24,814 Matching Annotations
  1. Mar 2022
  2. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.23.22272840
    1
    1. sciscore 28 Mar 2022

      SciScore for 10.1101/2022.03.23.22272840: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.23.22272840
  3. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.24.22272901
    1
    1. sciscore 28 Mar 2022

      SciScore for 10.1101/2022.03.24.22272901: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.24.22272901
  4. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.25.22272949
    1
    1. sciscore 28 Mar 2022

      SciScore for 10.1101/2022.03.25.22272949: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">We defined the comparator/control as people without the exposure of interest (e.g., male versus female, people without diabetes, etc.) or with different levels of the exposure (e.g., different age group or BMI category).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">We included peer-reviewed articles, results in trial registrations (if no report published yet), and pre-prints of primary studies, including (for KQ1) prospective/retrospective observational studies with ≥ 300 participants with Covid-19, and (for KQ2) randomized and quasi-randomized or experimental studies (e.g., controlled before-after, interrupted time series, uncontrolled before-after implementation studies), prospective or retrospective cohort studies with control groups, case-control studies, and case series/uncontrolled cohorts.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Limitation of the evidence and future direction: Our findings are mostly applicable to longer-term consequences of Covid-19 occurring ≥22 weeks after diagnosis or illness onset as we identified only a few studies with shorter follow-up length. Also, despite the large volume of data emerging, many studies came from a hospitalized population. Of all the included studies, we identified only one that was exclusively in children who were previously hospitalized with Covid-19 (40). The study reported on several potential risk factors including age, sex, acute Covid-19 severity, obesity, and allergic diseases, however, none were identified as having a strong association with outcomes of our review. Evidence was also sparse in relation to pre-existing socioeconomic variables (e.g., race/ethnicity, income, education, employment) and marginalized groups including indigenous communities, institutionalized populations, and persons with disability, despite being listed as priority populations for Covid-19 policies by several jurisdictions. Similarly, we did not locate studies reporting on associations between Covid-19 vaccination status and long-term consequences of Covid-19. Moreover, current studies are mostly based on self-reported outcome and exposure data, which could be subject to recall bias and misclassification, and may limit generalizability of the evidence to other populations (30). There is also the possibility of over/under-estimation of the reported associations as people fr...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.25.22272949
  5. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.24.22272854
    1
    1. sciscore 28 Mar 2022

      SciScore for 10.1101/2022.03.24.22272854: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics approval: Ethical approval was granted by Regional Committees for Medical and Health Research Ethics (REC) Southeast (reference number 122745).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      The study also has some limitations. For the combined registries there can be errors for specific individuals, missing individuals, and older data (e.g county of residence, household crowding). Data used from these registries are not collected for the purpose of this study alone and some details might not be as precise. But there is no reason to believe that such discrepancies, if they exist, would differ among the different groups that we have compared. Various aspects related to disease dynamics, risk of infection, testing strategy, and response changed over the study period, making it challenging to identify all elements that affect vaccine effectiveness and risk of infection. However, we expect these changes to be similar between the adolescents in this study and by using time explicitly in our models we take some of these changes indirectly into consideration. However, residual confounding may still be present. The sensitivity analyses using data from only cases screened for variants compared to all reported cases provided similar estimates on vaccine effectiveness (supplementary material, part 2). Therefore, we conclude that using all reported SARS-CoV-2 cases in periods with one variant dominating can provide similar vaccine effectiveness estimates with larger power when only a small proportion of samples are screened. Even though testing capacity is high in Norway and regular testing was recommended for adolescents in areas and periods with high infection rates that a...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.24.22272854
  6. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.23.22272819
    1
    1. sciscore 28 Mar 2022

      SciScore for 10.1101/2022.03.23.22272819: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We made these calculations and created these charts using Excel for Microsoft 365.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      However, the usability of VAERS data depends on users understating this surveillance system’s limitations and knowing how to interpret its results. Governmental regulations, availability of vaccines, and public health recommendations have the largest impact on reporting rates, which could be used to improve VAERS data.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.23.22272819
  7. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.24.485222
    1
    1. sciscore 28 Mar 2022

      SciScore for 10.1101/2022.03.24.485222: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">22 We then used the Gensim implementation of Word2vec to train a word embedding with 3,600 dimensions, a 6-token window of optimization, and a minimum token frequency of 5 instances within the corpus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Word2vec</div><div>suggested: (word2vec, RRID:SCR_014776)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">23 We compute a vector representing each PDBe ligand using the mean embedding of all synonyms for the chemical compound as listed in the PubChem database.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PubChem</div><div>suggested: (PubChem, RRID:SCR_004284)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.24.485222
  8. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.23.485509
    1
    1. sciscore 27 Mar 2022

      SciScore for 10.1101/2022.03.23.485509: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: APS1: North America - 1: All patient cohort data was collected and evaluated at the NIH, and all APECED/ APS1 patients were enrolled in a research study protocol approved by the NIH Institutional Review Board Committee and provided with written informed consent for study participation (protocol #11-I-0187, NCT01386437).<br>Consent: APS1: North America - 1: All patient cohort data was collected and evaluated at the NIH, and all APECED/ APS1 patients were enrolled in a research study protocol approved by the NIH Institutional Review Board Committee and provided with written informed consent for study participation (protocol #11-I-0187, NCT01386437).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">#2272S) and/or anti-FLAG (Cell Signaling Technologies, #1493S) antibodies were used as positive controls for immunoprecipitations.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-FLAG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We applied a logistic regression classifier on log-transformed PhIP-Seq RPK values from APS1 patients (n = 128) versus healthy controls (n = 186) using the scikit-learn package (Pedregosa et al 2011) with a liblinear solver and L1 regularization.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>scikit-learn</div><div>suggested: (scikit-learn, RRID:SCR_002577)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">North America - 2: All patients underwent informed consent with research study protocols approved by the UCSF Human Research Protection Program (IRB# 10-02467).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UCSF Human Research Protection Program</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      A practical limitation of this technique is that non-specific phage may also be amplified, in addition to a wide array of autoreactive, but non-disease related peptides. We tested whether we could detect global differences between case and control cohorts as a measure of autoreactivity. As each APS1 patient is known to have multiple, high-affinity antibodies to self-proteins (Fishman et al., 2017; Landegren et al., 2016; Meyer et al., 2016; Vazquez et al., 2020) we reasoned that this would be an ideal cohort to determine whether a global autoreactive state was discernible. As expected, each individual sample exhibits a spectrum of enriched genes, regardless of disease status (Figure 2A), indicating that measures of simple enrichment are inadequate for discrimination of cases from controls. We and others have shown that PhIP-Seq can robustly detect disease-associated antigens by comparing antigen-specific signal between disease and control cohorts (Larman et al., 2011; Mandel-Brehm et al., 2019; O’Donovan et al., 2020; Vazquez et al., 2020). In this dataset, encompassing 186 control samples and 128 APS1 samples, we further evaluated the importance of control cohort size. We iteratively down sampled the number of healthy control samples in our dataset to 5, 10, 25, 50, 100, or 150 (out of n=186 total control samples). The number of apparent hits was determined in each condition, where a gene-level hit was called when the following criteria were met: 1) at least 10% of APS1 samp...

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT01386437</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Natural History of Individuals With Immune System Problems T…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT03394053</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">The Mechanistic Biology of Primary Immunodeficiency Disorder…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT03610802</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Send-In Sample Collection to Achieve Genetic and Immunologic…</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/content/10.1101/2022.03.23.485509v1
  9. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.23.22272828
    1
    1. sciscore 27 Mar 2022

      SciScore for 10.1101/2022.03.23.22272828: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Human subjects and samples: Written informed consent was obtained from all patient and healthy donors, or from patients’ family if patients were too unwell to consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">X-Shift clustering was generated using the flowjo platform and used the same markers as UMAP, with the following settings: number of nearest neighbours (k): 20, Distance Metric: Angular, sampling limit 94000.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>flowjo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All spectra were acquired using an Orbitrap Fusion Tribrid mass spectrometer controlled by Xcalibur 2.1 software (Thermo Scientific) and operated in data-dependent acquisition mode using an SPS-MS3 workflow.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Xcalibur</div><div>suggested: (Thermo Xcalibur, RRID:SCR_014593)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(Thermo Scientific) and searched against the UniProt Human database (downloaded January 2021) using the SEQUEST HT algorithm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UniProt</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bioinformatics analysis of Proteomics: Following analysis in Proteome Discoverer 2.1, the proteomics data were processed and further analysed in the R statistical computing environment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Proteome Discoverer</div><div>suggested: (Proteome Discoverer, RRID:SCR_014477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PCAs were calculated using the PCA function in the FactoMineR package, and plotted using either ggplot (2D), or Plotly (3D).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FactoMineR</div><div>suggested: (FactoMineR, RRID:SCR_014602)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analysis was performed using Graphpad Prism 8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      A limitation of our study was the sample size where, particularly for proteomics, analysis of data following stratification by patient outcome was unfortunately not possible or underpowered. This risks the reduced detection of significant alterations to protein content due to the low number of patient samples. In summary, we show that severe COVID-19 is associated with hyperactive immature neutrophils, maintenance of CXCR2 expression and increased translational activity. Our study identifies neutrophil subpopulations as prognostic biomarkers of disease severity and supports a role for neutrophils in COVID-19 immunopathogenesis. CXCR2 downregulation on neutrophils may act to prevent progression to severe disease. Finally, as proposed by others, the IL-8 signalling pathway, and in particular CXCR2, may represent therapeutic targets for severe COVID-19 (83).

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/content/10.1101/2022.03.23.22272828v2
  10. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.24.22272883
    1
    1. sciscore 27 Mar 2022

      SciScore for 10.1101/2022.03.24.22272883: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Institutional Review Board (IRB) approval was obtained.<br>Consent: The requirement for patient informed consent was waived by the IRB as this project represented a non-interventional study utilizing routinely collected data for secondary research purposes.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Among patients who had anti-COVID spike protein antibody results, COVID-19 history was collected and included the following (if available): type of COVID vaccine received and number of doses, history of positive COVID infection, and therapies received for COVID treatment (if applicable).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-COVID spike protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary outcomes included positive anti-COVID spike protein antibody titers in the following patient subgroups: patients who received an additional primary shot; different lymphoma subtypes; patients who received anti-CD20 monoclonal antibody therapy within the previous 12 months; and patients who received active anticancer treatment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD20</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      There are some limitations to this study. Firstly, this was a single-center, retrospective chart review. Some patients received their COVID vaccine at an outside facility, therefore, the exact date and the type of vaccine received was not consistently available. Secondly, the timing of the additional primary shot of COVID vaccine was not uniform among all patients, and not all patients received this additional dose. As the COVID-19 pandemic progressed and the Center for Disease Control updated recommendations based on available evidence, some patients received the additional primary shot of the COVID vaccine closer to the recommended 28 days after completion of the primary series than others, and some have yet to receive their additional primary shot. Lastly, although there were 243 patients evaluated in the overall analysis, some subgroups of particular interest had smaller numbers of patients. In conclusion, lymphoma patients are capable of mounting a humoral response to the COVID mRNA vaccines. Although seroconversion is lower than in the normal population, it is still significant and warrants administration of COVID vaccine without delay, particularly during continuing high rate of infection. CLL/SLL appears predictive of a negative antibody response to the COVID vaccine, while HL/TCL histologies appeared to correlate to a positive antibody response, even with treatment within 6 months of vaccination. Our study suggests anti-CD20 monoclonal antibody therapy in the last 12...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.24.22272883
  11. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.24.22272892
    1
    1. sciscore 27 Mar 2022

