 1.5 × 10^6 PFU for the infants of SARS-CoV-2 (2019-nCoV/USA-WA1/2020).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Radiographs were scored for the presence of pulmonary infiltrates by a board-certified veterinary radiologist, who was blinded to the experimental group and time point, according to a standard scoring system (0: normal; 1: mild interstitial pulmonary infiltrates; 2: moderate pulmonary infiltrates perhaps with partial cardiac border effacement and small areas of pulmonary consolidation; 3: severe interstitial infiltrates, large areas of pulmonary consolidation, alveolar patterns and air bronchograms).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Paraffin sections were treated in an antigen unmasking solution (Vector) at 100°C for 20 minutes before incubation with a primary antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen unmasking solution (Vector)</div><div>suggested: (Vector Laboratories Cat# H-3301, RRID:AB_2336227)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293 T/ACE2 cells were provided by M. Farzan and H. Mu at Scripps Florida.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>T/ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK 293T cells expressing ACE2 receptors were suspended using TrypLE Select Enzyme solution (Thermo Fisher Scientific) and immediately added to all wells (10,000 cells in 100 μl of growth medium per well).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirions were produced in HEK293 T/17 cells (American Type Culture Collection, catalog no. CRL-11268) by transfection using Fugene 6 (Promega, catalog no. E2692) and a combination of S plasmid, lentiviral backbone plasmid (pCMV ΔR8.2), and firefly Luc reporter gene plasmid (pHR’ CMV Luc) (78) in a 1:17:17 ratio.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV ΔR8.2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis of the bulk RNA-seq data: RNA-Seq data was quality checked with FastQC (59) and preprocessing was carried out using TrimGalore (60) toolkit to trim low-quality bases and Illumina adapter sequences using default settings.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FastQC</div><div>suggested: (FastQC, RRID:SCR_014583)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reads were aligned to the ENSEMBL Homo_sapiens.GRCh38.dna.primary_assembly genome using the ENSEMBL Homo_sapiens.GRCh38.100 transcript (61) annotation file with STAR (62) splice-aware RNA-seq alignment tool in paired mode allowing maximum multimapping of 3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ENSEMBL</div><div>suggested: (Ensembl, RRID:SCR_002344)</div></div><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_004463)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene level counts were quantified using FeatureCounts (63) tool, counting unique features in non-stranded mode and retaining both gene ID, gene name, and gene biotype mapping from the ENSEMBL annotation file.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FeatureCounts</div><div>suggested: (featureCounts, RRID:SCR_012919)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Normalization and differential expression were carried out with DESeq2 (64)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bioconductor (65) package, utilizing the ‘apeglm’ Bioconductor package (66) for log fold change shrinkage, in R statistical programming environment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bioconductor</div><div>suggested: (Bioconductor, RRID:SCR_006442)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The RNA-seq data was processed using the TrimGalore toolkit1 which employs Cutadapt2 to trim low quality bases and Illumina sequencing adapters from the 3’ end of the reads.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TrimGalore</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene counts were compiled using the HTSeq tool5.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HTSeq</div><div>suggested: (HTSeq, RRID:SCR_005514)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Normalization and differential expression was carried out using the DESeq26 Bioconductor7 package with the R statistical programming environment8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq26</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Bioconductor7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene set enrichment analysis9 was performed to identify gene ontology terms and pathways associated with altered gene expression for each of the comparisons performed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene set enrichment</div><div>suggested: (Gene Set Enrichment Analysis, RRID:SCR_003199)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Our study has limitations. Firstly, we only infected two dam-infant macaque pairs and more animal numbers are needed to determine statistical differences. Additionally, a mock-inoculated control group is necessary to decipher whether the differences observed are due to SARS-CoV-2 infection alone, the age-dependent maturation of tissues and the immune response, and/or experimental procedures. Finally, the time of euthanasia was not focused on evaluating acute inflammatory responses in tissues, as at 2 weeks, virus replication is mainly gone and tissue responses reflect repair in this animal model, and we evaluated trachea instead of lung responses. However, our study is valuable in that it agrees with currently published data in SARS-CoV-2-infected pediatric and adult cohorts and furthers our understanding of why younger populations are less susceptible to severe COVID-19 compared to adults. Additionally, this model will allow further definition of molecular mechanisms of age-dependent SARS-CoV-2 pathogenesis and assess efficacy of medical countermeasures.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.14.480347: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.10.22270471: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Informed consent: The study was approved by the Institutional Review Board at the University of California, San Francisco (UCSF).<br>Consent: All participants provided written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Samples were assayed blinded with respect to associated patient and clinical information.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the primary analysis, we defined PASC as any COVID-19 attributed symptom that was present during a study visit >6 weeks following SARS-CoV-2 infection; this definition was selected because it is consistent with prior work and consensus definitions [48,49].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PASC</div><div>suggested: (PASC , RRID:SCR_016642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All samples were acquired on a BD LSR-II analyzer and analyzed with FlowJo X software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      This study has several limitations. The sample size was small, as relatively few PWH were infected with SARS-CoV-2 during the first year of the pandemic in our geographic area [73]. As there were few PWH without PASC, we were likely underpowered to make comparisons within the PWH sub-group; larger cohorts will be needed to do so. Our case definition, although potentially overly sensitive, is in line with consensus case definitions [16,17] and the association between HIV status and PASC was maintained in sensitivity analyses using more stringent definitions. However, given the nature of our recruitment, we emphasize that the high prevalence of PASC in our study cohort should not be considered to represent the population-level prevalence of this condition, which is likely much lower [27]. In addition, while the groups with and without HIV infection were well-matched on key variables demonstrated to be important in the immune response to SARS-CoV-2 infection and in PASC, the potential for residual confounding remains. For example, data on additional clinical factors that may be related to both HIV status and PASC, including comorbid mental health conditions and substance use, were unavailable. We used concurrent CD4+ T cell count and CD4/CD8 ratio as markers of immune reconstitution; CD4+ T cell nadir might be an important factor but we were unable to confirm these values in most participants due to fragmentation of healthcare records. Regarding laboratory measurements, we used ...


      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04362150</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Long-term Impact of Infection With Novel Coronavirus (COVID-…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.10.22270804: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      With the caveat that our study is observational epidemiology and causality cannot be inferred, our study does support the possibility that external folate supply facilitates the production of large amounts of virus, contributing to clinical infection and mortality. Our study also supports the notion that SARS-CoV-2 replication is enhanced by folate supply by our finding that co-prescription of an antifolate (methotrexate) can ameliorate the possibly adverse effect of supplementation with folic acid on COVID-19 outcomes. There is also evidence that inadequate folate status may be harmful in the context of host resistance to infection with SARS-CoV-2. In addition to the well-recognized complication of anemia, folate deficiency has other detrimental health effects, including suppression of immune function.19 Additional support for the concept that adequate folate status is important in COVID-19 outcomes is provided by the observation that folate deficiency was associated with poorer outcomes in a cohort of COVID-19 patients.20 (It is important to note that it is possible that in the study by Itelman et al,20 if increased folate levels were causal of COVID-19 diagnosis and poor outcomes, that the association with lower folate levels could have been caused by selection (collider) bias.21 ) Vitamin B12 deficiency has also been proposed as a factor related to poor COVID-19 outcomes, presumed to be through the induction of functional folate deficiency.22 A drug-protein structure inte...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.12.480188: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Golden Syrian hamsters comprising equal numbers of males and females were purchased from an approved vendor.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum IgG ELISA: Indirect ELISA was performed to analyze sera for binding antibodies to SARS-CoV-2 spike protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 spike protein .</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary detection antibody (goat anti-species-HRP IgG; Abcam) was added at a dilution of 1:10,000 in 100 µl per well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>goat anti-species-HRP IgG; Abcam</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-species-HRP IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, 2.4 x105 Sf9 insect cells were plated into a well of a 24 well plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sf9</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plaque reduction neutralization test (PRNT): Vero 76 cells were cultured in 24-well plates at 175,000 cells/well in DMEM + 10% v/v FBS + Gentamicin and incubated at 37 °C, 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero 76</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, Vero cell culture medium was removed from 24-well plate and 250 μl of titrated serum samples were added in duplicates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Baculovirus production: The Beta variant spike protein ectodomain gene (amino acids 1-1201) containing the native signal peptide, 3Q mutations to the furin cleavage site and 2P mutations, was codon-optimized for insect cell protein expression, using GenScript proprietary algorithm and was directly synthesized into pFAST-BAC1 transfer plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pFAST-BAC1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate a control for the amplification reaction, RNA was isolated from the applicable SARS-CoV-2 plasmid control using the same procedure. qPCR was set up using TaqMan Fast Virus 1-Step Real-time RT-PCR protocol with assay setup performed using Qiagen Qiagility automated PCR setup platform and analyzed in Applied Biosystems on QuantStudio 3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: RRID:Addgene_164583)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Encapsulation of antigen were quantified by densiometric analysis using a known S1S2 protein standards in Fiji ImageJ software (v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum titration curves were analyzed by 5-parameter, non-linear regression using GraphPad Prism version 8.4.3 to determine antibody titers.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      The main limitation of the present study was that T cell responses had not been investigated, as commercialized antibodies required for assessment of hamster T cell subsets and function were largely unavailable 66. Concerns over such constraints of the hamster model had been raised 67. Nevertheless, our previous mouse study did establish the presence of functional, memory CD4+ and CD8+ T cells after primary vaccination 34. Unlike neutralizing antibodies, which generally exhibited narrow target specificity as evidenced by moderate to severe reduction in potency against different variants, T cell epitopes were remarkably conserved 24. Studies had shown CD4+ and CD8+ T cells from previous vaccination or infection to retain robust activity against Omicron, despite the variant’s extensive mutations and increased resistance to neutralizing antibodies 22, 23. It was believed that cross-reactive T cells may contribute to the control Omicron infection and possibly account for the reduction in disease severity compared to the earlier Delta wave 68.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.09.22270714: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.


      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.13.480238: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Viral cytopathic effect and GFP expression were scored in a blinded manner at different time points post infection, and the supernatants were collected and stored at -20 °C. 2.10 Flow cytometry: For the cell surface staining of transfected HEK293T cells, cells were collected, washed in PBS, resuspended, transferred to tubes and samples were centrifuged in a cooled centrifuge (4 °C) at 500 g for 5’.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: , Human adenocarcinomic bronchial epithelial cells Calu3 (Cat. No. HTB-55) and human glioblastoma U87 MG cells (Cat. No. HTB-14) were obtained from ATCC as mycoplasma-free stocks and grown in Dulbecco’s Modified Eagle Medium (DMEM, Thermo Fisher Scientific) supplemented with 10% (v / v) fetal bovine serum (FBS; HyClone)</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">goat anti-Rabbit IgG monoclonal antibody (Cat. n° 4414, Cell Signaling Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Rabbit IgG</div><div>suggested: (Cell Signaling Technology Cat# 4414, RRID:AB_10693544)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After removal of the supernatant, cells were incubated with the primary (anti-Spike) antibody (30’ at 4 °C), washed in PBS, followed by a 30 min incubation at 4 °C with the secondary (labeled) antibody, and washed again.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Spike </div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were washed twice with Perm/Wash buffer before the addition of the primary (anti-Nucleocapsid) antibody (0.3 µg per sample).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Nucleocapsid </div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CRL-1586), Human adenocarcinomic alveolar epithelial cells A549 (Cat. No. CCL-185)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 viral stocks were prepared by inoculation of confluent Vero E6 cells as described in detail in a recent preprint report [not peer-reviewed] (16)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.4 Lentiviral transduction of ACE2: For lentivirus production, 50-70 % confluent HEK293FT cells in T-25 flasks were transfected with Lipofectamine LTX & PLUS Reagent (Thermo Fisher Scientific)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293FT</div><div>suggested: RRID:CVCL_6911)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The next day, the transfected HEK293T cells were collected, resuspended, and counted on a Luna automated cell counter (Logos Biosystems), and administered to the U87.ACE2+ cells (20,000 cells/well).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">One day prior to the experiment, U87.ACE2+ cells were seeded at 20,000 cells/well in 96 well-plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>U87.ACE2+</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monophosphoramidate prodrug Remdesivir GS-5734 (Cat. n° 469411000, Acros Organics); purified SARS-CoV-2 spike-specific monoclonal rabbit primary antibody R001 (Cat. n° 40592-R001, Sino Biological). 2.3 Plasmids: Second generation lentiviral support plasmids pMD2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMD2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">G and pSPAX2 were obtained from Addgene (www.addgene.org, Cat. n° 12259 and 12260, respectively).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSPAX2</div><div>suggested: RRID:Addgene_12260)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Using the NEBuilder HiFi DNA assembly cloning kit (NEB), ACE2, derived from a pcDNA3.1-hACE2 vector (Cat. n° 145033, Addgene), was inserted into a pLenti6.3 vector (Thermo Fisher Scientific) in which the Cytomegalovirus (CMV)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1-hACE2</div><div>suggested: RRID:Addgene_145033)</div></div><div style="margin-bottom:8px"><div>pLenti6.3</div><div>suggested: RRID:Addgene_120848)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">immediate-early enhancer/promoter region was replaced with a 0.6kb minimal Ubiquitous Chromatin Opening Element (UCOE) sequence and a Spleen Focus Forming Virus (SFFV) promoter derived from pMH0001 (Cat. n° 85969, Addgene).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMH0001</div><div>suggested: RRID:Addgene_85969)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An internal ribosomal entry site (IRES) was inserted behind the ACE2 sequence via restriction digestion of a pEF1a-IRES vector (Cat. n° 631970</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pEF1a-IRES</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) containing ten betasheets of a modified mNeonGreen and a porcine teschovirus-1 2A peptide (P2A) coding sequence was inserted between the IRES sequence and the Blasticidin resistance cassette. pCAGGS.SARS-CoV-2_SΔ19_fpl_mNG2(11)_opt was generated through gibson assembly (NEBuilder, New England Biolabs) of a pCAGGS vector backbone cleaved using EcoRV-HF and HindIII-HF (New England Biolabs) and a PCR fragment of a codon-optimized SARS-CoV-2 Wuhan spike protein with a C-terminal 19 amino acid deletion as described in (18).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_127347)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pcDNA3.1.mNG2(1-10) was generated through gibson assembly (NEBuilder, New England Biolabs) of a pcDNA3.1 vector (Thermo Fisher Scientific), amplified by PCR, and a PCR fragment of the first 10 betasheets of a modified mNeonGreen, synthesized by Genscript.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1.mNG2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In parallel, HEK293T cells were transfected with transfection mixes containing 2.5 µg pCAGGS.SARS-CoV-2_SΔ19_fpl_mNG2(</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS.SARS-CoV-2_SΔ19_fpl_mNG2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Signal intensities were quantified with Image Lab software v5.0 (Bio-Rad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Image Lab</div><div>suggested: (Image Lab Software, RRID:SCR_014210)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Acquisition of all samples was done on a BD FACSCelesta flow cytometer (BD Biosciences) with BD FACSDiva v8.0.1 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD FACSDiva</div><div>suggested: (BD FACSDiva Software, RRID:SCR_001456)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometric data were analyzed in FlowJo v10.1 (Tree Star).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.13.22270898: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Statement of principal findings: We have shown that: Strengths and limitations: Strengths of this study are the complete ascertainment of cases, the comprehensive linkage to electronic health records, and the incidence density sampling design that controls for calendar time, age, sex and general practice. A limitation is that the data on prescribin of biologics is only a snapshot of those on biologics in March 2020, and it covers only about one-third of the Scottish population. Hospital outpatient prescribing is not recorded in electronic form within the NHS, and the prescription records held by the medication homecare services companies were not available for this study. Although the clinics that provided ths biologics list are not representative of the Scottish population, the matching of cases and controls on general practice ensures that the controls are drawn from the catchment population of these clinics. However because the coverage of the list is limited, the sample size is not large enough to estimate reliably the effects of specific classes of biologics such as B cell depleters, or the efficacy of vaccines in those on biologics. Comparison with other studies: The rate ratio of 2.1 for hospitalised COVID-19 in rheumatology patients treated with csDMARDs is rather higher than the rate ratio of 1.3 for mortality associated with any diagnosis of rheumatoid arthritis, lupus or psoriasis (not restricted to those with arthritis) in the OpenSAFELY study [11]. The rate ratio...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.12.22270438: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: After approval from the authors’ institutional ethics committee, initial contact was made with key individuals from a range of organisations, who then invited their members on our behalf.<br>Consent: We encouraged prospective participants to contact us directly to arrange an interview, upon which we secured informed written consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.11.22270836: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All questionnaire answers and data on the study participants were stored in the REDCap secure database with an “auto-archiver”.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Graphics were generated by ggplot2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Strengths and limitations: This is a unique cohort of young Swiss, mainly male, army recruits. In contrast to other studies, we had a control group, unequivocal evidence of SARS-CoV-2 infection and our test battery yielded objective and quantitative scores for analyses. A major strength of our study is the specifically designed, comprehensive test battery to quantify possible multi-organ sequelae based on the results of a systematic review (11). A limitation of our study is the small proportion of female participants (5.6%) which precluded meaningful sex-based evaluation of sequelae in young women. Further research: The test battery developed here can be applied and even expanded for use in other population groups especially young women. We advocate further follow-up of this LoCoMo cohort and the initiation of other longitudinal studies to understand the trajectory of sequelae persistence beyond 1 year and focused research to clarify the pathophysiology and triggers of the identified sequelae and possibly the increased risk of cardiovascular disease. A clearer definition of Long-COVID or Post Acute Sequelae of COVID-19 (PASC) is also urgently needed (27) and we suggest that this should be nuanced for different population groups.