      SciScore for 10.1101/2022.03.24.22272892: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: A favourable ethical opinion was received from the University of Leeds School of Medicine Research Ethics Committee in January 2021 (reference MREC 20-041 - Secondary analysis of C19-YRS (COVID-19 Yorkshire Rehabilitation Scale) and approved by Leeds Community Healthcare Research and Innovation department.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A favourable ethical opinion was received from the University of Leeds School of Medicine Research Ethics Committee in January 2021 (reference MREC 20-041 - Secondary analysis of C19-YRS (COVID-19 Yorkshire Rehabilitation Scale) and approved by Leeds Community Healthcare Research and Innovation department.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Community Healthcare</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      The NIHR-funded project Long Covid Multidisciplinary Consortium for Optimising treatments and services acrOss the NHS (LOCOMOTION) is a platform of >5000 patients in the UK whose symptoms and functional limitations will be captured using the modified C19-YRS at regular 3-monthly intervals.24 We will have the opportunity to assess the construct and criterion validity of the scale, responsiveness and ability to monitor effect of interventions, along with picking up the natural daily and weekly fluctuations of the condition. This can also estimate how effectively the measure captures differences between individuals, and changes over time within the individual. The floor and ceiling effects of the measure will be assessed to establish the active measurement range of the scale, and we will estimate how effectively the measure captures small differences between individuals at either end of the clinical spectrum of the condition. We will also evaluate the respondent burden of completing the measure within the population, and we will assess the use of digital tools, which can be challenging in certain cohorts (such as those with cognitive problems and those who do not use smartphones). The scale will undergo further Rasch analysis to validate the scale and determine its validity as an outcome measure in LC. Additionally, when the assumptions of the Rasch model are satisfied, it is possible to transform the ordinal-level scale raw scores to an interval-level score, due to the sufficie...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.24.22272892
  12. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.24.22272835
    1
    1. sciscore 27 Mar 2022

      SciScore for 10.1101/2022.03.24.22272835: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Our analysis is subject to a number of limitations. First, in order to provide timely evidence of the effectiveness of a fourth dose of BNT162b2b vaccine, we were only able to include 10 weeks of data. Although the pattern of a short-term increase in protection against infection followed by waning is already present, long-term effectiveness needs to be evaluated. This is particularly important for estimates of effectiveness of the fourth dose against severe disease. It has been previously demonstrated that protection from previous doses against severe disease wanes more slowly compared to waning of protection against infection.20,26 Nonetheless, our study suggests a more rapid waning of protection against infection from a fourth dose compared to previous doses; therefore, waning of effectiveness against COVID-19-associated hospitalization and mortality needs to be further examined over a longer period. A second inherent limitation stems from the varying dominance of different SARS-CoV-2 variants over time. The post-fourth dose period in Israel has been dominated by the Omicron variant, which renders it difficult to assess the relative effectiveness of the fourth dose against other variants, a well-recognized limitation of real-world analyses during this pandemic.6,27,28 Furthermore, as the eligible population for a fourth dose was comprised of individuals aged 60 or older, we cannot infer effectiveness and potential waning in younger persons. Additionally, the fourth-dose rec...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.24.22272835
  13. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.23.22272836
    1
    1. sciscore 27 Mar 2022

      SciScore for 10.1101/2022.03.23.22272836: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study oversight: The Ethics Committee Research UZ/KU Leuven approved our study protocol (study number S64919).<br>Consent: The need for individual informed consent was waived by the Ethics Committee since data was gathered in the context of an ongoing public health response.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.23.22272836
  14. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.22.22272691
    1
    1. sciscore 27 Mar 2022

      SciScore for 10.1101/2022.03.22.22272691: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.22.22272691
  15. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.24.22272891
    1
    1. sciscore 27 Mar 2022

      SciScore for 10.1101/2022.03.24.22272891: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Individuals were eligible if 16 years or older and were willing and able to sign a digital informed consent form in Dutch.<br>IRB: MPBio and Clinitest were not CE-marked for OP-N sampling, but after safety checks by the quality team of the PHS West-Brabant, and consultation with in-house in-vitro diagnostic regulation experts and the Medical Ethical Committee Utrecht, both Ag-RDTs were considered safe for use with OP-N sampling.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">7 For the present study, we conservatively assumed sensitivities of 70% for all three Ag-RDTs irrespective of self-sampling method, with an error margin of 5%, type I error of 5% and power of 80%.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The study is reported according to the STARD 2015 guidelines.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STARD</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Our study also has some limitations. First, the sample size calculation was based on the primary analysis and diagnostic accuracy parameters are by definition less precise for stratified and weekly analyses. Second, we did not determine the virus lineage in individual samples but relied on the national pathogen surveillance data to estimate the weekly Omicron variant prevalence.16 This surveillance system includes approximately 2,000 random samples from positive samples across the country on a weekly basis. Since regional variations in the Netherlands are very small (data not shown), we are confident that Omicron’s share was over 90% in all test-sites from 12 January 2022 onwards. Third, the viral load cut-off that we used was the cut-off above which 95% of people with a positive RT-PCR test result had a positive virus culture in our similar previous study.2 Those experiments were done when the Alpha variant dominated and participants were mostly unvaccinated. However, we believe that this estimate is still more meaningful than using arbitrary Ct value cut-offs of 25 or 30, as is often done.21,22 We found that Ag-RDT performance with nasal self-sampling declined during the period that Omicron emerged. We also showed that Ag-RDT performance can be improved by adding oropharyngeal to nasal self-sampling. Therefore, after proper evaluation, Ag-RDT manufacturers may consider extending their instructions for use to include combined oropharyngeal and nasal self-sampling. Positive p...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.24.22272891
  16. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.21.485247
    1
    1. sciscore 27 Mar 2022

      SciScore for 10.1101/2022.03.21.485247: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animal experiments: All the animal experiments were performed in accordance with protocols approved by the Icahn School of Medicine at Mount Sinai (ISMMS) Institutional Animal Care and Use Committee (IACUC).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mouse immunization and challenge studies: Female BALB/c mice were used in all studies.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">All samples were analyzed in a blinded manner.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The HN protein was detected by a mouse monoclonal antibody 8H2 (MCA2822, Bio-Rad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MCA2822</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA plates were afterwards washed 3 times with PBST and 50 μL of anti-mouse IgG-horseradish peroxidase (HRP) conjugated antibody (Cytiva, GE Healthcare) was added at a dilution of 1:3,000 in blocking solution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG-horseradish</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">During this time the primary antibody was biotinylated according to manufacturer protocol (Thermo Scientific EZ-Link NHS-PEG4-Biotin)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NHS-PEG4-Biotin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blocking solution was removed and 100 μl/well of biotinylated mAb 1C7C7, a mouse anti-SARS nucleoprotein monoclonal antibody generated at the Center for Therapeutic Antibody Development at The Icahn School of Medicine at Mount Sinai ISMMS</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plaques were immuno-stained with an anti-SARS-CoV-2 NP primary mouse monoclonal antibody 1C7C7 kindly provided by Dr. Thomas Moran at ISMMS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 NP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An HRP-conjugated goat anti-mouse secondary antibody was used at 1:2000 and the plaques were visualized using TrueBlue™ Peroxidase Substrate (SeraCare Life Sciences Inc.)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VERO-TMPRSS2 cells (BPS Biosciences, #78081) were maintained in DMEM (Gibco) containing 10% (vol/vol)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VERO-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Specifically, transfected BSRT7 and DF-1 cells were washed with warm PBS and trypsinized.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DF-1</div><div>suggested: RRID:CVCL_XF08)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BSRT7 cells were mixed with DF-1 cells (~1: 2.5) in a 10-cm dish.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BSRT7</div><div>suggested: CCLV Cat# CCLV-RIE 0583, RRID:CVCL_RW96)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero-E6 cells or Vero-TMPRSS2 were seeded onto 12-well plates in growth media at 1:5 and cultured for two days.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse immunization and challenge studies: Female BALB/c mice were used in all studies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the variant HXP-S were inserted into the pNDV_LS/L289A rescue plasmid (between P and M genes) by in-Fusion cloning (Clontech, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNDV_LS/L289A</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The recombinant product was transformed into MAX Efficiency™ Stbl2™ Competent Cells (Thermo Fisher Scientific, MA, USA) to generate the pNDV-HXP-S rescue plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNDV-HXP-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The next day, cells were transfected with 2 μg of pNDV-HXP-S, 1 μg of pTM1-NP, 0.5 μg of pTM1-P, 0.5 μg of pTM1-L and 1 μg of pCI-T7opt and were re-suspended in 250 μl of a modified Eagle’s Minimum Essential Medium (Opti-MEM; Gibco).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pTM1-NP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pTM1-P</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pTM1-L</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCI-T7opt</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the mammalian-cell codon-optimized nucleotide sequence of a soluble spike protein (amino acids 1-1,213) lacking the polybasic cleavage site, carrying two stabilizing mutations (K986P and V987P), a signal peptide, and at the C-terminus a thrombin cleavage site, a T4 fold-on trimerization domain, and a hexahistidine tag was cloned into the mammalian expression vector pCAGGS. https://www.beiresources.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS.</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the mammalian-cell codon-optimized nucleotide sequence of a soluble spike protein (amino acids 1-1,213) lacking the polybasic cleavage site, carrying two stabilizing mutations (K986P and V987P), a signal peptide, and at the C-terminus a thrombin cleavage site, a T4 fold-on trimerization domain, and a hexahistidine tag was cloned into the mammalian expression vector pCAGGS. https://www.beiresources.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.beiresources.org/</div><div>suggested: (BEI Resource Repository, RRID:SCR_013698)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis was performed using GraphPad Prism 7 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using Prism software (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04871737</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Study of a Live rNDV Based Vaccine Against COVID-19</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT05181709</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Live Recombinant Newcastle Disease Virus-vectored COVID-19…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04830800</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Phase 1/2 Safety and Immunogenicity Trial of COVID-19 Vacc…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04764422</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Assess the Safety and Immunogenicity of NDV-HXP-S Vaccine in…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04993209</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Clinical Trial of the COVID-19 Vaccine (Recombinant, Inactiv…</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.21.485247
  17. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.22.22272769
    1
    1. sciscore 27 Mar 2022

      SciScore for 10.1101/2022.03.22.22272769: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical approval: This project received approval from the Institutional Review Board of the University of Hong Kong.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      We found no effect of two doses of CoronaVac and a limited effect of BNT162b2 against mild/moderate disease, with the caveat that many individuals had received their second dose several months before exposure to the SARS-CoV-2 virus. Limited protection against mild/moderate disease was restored with third doses for both vaccines, but we were only able to estimate VE for the short period since administration of third vaccine doses, and it is unclear how long this protection will last. Although improved effectiveness of a third dose was observed against severe outcomes in younger age groups, the absolute VE of two doses remains high in this age group for both vaccines and the relative effects should be interpreted accordingly.29 Our finding that three doses of CoronaVac are needed for older adults to achieve high levels of protection is consistent with World Health Organization recommendations for this group.30 While there is a preferential recommendation in Hong Kong for a third dose of BNT162b2 in adults who received two doses of CoronaVac,31 this did not translate to preference in the community. Of all adults who had received two doses of CoronaVac and a third dose, only 26% received the third dose with BNT162b2. We were unable to evaluate the comparative effectiveness of heterologous vs homologous third dose schedules or durability of three dose protection in this study, but evidence from our analyses that three doses of inactivated vaccine provides a high level of protecti...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.22.22272769
  18. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.24.485596
    1
    1. sciscore 27 Mar 2022