      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04942249</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Enrolling by invitation</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Long COVID in Military Organisations</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.10.22270735: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.


      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      There are a number of limitations to our study. Whilst publicly available case reports were initially highly detailed, less information was released as the epidemic progressed. Data on date of symptom onset which we used to estimate Rt was missing for 30% of reported cases. However, the majority of cases with missing onset dates were reported after the end of our trusted period on 23 March so would not have affected our estimates of transmissibility. There was limited information on the age distribution of cases or symptoms especially for large clusters such as the care home outbreak in Chiba prefecture or the live music venues in Osaka. Similarly, the information released varied substantially by prefecture with Tokyo, which was the worst affected, only releasing minimal information beyond age group and sex. This may have biased our estimates of the age-dependent probability of transmission especially for the younger and older age groups associated with these clusters. Finally, we did not follow the entire clinical progression for patients with symptom data. Therefore, patients may have later developed more severe symptoms that were not presented here. However, this should not affect the variation in symptom type at the time of symptom onset across age groups.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.12.22270851: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.10.22270823: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.11.22269594: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: The system has been validated and was described in detail in 2017 (10).</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      However, our findings are subject to some limitations. The estimation of regional catchment population with the given data is difficult, therefore larger regions based on federal states were used (19). Yet, regional estimations are a strength of notification data. For the years 2020 and 2021, we saw a notable decrease of patient admissions in the hospital sentinel. This effect was observed world-wide and was probably due to a combination of aspects such as the cancelling of elective operations and an increased hesitancy to use the health service in general and especially hospitals (38-45). As we had stable catchment population estimations in the preceding years, using a fixed catchment population derived from the median of previous years was justified. The number of COVID-19-cases detected in hospitals is dependent on testing, and is likely underestimated. However, routine screening upon admission in sentinel hospitals was in place since July 2020. Furthermore, cases with laboratory confirmed SARS-CoV-2 infection hospitalized due to symptoms other than severe acute respiratory infections are not reported within the SARI sentinel. Thus, the focus on COVID-19 cases with SARI is more robust and less biased by the testing strategy as seen in notification data, as pneumonia was known to be the main syndrome of severe COVID-19 since the first case reports from China (46). We also note that weekly estimation of age-specific rates can lack accuracy due to low case numbers, especially...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.11.22270854: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Aliquots of prespecified volume according to manufacturer instructions were tested for the presence of SARS-CoV-2 antibodies by the Roche Elecsys Anti-SARS-CoV-2 assay against nucleocapsid (N) antigen (56).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 assay against nucleocapsid ( N ) antigen ( 56</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      A few caveats are worth noting. First, our findings about the persistence of infection-induced immunity are based on a 13-month study. The duration and quality of protective immunity over longer timescales remain open questions. Recent studies have found that antibody responses improve over time through affinity maturation (47, 48) and that long-lived plasma cells can be identified in the bone marrow at least one year after infection, suggesting that immunity conferred by infection or vaccination could be potent and durable against non-immune evasive variants (49). Persistent germinal center responses and durable T cell memory have also been observed among vaccine recipients (50–52). However, how the protection holds up against immune-evasive variant such as Omicron remains an outstanding question. Unfortunately, the PHIRST-C cohorts did not cover the Omicron wave, thus we could not directly measure immune protection at the individual level and relied on modelling of population-level dynamics. Post-Omicron serologic surveys following up the cohort population could provide deeper insight into the full impact of the Omicron wave. In our projections of SARS-CoV-2 resurgences, we did not consider waning explicitly since our cohort data did not support pronounced waning of infection-induced immunity. Accordingly, our projections are most relevant to short time scales, in the order of a few months. Interestingly, we find that resurgences are likely even over short time horizons. A ...


      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT02519803</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Unknown status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Prospective Household Observational Cohort Study of Influe…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.09.22270705: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Limitations of our study is that it is an observational study of publicly reported data of the deaths from all causes and COVID-19 in England and Wales during the SARS-CoV2 pandemic and do not involve review of the individual charts to accurately adjudicate the deaths. The other limitations of our study are the generalizability of the findings is limited to the England and Wales population. Despite the declining COVID-19 deaths observed during the Delta variant surge in our study, the percent of deaths in Care Homes due to COVID-19 during the Delta variant surge is 2.5% which is higher than deaths due COVID-19 at Homes (1.6%). As per the data of 2002, about 0.7% of England and Wales population (n=442,888) living in the Care Homes are at increased risk for mortality as was observed during the first two waves with COVID-19 infections, due to advanced age of the Care Home population (75.6% and 50.3% of Care Home residents are ≥75 years and ≥85 years age groups respectively in England and Wales) and multiple preexisting conditions among the Care Home population19,30.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.11.22270698: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.11.22270873: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Each participant additionally performed nasal self-swabs without supervision for two of the four randomly selected rapid antigen tests on the day of oropharyngeal swab collection according to the manufacturers’ instructions (the order was determined by the participant) and sent a photograph of the test results by means of a bar-coded form without participant’s name via e-mail to an e-mail address specifically set up for the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was performed by using SPSS (program release 26).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      A potential limitation of the study might be a relatively high number of medical staff, e.g. participants likely were better trained to use AG-ST as the rest of the general population. Therefore, handling or interpretation errors could be underestimated in this cohort. As additional criteria might affect the performance of AG-ST it would have been useful to allow the user to describe in a free text field of the form sheet used to transfer the test results to the study center the possible source of interpretation errors, e.g. by lack of readability of the test, missing components in the kits etc. In summary, our data show that the Clungene and Mexacare tests are probably less suitable for usage as antigen self-tests due to their high rate of false positive results and high number of unclear/invalid results, respectively. Tests with a high false-positivity rate should especially be avoided to be used in a population with a low prevalence of SARS-CoV-2.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.10.22270732: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Secondary analysis was conducted using the data available at National COVID-19 positive pregnant women surveillance in Sri Lanka.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data was initially transferred to MS Excel software; they were coded and analysed using Statistical Package for Social Sciences (SPSS) 22 version.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.11.22270876: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: The sampling frame for online research was non-probabilistic, that is, not all members of the population (N) had the same probability of participating due to the digital gap between those with and without access to communication technology.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Registered nutritionists randomly selected visiting out-patients and applied the same survey using a mobile phone or PDA (Personal Digital Assistant).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data processing and analysis were completed using statistical packages SPSS (Social Package for Social Sciences) and STATA (15.1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      This mixed food intake pattern is of concern because it was reported among 40% of our sample, and the group also showed economic limitations. The social characteristics of participants from patterns 1 and 2 vary from those belonging to the pattern 3 group, and these differences signal potential socioeconomic inequalities. Inequalities may explain non-healthy behaviors and decreased consumption of healthy food. On the other hand, the contrasting behaviors found in patterns 1 and 2 is a clear reminder that having resources does not always translate into positive decisions regarding food intake or health behaviors. Furthermore, other variables, such as self-perception of health status, social networks, and social and gender inequalities should be taken into account when it comes to formulating public health policies to promote healthy behaviors (24; 25; 26). Recent studies have also confirmed the impact of low income and food insecurity on the nutritional behavior of family members (27; 28). This is particularly troubling since Panama has experienced accelerated development during recent decades. Despite this progress in development, the country has not been able to reverse the high inequality rates and remains among the countries with the most unequally distributed wealth in the region (29). This level of inequality persisted and was most likely increased during the COVID-19 pandemic. Social and economic factors have an influence on individuals’ decisions regarding food consump...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.10.22270744: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the Cleveland Clinic Institutional Review Board as exempt research (IRB no. 21-1163).<br>Consent: A waiver of informed consent and waiver of HIPAA authorization were approved to allow access to de-identified health information by the research team.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      The study has its limitations. Individuals with unrecognized asymptomatic prior infections would have been misclassified as previously uninfected, resulting in underestimating the protective effect of prior infection. Many asymptomatic incident infections were probably missed. There is little reason to suppose, however, that they would have been missed in the various groups at rates disproportionate enough to change the directionality of the study’s findings. Because our employee health symptom-monitoring processes were overwhelmed by disease volume during the Omicron phase of the pandemic, we were unable to distinguish between symptomatic and asymptomatic infections and had to limit our analyses to all detected infections. We did not have a way to adjust for behavioral differences and household exposures, both of which can strongly influence risk of COVID-19. Our study of healthcare personnel included no children and few elderly subjects, and the majority would not have been immunocompromised. Lastly, knowing that the Omicron variant causes milder infection than the Delta variant, the clinical impact of protective effect of vaccine boosting on severe infections would be smaller than the protective effect on infections overall that this study found. The findings of this study have important implications. Those who have had COVID-19 are better protected against the Omicron variant than those who received two doses of an mRNA COVID-19 vaccine, with protection lasting at least 6...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.10.22270805: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: 10 Informed consent was obtained for each participant.<br>IRB: The study was approved by the Research Ethics Board of the Research Institute of the McGill University Health Centre (MP-37-2022-7762).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Study data were collected and managed using REDCap.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Diagnostic testing procedures: The RADT used was the Panbio COVID-19 Ag Rapid Test Device (Abbott Laboratories, Saint-Laurent, Quebec).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott Laboratories</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Limitations include the small proportion of eligible businesses that entered the study, and that a single RADT was assessed with uncertain generalizability to the full diversity of available RADTs. Self-administered RADTs are inexpensive and can be decentralised and implemented at scale for serial mass testing of asymptomatic persons to break chains of transmission and reduce SARS-CoV-2 incidence.14,15 This work shows that longitudinal mass SARS-CoV-2 RADT testing can be accurately self-performed and provides evidence for optimizing performance. This use case may become more pertinent with the emergence of new SARS-CoV-2 variants of concern.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.12.22270883: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT00676715</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Study of the Efficacy and Safety of Ocrelizumab in Patient…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.11.22270667: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Semi-quantitative determination of antibody titres in dried blood spot eluates was done using a commercially available ELISA that detects anti-Spike IgG/A/M with 98.3% specificity and 98.6% sensitivity (product code MK654; The Binding Site, Birmingham, UK).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Spike IgG/A/M</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were done using Stata/MP (version 17.0) and GraphPad Prism (version 9.1.2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      A limitation of our study is that our findings are limited to recipients of ChAdOx1 and BNT162b2 vaccines, although these are two of the most widely administered vaccines and operate via different mechanisms. We also lacked statistical power in our analysis of breakthrough infection following vaccination with BNT162b2, because of fewer participants and lower rates of infection. Finally, our results are not generalisable to children or populations of non-White ethnicity. In conclusion, our combined measure of anti-Spike IgG/A/M was only modestly predictive of breakthrough infection in vaccinated individuals, and performance was significantly improved by incorporating factors reflecting post-vaccination SARS-CoV-2 exposure. Combined with the poor correlation observed between anti-Spike IgG/A/M and S peptide-stimulated IFN-γ, these findings suggest that the relatively limited predictive value of anti-Spike IgG/A/M titres for protection may reflect their inability to reflect protective vaccine-induced cellular responses.


      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04330599</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Longitudinal Population-based Observational Study of COVID-1…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.10.22270799: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were conducted using Stata V16, with figures generated using the ggplot2 package for R V4.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      There are several limitations that may have impacted on the results from this study. The study was conducted between October 2020 and April 2021. In this period, the local community incidence for the study sites ranged from <50 to >1200 weekly cases per 100,000 people. There were corresponding large variations in the healthcare burden of COVID-19, with several sites recording weeks when more than half of all inpatients were SARS-CoV-2 positive. High community infection rates and associated increases in the incidence of HOCI cases contributed to difficulties for site research teams in generating good quality viral sequences and reports for all HOCI cases within target timeframes. It may therefore be more achievable to develop systems for rapid viral WGS and feedback for endemic respiratory viruses at lower and more consistent levels. The peak in SARS-CoV-2 levels in December 2020 to January 2021 corresponded to the rise of the highly transmissible Alpha variant in the UK[20]. We did not find that the local prevalence of the Alpha variant was associated with the incidence rate of HAIs, beyond any effect mediated by higher community incidence. This matches the conclusions of a previously reported sub-study analysis using data from our sites[28]. The study intervention made use of a bespoke sequence reporting tool[10]. The SRT combined both patient-meta-data and sequencing data, providing a single-page, easily interpretable report for IPC teams. It also facilitated standardisatio...


      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04405934</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">COG-UK Project Hospital-Onset COVID-19 Infections Study</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.11.22270841: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Despite these obvious limitations, here we argued that Poisson underdispersion provides a simple and useful test to detect one kind of reporting anomalies and highlight unreliable data.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.10.22270782: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.1 SSearch strategy and selection criteria: We searched PubMed, Scopus and preView for COVID-19 or SARS-CoV-2 and at least one of hepatitis, tuberculosis, HIV, or malaria (last search date: January 13, 2021), without language restrictions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For graphical presentation, we use simple line graphs (package ggplot2 [23] in R) and forest plots (package forestplot [24] in R).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Besides re-allocation of staff, viral hepatitis and HIV services suffered from a reduction in face-to-face counselling as a consequence of applying physical distancing measures requiring, e.g., limitation of capacity [68, 75]. The fear of acquiring SARS-CoV-2 in hospital settings was a near-universal contributor to a decline in service usage and healthcare-seeking behaviour, with 50% of hepatitis appointments cancelled by patients [103]. Additionally, for TB, due to the overlap of symptoms, this was aggravated by the fear of being diagnosed with SARS-CoV-2 instead of TB, which in many countries carried a heavy stigma. Nevertheless, data on suspected cases from Africa [99, 111] shows that health-seeking behaviour was impacted more for less severe cases and that inequalities are reflected in the data [32] showing a greater reduction in attendance for children than adults, and for women than men. Regarding malaria, some local reports identified the fear of SARS-CoV-2 as problematic and described active counter-measures [125, 130]. In the case of HIV, restrictions in transportation and movement were another reason impeding service usage in some areas [58, 65]. For viral hepatitis, the heterogeneity in findings was also linked to the origin of survey participants and centre location [122]. Replies from low-income countries particularly alluded to people identified with viral hepatitis not being referred to care or further medically investigated, or that treatment shortages had led...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.10.480009: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.10.479867: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animal experiments were executed by certified staff in Center for Animal Experiments of Wuhan University, approved by the Institutional Animal Care and Use Committee (AUP #WP2021-0607).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">2.5 Cell culture: HEK 293T/17 and ACE2-expressing 293T cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 2 mM L-glutamine, 10% FBS (sigma-aldrich) and 1% penicillin/streptomycin (BI) at 37 °C and 5% CO2. 2.6 Animals: Female BALB/c mice age of 6-8 weeks and heterozygous B6/JGpt-H11em1Cin(K18-ACE2)/Gpt mice (K18-hACE2 KI mice) age of 5-7 weeks and body weight of 18-20 g were used.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following washes, the secondary antibody, goat Anti-Mouse IgG H&L conjugated HRP (Abcam), was incubated in plate at room temperature for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>goat Anti-Mouse IgG H&L conjugated HRP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-Mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.11 SARS-CoV-2 Delta virus neutralization assay: SARS-CoV-2 Delta-neutralizing antibody was determined by in vitro inhibition of cytopathic effect (CPE), and was performed in the ABSL-3 lab at Center of Laboratory Animal Sciences, Wuhan University (Wuhan, China).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CPE</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.5 Cell culture: HEK 293T/17 and ACE2-expressing 293T cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 2 mM L-glutamine, 10% FBS (sigma-aldrich) and 1% penicillin/streptomycin (BI) at 37 °C and 5% CO2. 2.6 Animals: Female BALB/c mice age of 6-8 weeks and heterozygous B6/JGpt-H11em1Cin(K18-ACE2)/Gpt mice (K18-hACE2 KI mice) age of 5-7 weeks and body weight of 18-20 g were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T/17</div><div>suggested: ATCC Cat# CRL-11268, RRID:CVCL_1926)</div></div><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After that, the 293T-ACE2 cells are added and incubated for 24 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus-serum mixtures were added to Vero-E6 cells seeded in 24-well plate and cultured in a 5% CO2 incubator at 37 °C for 3 days.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.5 Cell culture: HEK 293T/17 and ACE2-expressing 293T cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 2 mM L-glutamine, 10% FBS (sigma-aldrich) and 1% penicillin/streptomycin (BI) at 37 °C and 5% CO2. 2.6 Animals: Female BALB/c mice age of 6-8 weeks and heterozygous B6/JGpt-H11em1Cin(K18-ACE2)/Gpt mice (K18-hACE2 KI mice) age of 5-7 weeks and body weight of 18-20 g were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>B6/JGpt-H11em1Cin(K18-ACE2)/Gpt</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>K18-hACE2 KI</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mRNA integrity was measured with a gel retardation assay [15] and microfluidic capillary electrophoresis (Agilent Fragment Analyser) [16], as previously reported.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Agilent Fragment Analyser</div><div>suggested: (OMICtools, RRID:SCR_002250)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was mainly processed using Prism software version 8.3</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GraphPad Software Inc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 9. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.09.479781: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were washed once (500 μL FCM buffer) and resuspended in 100 μL of the FCM buffer with 5μL of the secondary Antibody (PE-anti human IgG Fc Recombinant, Biolegend, Catalogue 366903) and incubated for 30 minutes at 4°C., in the dark.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PE-anti human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The parental HEK293 cells were used as a control for binding specificity.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All genes were purchased from Biomatik Corporation (Ontario, CA) and cloned into pET-32a (+) between the Nco I and Xho I restriction sites.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-32a</div><div>suggested: RRID:Addgene_120288)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Biolisa COVID-19 Anticorpo Neutralizante kit (Ref: K243-1) was kindly provided by Bioclin®.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bioclin®</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were then washed twice with 500 μL FCM buffer, and the cell pellets were resuspended back in 500 μL of FCM buffer for analysis in Becton-Dickinson FACSCalibur.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Becton-Dickinson</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>FACSCalibur</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data were analyzed using FlowJo software (BD Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.07.479493: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A WT SARS-CoV-2 isolate (D614G Spike + P323L nsp12 changes compared to WA1 strain) was passaged in Vero E6 cells initially in the presence of 1 µM of RDV and then increasing the drug concentration until clear virally-induced cytopathic effects were noted.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, A549-hACE2 cells were seeded at 12,000 cells per well in medium containing 2% FBS into a white clear-bottom 96-well plate (Corning) at a volume of 50 µL and incubated overnight at 37°C with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-hACE2</div><div>suggested: RRID:CVCL_A5KB)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.11.480029: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.3 Physiochemical characterization: Using the Expasy protparam 14, the protein sequences of BA.1, BA.1.1, BA.2, and BA.3’s whole spike protein and RBD were compared to Wuhan-Hu-1 (Wild type).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Wuhan-Hu-1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.2 Multiple alignment of Omicron Variants with Wild Type: Using Clustal Omega 13 with the default settings, the protein sequence of Wuhan-Hu-1 (Wild type) was aligned with the protein sequences of omicron variant and sub-lineages BA.1, BA.1.1, BA.2, and BA.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Clustal Omega</div><div>suggested: (Clustal Omega, RRID:SCR_001591)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Receptor-binding domain of Omicron and sub-variants were computed for electrostatic potential using electrostatic potential calculated with the Adaptive Poisson–Boltzmann Solver (APBS) program implemented in PyMOL 21.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.7 Pathogenicity analysis: PredictSNP 24 was used to determine the pathogenicity of all mutations.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PredictSNP</div><div>suggested: (PredictSNP, RRID:SCR_006327)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Using the PredictSNP web server, prediction algorithms from programmes like as MAPP, PolyPhen1 and PolyPhen-2, SIFT, SNAP, and PANTHER were utilised to achieve a consensus pathogenicity score.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAPP</div><div>suggested: (MAPP, RRID:SCR_010775)</div></div><div style="margin-bottom:8px"><div>PolyPhen1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>PolyPhen-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SIFT</div><div>suggested: (SIFT, RRID:SCR_012813)</div></div><div style="margin-bottom:8px"><div>SNAP</div><div>suggested: (SNAP, RRID:SCR_007936)</div></div><div style="margin-bottom:8px"><div>PANTHER</div><div>suggested: (PANTHER, RRID:SCR_004869)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.11.480063: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">From the wild type, three mutations such as L452R, T478K and E484Q by performing key replacement of residues using mutagenesis module of PyMOL v2.5, Schrodinger LLC (DeLano, 2002).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CABS-Flex – a standalone fast modelling package was considered to understand the flexibility of both the Spike RBD domain and ACE2-Spike complex (Badaczewska-Dawid et al., 2020; Kurcinski et al., 2019; Kuriata et al., 2018) Molecular Dynamics Simulations and MM-GBSA calculations: The molecular dynamics simulations were performed up to 100ns using Desmond package (Bowers et al., 2006; Chow et al., 2008).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Desmond</div><div>suggested: (Desmond, RRID:SCR_014575)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.11.22270785: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics approval and data governance: Approval for use of the diabetes data was provided by the Public Benefit and Privacy Panel (https://www.informationgovernance.scot.nhs.uk/pbpphsc/) (ref. 1617-0147) and the Scotland A Multicentre Research Ethics Committee (ref 21/WS/0047).<br>Consent: Individual consent is not required for Public Health Scotland staff to process personal data to perform specific tasks in the public interest that fall within its statutory role.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: The clinical classification of type in SCI-Diabetes has previously been validated against detailed prescribing and hospital admission histories; in the years 2015-2019 we reclassified the type of diabetes as type 2, monogenic or secondary in less than 2% of those aged under 16 clinically labelled as type 1 diabetes for example.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Strengths and limitations: Strengths of this study include the availability of individual level data, comprehensive national coverage of PCR tests, the inclusion of data on the level of negative testing around the time of presentation and most importantly validation of the accuracy of dates of diagnosis of type 1 diabetes in the SCI-diabetes registry against date of first hospitalization for type 1 diabetes in paediatric cases for whom the policy is to admit all newly-diagnosed cases immediately. Limitations are that because the numbers of incident cases of type 1 diabetes exposed to SARS-CoV-2 infection were relatively small, for formal modelling of the hazard ratio we had to use fairly broad categories of 0-30 and >30 days for exposure period. However the clustering of negative and positive tests around the date of diagnosis is obvious on inspection of scatter plots. Another limitation common to other studies of this question are that until mass testing was rolled out in late 2020, most cases of SARS-CoV-2 in younger people were not detected. However the cumulative incidence of infection in 5-14 year olds in the UK is estimated to have been only about 15% up to late 2020 [20], so misclassification of exposed individuals as unexposed would only slightly reduce the rate ratios for Type 1 diabetes associated with detected infection in this age group. Comparison with previous studies: Our results do not confirm the association of incident diabetes before age 18 years with SARS-...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.09.479755: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To do that, we retrieved the following genomes in FASTA format: 1) the human genome, coding and non-coding transcriptome (GRCh38, from NCBI and ENSEMBL, respectively); 2) the reference genomes of SARS-CoV-2 (NC_045512.2), SARS-CoV (NC_004718.3), MERS-CoV (NC_038294.1), and influenza (GCF_001343785.1); and 3) different SARS-CoV-2 variants (original 2019 variant and the currently dominant Delta and Omicron) from USA (Texas, California and New York), Brazil, Portugal, Spain, England, Germany, Russia, China (without Wuhan), and Wuhan strains, obtained from the Global Initiative on Sharing Avian Influenza Data (GISAID) [14].