      SciScore for 10.1101/2022.03.24.485596: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Research was conducted under a project license from the Dutch competent authority and the study protocol (#17-4312) was approved by the institutional Animal Welfare Body.<br>Euthanasia Agents: Hamsters were euthanized by cardiac puncture under isoflurane anesthesia and cervical dislocation.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animals and experimental setup: Female Syrian golden hamsters (Mesocricetus auratus; 6 weeks old; Janvier, France) were handled in an ABSL-3 biocontainment laboratory.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">For unbiased experiments, all animals were randomly assigned to experimental groups.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Counting of IBA-1+ cells was determined by manual counting by two independent blinded observes.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Both cells were grown at 37°C in a humidified CO2◻incubator and routinely tested for mycoplasma.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were incubated in 3% BSA (bovine serum albumin; Sigma) in PBS and stained with a rabbit anti-nucleocapsid antibody (Sino biological; 1:2000) in PBS containing 0.1% BSA, washed thrice in PBS, and stained with donkey anti-rabbit Alexa Fluor 488 (Invitrogen; 1:4000) in PBS containing 0.1% BSA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-nucleocapsid</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Slides were then incubated with a rabbit polyclonal antibody against SARS-CoV/SARS-CoV-2-nucleoprotein (40143-T62, Sino Biological, Pennsylvania, USA) (1:1000), mouse CD3 (ab16669, Abcam, Cambridge, UK) (1:10, 20μg/ml), human Iba-1 (019-19741</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV/SARS-CoV-2-nucleoprotein ( 40143-T62 , Sino Biological , Pennsylvania , USA )</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD3</div><div>suggested: (Abcam Cat# ab16669, RRID:AB_443425)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Drosten) was propagated to passage three on Vero E6 cells in Opti-MEM I (1X) + GlutaMAX (Gibco), supplemented with penicillin (10,000 IU/mL) and streptomycin (10,000 IU/mL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus Titrations: Ten-fold serial diluted samples were added to monolayers of Calu-3 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: KCLB Cat# 30055, RRID:CVCL_0609)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plaque assay analysis was performed using ImageQuant TL 8.2 software (GE Healthcare).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageQuant</div><div>suggested: (ImageQuant, RRID:SCR_014246)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were taken with a 200x magnification (20x air objective; Olympus) with CellSens software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CellSens</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Graphs and statistical tests were made with GraphPad Prism version 9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Figures were prepared with Adobe Illustrator CC2019</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Adobe Illustrator</div><div>suggested: (Adobe Illustrator, RRID:SCR_010279)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, Adobe Photoshop CC2019 and Biorender.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Adobe Photoshop</div><div>suggested: (Adobe Photoshop, RRID:SCR_014199)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.24.485596
  19. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.24.485618
    1
    1. sciscore 27 Mar 2022

      SciScore for 10.1101/2022.03.24.485618: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.24.485618
  20. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.24.22272870
    1
    1. sciscore 27 Mar 2022

      SciScore for 10.1101/2022.03.24.22272870: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Relevant peer-reviewed studies published in English were identified within Medline (OVID) and EMBASE (OVID) until the 11th of June 2021.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Medline</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div><div style="margin-bottom:8px"><div>EMBASE</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Strengths and limitations: Several strengths of our meta-analysis increase our confidence in our findings. The inclusion of only age/gender adjusted cohort study data allowed us to control for the primary factor associated with adverse outcomes, which is the patient’s age, hence allowing us to assess the independent effect of each prognostic factor (106). Moreover, we performed separate analyses by clinical setting that allowed us to both quantify the incidence of adverse outcomes, as separate endpoints, which may assist in managing patient flows and triaging. As we applied the GRADE methodology for assessing the evidence about prognostic factors, we rigorously evaluated the certainty of the evidence behind each meta-analysis. Some limitations of our study should also be acknowledged as our results reflect the status quo in Europe during the first waves of the pandemic when the alpha and beta variants were most dominant and with the EU population largely unvaccinated, hence further research is needed to assess how subsequent vaccination would impact patient mortality. We restricted our inclusion criteria to Europe, to enhance the comparability of the results and utility for European clinicians and policymakers, as they have similar healthcare resources, acknowledging that our results may not be generalisable to other areas of the globe. However, similar results are noted in different geographical areas (107). Furthermore, there was evidence of heterogeneity as the definition ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.24.22272870
  21. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.24.485614
    1
    1. sciscore 26 Mar 2022

      SciScore for 10.1101/2022.03.24.485614: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Heavy chain Ab design, expression and purification: For the generation of a full length heavy-chain-only antibody, the different VHHs were amplified with SL13/14 and cloned into the vector pNEM_camhAb. pNEM_camAb was designed in our lab as vector for eukaryotic protein expression with a camelid Fc fragment (CH2-CH3 domain) resulting in hcAbs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CH2-CH3 domain</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western Blot analyses and ELISA: To investigate the different hcAb candidates in Western Blot, 1 μg SARS-CoV-2 Spike protein (antibodies-online, ABIN6952734) per lane was applied onto a 4-12% SDS polyacrylamide gradient gel.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibodies-online , ABIN6952734</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing the membrane, a horseradish peroxidase (HRP) conjugated secondary antibody (ABIN1981272, antibodies-online) was applied and incubated for 3 h at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibodies-online</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In specific, VSV*ΔG either bearing the SARS-CoV-2 (D614G) or SARS-CoV-2 B.1.1.529 (Omicron) Spike protein was incubated with a two-fold dilution of hcAbs and subsequently used to inoculated VeroE6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expi293 cells were grown at 37°C, 8% CO2 with 130-150 rpm on a Rotamax120 platform shaker (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Amplified VHHs were cloned into phagemid vector pADL-22c (Antibody Design Labs).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pADL-22c</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Positive clones were sequenced and become heavy chain only antibodies by cloning into the expression plasmid pNEM_camAb.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNEM_camAb</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The expression vector for the Omicron spike (based on isolate hCoV19/Botswana/R40B58_BHP_3321001245/2021; GISAID Accession ID: EPI_ISL_6640919) was generated by Gibson assembly using five overlapping DNA strings (Thermo Fisher Scientific, sequences available upon request), linearized (BamHI/XbaI digest) pCG1 plasmid and GeneArt™ Gibson Assembly HiFi Master Mix (Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VLPs): Human codon optimized sequences of genes encoding the S and E structural proteins of SARS-CoV-2 were synthesized by BioCat GmbH (Heidelberg, Germany) and subcloned into the pcDNA3.1 expression plasmid using the NheI 5’ and XhoI 3’ restriction site, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Another plasmid (pEXP-M+N) for the dual expression of the human codon optimized sequences of the M and N protein was generated by Vectorbuilder Inc. (VB200528-1033wpt).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pEXP-M+N</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The DNA mix was composed of pcDNA3.1-Spike (FKO), pcDNA3.1-E-Protein and pEXP-M+N-protein at a ratio of 6:2:3 diluted in Opti-MEM I Medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1-Spike</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pcDNA3.1-E-Protein</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pEXP-M+N-protein</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VLPs): Human codon optimized sequences of genes encoding the S and E structural proteins of SARS-CoV-2 were synthesized by BioCat GmbH (Heidelberg, Germany) and subcloned into the pcDNA3.1 expression plasmid using the NheI 5’ and XhoI 3’ restriction site, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioCat</div><div>suggested: (BioCAT, RRID:SCR_001440)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.24.485614
  22. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.22.485425
    1
    1. sciscore 26 Mar 2022

      SciScore for 10.1101/2022.03.22.485425: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: The study proposal was evaluated and approved by the Animal Welfare Body of Poonawalla Science Park – Animal Research Center (Bilthoven, The Netherlands) under permit number AVD32600 2018 4765 of the Dutch Central Committee for Animal experiments.<br>IACUC: The study proposal was evaluated and approved by the Animal Welfare Body of Poonawalla Science Park – Animal Research Center (Bilthoven, The Netherlands) under permit number AVD32600 2018 4765 of the Dutch Central Committee for Animal experiments.<br>Euthanasia Agents: Euthanasia was performed by exsanguination via heart puncture under anesthesia with ketamine and medetomidine.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Ferrets: Twenty outbred male ferrets (Mustela putorius furo), aged 8 months, were obtained from the colony of Euroferret (Denmark).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Histopathology was scored blindly by a veterinary pathologist.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All ferrets tested negative for antibody responses measured against SARS-CoV-2 spike protein (S), its receptor binding domain (RBD), and the nuclear protein of influenza virus by ELISA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 spike protein (S), its receptor binding domain (RBD)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fixation of the cells occurred with incubation of Fixation/Permeabilization buffer for 20 min/4°C, followed by two washing steps with 1x permbuffer, prior to incubation for 30 min/RT with the antibodies: FITC-conjugated anti-CD3e (MCA1477A647, clone CD3-12, BioRad) and PE- conjugated anti-IFNγ (MCA1783PE, clone CC302, Bio-rad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD3e</div><div>suggested: (Creative Diagnostics Cat# CABT-48633RH, RRID:AB_2528922)</div></div><div style="margin-bottom:8px"><div>anti-IFNγ</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>MCA1783PE</div><div>suggested: (Bio-Rad Cat# MCA1783PE, RRID:AB_324003)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 virus culture was performed in VERO E6 cells (Vero C1008, ATCC CRL-1586), first grown in Dulbecco’s Modified Eagle Medium (DMEM, Gibco) supplemented with 10% of fetal bovine serum (FBS) + 1x penicillin, streptomycin and glutamine (PSG) at 37°C and 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: ATCC Cat# CRL-1586, RRID:CVCL_0574)</div></div><div style="margin-bottom:8px"><div>C1008</div><div>suggested: ATCC Cat# CRL-1586, RRID:CVCL_0574)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MDCK cells were washed twice with PBS, and H1N1 virus suspension was added to the cells in MEM + 1x PSG + 2 µg/ml L-</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDCK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">TCID50 determination: SARS-CoV-2 virus stock, swab material and tissue samples were 1:10 serial diluted in DMEM medium containing 2% FBS and 1x PSG and added on VERO E6 cells in 96-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VERO E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell acquisition was performed on the BD LSRFortessa™ Cell Analyzer (BD Biosciences) and analyzed using FlowJo V10.6.2 (BD Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: All data were analyzed with GraphPad Prism 9.1.0 software (GraphPad Software, Inc).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.22.485425
  23. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.21.22271747
    1
    1. sciscore 26 Mar 2022

      SciScore for 10.1101/2022.03.21.22271747: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: The volunteers of 300 applying for the test at Hacettepe University Hospital with their consent occurring from November 3 through November 24, 2020 were included in the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For positive control, N-gene sequence was obtained from National Center of Biotechnology Information (NCBI) with GenBank accession number MN908947.3 and genomic positions between 27894..28259 of Wuhan-Hu-1 genome (NCBI Reference Sequence: NC_045512) was used which was cloned in pGEM®-T Easy vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pGEM®-T Easy</div><div>suggested: RRID:Addgene_66562)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.21.22271747
  24. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.23.22272811
    1
    1. sciscore 26 Mar 2022

      SciScore for 10.1101/2022.03.23.22272811: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Strength and limitation: The major strength of this study included large sample size of the UK Biobank with detailed health records and sufficient period of follow-up. This study is very comprehensive and covers most clinically relevant categories of diagnosis. In addition to any hospitalization/mortality, we also performed additional analysis on hospitalization with/without relevant history of disease (i.e. new-onset and recurrent diseases). Apart from these, we also made use of advanced statistical methods to evaluate whether our findings are consistent to different modeling strategies. For example, the PERR adjustment was employed to minimize unmeasured confounding. There are several limitations of this study. Firstly, this is an observational study. Although we have included many known confounders in the model and used other methods (e.g. PERR) to minimize residual confounding, confounding effects cannot be excluded completely. However, many results remained significant after PERR adjustment which provides further support to our findings. Secondly, subclinical disorders may be underestimated and some disorders may be too rare to be included for further analysis. In addition, due to the relatively small number of events for some disorders, absence of significant associations can also be due to inadequate statistical power. We also note that mild or asymptomatic infections may not be detected and considered as having no history of COVID-19; however this is likely to result ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.23.22272811
  25. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.22.22272730
    1
    1. sciscore 26 Mar 2022

      SciScore for 10.1101/2022.03.22.22272730: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics statement: The study was conducted in accordance with the Declaration of Helsinki and was approved by the Ethics Committee of the author’s University.<br>Consent: Informed consent was obtained from all subjects.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data were analysed using SPSS 13.0 (SPSS, Inc., Chicago, IL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Our study also has some limitations that should be considered. The survey was carried out in the late stage of the epidemic when the epidemic had been effectively contained and people’s negative emotions may have been substantially relieved. This timing may have affected the results of the survey. The conclusions would be enhanced by the inclusion of more participants and a longer study duration.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.22.22272730
  26. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.23.22272094
    1
    1. sciscore 26 Mar 2022

      SciScore for 10.1101/2022.03.23.22272094: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All consecutive patients who visited the facilities for a Covid test and who met inclusion criteria were enrolled in the study and informed consent was obtained.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Operators of the Gazelle COVID-19 Test and the RT-PCR test were blinded to the results on the different test platform.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      This study has some limitations. subjects with invalid results were not able to be retested because participants left the facility before test results were available. A total of 2.6% of the initial Gazelle Covid-19 test results were either invalid or canceled and would have required patient retesting in accordance with the IFU. Re-collection of samples and retesting would be expected to further reduce the invalid rate, but this was not possible during our study. Discrepant results observed between the Gazelle Covid-19 test and reference RT-PCR could not be further clarified, as further samples were not available for retesting. In summary, herein we have shown that the Gazelle Covid-19 test using a nasal swab collection method is highly accurate and has close concordance with RT-PCR based assay for detection of SARS-CoV-2 in a POC setting. Gazelle Covid-19 test has potential to quickly and effectively screen all symptomatic patients suspected of COVID-19 at POC, enabling rapid detection and isolation of people most likely to pose an infectious risk.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04987918</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Not yet recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Gazelle COVID-19 Test Clinical Accuracy Protocol</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.23.22272094
  27. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.22.22272773
    1
    1. sciscore 26 Mar 2022

      SciScore for 10.1101/2022.03.22.22272773: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Study design: After written informed consent, two combined nasopharyngeal and oropharyngeal swabs were collected from each patient.<br>IRB: Legal and ethical considerations: The study was conducted according to the revised principles of the Declaration of Helsinki and was approved by the ethics committee of the Ruhr-University Bochum (registration number 20-7065) in November 2020.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Sample size calculation was performed using G*Power Version 3.1.9.6 for windows [12].</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Total RNA was purified from VeroE6 cells using the RNeasy Mini Kit (QIAGEN®, www.qiagen.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was performed using GraphPad Prism version 8.0.0 for Windows (GraphPad Software, San Diego, California USA, www.graphpad.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sample size calculation was performed using G*Power Version 3.1.9.6 for windows [12].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>G*Power</div><div>suggested: (G*Power, RRID:SCR_013726)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequencing libraries were prepared from 4·5μl cDNA using NEBNext® ARTIC SARS-CoV-2 Library Prep Kit for Illumina sequencing platforms (New England BioLabs® Inc., neb.com, catalog #E7650).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>New England BioLabs®</div><div>suggested: (New England Biolabs, RRID:SCR_013517)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In addition, variants in spike domains were identified and annotated using Geneious prime 2021.2.2 (https://www.geneious.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.geneious.com</div><div>suggested: (Geneious, RRID:SCR_010519)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Our study encompasses several limitations. Patients were encouraged to forcefully cough twice to contaminate surfaces. However, we cannot exclude that potentially repeated coughing over a prolonged time results in a more effective virus transfer compared to our controlled conditions. Moreover, sneezing can produce significantly more infectious droplets potentially containing infectious particles, therefore, we cannot exclude potential transmissions via other this route. Furthermore, a selection bias cannot be excluded, and the included patients are not demographically representative. Strengths of the present study include the high viral load of the patients included, a standardized protocol for sample acquisition, laboratory procedures and the inclusion of VoC.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.22.22272773
  28. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.21.22272669
    1
    1. sciscore 26 Mar 2022

      SciScore for 10.1101/2022.03.21.22272669: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.21.22272669
  29. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.21.22272279
    1
    1. sciscore 26 Mar 2022

      SciScore for 10.1101/2022.03.21.22272279: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.21.22272279
  30. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.22.22271707
    1
    1. sciscore 26 Mar 2022

      SciScore for 10.1101/2022.03.22.22271707: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">RANDOMIZATION AND INTERVENTION: A randomly-selected subset of 6200 cohort participants who were assessed as eligible on the basis of data from their enrolment questionnaire, and who reported no supplemental vitamin D intake at baseline, were individually randomized by the trial statistician using a computer program (Stata v14.2) to receive an offer of a postal vitamin D test with supply of 3200 IU vitamin D/day if their blood 25(OH)D concentration was found to be less than 75 nmol/L (‘higher-dose offer group’) vs. the same testing offer with supply of 800 IU vitamin D/day if 25(OH)D was less than 75 nmol/L (‘lower-dose offer group’) vs. no offer of vitamin D testing or supplementation (‘no offer group’), with a 1:1:2 allocation ratio.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Our study also has limitations. Provision of supplements to participants randomized to intervention was contingent on demonstrating inadequate vitamin D status: thus, a subset (13.7%) of participants randomized to intervention did not receive study supplements. On the other hand, another subset (49.9%) of participants randomized to no offer took a vitamin D supplement on one or more occasions during follow-up. This may have led to increases in 25(OH)D concentrations in the no offer arm over the course of the study, although seasonal effects (sampling in June vs. December) will also have contributed. Together, these factors could have diluted any effect of vitamin D in the primary intention-to-treat analysis. We sought to overcome this by conducting a sensitivity analysis, which included only those randomized to offer vs. no offer who did vs. did not take supplemental vitamin D, respectively. The fact that this analysis showed no effect of vitamin D supplementation on all outcomes investigated, despite the larger differences in end-study 25(OH)D concentrations between intervention vs. no-offer arms seen for this analysis vs. the intention-to-treat analysis (Fig. 2), provides some reassurance that the null result yielded by the intention-to-treat analysis is valid. Ultimately, however, this trial was designed to investigate the effectiveness of a pragmatic ‘test-and-treat’ approach to boosting population vitamin D status, rather than biologic efficacy of vitamin D to prevent AR...

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04579640</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Trial of Vitamin D to Reduce Risk and Severity of COVID-19 a…</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.22.22271707
  31. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.22.485373
    1
    1. sciscore 26 Mar 2022

      SciScore for 10.1101/2022.03.22.485373: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">47 Reverse transcription reactions were performed in a 20-µl reaction mixture that contained the specified amount of RNA transcripts produced in vitro or 1 µg of RNA extracted from either HEK-293T cells or S- pseudovirus preparations, 2 µl of random primer mix (60 µM; 25 µM oligo(dT) and 35 µM random hexamers), 2 µl 10X RT buffer, 1 µl dNTP mix (10mM) (Thermo Fisher - Invitrogen), 0.2 µl RNase inhibitor (40 U/µl), and 0.2 µl MMuLV RT (200 U/µl).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After electrophoresis, samples were analyzed by immunoblot assays using the following primary antibodies: monoclonal anti-p30 antibody Ab130757 (Abcam); monoclonal anti-C9 antibody Ab5417 (Abcam) (used for C9-tagged S proteins of SARS-CoV and MERS-CoV); polyclonal anti- VSV-G antibody EPR12997 (Abcam) and polyclonal anti-SARS-CoV-2 S antibody 40590-T62 (SinoBiological).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-p30</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-C9</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti- VSV-G</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 S</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transfection of HEK-293T cells was carried out using Lipofectamine 2000 (Thermo Fisher Scientific - Invitrogen)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The filtrate containing pseudoviral particles (200 µl) was inoculated onto Vero E6 cells and the cells were then incubated on a rocker for 2 h prior to addition of complete DMEM (300 µl).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DNA constructs: Plasmid pcDNA3.1-SARS-CoV-S contained a short coding sequence corresponding to the CD5 signal peptide (codons 1-24) that replaced the first eleven N-terminal codons in the original SARS-CoV-S sequence.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1-SARS-CoV-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting PCR products were digested with HindIII and EcoRI or NotI and ApaI, and were then cloned into the HindIII-EcoRI-digested pcDNA3.1-MERS-CoV-S or NotI-ApaI-digested pcDNA3.1-SARS- CoV-2-S-Δ19 vectors.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1-MERS-CoV-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pcDNA3.1-SARS-</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting plasmids were named pcDNA3.1-CD5-MERS-CoV-S and pcDNA3.1-CD5-SARS-CoV-2-S-Δ19, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1-CD5-MERS-CoV-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Similarly, the first eleven codons of SARS-CoV-2-S- Δ19 were replaced by the CD5 signal in the pcDNA3.1-CD5-SARS-CoV-2-S-Δ19 plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1-CD5-SARS-CoV-2-S-Δ19</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Synthesis of Luciferase (LUC) RNA molecules for production of standard curves: Using plasmid pTG-Luc as a template, the DNA sequence encoding LUC was isolated by PCR with primers containing KpnI and BamHI sites.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pTG-Luc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">36 The PCR product was cloned into the corresponding sites of pBluescript SK in which a T7 promoter sequence is found immediately next to the cloning site on the 5’ end.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBluescript</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Using BamHI-linearized pSK-Luc (5 µg per reaction), in vitro run-off transcription with T7 RNA polymerase was performed using buffer T (80 mM HEPES, pH 7.5, 20 mM MgCl2, 2 mM spermidine, 40 mM DTT and 10 mM NaCl) that was supplemented with pyrophosphatase (0.1 U/µl) as described previously.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSK-Luc</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Relative luciferase units (RLU) were determined using the Glomax 20/20 luminometer (Promega) and infectivity values were analyzed as described previously 36 and plotted using GraphPad Prism 9.3.1 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.22.485373
  32. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.22.485230
    1
    1. sciscore 26 Mar 2022