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NCBI</div><div>suggested: (NCBI, RRID:SCR_006472)</div></div><div style="margin-bottom:8px"><div>ENSEMBL</div><div>suggested: (Ensembl, RRID:SCR_002344)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alignment to those genomes was performed using the short-reads aligner Bowtie v1.1.0 [15], reporting all valid alignments per read, with the following parameters: maximum number of attempts to match an alignment = 4, and maximum number of mismatches in the “seed” = 3, with “seed” length = 7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bowtie</div><div>suggested: (Bowtie, RRID:SCR_005476)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.09.479842: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.10.479924: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells were transfected with pcDNA5_FRT_TO-3xFLAG-3C-Nsp1 (prof.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells were transfected with pcDNA5_FRT_TO-3xFLAG-3C-Nsp1 (prof.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA5_FRT_TO-3xFLAG-3C-Nsp1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Each replica of HEK293T cells transfected with either pcDNA5_FRT_TO-3xFLAG-3C-Nsp1 or pcDNA3 (control) were trypsinized and collected by centrifugation and washed twice with phosphate-buffered saline (PBS, Corning).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3</div><div>suggested: RRID:Addgene_15475)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sucrose gradient analysis: Sucrose density gradient ultracentrifugation fractionation: HEK293T cells were transfected with pcDNA5_FRT_TO-3xFLAG-3C-Nsp1 or with pEGFP-C1 in triplicates as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pEGFP-C1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transfection of HEK293T cells was performed by mixing plasmid DNA with PolyJet™ In Vitro DNA Transfection Reagent (SignaGen Laboratories) and incubation with cells for 3 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PolyJet™</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">LC-MS protein identification of crosslinked samples and analysis: LC-MS/MS analysis of DSSO crosslinked sample was performed on an Orbitrap Fusion Lumos Tribrid mass spectrometer (Thermo Fisher Scientific, Germany) connected to an Ultimate 3000 RSLCnano system (Dionex, Thermo Fisher Scientific, Germany), which were operated under Tune 3.4, SII for Xcalibur 1.6 and Xcalibur 4.4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Xcalibur</div><div>suggested: (Thermo Xcalibur, RRID:SCR_014593)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">AP-MS analysis: Raw data from mass spectrometry were searched as described above using MaxQuant (1.6.17.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MaxQuant</div><div>suggested: (MaxQuant, RRID:SCR_014485)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The domain was built in MODELLER version 9.23 (41) and fitted in the density for “protein X” in the 43S preinitiation complex.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MODELLER</div><div>suggested: (MODELLER, RRID:SCR_008395)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.09.479840: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The blocking buffer was then aspirated and 50 μL of a 1:4000 dilution of rabbit anti-SARS-CoV-2 nucleocapsid (N) antibody (MA536086, Invitrogen) in blocking buffer was added and incubated for 2 h at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 nucleocapsid (N</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>MA536086</div><div>suggested: (Thermo Fisher Scientific Cat# MA5-36086, RRID:AB_2866697)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549-ACE2 cells that stably express human angiotensin-converting enzyme 2 (hACE2) were established and provided by the University of Texas Medical Branch (46).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All viruses were propagated 1-2 times in Vero-TMPRSS2 cells as follows.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nucleoprotein ELISA: 3×104 A549-ACE2-TMPRSS2 cells in 100 μL DMEM (supplemented with 10% FBS and 1X penicillin/streptomycin) were seeded into each well of a 96-well plate and incubated overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-ACE2-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antiviral activity assessment from recombinant luciferase containing viruses: For Nluc readouts, 1.2×104 A549-hACE2 cells per well were suspended in 50 μL infection medium and seeded into a white clear-bottom 96-well plate (Corning) and incubated overnight at 37°C with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-hACE2</div><div>suggested: RRID:CVCL_A5KB)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Site-directed mutagenesis and recombinant virus rescue: To produce recombinant SARS-CoV-2 virus, we utilized a SARS-CoV-2 reverse genetics system previously described (24, 49) that was slightly modified by fusing plasmids F1-F3 single plasmid making it a 3-plasmid reverse genetics system producing infectious virus containing either Nano luciferase (Nluc) or the Firefly luciferase (Fluc) transgene.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>F1-F3</div><div>suggested: RRID:Addgene_87224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Desired substitutions in nsp12 of the SARS-CoV-2 genome were added to the nsp12 containing F4 plasmid using the Quick-Change PCR protocol using Platinum SuperFI II PCR master-mix (ThermoFisher Scientific cat. No. 12361010) following manufacturer’s protocols.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>F4</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">EC50 values were determined using GraphPad Prism 8.1.2 using non-linear regression curve fits.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.09.479835: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All experiments were approved and performed per the guidelines set forth by the Institutional Biosafety Committee (IBC) and the Environmental Health and Safety Office (EHSO) at the University of Illinois at Chicago.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cleavage of the spike protein was detected using anti-SARS-CoV Spike Protein (SDelta3) monoclonal antibody (7G12, Thermo Fisher Scientific, CA, USA)) raised against immunogen aa168-461 of the S1 domain.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV Spike Protein (SDelta3</div><div>suggested: (Thermo Fisher Scientific Cat# MA5-35945, RRID:AB_2866557)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 1 x 10^6 293T ACE2 cells were nucleofected with sgRNA:TracrRNA: Cas9 complex using Amaxa Cell Line Nucleofector Kit V and cultured for 72h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus entry inhibition assay: SARS CoV2 pseudotyped virus particles were produced by transfecting HEK293T cells with the following plasmids 1) lentiviral backbone plasmid-pHAGE-CMV-Luc2-IRES-ZsGreen that expresses luciferase and ZsGreen reporters.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">25 x 103 human ACE2 expressing 293T cells were seeded in 96 well plates and infected with bald pseudovirus without spike glycoprotein (negative control) and SARS CoV2 spike protein-expressing pseudovirus and treated with 1 μM concentration (50μl Infection medium 2% FBS + 150 μl pseudovirus) of the candidate inhibitory small molecules.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CPE assay using infectious SARS CoV2: 25 x 103 hACE2-293T (BEI resources) and human TMPRSS2 expressing Vero E6 cells (Ordered from Japanese Collection of Research Bioresources Cell Bank (JCRB) and distributed by Sekisui XenoTech, LLC, KS) or Vero E6 cells (ATCC), Vero E6 Cells Expressing TMPRSS2 and Human ACE2 (Vero E6-TMPRSS2-T2A-ACE2) (NR-54970, BEI) were seeded in each well of 96 well plates in 100 μl of 5% DMEM medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2) pHDM-Hgpm2-lentiviral helper plasmid expressing HIV Gag-Pol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHDM-Hgpm2-lentiviral</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">3) pHDM-tat1b: lentiviral helper plasmid expressing HIV Tat.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHDM-tat1b</div><div>suggested: RRID:Addgene_164442)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">4) pRC-CMV-Rev1b: lentiviral helper plasmid expressing HIV Rev, and pHDM expressing the SARS CoV2 Wuhan-Hu-1 Spike envelope Glycoprotein (Procured from BEI resources).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pRC-CMV-Rev1b</div><div>suggested: RRID:Addgene_164443)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analyses were performed using Prism GraphPad (V9.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.09.479588: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.09.22270692: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants provided written informed consent before participation in the study, and the study was conducted in accordance with Good Clinical Practice principles.<br>IRB: The study was performed in compliance with all relevant ethical regulations, and the protocol (DRO-1006) for studies with human participants was approved by the institutional review board of The Rockefeller University.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293Tcells were transfected with pNL4-3ΔEnv-nanoluc and pSARS-CoV-2-SΔ19.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293Tcells</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293Tcells were transfected with pNL4-3ΔEnv-nanoluc and pSARS-CoV-2-SΔ19.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNL4-3ΔEnv-nanoluc</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pSARS-CoV-2-SΔ19</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Group comparisons were performed using Mann-Whitney test (GraphPad Prism).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.09.479786: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Default parameters were used to run BLASTN and an e-value threshold of 0.01 was chosen since that indicated statistically significant match44.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLASTN</div><div>suggested: (BLASTN, RRID:SCR_001598)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To obtain position-based clustering of the epitopes, the following steps were carried out: 3.6 Identification of Epitopes on Protein: 3.6.1 Mutations in Proteins affecting Epitopes and Mutation Density: Certain epitopes were not found by MSA as exact subsequences on proteins.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">First, we compared the reference sequence from UniProt with the sequence of the protein structures deposited in the Protein Data Bank48, 49 and then we visualize the epitope positions in the 3D shape of the protein by selecting the protein deposited structure showing 100% identity with the consensus sequence.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UniProt</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Thus, we generated four BLAST databases, one for each protein and cell type.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.10.479919: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Experimental procedures were approved by the Austrian Ministry of Science and Research (66.009/0145-WF/II/3b/2014 and 66.009/0277-WF/V/3b/2017) and conformed to the 2010/63 European Communities Council Directive.<br>Euthanasia Agents: At the end of the post-immunization survival period, mice were deeply anesthetized by isoflurane (at 5% with 1 L/min flow rate of tubed air) and then perfusion-fixed by transcardially applying 4% (wt/vol) paraformaldehyde and 0.1% glutaraldehyde in 0.1 M phosphate buffer (PB; pH 7.0).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animals, blood sampling and tissue processing: A total of 18 male and 4 female mice (C57BL/6J, 8–12-week-old) were group housed under standard conditions with a 12/12 light/dark cycle.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing in PBS for 10 min, Alexa Fluor 594-tagged goat anti-mouse antibody was applied for 1 h at room temperature under continued gentle agitation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody binding was determined with goat anti-mouse HRP-conjugate (1:10,000 in assay buffer supplemented with goat serum (2% V/V)) and incubated at room temperature for 60 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse HRP-conjugate</div><div>suggested: (Icosagen AS Cat# A1-900-100, RRID:AB_11135309)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animals, blood sampling and tissue processing: A total of 18 male and 4 female mice (C57BL/6J, 8–12-week-old) were group housed under standard conditions with a 12/12 light/dark cycle.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For vector construction, the portion of the nucleocapsid (N100-300 aa) fused to the RBD (S300-685 aa) including 4 glycines as a hinge region was cloned into a pET-30a vector and designated ‘VieVac’ (Supplementary Figure 1A).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-30a</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Directional cloning into the Gateway pEntry/D-TOPO vector: A 4-nucleotide overhang (CACC) was placed in front of the forward primer CACCATGAAAGATCTCAGTCCGCG, while TCATCGCGCTCTTCGCGGGG served as reverse primer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pEntry/D-TOPO</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The original construct (engineered pET-30a/VieVac) has been used as template.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-30a/VieVac</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Insertion into baculovirus and amplification in insect cells: The pEntry/D-TOPO/VieVac construct (25 ng) was shifted into the baculovirus-compatible pDEST™ 10 expression vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pEntry/D-TOPO/VieVac</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, Max Efficiency® DH10Bac™ competent E. coli were transformed with the engineered pDEST™ 10 containing the VieVac recombinant construct using the heat shock method at 42 °C for 30 s.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pDEST™</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression of the activation marker CD44 was measured on a FACS Canto II flow cytometer (Becton Dickinson) and analyzed using the FlowJo software (TreeStar).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell counting was performed in ImageJ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In histochemical experiments, data were normalized to a surface area of 1 mm2 and expressed as means ± s.e.m, followed by one-way ANOVA in GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.11.22270611: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: A written informed consent was obtained for each participating subject (Supplementary Methods).<br>IRB: The study was approved by the local ethical committee of Hamburg (reference number: PV7336) and published at clinicaltrials.gov (NCT04534608).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were performed using R software (version 4.0.2) and GraphPad Prism (version 8.4).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      There are limitations to this study. Teenagers were relatively underrepresented when compared to younger children and Hamburg census data. The retrospective nature of serological testing in this study did not allow for confirmation of infection by direct virus detection (PCR), therefore seropositivity is used as a surrogate marker for past infection. Furthermore, PCR test results from study participants from the time of infection were not available and index cases in family clusters were identified based on patient history of symptomatic illness (Supplementary Table S2). A selection bias needs to be considered when interpreting our findings. First, our study included over 50 % volunteers, second, blood draws were more likely to have been carried out in older children. In this study, no serum neutralization tests have been performed. Instead, seropositivity was defined based on two different serum antibody tests, both of which have shown good correlation with plaque reduction neutralization tests [52,53]. While this approach does not measure direct antibody mediated protective immunity, it reduces the probability of false positive tests, especially when multiple family members are assessed. Since the samples used for antibody measurements in this study were obtained after the first 2020 wave of infections, they represent infections with the ancestral SARS-CoV-2 which has now been replaced by more recent viral variants. In spite of this, our data is relevant to antibody respons...