      SciScore for 10.1101/2022.03.22.485230: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Mouse studies: All animal work was done under the oversight of the Bloodworks Northwest Research Institute’s Institutional Animal Care and Use Committee (Seattle, WA).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum IgG, IgG1, and IgG2a titers by ELISA: SARS CoV-2 spike protein-binding IgG antibodies in mouse serum were measured by ELISA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were then washed, and spike protein-bound antibodies were detected using an Anti-Mouse IgG (Fc Specific)-Alkaline Phosphatase antibody (Sigma-Aldrich, #A2429) at a 1:4000 dilution in blocking buffer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Mouse IgG</div><div>suggested: (Innovative Research Cat# HM4000, RRID:AB_1482268)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Splenocytes were stained for viability with Zombie Green (BioLegend, San Diego, CA) in 50 μL of PBS, and then Fc receptors were blocked with CD16/CD32 antibody (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD16/CD32</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IL-17A (Invitrogen, #88-7371-88), or IL-5 (BD Biosciences, #51-1805KZ) capture antibodies at a 1:200 dilution in ELISpot coating buffer (eBioscience, Waltham, MA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IL-17A</div><div>suggested: (Thermo Fisher Scientific Cat# 88-7371-88, RRID:AB_2575104)</div></div><div style="margin-bottom:8px"><div>IL-5</div><div>suggested: (Novus Cat# NB 200-515, RRID:AB_535720)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After a 3-hour incubation, plates were washed with PBS with 0.1% Tween 20, and secondary antibody (Goat Anti-Mouse IgG-HRP or IgA-HRP [SouthernBiotech, Birmingham, AL; #1030-05 and #1040-05]) was added at a 1:1000 dilution in PBS with 0.1% Tween and 5% FBS overnight at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Mouse IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After complexing, vaccine was lyophilized using a VirTis AdVantage 2.0 EL-85 (SP Industries, Warminster, PA) benchtop freeze dryer controlled by the microprocessor-based Wizard 2.0 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EL-85</div><div>suggested: RRID:CVCL_EL85)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK-293 cells (American Type Culture Collection, Manassas, VA; #CRL-3216) were plated at 4 x 105 cells/mL in 6-well plates 18-24 hours before the assay to achieve 50-70% confluency at assay start.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All animal work was in compliance with all applicable sections of the Final Rules of the Animal Welfare Act regulations (9 CFR Parts 1, 2, and 3) and the Guide for the Care and Use of Laboratory Animals, Eighth Edition.69 C57BL/6J mice obtained from The Jackson Laboratory (Harbor, ME) were used for all animal studies in this work.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: RRID:IMSR_JAX:000664)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These sequences were then codon-optimized for mammalian (human) expression by Codex DNA (San Diego, CA) using a proprietary algorithm, synthesized by BioXp (Codex DNA), and inserted into AAHI’s backbone saRNA expression vector by Gibson cloning.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioXp</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All RNA samples were mixed with glyoxal loading dye (Invitrogen, Waltham, MA) 1:1 by volume, incubated at 50°C for 20 minutes, loaded on a denatured 1% agarose gel in NorthernMax-Gly running buffer (Invitrogen) alongside Millennium RNA Markers (Thermo Fisher Scientific), and run at 120 V for 45 minutes before imaging on a ChemiDoc MP Imaging System (Bio-Rad Laboratories, Hercules, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bio-Rad Laboratories</div><div>suggested: (Bio-Rad Laboratories, RRID:SCR_008426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spots were counted and data were analyzed using ImmunoSpot software (Cellular Technology Limited, Cleveland, OH)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImmunoSpot</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were conducted using Prism 9 (GraphPad Software, San Diego, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.22.485230
  33. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.21.22272673
    1
    1. sciscore 26 Mar 2022

      SciScore for 10.1101/2022.03.21.22272673: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus culture isolation: Culture isolation was performed on Vero E6 cells, as previously described [33].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Freebayes results were filtered with a threshold of 70% for the majority nucleotide.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Freebayes</div><div>suggested: (FreeBayes, RRID:SCR_010761)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The clade was designated at the consensus level with the Nextclade online tool (https://clades.nextstrain.org/) [42,32] and an in-house Python script allowed detection of variants and hybrids of variants.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nucleotide diversity at genomic positions was calculated using the Microsoft Excel software (https://www.microsoft.com/en-us/microsoft-365/excel) with an in-house built file.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reads were then filtered according to variant-specific nucleotide patterns using SAMtools combined with an in-house awk script.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAMtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequences were aligned using MAFFT v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">7 [44] with their 20 most similar hits identified with the BLAST tool [45] among SARS-CoV-2 genomes from our database that contains sequences obtained from clinical samples collected between February 2020 and February 2022 [27,14]</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogeny reconstruction was performed using the IQ-TREE software with the GTR Model and 1,000 ultrafast bootstrap repetitions (http://www.iqtree.org) [46], and trees were visualized with iTOL (Interactive Tree Of Life) (https://itol.embl.de/) [47] and MEGA X (v10.2.6; https://www.megasoftware.net/) [47] softwares.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IQ-TREE</div><div>suggested: (IQ-TREE, RRID:SCR_017254)</div></div><div style="margin-bottom:8px"><div>MEGA</div><div>suggested: (Mega BLAST, RRID:SCR_011920)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.21.22272673
  34. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.21.22272480
    1
    1. sciscore 26 Mar 2022

      SciScore for 10.1101/2022.03.21.22272480: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the French Institutional Authority for Personal Data Protection (Commission Nationale de l’Informatique et des Libertés DR-2020-178, October 22nd, 2020) and the ethics committee (Comité de Protection des Personnes Nord Ouest IV, ECH20/09, September 7th, 2020)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Receiver operating characteristic (ROC) analysis with area under the curve (AUC) was performed to analyze the diagnostic performance to differentiate severe and non-severe COVID-19 of promising miRNAs defined by the consensus between differential expression analysis and sPLS-DA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>sPLS-DA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Only the expressed miRNAs were kept for further analyses Target prediction, GO enrichment and pathway analysis: miRWalk (http://mirwalk.umm.uni-heidelberg.de/) was used for the prediction of targets of dysregulated miRNAs and GO enrichment analysis, Kegg and Reactome pathways enrichment analyses [27].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>miRWalk</div><div>suggested: (miRWalk, RRID:SCR_016509)</div></div><div style="margin-bottom:8px"><div>Reactome</div><div>suggested: (Reactome, RRID:SCR_003485)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In parallel to these univariate analyses sparse Partial Least Squares-Discriminant Analysis (sPLS-DA) was performed with the mixOmics package [32].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>mixOmics</div><div>suggested: (mixOmics, RRID:SCR_016889)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Study limitations: our study has a relatively small size. Therefore our results should be confirmed in a larger cohort, which could allow a multiparametric approach and the building of scores. Another limit is the heterogeneity of the control group with respect to clinical severity. Moreover, our study showed several miRNAs allowed to differentiate between severe and non-severe COVID-19. In order to be used as predictive biomarkers, the expression of these miRNAs should be studied at disease onset and during the clinical course in order to determine the kinetics of miRNA expression and their correlation with severity.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.21.22272480
  35. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.20.22272651
    1
    1. sciscore 26 Mar 2022

      SciScore for 10.1101/2022.03.20.22272651: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: During the individual interview, all information about the study was provided and written consent was obtained from each participant.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Out of 501 people screened for SARS-CoV-2 antibodies in May 2021, 109 people were included in the follow-up study, considering previous serological status as identified in the first study, status of vaccination, their availability and agreement to participate in the repeated testing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following groups were selected: Group 1 (N-, V-): Participants seronegative for SARS-CoV-2 antibodies in May 2021 (anti-NCP-negative), non-vaccinated; N=38 Group 2 (N-, V+): Participants seronegative for SARS-CoV-2 antibodies in May 2021 (anti-NCP-negative), fully vaccinated before December 2021; N=29 Group 3 (N+, V-): Participants seropositive for SARS-CoV-2-specific IgG antibodies in May 2021 (anti-NCP-IgG positive) and non-vaccinated; N=25 Group 4 (N+, V+): Participants seropositive for SARS-CoV-2-specific IgG antibodies in May 2021 (anti-NCP-IgG positive), fully vaccinated before December 2021; N=17 Of note, all vaccinated participants took the vaccination individually; therefore they could be vaccinated at different time points within May and December, and with different types of vaccines; most of them were vaccinated with the Pfizer vaccine (65%, 30 out of 46).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-NCP-negative</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-NCP-IgG positive</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2-specific IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-NCP-IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed by GraphPad Prism 9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.20.22272651
  36. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.20.22272571
    1
    1. sciscore 26 Mar 2022

      SciScore for 10.1101/2022.03.20.22272571: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.20.22272571
  37. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.20.22272549
    1
    1. sciscore 26 Mar 2022

      SciScore for 10.1101/2022.03.20.22272549: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.20.22272549
  38. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.22.22272775
    1
    1. sciscore 26 Mar 2022

      SciScore for 10.1101/2022.03.22.22272775: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Strengths and limitations: Our study has several strengths. First, we used death registration records for the whole of England, linked to all vaccination records, including those which are not available in the main NIMS COVID-19 vaccination data, because the people died shortly after vaccination. As a result, we had information on the cause of death based on medical certificate of cause of death. To limit further the risk of outcome misclassification, we not only examined deaths due to cardiac events but also all-cause mortality. Second, using a self-controlled case series, our estimates account for time-invariant confounding, which is crucial because young people who were clinically extremely vulnerable were prioritised for vaccination. Comparing the risk of deaths between vaccinated and unvaccinated individuals would have been challenging in the absence of detailed information on pre-existing health status. The main limitation of our study is the delay in death registration. Not all deaths that occurred in the period have already been registered and registration delays can be substantial for young people, as deaths are more likely to be investigated by a coroner than for older adults. Registration delays should affect more deaths that occurred later in the year, and therefore deaths that occurred further from vaccination status, leading to overestimating the incidence case ratios. To minimise the impact of registration delays, we restricted the follow up period to 12 weeks ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.22.22272775
  39. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.22.485323
    1
    1. sciscore 26 Mar 2022

      SciScore for 10.1101/2022.03.22.485323: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Mouse Study: Mouse immunization studies were performed at IBT Bioservices, Rockville, MD, USA under the approved IACUC animal study protocol # AP-160805.<br>IACUC: Mouse Study: Mouse immunization studies were performed at IBT Bioservices, Rockville, MD, USA under the approved IACUC animal study protocol # AP-160805.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Six-to eight-week-old female CD-1 mice were randomly assigned to each of the five groups, with 8 animals in each, except for group with two intranasal vaccinations, where 7 animals were assigned.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Six-to eight-week-old female CD-1 mice were randomly assigned to each of the five groups, with 8 animals in each, except for group with two intranasal vaccinations, where 7 animals were assigned.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">17 Determination of serum and BAL S-2P specific IgG and IgA by ELISA: Serum and bronchoalveolar lavage samples (BAL) were evaluated for S-2P specific IgG and IgA antibody responses by ELISA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BAL S-2P specific IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S-2P specific IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">At the end of 3 days, the cells were washed and plated onto PVDF ELISpot filter plates coated with anti-mouse IgG or IgA capture antibody (Mabtech, Cat# BASIC 3825-2H and BASIC 3835-2H).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following incubation, the mixture was added to monolayer of Vero cells in triplicates and incubated for 24 hours at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Six-to eight-week-old female CD-1 mice were randomly assigned to each of the five groups, with 8 animals in each, except for group with two intranasal vaccinations, where 7 animals were assigned.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD-1</div><div>suggested: RRID:MGI:2686808)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      With the caveat that IM vaccination temporarily reduced nasal colonization following vaccination, our intranasal vaccination outcomes were in line with other data generated in the same hamster model using an S-2P vaccine adjuvanted with a combination of Alum and CpG 1018,16, 17 suggesting that intranasal immunization could be as efficient as intramuscular vaccination with the potential advantage of induction of mucosal immunity that would eliminate the virus at its port of entry. The NE01 adjuvant is a clinical-stage adjuvant and has been evaluated in several clinical trials, including a phase 1 anthrax vaccine trial and a seasonal flu trial.32 NE01-adjuvanted vaccines demonstrated a remarkable safety profile and a robust mucosal and systemic immunity. Additionally, the exceptional stability (at 5°C) and ease of administration, reduces the complexities involved with ultra-low cold chain storage and needle-less administration, making this vaccine attractive to low-income countries. We believe our NE01 technology can play a role in providing safe and efficacious standalone vaccine to protect against infection and disease. In the light of the fact that billions of people had already received IM vaccines and that many vaccines are already licensed and have been used, our future development plan includes using this unique intranasal vaccine as a booster vaccine to those who had received IM vaccines fin order to boost their systemic immunity and to confer complementary mucosal immu...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.22.485323
  40. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.23.485487
    1
    1. sciscore 26 Mar 2022