      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04534608</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">COVID-19 Child Health Investigation of Latent Disease in Ham…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.09.22269224: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Participants for Calibration test in patients: Work flow: Following patient information and consent to participate in the study, the patient is asked to fast from food and drink for at least 30 minutes.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">When the patient has fasted for at least 30 minutes, the first saliva sample is collected according to the protocol of either QuickSpit or BioSaliva.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioSaliva</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      A single test gives an answer at a single point in time and cannot be the basis of re-opening businesses and in controlling the pandemic, suggesting that testing should be frequent, carried out at least twice a week, in order to make these rapid tests effective in a pandemic [26-29], thus highlighting the critical requirement for a cheap, easy-to-use, rapid, robust assay, which can be facilely manufactured and deployed to all countries, independent of the local resource limitations. An important advantage of the AptameX™ assay is that it does not depend on components used in lateral flow based rapid antigen tests, such as membranes, conjugate pads, sample pads, plastic cassettes, which are now in huge demand, with the test simply requiring gold nanoparticles, DNA and NaCl, reagents which are widely available from a plethora of suppliers worldwide. The performance of antigen-based rapid diagnostic tests varies greatly with clinical sensitivities ranging from 23% - 71% and 2-5 orders of magnitude less sensitive than RT-PCR [26-29]. Current rapid tests have high sensitivities at CT values of 25 or lower, but at higher CT values particularly above 28, performance declines [26-29]. Optimal CT values should be lower than 25. A case in point: the example where Innova tests “identified only two-thirds of the cases with CT levels below 25” indicates that the laboratory which processed the samples performed at a level far from what should be required. Their CT value of 25 would probabl...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.10.480017: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Additional fragments to complete the assembly of each clone were also amplified using the pCMV-Spike (wild-type) template (labeled fragments 17-23).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV-Spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Construct assembly Part 1- Gibson assembly of Clones 1,2,3 and 4: pCDNA3.1 was digested with BamHI and HindIII, treated with Antarctic Phosphatase and purified using a DNA cleanup column, and checked for background by transformation before using in the assembly reaction.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Despite these caveats, we believe that this strategy will be of great use in resource-constrained settings.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.10.479714: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: The research study has been approved by the Ethics Committee under the Ministry of Health of the Republic of Uzbekistan (#6/20-1582).<br>IRB: The research study has been approved by the Ethics Committee under the Ministry of Health of the Republic of Uzbekistan (#6/20-1582).<br>Consent: We received a verbal consent for a voluntary participation from all patients involved for sample collection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Among all tested patients, 32 PCR-positive samples (18 females and 14 males) were selected for further studies, which were randomly selected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Biological samples were collected randomly from PCR-positive patients after laboratory testing for SARS-CoV-2.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The filtered variants were used for sample clustering with Maximum Likelihood Tree in Molecular Evolutionary Genetics Analysis (MEGA, https://www.megasoftware.net) software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGA</div><div>suggested: (Mega BLAST, RRID:SCR_011920)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.09.479776: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.09.22270653: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study oversight: In accordance with the guidelines, this work with de-identified samples was approved for research by the SUNY Downstate Institutional Review Board & Privacy Board under the title “Pilot program for instituting massive COVID19 surveillance screening in schools and the workplace (IRB#1603504-6).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For whole genome sequencing, RNA was extracted and confirmed as SARS-CoV-2 positive by RT-qPCR with the Thermo Fisher TaqPath SARS-CoV-2 assay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo Fisher TaqPath</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.09.22270747: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Inclusion criteria were being vaccinated twice against SARS-CoV-2, an elapsed period of at least 14 days since the second vaccination (as the vaccination effect is first built up during this time) and written informed consent.<br>IRB: Ethics: The study was conducted in accordance with the Declaration of Helsinki and Good Clinical Practice (10) and approved by the ethics committee of the University of Luebeck (21-353).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Subgroup analyses by age (age below 65 years versus 65+), sex (female versus male) and comorbidity (no versus any comorbidity) were done.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Exclusion criteria were a third vaccination, unknown date of second vaccination, unsuccessful blood drawings, no laboratory result of the blood sample or a positive test for anti-SARS-CoV-2 nucleocapsid protein (NCP) antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 nucleocapsid protein (NCP)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Laboratory methods: The blood samples were analysed for four main outcomes: anti-SARS-CoV-2 S1-Protein IgG antibodies, antibody neutralization capacity, SARS-CoV-2 S1 reactive T cells (i. e. interferon-gamma release assay, IGRA) and anti-SARS-CoV-2 nucleocapsid protein antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 nucleocapsid protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The measured “relative units/ml” were calibrated with the “First WHO standard of anti-SARS-CoV-2 immunoglobulin” (NIBSC code 20/136) and converted into Binding Antibody Units (BAU)/ml by multiplication with the factor 3.2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pairwise correlation coefficients were calculated for SARS-CoV-2 S1 reactive T cells, anti-SARS-CoV-2 S1-Protein IgG antibodies and antibody neutralization capacity.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 S1-Protein IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A log-linear regression model predicted that an antibody neutralization capacity value of 75 % corresponds to an IgG antibody value of about 200 BAU/ml.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>an IgG</div><div>suggested: (Hangzhou HuaAn Biotechnology Cat# HA1001, RRID:AB_2819166)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      We are very aware that immunological tests are subject to a number of limitations. Although manifold evidence suggests that there is a correlation between neutralising activity in plasma and protection from symptomatic infection at the population level, the titres of neutralising antibodies decrease over time after infection or vaccination; the kinetics of the decrease vary from person to person. Even normalisation to the WHO standard may not fully compensate for the inter-assay variability of pseudovirus-based neutralisation assays. High speed development of variants (of concern) with presumably altered surface properties makes prognosis of protection somewhat difficult, e.g. shift from delta to omicron basically led to a shift from protection against infection” to (limited) protection against severe sequelae/ severe disease”. Consequently this protection correlate might (as an absolute value) only hold true for conditions present during the study period. Furthermore, exposure to high viral loads would require higher protective titres than exposure to low viral loads (e.g. when masks are worn). Conclusions: Our study makes statements from a time when the Delta variant was predominant. The conclusions do not necessarily apply to other variants such as Omikron. For residents, the mean time between the second vaccination and blood collection was 22 days longer than for HCW (195 days and 173 days, respectively). This could influence the results in such a way that the decline of ...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.10.22270783: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.09.22270547: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Samples: Residual Covid-19 nasopharyngeal patient samples were obtained from the AZ Delta hospital, Roeselare, Belgium with approval of the University Hospital Ghent ethics committee (BC-09263).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This process allows selection of highly specific, high affinity anti-peptide antibodies capable of binding low abundance peptides from solution and retaining them through extensive washing steps designed to minimize non-specific background.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-peptide</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phuket/3073/2013): MDCK cells were cultured, seeded and infected according to the protocol outlined above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDCK</div><div>suggested: CLS Cat# 602280/p823_MDCK_(NBL-2, RRID:CVCL_0422)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV-2 sample preparation protocol was automated using the Andrew Alliance Pipette+ and Shaker+ connected device (Waters Corporation, Milford, MA, USA) both operated via the OneLab platform.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>OneLab</div><div>suggested: (OneLab, RRID:SCR_005545)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PCR amplification was performed using a CFX96 real-time thermal cycler (Bio-Rad Laboratories) and data were analysed with the SARS-CoV-2 Viewer (Seegene).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bio-Rad Laboratories</div><div>suggested: (Bio-Rad Laboratories, RRID:SCR_008426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Skyline (version 21.1) was used to process the raw LC-MS data using a template file containing the six target peptides.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Skyline</div><div>suggested: (Skyline, RRID:SCR_014080)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.10.22269967: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Consent was obtained at enrolment and reviewed at each quarterly visit.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: IgG levels were detected using an in-house, validated ELISA test based on the RBD of the spike protein.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data was extracted from REDCap and exported into CSV/Microsoft Excel worksheets for initial management.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed with R version 4.1.2 and RStudio Version 2021.09.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RStudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Kaplan-Meier survival analysis, Kaplan-Meier curves and Cox regression models were produced with the survival and ggplot2 R packages.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Our study nevertheless has some limitations. First, we observed a very small number of reinfections, hence limiting statistical power. Specifically, we could not determine whether demographic and/or clinical individual characteristics were associated with an increased or decreased reinfection incidence rate. It is also likely that we missed cases of asymptomatic reinfections, since we did not systematically screen all participants with NP swabs on a regular basis (e.g., every 2 weeks). Participants were randomly swabbed only twice during the entire follow-up, which could allow for asymptomatic reinfections to remain undetected. Our measured reinfection incidence rate thus probably underestimates the true reinfection rate, especially if asymptomatic reinfections are PCR-positive for only a short time. Our study could not identify any case of confirmed reinfection by genetic comparison of viral strains, because material recovered in reinfection swabs was insufficient to allow genome sequencing. These low viral loads suggest that reinfected individuals may be less likely to transmit SARS-CoV-2 to susceptible individuals compared to naïve individuals who become infected [30], with the caveat that our study was conducted prior to the spread of the Omicron variant. Vaccines against SARS-CoV-2 became available to participants about 4 months after the initiation of our study. Since participant recruitment was not yet completed when vaccination started, time between enrolment and vacc...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.09.22270272: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Daily Syndromic Surveillance and Supplemental Surveys: Following informed consent provided through secure web-based systems, participants completed a onetime enrollment questionnaire (Supplemental Figure 2) which was immediately followed by a survey questionnaire which collected basic demographics (age, sex, and race/ethnicity), address, and if they were a current healthcare worker (Supplemental Figure 3).<br>IRB: The Institutional Review Board (IRB) at Wake Forest Baptist Health serves as the central or reliance IRB.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The tips were returned by pre-addressed mail to our laboratory for further processing using a one of two lateral flow assays (LFA) detecting IgM and/or IgG antibodies to SARS-CoV-2 (Syntron, Syntron Bio Research Inc., Carlsbad, California, USA or Innovita, Beijing Innovita Biological Technology, China).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sites had the option to host their own system using REDCap (Research Electronic Data Capture), a software toolset and workflow methodology for electronic collection and management of data (8,9).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      The CCRP design is participant-friendly and embraces modern technologies and practical methods to overcome limitations of more traditional studies. For these reasons, the CCRP provides a unique resource for generating evidence-based answers to questions about the SARS-CoV-2 pandemic in the US. The CCRP has several limitations. First, the CCRP is not a population-based study and does not consist of a random sample from the populations in the health system catchment areas, so selection bias is likely. In part, this bias is due to the study requirement of having an active email address and certain recruitment methods that relied on access to mobile technology and web or cell connectivity. CCRP participants were overrepresented by older, female, and Non-Hispanic White groups, although serology cohorts were sampled to more closely represent the demographics of surrounding counties. The decision to participate and loss-to-follow up may also have varied by demographics. As such, results may not be generalizable to broader geographic areas or to populations with less access to healthcare or electronic communications. Second, the logistics of providing serology tests to participants in their homes proved challenging, and the selection strategy for testing and the test platform utilized differed between the National Coalition and the NC State Coalition. There were clear tradeoffs between selectively reduced participation from requiring participants to have a smartphone to report the te...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.09.22269744: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.09.22270718: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study Participants: This study used stored samples and data from studies that were approved by The Johns Hopkins University School of Medicine Institutional Review Board.<br>Consent: All study participants provided written informed consent and were de-identified prior to laboratory testing.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were analyzed using three commercially available serologic assays: Euroimmun Anti-SARS-CoV-2 ELISA (Mountain Lakes, NJ), the CoronaCHEK™ COVID-19 IgG/IgM Rapid Test Cassette (Hangzhou Biotest Biotech Co Ltd), and the Bio-Rad Platelia SARS-CoV-2 Total Antibody ELISA (Marnes-la-Coquette, France).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 ELISA (Mountain Lakes, NJ)</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">17 Analytes with ≥80% overall detectability were evaluated for cytokine level differences between symptom groups and included Eotaxin, Eotaxin-3, IFN-y, IL-12/IL23p40, IL-15, IL-16, IL-17A, IL-18, IL-1RA, IL-6, IL-7, IL-8, IP-10, MCP-1, MCP-4, MDC, MIP-1B, TARC, TNF-a, and VEGF-A.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MCP-1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analysis were performed in STATA v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Our study had several limitations. First, capture of clinical symptoms was based on self-reporting rather than review of the patients’ medical records. Individuals reporting a certain symptom may have experienced a more severe presentation than others reporting the same symptom, which was not captured by this dataset and may have influenced antibody production. Second, samples were obtained a median of 49 days after participants had PCR positive results and 30 days post symptom resolution. Antibody levels may have declined at the time of sample collection; furthermore, samples were collected at only one timepoint and inferences about persistently high titers of antibodies based on symptom cannot be made. In this cohort of known SARS-CoV-2 infected individuals, we found a strong association between cough and antibody response. Conversely, a sore throat was strongly associated with a lack of antibody response to SARS-CoV-2 infection. Future studies could test for IgA levels in nasal or throat samples to evaluate whether a robust mucosal IgA response is associated with certain clinical presentations of COVID-19. Immune factors other than antibodies and our panel of human cytokines may also be evaluated to better characterize the immune responses generated by individuals exhibiting particular symptomatology.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.08.479661: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Human peripheral blood mononuclear isolation and infection: Clinical study was approved by local ethics committee (protocol number 19204) in accordance with institutional guidelines; participants were aware of the nature of the study and signed written informed consent), PBMCs derived from healthy donors (age 30-60, no chronic comorbidities, absence of medications) were isolated by gradient centrifugation using Lympholite-H Cell Separation Media.<br>Consent: Human peripheral blood mononuclear isolation and infection: Clinical study was approved by local ethics committee (protocol number 19204) in accordance with institutional guidelines; participants were aware of the nature of the study and signed written informed consent), PBMCs derived from healthy donors (age 30-60, no chronic comorbidities, absence of medications) were isolated by gradient centrifugation using Lympholite-H Cell Separation Media.