      SciScore for 10.1101/2022.03.23.485487: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was performed with GraphPad Prism (version: 8.4.2, for Windows, GraphPad Software, San Diego, California USA, (39)).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.23.485487
  41. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.22.485418
    1
    1. sciscore 26 Mar 2022

      SciScore for 10.1101/2022.03.22.485418: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animal vaccination: Animal immunization were performed previously on 6-8 weeks female C57BL/6Ncr mice purchased from Charles River in two sets of experiments: 1) sequential vaccination with two doses of 1μg WT LNP-mRNA followed by 10μg Omicron BA.1 or WT boosters7; 2) vaccination with two doses of 1μg WT, B.1.351, B.1.617 LNP-mRNA8.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: 293T and hACE2-293FT cells were maintained in Dulbecco’s minimal essential medium (DMEM, Fisher) supplemented with 10% fetal bovine serum (Hyclone) and penicillin (100 U/ml)-streptomycin (100 ug/ml).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>hACE2-293FT</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animal vaccination: Animal immunization were performed previously on 6-8 weeks female C57BL/6Ncr mice purchased from Charles River in two sets of experiments: 1) sequential vaccination with two doses of 1μg WT LNP-mRNA followed by 10μg Omicron BA.1 or WT boosters7; 2) vaccination with two doses of 1μg WT, B.1.351, B.1.617 LNP-mRNA8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6Ncr</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.22.485418
  42. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.22.484725
    1
    1. sciscore 26 Mar 2022

      SciScore for 10.1101/2022.03.22.484725: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The genomic nucleotide sequences were individually queried against GISAID’s Audacity web application and the top matching clade, lineage and corresponding distances were recorded.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Audacity</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The program relies on the Biopython packages (Bio.PDB, Bio.AlignIO) and other structure processing and parser libraries for individual programs listed as follows: NACCESS, DSSP, ResidueDepth (MSMS) and Half Sphere Solvent Exposure (HSExposure).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Biopython</div><div>suggested: (Biopython, RRID:SCR_007173)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.22.484725
  43. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.23.22272804
    1
    1. sciscore 26 Mar 2022

      SciScore for 10.1101/2022.03.23.22272804: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Potential confounding factors: The following potential confounders were defined at a single time (typically the day before the start of comparison period 1; full details in Supplementary Table 3): age; sex (male or female); English Index of Multiple Deprivation (IMD, grouped by quintiles); ethnicity (Black, Mixed, South Asian, White, Other, as per the UK census); number of SARS-CoV-2 tests between 18 May 2020 (when widespread testing became available) and eligibility for first vaccine dose; and receipt of one or more flu vaccines in the five years prior to COVID-19 vaccine eligibility.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Our study has several limitations. First, as in any observational study, our estimates could be affected by confounding by unmeasured factors. However, the detailed linked data analysed permitted adjustment for a wide range of potential confounding factors. Second, patients registered with a GP who have moved or emigrated (or whose death was not recorded)25 may contribute person-time but not events. Because the BNT162b2 and ChAdOx1 groups are defined by recent vaccination, these “ghost” patients are more likely to be present in the unvaccinated group, leading to bias in estimates of waning. Also, healthcare workers could be identified and excluded from the vaccinated groups because this information was recorded at the time of vaccination, but not from the unvaccinated group. This limitation should not affect results for the 65+ subgroup, most of whom are retired, or comparisons between BNT162b2 and ChAdOx1. Third, consistent with an Australian survey,24 we found that unvaccinated individuals had tested less frequently than vaccinated individuals during the pre-vaccine rollout period when widespread testing was available, and were considerably less likely to be tested during follow-up. Fourth, differential depletion of susceptible people in the unvaccinated groups over time may lead to attenuation of HRs even when true vaccine effectiveness does not change. However, such bias is likely to be minimal when vaccine effectiveness is high.27 Our results have immediate implications ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.23.22272804
  44. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.22.22272793
    1
    1. sciscore 26 Mar 2022

      SciScore for 10.1101/2022.03.22.22272793: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Ethics approval: All participants provided written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Binding antibody assays: We measured total binding antibodies against SARS-CoV-2 nucleocapsid (N) and spike (S) receptor binding domain (RBD) in serum using the Elecsys Anti-SARS-CoV-2 and Anti-SARS-CoV-2 S assays, respectively, on a Cobas e601 module analyzer (Roche Diagnostics).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 nucleocapsid ( N ) and spike ( S ) receptor binding domain ( RBD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were conducted using Prism v9.2.0 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Our study has several limitations. Our results may not be generalizable to PLWH who are not receiving antiretroviral therapy, who have multiple co-morbidities or who have CD4+ T-cell counts <200 cells/mm3. We found no evidence that a low nadir CD4+ T-cell count negatively influenced COVID-19 vaccine response however, indicating that prior low CD4 T+ cell counts will not necessarily compromise immune responses to COVID-19 vaccines presently. We did not investigate T-cell responses, which may play critical protective roles, particularly against variants [48, 49]. Individuals ≥70 years old and PLWH meeting priority criteria were eligible for full mRNA-1273 third doses, but we could not directly assess mRNA-1273 dose-related effects on immune responses due to incomplete dosing information. Finally, while immune correlates of vaccine-mediated protection are being elucidated for SARS-CoV-2 [50], the implications of our results on individual-level protection from infection and disease remain uncertain, particularly in the context of Omicron. In conclusion, adult PLWH with well-controlled viral loads and preserved CD4+ T-cell counts mount strong and functional antibody responses to two and three COVID-19 vaccine doses, including to Omicron, though it will be important to monitor these responses over time. Studies of PLWH who are not receiving antiretroviral treatment or who have low CD4+ T-cell counts are also needed.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.22.22272793
  45. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.21.22272358
    1
    1. sciscore 26 Mar 2022

      SciScore for 10.1101/2022.03.21.22272358: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Consent was obtained prior to study enrollment.<br>IRB: This study was approved by the National Institutes of Health Institutional Review Board.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: Statistical analyses were performed using Microsoft Excel (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(Microsoft, Redmond, WA) and Graph Pad Prism (San Diego, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graph Pad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04419870</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Acute Infection in Mitochondrial Disease: Metabolism, Infect…</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.21.22272358
  46. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.23.22272807
    1
    1. sciscore 26 Mar 2022

      SciScore for 10.1101/2022.03.23.22272807: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Limitations: Participants were grouped based on their self-reported olfactory disorders. It is possible that participants did not accurately classify their olfactory disorder (7,58). To limit inaccurate data, we asked specific questions describing their smell loss (Figure 1) and excluded participants whose self-reported olfactory disorder did not fit conventional categories (i.e. someone who reported having both anosmia and hyposmia). An area of future research is to directly screen for smell function with another validated smell test to classify participants’ smell function more accurately to better understand how they perform differently on SCENTinel test versions. Granted, there are no direct, validated tests that diagnose parosmia aside from SCENTinel 1.1. Until then, in-depth interviews would be necessary. Another limitation of this study is that COVID-19 test results were also self-reported. However, participants in this study were recruited from a Facebook group specifically for those with smell loss from COVID-19, and specific questions describing the cause of their smell loss (In your opinion, what might have been the cause of your smell loss? Selected “COVID-19”), and their COVID-19 test results (What was the test result? 1) Selected “Positive Lab Test (COVID+)”) were included to eliminate participants who had smell loss unrelated to COVID-19 and reduce heterogeneity. Nevertheless, SCENTinel 1.1 was designed to screen for olfactory disorders regardless of the etiolo...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.23.22272807
  47. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.22.22272758
    1
    1. sciscore 26 Mar 2022

      SciScore for 10.1101/2022.03.22.22272758: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.22.22272758
  48. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.22.22272739
    1
    1. sciscore 26 Mar 2022

      SciScore for 10.1101/2022.03.22.22272739: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants signed a written consent before being enrolled in the trial.<br>Field Sample Permit: The trials were designed and funded by Nanogen Pharmaceutical Biotechnology JSC and the Ministry of Science and Technology (MOST) of Vietnam.<br>IRB: The trial protocol was approved by the Ethics Committee/Protocol Review Board of the Ministry of Health (Vietnam) and was performed in accordance with the ICH-GCP good clinical practice guidelines, with an ethical policy consistent with the “Declaration of Helsinki” and applicable Vietnamese laws and regulations.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Eligible participants were men and non-pregnant women, at least 18 years of age with a body mass index (BMI) of 16 to 41 (kg/m2).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">This was a multicenter, randomized, double-blind, placebo-controlled clinical trial to evaluate the safety, immunogenicity, and protective efficacy of the Nanocovax vaccine on Vietnamese volunteers from 18 years of age and older.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Trial staff responsible for the vaccine/placebo administration, as well as participants were unaware of vaccine/placebo assignment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">The total number of research subjects selected in the study was expected to be 13,000 participants, with the statistical power 80% and 2 interim analysis (IA) at 35% and 70% of the total target cases using the one-sided O’Brien-Fleming boundary method, assuming the VE was 75%, and the alpha error in the one-sided test was 0.025 in the end-of-term analysis.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization Antibody Detection Kit, L00847-C) and the T cell response by intracellular cytokine-staining (ICS).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>L00847-C</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Geometric means (of anti-S IgG concentration and neutralizing antibody titer) and associated 95% confidence intervals (CI) were calculated based on log-transformed data.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S IgG</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      This Phase 3 trial has a number of limitations. As mentioned above, the VE analysis encountered multiple challenges: the emergence of Delta variant, the government polices (strict quarantine, vaccine mandate regardless of vaccine trial enrollment) and the difference in Covid-19 survaillance at different study sites. Other limitations are low ethnic diversity (all Vietnamese), small study sized and limited follow-up time. In fact, due to ethical concerns, especially the safety of all participants, the principal investigators, the sponsor, and Ethics Committee decided to terminate the study in December 2022 (1 year of ahead of the projected end date). All participants received emergency use authorized vaccines after this date. In conclusion, Nanocovax has excellent safety and immunogenicity profile and robust efficacy.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04683484</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Clinical Trial to Assess the Safety and Immunogenicity of …</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04922788</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Study to Evaluate the Safety, Immunogenicity, and Efficacy o…</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.22.22272739
  49. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.22.485413
    1
    1. sciscore 26 Mar 2022

      SciScore for 10.1101/2022.03.22.485413: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">By loading the optimized RBD-ACE2 complex structure into the PISA server, the interfacial contact information can be promptly generated.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PISA</div><div>suggested: (PISA, RRID:SCR_015749)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.22.485413
  50. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.23.485397
    1
    1. sciscore 26 Mar 2022