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Cells were tested for mycoplasma contamination as previously described(41) CRISPR/Cas9 design and transfection: A549 and Huh-7 cells were transfected with CRISPR/Cas9 RNP (IDT, Coralville, Iowa) by nucleoporation</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">anti-LC3 I-II (1:1000, L7543, Sigma-Aldrich, St. Louis, MO 63103, USA), anti-ATG5 (1:1000, Anti-APG5L/ATG5 antibody, ab228668, Abcam, Cambridge, UK) and anti-β-actin (1:1000, A2066 Sigma-Aldrich, St. Louis, MO 63103, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-LC3 I-II</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-ATG5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-APG5L/ATG5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-β-actin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were fixed using 3.7% formaldehyde and stained with the following primary antibodies: anti-NAAA (1:300</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-NAAA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">0, Abnova, Taipei, Taiwan), ZIKA: Anti-Flavivirus NS1 antibody (ab214337), Anti-SARS-CoV-2 spike protein (Sino Biological, Beijing, China, 1:200).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ZIKA: Anti-Flavivirus NS1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-Flavivirus</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 spike protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Ultrathin sections were collected on a nickel-coated grid, processed for LC3 detection using a primary antibody (Rabbit anti-LC3, Abcam, ab128025, AB_11143008).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-LC3</div><div>detected: (Abcam Cat# ab128025, RRID:AB_11143008)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing in cold PBS, ultrathin sections were incubated in the gold-conjugated secondary antibodies (20 nm gold particles, EM Goat anti-Rabbit IgG, gold conjugated antibody BBInternational EM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GAR 20 AB_1769136), diluted 1:20 in blocking buffer (1% goat serum and 0.2% saponin in PBS) for 1 h at 22 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GAR 20</div><div>suggested: (BBI Solutions Cat# EM GAR20/0.25, RRID:AB_1769136)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549 and Huh-7 cells and NAAA-/- cells were infected with 1 M.O.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: CLS Cat# 300156/p7178_HuH7, RRID:CVCL_0336)</div></div><div style="margin-bottom:8px"><div>NAAA-/-</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western blot analysis: A549 and Huh-7 cells were lysed with RIPA lysis buffer (Millipore, Massachusetts, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.08.479664: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Stock cells were tested for mycoplasma contamination and authenticated by short-tandem repeat (STR) profiling.<br>Authentication: Stock cells were tested for mycoplasma contamination and authenticated by short-tandem repeat (STR) profiling.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies used were: anti-HIV-1 p24 (ARP432, CFAR), anti-GFP (sc-9996, SCBT), anti-HA (C29F4, CST), anti-Strep-tag</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Primary antibodies used were: anti-HIV-1 p24 ( ARP432 , CFAR) , anti-GFP ( sc-9996 , SCBT) , anti-HA ( C29F4 , CST)</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-HIV-1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-GFP</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-9996, RRID:AB_627695)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies include, anti-mouse (61-6520, Thermo Fisher)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Innovative Research Cat# 61-6520, RRID:AB_138451)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were labelled with the following primary antibodies, anti-Nup98 or anti-ORF6 diluted in 4% BSA in PBS for 1 hour at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Nup98</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-ORF6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then incubated with the following secondary antibodies, donkey anti-rabbit-AF568 (ab175692, Abcam) and donkey anti-sheep AF568 (A-21099, Invitrogen) diluted in 4% BSA in PBS for 1 hour at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit-AF568</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>donkey anti-sheep AF568 (A-21099, Invitrogen) diluted in 4% BSA in PBS for 1 hour at RT.</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: HEK293T, HeLa, Mus dunni tail fibroblast (MDTF) and Vero cell lines were maintained in Dulbecco’s modified Eagle medium (DMEM, Thermo Fisher), supplemented with 10% heat-inactivated foetal bovine serum (FBS, Biosera) and 1% Penicillin/Streptomycin (Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunoprecipitation: HEK293T cells were grown in 10 cm2 culture plates transfected and incubated for 16 hrs after which media was replaced.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viruses were titrated by plaque assay on Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plasmids used to generate HIV-1 and MLV VLPs for transduction of ORFs, pCMVΔ8.91 and pHIT60 respectively, and pVSV-G have been described before [38, 39].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMVΔ8.91</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pVSV-G</div><div>suggested: RRID:Addgene_138479)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the initial experiments on Gag expression (Figs 1A-C and S1A and B Figs) and ORF6 co-expression with Rae1 (Fig 2A), a pLVX-IRES-Puro vector encoding an individual ORF was used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLVX-IRES-Puro</div><div>suggested: RRID:Addgene_140240)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The pLVX-StrepII-ORF-IRES-Puro plasmids were then cloned using the NEBuilder HiFi DNA Assembly Cloning Kit (NEB) from the pTriEX-6 plasmids, using the primers listed in Table 1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLVX-StrepII-ORF-IRES-Puro</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pTriEX-6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the remaining assays that required ORF detection or immunoprecipitation, a pLVX-EF1α-SARS-CoV-2-ORF-2xStrep/2xStrep-ORF -IRES-Puro encoding one of the nine ORFs or pLVX-EF1α-eGFP-2xStrep-IRES-Puro plasmid was used, referred to as twin-strep-tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLVX-EF1α-SARS-CoV-2-ORF-2xStrep/2xStrep-ORF -IRES-Puro</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pLVX-EF1α-eGFP-2xStrep-IRES-Puro</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These plasmids were kindly gifted from Nevan Krogan (Addgene plasmid #141383-4, #141387-90, #141392-95); http://n2t.net/addgene:141383-4, 141387-90, 141392-95; RRID:Addgene_141383-4, 141387-90, 141392-95) [5].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>#141383-4</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate the pLVX-EF1α-CoV-1-ORF6-2xStrep-IRES-Puro plasmid, the ORF6(CoV-1)-2XStrep gene was synthesised by GeneArt and cloned in using the EcoRI and BamHI restriction sites.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLVX-EF1α-CoV-1-ORF6-2xStrep-IRES-Puro</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ORF6 mutations were introduced into the pLVX-StrepII-SARS-CoV-2-ORF6-IRES-Puro and pLVX-EF1α-SARS-CoV-2-ORF6-2xStrep-IRES-Puro plasmids using the QuickChange II-XL site-directed mutagenesis kit (Agilent) according to the manufacturer’s instructions using SDM primers listed below.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLVX-StrepII-SARS-CoV-2-ORF6-IRES-Puro</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pLVX-EF1α-SARS-CoV-2-ORF6-2xStrep-IRES-Puro</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following plasmids were sourced from Addgene, psfGFP-N1 (Addgene, #54737) and pmApple-N1 (Addgene, #54567).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pmApple-N1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pCMVsport6Rae1 (MGC:117333) was purchased from Horizon Discovery Biosciences Limited.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMVsport6Rae1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus-like particles (VLP) production: HIV-1 and MLV virus-like particles were generated by co-transfecting HEK293T cells with plasmids, pCMVΔ8.91 (HIV-1) or pHIT60 (MLV) and pVSV-G using lipofectamine 2000 (11668019, Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHIT60</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For generating GFP reporter VLPs, pCSGW (HIV-1) or pczCFG2fEGFPf (MLV) were also added [39, 40].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCSGW</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subcellular fractionation: HEK293T cells were transfected with psfGFP-N1 and either treated with LMB (Merck) at 5nM; or co-transfected with plasmids expressing pLVX-EF1α-ORF6, ORF6(M58A) or ORF9b [5].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>psfGFP-N1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pLVX-EF1α-ORF6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following primers and probes were used; sfGFP: for 5’-GCGCACCATCAGCTTCAAGG, rev 5’-GTGTCGCCCTCGAACTTCAC and probe 5’-FAM-CGGCACCTACAAGACCCGCGC-TAMRA. mRNAseq: The quality of extracted RNA was checked by Agilent TapeStation 42000 on Agilent RNA ScreenTape (Agilent technologies) before proceeding to library preparation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Agilent TapeStation</div><div>suggested: (Agilent TapeStation Laptop, RRID:SCR_019547)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RNA-seq libraries were generated using the NEBNext Ultra Directional RNA Library Prep kit for Illumina with NEBNext® Poly(A) mRNA Magnetic Isolation Module (both New England BioLabs).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NEBNext®</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Poly(A</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Enriched GO terms (Biological process) were filtered and mapped using the REViGO tool available at http://revigo.irb.hr/ [41].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REViGO</div><div>suggested: (REViGO, RRID:SCR_005825)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Normalisation and differential expression analyses were conducted within DESeq2 [43]: normalisation factors for gene-level read counts were produced using counts for the D. melanogaster spike-in controls and differential gene expression calculations were subsequently performed for Human genes alone using the pre-calculated size factors.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: Statistical analysis was performed using GraphPad Prism 9 software. (*, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001, ns – not significant).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.09.479669: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical approval for this cohort was obtained from the Hamad Medical Corporation Institutional Review Board Research Ethics Committee (reference MRC-05-003), and Qatar Biomedical Research Institute-Institutional Review Board (Reference QBRI-IRB 2020-06-19).<br>Consent: All participants (patients and controls) provided written informed consent prior to enrolment in the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples including controls were randomized and applied to the microarray slides for 2 hours and samples’ IgGs were then detected by secondary Cy3-labeled IgG antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cy3-labeled IgG</div><div>suggested: (SeraCare KPL Cat# 5230-0359, RRID:AB_2892090)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Biotinylated human IgG (detected by fluorescently labelled secondary antibody) and biotinylated human anti-IgG (detected only when plasma or serum is added to the slide) were used as positive controls to assess assay integrity.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To check this latter possibility, we selected two proteins (SPANXN4 and STK25) that showed the highest autoantibody alterations to perform their sequence alignment and antigen specificity analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPANXN4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>STK25</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antigen specificity analysis.</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Uniprot BLASTP program was used to compare proteins sequences.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLASTP</div><div>suggested: (BLASTP, RRID:SCR_001010)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein pathways prediction: The assingment of KREX array proteins to functional KEGG categories and their hierarchical organisation was displayed by using Paver, a software for the visualization of Voronoi Treemaps28.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This analysis was performed on R 3.6.2 using clusterProfiler 3.14.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>clusterProfiler</div><div>suggested: (clusterProfiler, RRID:SCR_016884)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.08.479519: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Following air sampling, the elution and quantification of HBsAg concentration was performed in the same way as previously described for the cobas e analyzer panel sub-study but was conducted on the cobas e 801 analytical unit</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Internally validated software (OASEpro HetIA, Roche Diagnostics International) was used to calculate the concentration (IU/mL) of HBsAg from the signal detected by the cobas e analyzers and data were processed using Microsoft Excel (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.07.479471: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 19. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.07.479477: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">P43 crystals: Protein expression and purification: The gene encoding SARS-CoV-2 NSP3 Mac1 (residues 3-169) was cloned into a pET-22b(+) expression plasmid with a TEV-cleavable N-terminal 6-His tag (Genscript).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-22b(+)</div><div>suggested: RRID:Addgene_12651)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">crystals: Protein expression and purification: The gene encoding SARS-CoV-2 2-170 NSP3 Mac1 was cloned into a pET-11a plasmid (Bio Basic) and transformed into E. coli (BL21-DE3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-11a</div><div>suggested: RRID:Addgene_154201)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After five macrocycles of refinement, the 2mFO-DFC (unfilled) and the mFO-DFC NSL density maps were inspected in Coot and modifications made to the coordinates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phases were obtained by molecular replacement with Phaser using the same search model as the lower resolution X-ray experiment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phaser</div><div>suggested: (Phaser, RRID:SCR_014219)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The number of contacts made by water molecules was defined as the number of protein nitrogen or oxygen atoms within 3.5 Å of a water, with distances calculated using PyMOL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      One caveat to using the neutron-determined orientations is that only orientations of highly ordered water molecules could be determined with high confidence (Fig. 5D/E). Fortunately, these waters are most frequently involved in bridging interactions. Simulation-based methods might yield an improved model of the orientations of disordered water molecules (65). We found that the conformational ensemble of Mac1 was unusually robust to temperature and pH perturbation in the crystal. Room temperature crystallography can reveal low occupancy, functionally relevant conformational states of proteins (51, 66–68). The 1.1 Å room temperature structure of Mac1 reported here, in combination with the previously reported 0.85 Å structure determined using the same crystal form at 100 K (14), allowed a detailed analysis of temperature dependent changes in structure and function. Overall, the structure and flexibility at 100 and 293 K were remarkably similar, indicating that unlike several recently reported examples (68–70), Mac1 displays minimal temperature dependent structural changes in crystallo (Fig. 4C). Similarly, assuming that the crystals have equilibrated to the target pH in the ∼4 hour soaks conducted here (71), the pH shift experiments revealed that the Mac1 active site residues and water networks are remarkably robust (Fig. 6I/J), and this is matched by the invariance in ADPr binding across the entire pH range (Fig. 6G/H). One caveat to the pH-shift experiments is the pH-dependent...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.07.479419: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: For studies (K18-hACE2 and 129S2 mice) at Washington University School of Medicine, the protocols were approved by the Institutional Animal Care and Use Committee at the Washington University School of Medicine (assurance number A3381–01).<br>Euthanasia Agents: (b) BALB/c mice: 6 to 8-week-old female BALB/c mice were immunized three weeks apart with 1 or 0.1 μg of mRNA vaccines (mRNA-1273 or mRNA-1273.529) or PBS (in 50 μL) via intramuscular injection in the quadriceps muscle of the hind leg under isoflurane anesthesia.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mouse experiments: (a) K18hACE2 transgenic mice: Seven-week-old female K18-hACE2 C57BL/6 mice were immunized three weeks apart with 5, 0.25, or 0.1 μg of mRNA vaccines (control or mRNA-1273) in 50 μl of PBS via intramuscular injection in the hind leg.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Experiments were neither randomized nor blinded.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Experiments were neither randomized nor blinded.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All cells routinely tested negative for mycoplasma using a PCR-based assay.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed and sequentially incubated with an oligoclonal pool of SARS2-2, SARS2-11, SARS2-16, SARS2-31, SARS2-38, SARS2-57, and SARS2-71(Liu et al., 2021c) anti-S antibodies and HRP-conjugated goat anti-mouse IgG (Sigma Cat # A8924, RRID: AB_258426) in PBS supplemented with 0.1% saponin and 0.1% bovine serum albumin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS2-57</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS2-71</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-S</div><div>detected: (Sigma-Aldrich Cat# A8924, RRID:AB_258426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blood was sampled three weeks after the first immunization and two weeks after the second immunization, and anti-spike and neutralizing antibody levels were measured by ELISA and a VSV-based pseudovirus neutralization assay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-spike</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero-hACE2-TMPRSS2 cells were supplemented with 10 μg/mL of puromycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-hACE2-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody-virus complexes were added to Vero-TMPRSS2 cell monolayers in 96-well plates and incubated at 37°C for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate VSVΔG-based SARS-CoV-2 pseudovirus, BHK-21/WI-2 cells were transfected with the spike expression plasmid and infected by VSVΔG-firefly-luciferase as previously described (Whitt, 2010).