      SciScore for 10.1101/2022.03.23.485397: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">A total of 24 male golden hamsters 6-8 weeks old were assigned to four groups (n=6).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A secondary antibody, Alexa Fluor 647-conjugated AffiniPure Goat Anti-Human IgG, F(ab’)2, Cat#109-605-097 or Affinipure Rabbit Anti-Human IgG Fcγ fragment specific, Cat#309-005-008 (Jackson ImmunoResearch, West Grove, PA), at a final concentration of 0.5 μg/mL was used to detect the unbound fraction.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Human IgG</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 109-605-097, RRID:AB_2337888)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Biotinylated goat anti human-Fab antibody, Cat#ab64666 (Abcam, Cambridge, UK), or biotinylated goat Anti-Human ACE-2 antibody, Cat#DY933-05 (R&D Systems, Minneapolis, MN) was used as a detection antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti human-Fab</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-Human ACE-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Rituxan and FMC63 antibodies were labeled with AF488, Cat#ab236553, and AF647, Cat#ab269823 (Abcam), respectively, according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FMC63</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>AF647</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Methods and Materials: Mammalian expression and purification of recombinant proteins: Recombinant proteins were expressed by transient expression in CHO-K1 cells adapted to serum- free suspension culture (TunaCHO) using a mammalian expression vector and purified by Protein A affinity chromatography (LakePharma, San Carlos, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO-K1</div><div>suggested: CLS Cat# 603480/p693_CHO-K1, RRID:CVCL_0214)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Live SARS-CoV-2 and NL63 neutralization assay: Infectious virus USA-WA1/2020, Cat#NR-52281, and NL63, Cat#NR-470 (BEI, Manassas, VA) was expanded using a single passage in Vero/TMPRSS2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero/TMPRSS2</div><div>suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pharmacokinetic (PK) assays: The study was conducted by The Jackson Laboratory, Bar Harbor, ME using 6-8 week old male B6.Cg-Fcgrttm1Dcr Tg(FCGRT)32Dcr/DcrJ mice homozygous for the human FcRn transgene.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B6.Cg-Fcgrttm1Dcr Tg(FCGRT)32Dcr/DcrJ</div><div>suggested: RRID:IMSR_JAX:014565)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Astra v6.1.7 software (Wyatt Technology) was used for light scattering and refractive index data acquisition and processing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Astra</div><div>suggested: (ASTRA, RRID:SCR_016255)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pharmacokinetic (PK) analysis: Noncompartmental pharmacokinetic data analysis was performed using Phoenix WinNonlin v8.3 (Certara, Princeton, NJ).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phoenix WinNonlin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Kinetic data were obtained using IncuCyte 2021A software (Sartorius) before area-under-the-curve (AUC) (mean ± SEM) and non-linear regression analysis were performed using GraphPad Prism v9.3.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.23.485397
  51. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.21.22270828
    1
    1. sciscore 26 Mar 2022

      SciScore for 10.1101/2022.03.21.22270828: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the Fundação de Medicina Tropical Dr. Heitor Vieira Dourado Ethics Review Board (CAAE: 51963021.9.0000.000) and the requirement for informed consent was waived by the Ethics Commission because these data come from medical and laboratory assistance that took place between 2020 and 2021 and medical records were available anonymously encoded.<br>Consent: The study was approved by the Fundação de Medicina Tropical Dr. Heitor Vieira Dourado Ethics Review Board (CAAE: 51963021.9.0000.000) and the requirement for informed consent was waived by the Ethics Commission because these data come from medical and laboratory assistance that took place between 2020 and 2021 and medical records were available anonymously encoded.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GREEN PATIENT: characterized as patients that only presented increased ferritin levels.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GREEN</div><div>suggested: (GReEn, RRID:SCR_009264)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Our study also has some significant limitations. The drawbacks of the work were that, for some patients there are not all data of five markers daily, despite our efforts to perform the monitoring and dosing of five markers every day. That is due some patients did not present in the LEPAC or they were not found in their residences.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.21.22270828
  52. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.20.22272677
    1
    1. sciscore 25 Mar 2022

      SciScore for 10.1101/2022.03.20.22272677: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: The objective of the study was briefly explained to the participants before a written consent form was administered to each participant.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study participants were selected by simple random sampling based on their willingness to participate in the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      The main limitations were the sampling bias because some HFs could not access the online survey.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.20.22272677
  53. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.19.22272419
    1
    1. sciscore 25 Mar 2022

      SciScore for 10.1101/2022.03.19.22272419: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study protocol was supervised and approved by the Institutional Review Board of Farabi Eye Hospital, Tehran University of Medical Sciences, Tehran, Iran, with an ethical registration code of IR.TUMS.FARABIH.REC.1400.044.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analysis was performed using SPSS software version 24 for windows (SPSS Inc., Chicago, IL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Retrospective nature and probable clerical errors in data entry are limitations of this study. Low incidence of endophthalmitis necessitates very large study population size and multi-center collaborations to reveal potential risk factors with very small effects on the incidence of post-IVI endophthalmitis. However, such studies usually suffer from the lack of a unique, defined preparation and injection protocol among different centers that may confound the results. From this point of view, presence of a unique defined protocol before and after COVID epidemic in our tertiary center is a strength for this study. In conclusion, it seems that facial mask wearing by patients is probably not associated with an increased rate of post injection endophthalmitis and wearing these respiratory protections as a priority in respiratory epidemics such as COVID or seasonal influenza should not be a concern in this regard.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.19.22272419
  54. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.21.485243
    1
    1. sciscore 25 Mar 2022

      SciScore for 10.1101/2022.03.21.485243: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression and Purification of recombinant antibodies: A pair of plasmids separately expressing the heavy- and the light-chain of antibodies were transiently co-transfected into HEK293F cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serial 1/3 dilutions of antibodies were incubated with pseudoviruses at 37°C for 1 hour, and then the mixtures were added in ACE2 expressed Huh-7 cells (104 per well in 96-well plates).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production of recombinant D614G and variants spike ectodomain: The gene encoding SARS-CoV-2 S ectodomain (residues 1-1208, Gene Bank: MN908947) was synthesized (GeneScript) and cloned into mammalian expression constructs pcDNA-3.1, proline substitutions at residues 986 and 987, “GSAS” substitution at furin cleavage site (residues 682-685), a T4 fibritin trimerization motif, an HRV3C protease cleavage site, a TwinStrepTag, and an 8XHisTag at C-terminal were introduced simultaneously by MultiS one step cloning kit (Vazyme).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA-3.1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Using the SARS-CoV-2 WT plasmid as the template, mutations such as D614G, B.1.17 (Del 69H70V, N501Y, P681H, S982A, Del 145Y, A570D, T716I, D1118H), B.1.351 (K417N, E484K, N501Y) and P1 (K417T, E484K, N501Y) was introduced by Multi Site-Directed Mutagenesis Kit (Yeasen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 WT</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The expression plasmid of Omicron S with HexaPro mutations(26), “GSAS” substitution at furin cleavage site (residues 682-285), a T4 fibritin trimerization motif, a TwinStrep Tag, and a C-terminal 8 × His Tag was constructed into pcDNA3.1 vector by MultiS one step cloning kit (Vazyme).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, whole spike glycoprotein sequences of SARS-CoV, wild type or variants of SARS-CoV-2 were inserted into the vector of pcDNA3.1+ and severally co-transfected into 293 T cells (ATCC, Manassas, VA, USA) with a defective HIV-1 genome that encodes luciferase reporter.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1+</div><div>suggested: RRID:Addgene_117272)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A nonlinear regression analysis was performed on the resulting curves using Prism (GraphPad) to calculate half-maximal inhibitory concentration (IC50) values.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Automated data acquisition was carried out with SerialEM software(27).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SerialEM</div><div>suggested: (SerialEM, RRID:SCR_017293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cryo-EM image processing: All the data processing was carried out using either modules on, or through, RELION v3.0 and cryoSPARC(28).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RELION</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For S-15 complex (Fig.S10), a total of 6,943 movie stacks was binned 2 × 2, dose weighted, and motion corrected using MotionCor2(29).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MotionCor2</div><div>suggested: (MotionCor2, RRID:SCR_016499)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After blob-picking in cryoSPARC and 2D classification, trimer and monomer particles were observed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For model building of S-15 and S-60, the apo-S trimer model and the antibody (15 and 60) model generated by swiss-model were fitted into the map using UCSF Chimera(31) and followed by manually adjustment in COOT(33), as well as real space refinement in Phenix.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phenix</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Model validation was performed using MolProbity.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MolProbity</div><div>suggested: (MolProbity, RRID:SCR_014226)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.21.485243
  55. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.22.485312
    1
    1. sciscore 25 Mar 2022

      SciScore for 10.1101/2022.03.22.485312: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For simplicity, we assume that e1 = [τ1, i1, c1, v1] and e2 = [τ2, i2, c2, v2], that i = max(i1, i2), and that the intersection fragment between e1 and e2 consists of λ nucleotides, that is λ = min(q1, q2) + 1 – i; in case τ1 = O and other similar cases then we have necessarily λ =1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>c1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>e1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Similar to VCF and CRAM [23] files, we express each genome sequence in terms of its differences (substitutions and deletions) with respect to the reference, representing only the differences of each genome compared to the reference.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CRAM</div><div>suggested: (CRAM, RRID:SCR_012975)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The underlying principle is similar to the one in the previous section and in UShER [56]: we want to represent sequence information concisely as a set of differences with respect to the reference.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UShER</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Here we describe our efficient implementation of maximum likelihood phylogenetic placement within MAPLE using the likelihood genome lists presented in Sections 5.2 and 5.4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAPLE</div><div>suggested: (Maple, RRID:SCR_014449)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Note that some of our heuristics for SPR search are similar to some that have been developed for other phylogenetic packages, and in particular RAxML.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RAxML</div><div>suggested: (RAxML, RRID:SCR_006086)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">5.7 Software implementation: We implemented our methods in a Python3 script available from https://github.com/NicolaDM/MAPLE.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FastTree 2 was executed with options “-quiet” to limit screen output, “-nosupport” to skip support value computations, and “-nocat” to ignore rate variation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FastTree</div><div>suggested: (FastTree, RRID:SCR_015501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RAxML-NG was run with options “–threads 1” to use only one core per replicate on our cluster.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RAxML-NG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In order to speed up execution of MAPLE, we use PyPy (v7.3.5 with GCC 7.3.1 20180303 for Python 3.7.10; see https://www.pypy.org/#!).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used phastSim v0.0.3 [15] to simulate sequence evolution along this tree according to the non-reversible non-stationary neutral mutation rates estimated in [14] and using the SARS-CoV-2 Wuhan-Hu-1 genome [60] as root sequence.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>phastSim</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In simulations with rate variation we evaluate topology likelihoods in IQ-TREE 2 using a GTR+G model with four categories (which is slightly different from the rate variation model used in simulations, but which is available in IQ-TREE 2), while in all other cases we use a GTR model without rate variation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IQ-TREE</div><div>suggested: (IQ-TREE, RRID:SCR_017254)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.22.485312
  56. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.21.22272672
    1
    1. sciscore 25 Mar 2022