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-21/WI-2</div><div>suggested: RRID:CVCL_HB78)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549-hACE2-TMPRSS2 cells were used as target cells for the neutralization assay and maintained in DMEM supplemented with 10% fetal bovine serum and 1 μg/mL puromycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-hACE2-TMPRSS2</div><div>suggested: RRID:CVCL_A5KB)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For studies with BALB/c mice, animal experiments were carried out in compliance with approval from the Animal Care and Use Committee of Moderna, Inc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Heterozygous K18-hACE2 C57BL/6J mice (strain: 2B6.Cg-Tg(K18-ACE2)2Prlmn/J, Cat # 34860) were obtained from The Jackson Laboratory.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: RRID:MGI:3589388)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">129S2 mice (strain: 129S2/SvPasCrl, Cat # 287) and BALB/c mice (strain: BALB/cAnNCrl, Cat # 028) were obtained from Charles River Laboratories.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>129S2/SvPasCrl</div><div>suggested: RRID:IMSR_CRL:287)</div></div><div style="margin-bottom:8px"><div>BALB/cAnNCrl</div><div>suggested: RRID:IMSR_CRL:028)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse experiments: (a) K18hACE2 transgenic mice: Seven-week-old female K18-hACE2 C57BL/6 mice were immunized three weeks apart with 5, 0.25, or 0.1 μg of mRNA vaccines (control or mRNA-1273) in 50 μl of PBS via intramuscular injection in the hind leg.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Four weeks later, K18-hACE2 mice were challenged with 104 FFU of B.1.1.529 by the intranasal route.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(c) 129S2 mice: Seven-week-old female 129S2 mice were immunized three weeks apart with 5 or 0.25 μg of mRNA vaccines (control, mRNA-1273) in 50 μl of PBS via intramuscular injection in the hind leg.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>129S2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Homogenates were analyzed for cytokines and chemokines by Eve Technologies Corporation (Calgary, AB, Canada) using their Mouse Cytokine Array/Chemokine Array 31-Plex (MD31) platform.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AB</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus neutralization assay: Codon-optimized full-length spike genes (Wuhan-1 with D614G, B. 1.351, B. 1.617.2, and B.1.1.529) were cloned into a pCAGGS vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_127347)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The percentage of neutralization was calculated based on relative light units of the virus control, and subsequently analyzed using four parameter logistic curve (Prism 8,0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">. QUANTIFICATION AND STATISTICAL ANALYSES: Statistical significance was assigned when P values were < 0.05 using GraphPad Prism version 9.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Limitations of study: We note several limitations in our study. (1) Female K18-hACE2 and 129S2 mice were used to allow for group caging, and some of our studies had smaller cohorts and were performed in different strains, due to animal availability. Follow-up experiments in male mice and with larger cohorts are needed to confirm and extend these results. (2) We used a B.1.1.529 Omicron isolate that lacks an R346K mutation; this substitution or ones in the emerging BA.2 lineage might further affect vaccine-induced virus neutralization and protection. (3) Our analysis focused on antibody responses and did not account for possible cross-reactive T cell responses, which could impact protective immunity. (4) The B.1.1.529 virus is less pathogenic in mice (Abdelnabi et al., 2021; Bentley et al., 2021; Halfmann et al., 2022). This could lead to an overestimation of protection compared to other more virulent strains in mice. (5) We analyzed mRNA-1273 and mRNA-1273.529 booster responses and protection one month after administration. A time course analysis is needed to assess the durability of the enhanced neutralizing antibody responses and protection against B.1.1.529. (6) Experiments were performed exclusively in mice to allow for analysis of multiple arms and comparisons. Vaccination, boosting, and B.1.1.529 challenge studies in other animal models and ultimately humans will be required for corroboration. In summary, our studies in mice show protection against B.1.1.529 infection a...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.07.479468: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animal procedures were performed under the approvals of the Institutional Animal Care and Use Committee (IACUC) of University of Washington, Seattle, WA.<br>Euthanasia Agents: Mice were injected intramuscularly into the quadriceps muscle of each hind leg using a 27-gauge needle (BD, San Diego, CA) with 50 μL per injection site (100 μL total) of immunogen under isoflurane anesthesia.<br>IRB: This study was approved by the University of Washington Human Subjects Division Institutional Review Board (STUDY00010350)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">BALB/c mice for RBD-NP, S ‘2P’, and HexaPro immunizations: Female BALB/c mice (Stock # 000651, BALB/c cByJ mice) four weeks old were obtained from Jackson Laboratory, Bar Harbor, Maine, and maintained at the Comparative Medicine Facility at the University of Washington, Seattle, WA, accredited by the American Association for the Accreditation of Laboratory Animal Care International (AAALAC).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">One day post-transfection, cells were infected with VSV(G*ΔG-luciferase)29 and after 2 h were washed five times with DMEM before adding medium supplemented with anti-VSV-G antibody (I1-mouse hybridoma supernatant, CRL-2700, ATCC)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-VSV-G</div><div>suggested: (LSBio (LifeSpan Cat# LS-C51761-50, RRID:AB_1277784)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293T cells in DMEM supplemented with 10% FBS, 1% PenStrep seeded in 10-cm dishes were transfected with the plasmid encoding for the corresponding S glycoprotein using lipofectamine 2000 (Life Technologies) following manufacturer’s indications.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus Neutralization: HEK293-hACE2 cells15 or VeroE6-TMPRSS214 were cultured in DMEM with 10% FBS (Hyclone) and 1% PenStrep and 8ug/mL puromycin for TMPRSS2 maintenance with 5% CO2 in a 37°C incubator (ThermoFisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-TMPRSS214</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate VSVΔG-based SARS-CoV-2 pseudovirus, BHK-21/WI-2 cells were transfected with the spike expression plasmid and infected by VSVΔG-firefly-luciferase as previously described30.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-21/WI-2</div><div>suggested: RRID:CVCL_HB78)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentivirus encoding hACE2-P2A-TMPRSS2 was made to generate A549-hACE2-TMPRSS2 cells which were maintained in DMEM supplemented with 10% fetal bovine serum and 1µg/mL puromycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-hACE2-TMPRSS2</div><div>suggested: RRID:CVCL_A5KB)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Both viruses were propagated on Vero-TMPRSS2 cells and subjected to deep sequencing to confirm the presence of expected substitutions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immune complexes were added to VeroE6-TMPRSS2 cell monolayers and incubated for 1 h at 37°C prior to the addition of 1% (w/v) methylcellulose in MEM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BALB/c mice for mRNA-1273 immunizations: Female BALB/c mice (6 to 8 weeks old) were obtained from Charles River Laboratories.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1292S mice for mRNA-1273 immunizations: 129S2 mice (strain: 129S2/SvPasCrl, Cat # 287) were obtained from Charles River Laboratories and housed in a pathogen-free animal facility at Washington University in St. Louis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>129S2</div><div>suggested: RRID:IMSR_CRL:287)</div></div><div style="margin-bottom:8px"><div>129S2/SvPasCrl</div><div>suggested: RRID:IMSR_CRL:287)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmid construction: The SARS-CoV-2-RBD-Avi construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag, flexible linker, and avi tag (GHHHHHHHHGGSSGLNDIFEAQKIEWHE).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1-with</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV-2 S ‘2P’ ectodomain trimer (GenBank: YP_009724390.1, BEI NR-52420) was synthesized by GenScript into pCMV with an N-terminal mu-phosphatase signal peptide and a C-terminal TEV cleavage site (GSGRENLYPQG)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV</div><div>suggested: RRID:Addgene_16459)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The RBD-16GS-I53-50A fusion was cloned into pCMV/R using the Xba1 and AvrII restriction sites and Gibson assembly25.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV/R</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus Neutralization Assay for BALB/c mRNA-1273 samples: Codon-optimized full-length spike genes (Wuhan-Hu-1 with G614, Beta, or Gamma) were cloned into pCAGGS vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_127347)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animals were housed and maintained at the New Iberia Research Center (NIRC) of the University of Louisiana at Lafayette, an AAALAC International accredited institution, in accordance with the rules and regulations of the Guide for the Care and Use of Laboratory Animal Resources.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NIRC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Relative luciferase units were plotted and normalized in Prism (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody-dose response curves were analyzed using non-linear regression analysis (with a variable slope) (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 10. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.08.479559: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Target recognition and potential siRNA designing: siDirect version 2.0[23] is used to design effective and target-specific siRNA molecules against SARS-CoV-2 E, M, N and S gene sequences.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>siDirect</div><div>suggested: (siDirect, RRID:SCR_004853)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 17. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.08.479634: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All cell lines used in this study were regularly screened for mycoplasma contamination using the Universal Mycoplasma Detection Kit (ATCC, 30-1012K).<br>Authentication: All viruses were validated by genome sequencing.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed in PBS supplemented with 2 mM EDTA, permeabilized using Perm/Wash buffer (BD Biosciences), and subsequently stained for 1 h at room temperature with anti-NP mAb 1C7 antibody labeled with an Alexa488-fluorescent marker using the Alexa Fluor™ 488 Antibody Labeling Kit (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-NP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plates were subsequently fixed using 5% formaldehyde and immuno-stained using a monoclonal anti-SARS-CoV-NP antibody (Creative-Biolabs; NP1C7C7).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-NP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, plates were blocked (3% skim-milk TBS with 0.1% Tween20 for 1 h), stained for 90 min with anti-NP antibody (mAb 1C7, diluted 1:1000 in 1% skim-milk TBS with 0.1% Tween20), and finally secondary-stained with anti-mouse-HRP (antibody diluted 1:5000 in 1% skim-milk TBS with 0.1% Tween20 for 45 mins).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse-HRP</div><div>suggested: (Kindle Biosciences Cat# R1005, RRID:AB_2800463)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, SARS-CoV-2 spike protein monoplex IHC was conducted using a Chromomap DAB IHC kit (Roche, Basel, Switzerland) with CC1 antigen retrieval at 95°C for 64 minutes, primary incubation at 1:900 for 40 min at room temperature, rabbit anti-IgG1+IgG2a+IgG3 antibody (ab133469) at 37°C for 20 minutes (1:1,000), and ImmPRESS HRP Goat Anti-Rabbit IgG polymer pre-dilute detection (Vector Laboratories) at 37°C for 20 minutes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IgG1+IgG2a+IgG3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-Rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: Vero E6 (ATCC, CRL-1586), A549 (ATCC, CRM-CCL-185)-derived, and HEK293T (ATCC</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: KCB Cat# KCB 200744YJ, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">hACE2-A549 cells used in Fig.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>hACE2-A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IFNAR KO A549 cells were generated by CRISPR-Cas9 ribonucleoprotein (RNP) complex (IDT) transfection using the Nucleofector system (Lonza Bioscience).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Wild type and IFNAR KO A549 cells were then transduced with an Ace2 expression vector simultaneously using a pTRIP-SFFV-Blast-2A-myc-hACE2 construct, a kind gift from Nir Hacohen and Matteo Gentili (Massachusetts General Hospital and the Broad Institute), sequenced, and then functionally validated (Suppl. Fig. 3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IFNAR KO</div><div>suggested: RRID:CVCL_A8AL)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viruses: SARS-CoV-2 isolate USA-WA1/2020 (BEI Resources NR-52281) stocks were grown in Vero E6 cells as previously described (Miorin et al., 2020). hCoV-19/Japan/TY7-503/2021 (P.1) was obtained from BEI Resources (NR-54982).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">. B.1.351, B.1.617.2, and P.1 viral stocks were grown on Vero TMPRSS2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus was reconstituted from lyophilized sample and then titered using Vero cells as described (Huang et al., 2020; Xie et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In vitro antiviral growth assay: Vero E6, Ace2-A549, or Ace2-HEK293T cells were seeded in 96-well plates in DMEM (10% FBS) and incubated for 24 h at 37°C and 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ace2-HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike-induced syncytia assay: 30,000 Vero-TMPRSS2 cells were reverse transfected with 100 ng of pCAGGS-S plasmids in a black 96-wellplate using TransIT-LT1 Transfection reagent (Mirus) in complete growth medium (containing 10% FBS).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Wild type and IFNAR KO A549 cells were then transduced with an Ace2 expression vector simultaneously using a pTRIP-SFFV-Blast-2A-myc-hACE2 construct, a kind gift from Nir Hacohen and Matteo Gentili (Massachusetts General Hospital and the Broad Institute), sequenced, and then functionally validated (Suppl. Fig. 3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pTRIP-SFFV-Blast-2A-myc-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The pCAGGS-S plasmids used in this assay have been previously described (Escalera et al., 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS-S</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV-2 Delta variant (B.1.617.2 PV29995) was obtained from Dr. Viviana Simon (Mount Sinai Pathogen Surveillance Program)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pathogen Surveillance Program</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The IC50 was determined using GraphPad Prism software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">NeonGreen fluorescent infected cells were evaluated using Flow-Jo software after gating on live cell populations.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flow-Jo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Live focused single cells were gated and NeonGreen fluorescent positive cells were evaluated using Ideas software and pixels were exported for further analysis on Prism to graph the dot plots and compare NTZ-treated to mock by the Mann-Whitney two-tailed test.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">iAT2s were serially passaged approximately every 2 weeks by dissociation into single cells via the sequential application of dispase (2 mg/mL; Thermo Fisher Scientific; 17105-04) and 0.05% trypsin (Invitrogen; 25300054) and replated at a density of 400 cells/μL of Matrigel (Corning; 356231), as previously described (Jacob et al., 2019).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo Fisher Scientific</div><div>suggested: (Thermo Fisher Scientific, RRID:SCR_008452)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.08.22270676: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: A written informed consent was obtained from each participant, as approved by COFEPRIS, to voluntarily participate in the study for 12 months including 11 visits to the site plus at least six telephone follow-up calls scheduled according to the date of the first visit.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Female and male participants between 18 and 55 years of age without prior immunity to SARS-CoV-2 were enrolled.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">However, a subsequent test of anti-spike antibodies, post-administration of the vaccine, showed a low, yet positive antibodies level (148.8 AU/mL</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In addition, the participants were subject to COVID-19 testing (nucleic acid-GeneFinder™ COVID-19 Plus RealAmpKit, and antibody-as above) to exclude prior or active infection, as such infection was part of the exclusion criteria.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COVID-19 testing ( nucleic acid-GeneFinder™ COVID-19</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antibody-as</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Day 14, 21, 28, 42, 90, 180 and 365 visits include blood sampling for IgM – IgG – IgA antibodies, neutralizing antibodies, and T cell responses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgM – IgG – IgA</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Our study has several limitations. Quantitative neutralization assays with authentic SARS-CoV-2 could not be performed at the study site at the time of analysis due to biosafety restrictions. In addition, in this interim analysis, neutralizing activity against variants of concern could not be assessed. Furthermore, we were not able to directly compare immune responses induced by inactivated NDV-vectored SARS-CoV-2 vaccines (41) with those observed following administration of other authorized/licensed COVID-19 vaccines. We expect to perform these additional assays and direct comparisons at later time points as soon as reagents and materials become available. So far, the assessment of mucosal antibodies has also not been possible. Finally, this was a non-randomized open label study without a placebo control group, which is more prone to biases as compared to randomized and double-blinded study designs. In conclusion, we show that the live AVX/COVID-12-HEXAPRO vaccine has a safety profile that is remarkably independent of the dose and administration route with low frequency and intensity. Furthermore, the HD IM-IM and IN-IM vaccination regimens showed strong evidence of immunogenicity warranting further development of this vaccine candidate. Finally, it is important to note that the NDV vector technology is amenable to rapid changes in antigens expressed allowing for strain changes to match emerging viral variants. A B.1.1.529 (Omicron)-specific version of NDV-HXP-S is currently...


      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04871737</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Study of a Live rNDV Based Vaccine Against COVID-19</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04830800</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Phase 1/2 Safety and Immunogenicity Trial of COVID-19 Vacc…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04993209</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Clinical Trial of the COVID-19 Vaccine (Recombinant, Inactiv…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04764422</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Assess the Safety and Immunogenicity of NDV-HXP-S Vaccine in…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.08.22270696: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the Mass General Brigham Institutional Review Board.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Study population: We systematically identified all SARD participants with SARS-CoV-2 confirmed by PCR, nucleocapsid antibody, or antigen testing (from March 1, 2020 to November 3, 2021 for this analysis) at Mass General Brigham (MGB) HealthCare system in the greater Boston, Massachusetts area, as previously described(2, 9, 11-14).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen testing (from March 1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">neutralizing monoclonal antibodies to SARS-CoV-2, or clinical trial enrollment), hospitalization, supplemental oxygen, and mechanical ventilation were obtained by survey.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Study population: We systematically identified all SARD participants with SARS-CoV-2 confirmed by PCR, nucleocapsid antibody, or antigen testing (from March 1, 2020 to November 3, 2021 for this analysis) at Mass General Brigham (MGB) HealthCare system in the greater Boston, Massachusetts area, as previously described(2, 9, 11-14).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: (Active Motif Cat# 91351, RRID:AB_2847848)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Prolonged symptom duration definition: As in general population studies, prolonged symptom duration (or PASC) was defined either as those suffering from COVID-19 symptoms persistently for 28 or more days, or those whose symptoms initially resolved (or were not initially present) but then recurred/developed 28 or more days after COVID-19 onset, as defined by the US Centers for Disease Control and Prevention (CDC)(22, 23).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PASC</div><div>suggested: (PASC , RRID:SCR_016642)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Our study does have limitations. The cross-sectional nature allowed for the surveying of respondents at only one point in time post-COVID-19, possibly introducing recall bias, particularly related to assessment of disease activity and symptoms at acute COVID-19 onset. The survey response rate was 26%, similar to other survey studies, but there were some factors that may have response rate and could affect generalizability. We were also only able to assess survivors of COVID-19. Some participants who were very ill during their acute COVID-19 course may have been less likely to respond to the survey while recuperating. We found that hospitalization was significantly associated with prolonged symptom duration. Future studies may focus on this vulnerable population at high risk for protracted COVID-19 course. Our sample was heterogeneous, composed of participants with a variety of different SARDs. Future analyses in this study will focus on specific SARDs such as RA once the sample size is sufficient. Disease activity and flare were obtained by participant report rather than in-person physical examination. Since many SARD types were included, a single validated assessment would have been difficult to measure. However, the RAPID3 is commonly used as a survey instrument for all SARD participants to measure participant-reported disease activity and pain. It is possible that a small proportion of participants may have had persistent viral infection, as has been described for SARDs wi...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.08.22269319: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.


      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Power limitations prevented our analysis from studying other clinical outcomes such as hospitalizations or deaths. Our alternative modeling approach used the susceptibility profile of the vaccine-eligible population over time to estimate the COVID-19 cases prevented by vaccination. The key assumption in the alternative model was complete reporting of COVID-19 cases and vaccination, although this assumption was relaxed for estimating the relative reduction outcome. Similarly, we assumed the symptomatic fraction of reported SARS-CoV-2 infections remained constant over time, even with the introduction of vaccines (see Appendix). An increase in asymptomatic screening over time would bias the study to overestimate the public health impact of vaccination, while an increase in the asymptomatic fraction of infection over time due to vaccine effectiveness would bias the study to underestimate the public health impact of vaccination. In conclusion, we found that COVID-19 vaccination had a substantial public health impact by reducing COVID-19 cases in California. This study provides evidence on the public health impact of COVID-19 vaccination in the United States, and further supports the urgency for continued vaccination.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.08.22270685: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the Emory University Institutional Review Board under STUDY00001082.<br>Consent: Exclusion criteria included asymptomatic patients, those with symptoms associated with COVID-19 for greater than 7 days, and those unable to provide informed consent.<br>Field Sample Permit: Saliva specimens were collected using the SalivaDirect unsupervised collection kit (New Haven, CT) under the supervision of a healthcare provider, including a short straw (Salimetrics Saliva Collection Aid (Carlsbad, CA), catalog #5016.02) and a sterile 2 mL plastic tube containing 3 ceramic beads.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Clinical and demographic variables were collected in a centralized, web-based database (REDcap, Nashville, TN).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDcap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Absolute agreement of Ct values and antigen concentrations across sample types were calculated via an intraclass correlation coefficient (ICC) using a two-way mixed effects model in IBM SPSS Statistics for Windows, version 28 (IBM Corp.,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Limitations of our data include the use of self-collected swabs in the familial cohort, which may not have been collected as reliably as those collected by a healthcare provider in the cross-sectional cohort. RT-PCR assays were performed with a common assay (Cepheid GeneXpert) for MT and OP samples while saliva was assayed based on the SalivaDirect protocol. Neither assay has EUA approval as a quantitative test and this may limit conclusions, particularly from comparison of Ct values between saliva and the other specimens. Additionally, the quantity of cellular material and mucous may be inherently different between sample types with different collection methodologies, particularly with saliva collected as a pooled drool specimen compared to MT and OP samples obtained with collection swabs eluted in buffer. Despite this, the pragmatic question of viral yield for diagnostic samples can be investigated in this manner particularly because a consistent sample volume and a common assay was used for nucleocapsid measurements across all sample types. Thus, our data appear to suggest that higher antigen levels may be found in saliva specimens, but calculation of PPA failed to show benefit in diagnostic yield. Conclusions as to the utility of saliva for antigen testing may be limited by missing specimens from some participants and a small sample size. The observation of OP- and MT-predominant phenotypes is a key finding in our data in addition to the absence of an effect of days of sy...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.09.22270633: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.


      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.08.22270658: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study protocol (VKI-I/II-08/20) and its supplementary documentation were approved by the Ethics Committee of the Ministry of Health of the Russian Federation (No. 502 from September 21, 2020).<br>Consent: All participants were screened for eligibility on the basis of their health status, including their medical history, vital signs, physical examination and laboratory test results, and were enrolled after providing signed and dated informed consent forms.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study design and participants: The study is a randomized, double-blind, placebo-controlled, multi-center clinical trial of the tolerability, safety, and immunogenicity (Clinical trials, phase I/II) of the inactivated whole virion concentrated purified coronavirus vaccine CoviVac in adult volunteers aged 18-60.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">The laboratory specialists were provided with the samples marked with coded numbers, and thus were also blinded.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Statistical analysis: The sample size was determined based on the requirements of the national guidelines, and the distribution of the participants between Vaccine Group and Placebo Group was 3:1.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The participants of Stages 1 and 2 were also screened at enrolment for anti-SARS-CoV-2 IgM and IgG antibodies by ELISA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 IgM</div><div>suggested: (Bethyl Cat# E88-302, RRID:AB_2892019)</div></div><div style="margin-bottom:8px"><div>IgG antibodies by ELISA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum samples from randomly selected participants were additionally tested in ELISA for total antibodies against RBD with CoronaPass Total (Genetico, Russia) and for total antibodies to S protein trimer (Vector-Best, Russia)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vector-Best , Russia</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization test was performed using SARS-CoV-2 strain PIK35 in Vero cells as described previously (Kozlovskaya et al., 2021)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IgG antibodies to nucleocapsid protein (N) were detected using Architect SARS-CoV-2 IgG CMIA (Abbott Diagnostics, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Interferon-gamma (IFN-γ) production in response to stimulation with SARS-CoV-2 S-protein peptides was assessed using QuantiFERON SARS-CoV-2</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>QuantiFERON</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT05046548</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">This is a Double-blind, Placebo-controlled, Randomized Study…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.08.22270465: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Our analysis also did not include limitations on the capacity of health systems, which could affect mortality beyond what we capture with IFR. In addition, we do not attempt to model disease transmission dynamics, or include a temporal component in the model, so we assume anyone without immunity from vaccine or natural protection as of December 13, 2021 retains their risk of COVID-19 mortality through 2022. This is a major limitation given the speed with which the Omicron variant of COVID-19 has been spreading; however, our analysis considering vaccination scale-up after the whole population has been previously infected still estimates a cost-per-death averted of $115,000. Finally, our main analysis uses reported deaths or excess mortality estimates to estimate rates of prior infection with COVID-19, which are inexact measures especially for the regions of most concern. Nevertheless, they are the best available estimates to date. Experts have proposed several plans to rapidly expand global COVID-19 vaccine production and delivery.15,17,18 However, the international community has not yet invested the resources required nor displayed the political commitment necessary to scale global vaccination. As a result, 86 countries did not reach the World Health Organization’s target of vaccinating 40 percent of their populations by the end of 2021.29 This analysis shows that global vaccination can be undertaken for a fraction of the trillions of US$ already spent on global COVID-19 resp...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.08.22270506: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: As requested by French ethics and regulatory laws, the ethical committee of the French-speaking Society of Infectious Diseases (SPILF) (IRB00011642) gave its approval for the study (N°2022-0101), and the study was declared to the French National Commission for Informatics and Liberties (CNIL MR004: n°2224742).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Our study has several limitations. Firstly, due to the retrospective design of the study, some data retrieved from the medical files may have been erroneous or not completely accurate. However, the high number of studied patients, and comprehensive analysis on patients of known risk factors for adverse outcomes helped to reduce risk of biases. Secondly, we did not measure anti-Spike antibody titers in vaccinated patients at admission, a previously described predictive risk factor for SARS-CoV-2 infection and Covid-19 27; it would have helped to better understand whether severe infections in vaccinated subjects were due to waning of the neutralising antibody vaccine response. Moreover, we used ICU admission as a severity criterion; however, it is usually considered that older patients with many comorbidities would not benefit from ICU admission in terms of survival. Therefore, not being admitted to ICU does not necessarily mean that there is no severe form of Covid-19. In conclusion, patients hospitalised with a SARS-CoV-2 infection with the delta VOC have less marked severity criteria when they are vaccinated more than 14 days before hospitalisation, especially in case of elderly patients. These data should be provided when communicating information about Covid-19 vaccination with subjects at risk of severe Covid-19 because of their age or comorbidities.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.08.22270495: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the ethics committee of University Hospital Institute Méditerranée</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mapping was cleaned with Samtools (https://www.htslib.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The genomes the closest genetically to those obtained here were selected using Usher (https://genome.ucsc.edu/cgi-bin/hgPhyloPlace) and the GISAID BLAST tool (https://www.epicov.org/epi3/) then incorporated in phylogeny with all 21L/BA.2 Omicron variant genomes from France available in GISAID.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GISAID BLAST tool</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.08.22270649: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">AEs are presented by the MedDRA v24.0 term.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MedDRA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In the population pharmacokinetic model, logarithmically transformed plasma nirmatrelvir concentration versus time data were analyzed with NONMEM, version 7.5.0 and the FOCE method with interaction.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NONMEM</div><div>suggested: (NONMEM, RRID:SCR_016986)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Limitations of the study include that only a small number of participants were enrolled to provide an initial evaluation of safety and pharmacokinetics in healthy participants. Larger trials across various patient populations were needed to confirm nirmatrelvir/ritonavir safety and evaluate efficacy. Such large studies in patients with COVID-19 (Evaluation of Protease Inhibition for COVID-19 in High-Risk Patients [EPIC-HR], in Standard Risk Patients [EPIC-SR], and Post-Exposure Prophylaxis [EPIC-PEP]) along with clinical pharmacology studies (eg, in participants with renal or hepatic impairment), are either completed or ongoing. Study participants were also of limited ethnic diversity. However, a small number of Japanese participants were included, and no meaningful differences in safety and pharmacokinetic results were identified between Japanese and non-Japanese participants. In conclusion, in response to the urgent need for COVID-19 treatments, our innovative, seamless, and efficient approach in this study enabled accelerated dose and regimen selection for use in late phase clinical studies within 6 weeks from the first dose in humans without compromising the quality of safety and pharmacokinetic assessment, while providing the appropriate confidence to initiate pivotal efficacy trials. Nirmatrelvir/ritonavir was safe and well tolerated in healthy participants. Ritonavir enhanced nirmatrelvir pharmacokinetics, hereby expected to achieve plasma concentrations and maintain C...


      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04756531</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">STUDY OF PF-07321332 IN HEALTHY PARTICIPANTS</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04909853</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Renal Impairment Study of PF-07321332 Boosted With Ritonavir…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.08.479556: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein and oligonucleotides: SARS-CoV-2 nucleocapsid protein # YP_009724397 with quadruple D63G, R203M, G215C, and D377Y mutations including 6His with TEV cleavage site was synthesized and cloned into the pET-29a(+) expression vector by GenScript (Pisctaway, NJ).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-29a(+ )</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alignment of SARS and related sequences was carried out with COBALT at NLM (69), and highlights for similar residues were taken from ESPript (70), plotted with MATLAB (Natick,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MATLAB</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 37, 29 and 30. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.07.479306: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: All collections were conducted under protocols reviewed and approved by the Institutional Review Board of Columbia University.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Data reporting: No statistical methods were used to predetermine sample size.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.01.27.478053: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: COVID-HIG activity against SARS-CoV-2 is determined by validated in-house potency assays (trimeric SARS-CoV-2 Spike protein antigen and Lentivirus neutralization) at product release and has been characterized for neutralizing potency by a wild-type SARS-CoV-2 assay (Bennett et al., 2021) as well Production of SARS-CoV-2 Pseudovirus Variants and Neutralization</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">COVID-HIG is a human hyperimmune product of purified immunoglobulin (IgG) fraction of human plasma containing antibodies to SARS-CoV-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Each plasma donation is tested for human immunodeficiency viruses 1/2 (HIV-1/2) and hepatitis C virus (HCV) antibodies, and as well as hepatitis B virus (HBV) surface antigen.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HIV-1/2</div><div>suggested: (Capricorn Products Cat# HIV-018-48303, RRID:AB_2895202)</div></div><div style="margin-bottom:8px"><div>HCV</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HBV) surface antigen.</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The test material + virus mixture is added to Vero E6 cells and incubated at 37°C/5% CO2 for 24 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Titers were calculated using a nonlinear regression curve fit (GraphPad Prism software Inc., La Jolla, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) (Prism, Graphpad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04546581</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Inpatient Treatment of COVID-19 With Anti-Coronavirus Immuno…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04910269</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Outpatient Treatment With Anti-Coronavirus Immunoglobulin</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.07.22270640: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The Ethics Committee of the Universidad del Rosario approved the research protocol.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      This study has some limitations. First, we only considered admission values as predictors of mortality. Patients with COVID-19 might have different behaviors with several kinds of intervention requirements that we did not observe, and which could modify the prognosis. Additionally, we did not consider certain variables related to the Hb dissociation curve as PCO2 or acid-base status, which might be associated with residual confusion bias. Furthermore, we did not consider the pharmacological history that could affect the baseline CBC. Lastly, given the retrospective nature of our study, and since the data were gathered from clinical records, we could not guarantee a uniform measurement for each variable. It is necessary to note that no effect can be associated with high-altitude exposure given the absence of a comparative group. The variables studied might also be modified in chronic pulmonary disease or tobacco use. However, including those variables in the purposeful selection of covariates for multivariate analysis showed us that they lacked significance. This study allowed us to hypothesize that the adaptative mechanism for chronic hypoxia modifies the pathological process in respiratory diseases. Further studies are required to understand this biological interaction.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.02.07.479443: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>