      SciScore for 10.1101/2022.03.21.22272672: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We identified studies from published search strategies conducted by the Cochrane Haematology living systematic review teams which searched the following databases - MEDLINE, Embase, the Cochrane COVID-19 Study Register, Pubmed, Epistemonikos</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Embase</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div><div style="margin-bottom:8px"><div>Pubmed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">L*OVE List Coronavirus disease, World Health Organization COVID-19 Global literature on coronavirus disease and trial registry platforms, including ClinicalTrials.gov, WHO International Clinical Trials Registry Platform (ICTRP) and medRxiv (see references8,10).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ClinicalTrials</div><div>suggested: (ClinicalTrials.gov, RRID:SCR_002309)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      This study has a number of limitations. Firstly, it aggregates studies using different therapeutics and with different enrolment and outcome criteria. Secondly, it tries to equate administered doses of convalescent plasma and monoclonal antibodies based on a single study comparing in vitro neutralisation of pseudovirus32. In the case of convalescent plasma, we consider mean titre of donor plasma and mean plasma volume for dilution, which does not reflect the considerable variability that exists between individual donor plasma neutralisation titres and individual recipients’ plasma volumes. In addition, we consider only the ‘administered dose’, as the studies did not directly measure plasma neutralisation titres in recipients after administration. Gordon et al33 studied the pharmacokinetics of convalescent plasma after administration of a volume of 5 ml/kg to infants (leading to an estimated dilution of approximately 10-fold34). Direct measurement of recipient titres 30 minutes after infusion found a mean of 6.2% of donor titres, suggesting a decrease in titre of around 40% compared to what would be predicted by dilution alone. Thus, there may be a tendency for the ‘administered dose’ to be higher than a serum neutralisation level that might be directly measured in vivo after treatment. Despite these limitations, a major strength of our approach is to apply a rigorous quantitative analysis to the available data on passive antibody treatment for SARS-CoV-2. A major factor that ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.21.22272672
  57. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.22.22272745
    1
    1. sciscore 25 Mar 2022

      SciScore for 10.1101/2022.03.22.22272745: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Oversight: Hamad Medical Corporation and Weill Cornell Medicine-Qatar Institutional Review Boards approved this retrospective study with a waiver of informed consent.<br>Consent: Oversight: Hamad Medical Corporation and Weill Cornell Medicine-Qatar Institutional Review Boards approved this retrospective study with a waiver of informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">10 Laboratory methods and subvariant ascertainment: The large Omicron-wave exponential-growth phase started on December 19, 2021 and peaked in mid-January, 2022.2-6 A total of 315 random SARS-CoV-2-positive specimens collected between December 19, 2021 and January 22, 2022 were viral whole-genome sequenced on a Nanopore GridION sequencing device.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      This study has limitations. BA.1 and BA.2 ascertainment was based on proxy criteria, i.e., presence or absence of an S-gene “target failure” using the TaqPath PCR assay, but this method of ascertainment is well established not only for Omicron subvariants, but also for other variants such as Alpha.19,40,41 Some Omicron infections may have been misclassified Delta infections, but this is not likely, as Delta incidence was limited during the study duration (Section S2). While matching was done for sex, age, and nationality, this was not possible for other factors, such as comorbidities, as such data are not available. However, matching by these factors provided demonstrable control of bias in studies of different epidemiologic designs and that used control groups in Qatar.13,14,18,28,29 Effectiveness was assessed using an observational, test-negative, case-control, study design, rather than a design in which cohorts of individuals were followed up. However, the cohort study design applied earlier to the same population yielded findings similar to those of the test-negative case-control design,17,18,42 supporting the validity of this standard approach in assessing immunity protection.3,18,20-23 Moreover, our recent study of effectiveness of boosters relative to primary series used a cohort study design and generated results consistent with the above results.6 Nonetheless, one cannot exclude the possibility that in real-world data, bias could arise in unexpected ways, or from unk...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.22.22272745
  58. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.22.22272770
    1
    1. sciscore 25 Mar 2022

      SciScore for 10.1101/2022.03.22.22272770: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical clearance: This study was approved by the ethics committee of the Witten/Herdecke University (S-273/2021).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      As an additional limitation of our study, it must be mentioned that we only asked about subjectively perceived symptoms that were not necessarily confirmed by a physician. However, the work of Roessler et al. confirms our findings and shows that also even more severe conditions that were diagnosed by a trained physician occur more often in the COVID-19 cohort than in the control cohort.17 Recently, Cohen et al. detected an increase of 11% for SARS-CoV-2 infected patients over the age of 65 for other sequelae.24 In our questionnaire, we explicitly asked only about new onset symptoms. Nevertheless, it must be mentioned that we can not exclude that some employees may have overstated their reported symptoms. The socioeconomic impact of long lasting symptoms after a SARS-CoV-2 infection was early described by the surrogate sick leave of working people in Sweden. Median leave time from work was 35 days and 9% had sick leaves longer than four months.10 For both medical and socioeconomic reasons, predictors for long lasting symptoms are essential. Predictors were first identified by the Swedish study investigating sick leaves, which were older age and sick leaves within the year prior to infection in a first rough analysis.10 We identified a significant association between the occurrence of ageusia, anosmia or breathlessness during the first ten days, first Ct value <30 as well as a definitely nosocomial SARS-CoV-2 transmission, and a prolonged illness duration over 90 days. Through ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.22.22272770
  59. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.21.22272611
    1
    1. sciscore 25 Mar 2022

      SciScore for 10.1101/2022.03.21.22272611: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All sequences were aligned to hCoV-19/Wuhan/WIV04/2019 (WIV-04; EPI_ISL_402124) using MAFFT v7.42733.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Assessment of convergence (effective sample size > 200) was performed using Tracer v1.7139.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Tracer</div><div>suggested: (Tracer, RRID:SCR_019121)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To understand within-country source-sink dynamics during early introductions and proliferation patterns during later periods, we used BEAST v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BEAST</div><div>suggested: (BEAST, RRID:SCR_010228)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Using these sequences, we then reconstructed approximate ML phylogenies using FastTree v2.1.1142.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FastTree</div><div>suggested: (FastTree, RRID:SCR_015501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Similarly, we reconstructed an ML phylogenetic tree under the HKY+G nucleotide substitution model using IQ-TREE after removing any molecular clock outlying sequences identified by treetime.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IQ-TREE</div><div>suggested: (IQ-TREE, RRID:SCR_017254)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/content/10.1101/2022.03.21.22272611v1
  60. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.21.22272490
    1
    1. sciscore 25 Mar 2022

      SciScore for 10.1101/2022.03.21.22272490: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Participants were 18 years or older, provided informed consent, and completed demographic, clinical, and travel history questions.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">With SARS-CoV-2 genome MN908947.3 as reference, Illumina data was aligned with BWA-MEM and Guppy-called Nanopore data with minimap2 (using ont-map option)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA-MEM</div><div>suggested: (Sniffles, RRID:SCR_017619)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Variant Call Format (VCF) files were generated with FreeBayes [4] (Illumina) or medaka-variant (Nanopore) and these VCF files used in both cases to generate consensus sequences with bcftools.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FreeBayes</div><div>suggested: (FreeBayes, RRID:SCR_010761)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.21.22272490
  61. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.20.22271891
    1
    1. sciscore 25 Mar 2022

      SciScore for 10.1101/2022.03.20.22271891: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The Investigational Review Board or Ethics Committee at each study site approved the protocol.<br>Consent: All participants provided written informed consent before enrollment into the study.<br>Field Sample Permit: Serious adverse events (SAEs), medically attended adverse events (MAAEs) and adverse events of special interest (AESIs) if any, were collected during the entire study duration.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study Design and Study Population: This is an ongoing phase III prospective, single blinded, randomized, active controlled study conducted at 18 sites across India in accordance with the principles defined in the Declaration of Helsinki, International Conference on Harmonization guidelines (Good Clinical Practices), and the local regulatory guidelines.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study Design and Study Population: This is an ongoing phase III prospective, single blinded, randomized, active controlled study conducted at 18 sites across India in accordance with the principles defined in the Declaration of Helsinki, International Conference on Harmonization guidelines (Good Clinical Practices), and the local regulatory guidelines.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: A randomization scheme was generated by using a validated system.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Participants were seronegative to anti-SARS-CoV-2 IgG antibody prior to randomization into immunogenicity arm, whereas in safety arm subjects were randomized irrespective of their serostatus for SARS-CoV-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">6 Participants who were negative for both Anti-SARS CoV-2 human S1/S2 IgG antibodies and SARS CoV-2 infection were enrolled to study immune responses (immunogenicity arm).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>human S1/S2 IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Outcomes: The primary outcome of the study was demonstration of immunogenic superiority of BE’s CORBEVAX™ vaccine against COVISHIELD™ vaccine in terms of GMTs of anti-SARS-CoV-2 virus neutralizing antibodies at day 42 (14 days after 2nd dose).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-RBD antibody concentration in terms of GMC’s and to descriptively assess the safety, tolerability and reactogenicity of CORBEVAX™ vaccine during the study period.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-RBD</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This vaccine is based on recombinant, replication-deficient chimpanzee adenovirus vector encoding the SARS-CoV-2 Spike (S) glycoprotein, produced in genetically modified human embryonic kidney (HEK) 293 cells (CDSCO.gov).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>293</div><div>suggested: NCI-DTP Cat# NCI-293TT, RRID:CVCL_1D85)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This is also a single-blind study where study participants randomized into immunogenicity arm are kept blinded of the vaccination group to which they have been assigned, but the investigator and study staff are aware of the assigned group (CORBEVAX™ or COVISHIELD™). Procedure: Biological E’s CORBEVAX™ vaccine is based on recombinant RBD protein, which is produced in Pichia Pastoris culture as secretory protein and purified via multiple chromatography and ultrafiltration/normal-filtration steps.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Procedure: Biological</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Study limitations: This study has several limitations like efficacy of the vaccine against Covid-19 infection was not studied and long-term safety was not established as interim results are available only until day 56. However, it is worth noting that in a small set of patients (n=360) safety was established until 12 months and significantly higher neutralizing antibody titres (nAbs) persisted at least 6 months after second dose of the vaccination when compared to human convalescent serum (HCS).5 Overall, we conclude that CORBEVAX™ is safe, well tolerated and elicited excellent antibody and cellular immune responses that can offer significant protection against symptomatic infection from SARS-CoV-2 virus.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.20.22271891
  62. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.22.22272748
    1
    1. sciscore 25 Mar 2022

      SciScore for 10.1101/2022.03.22.22272748: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants provided written informed consent at the UKBB cohort recruitment.<br>IACUC: This study received ethical approval from UKBB Ethics Advisory Committee (EAC) and was performed under the application of 65397.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Genetic data management and quality controls were performed using Plink 1.9.20</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Plink</div><div>suggested: (PLINK, RRID:SCR_001757)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      This study also has some limitations. Residual confounding cannot be ruled out in this observational study, although robust statistical approaches for causal inference was applied, including PS matching and knowledge-driven negative control analyses. Participants recruited in UKBB might not fully represent the general population and were likely healthier. Although those Covid-19 participants were from non-hospital settings, they were likely to be symptomatic and more severe cases. The extent to which asymptomatic infection is associated with VTE risk warrants further investigation. Finally, the estimates from our analyses were an average and mixed effect of several SARS-CoV-2 strains, which should be cautiously extrapolated to novel variants, such as Omicron. Community-based ambulatory Covid-19 is associated with a striking 20-fold excess risk of VTE. This risk was much higher among unvaccinated individuals, and increased with older age, in men, and in patients with obesity. Inherited thrombophilia further doubled VTE risk, comparable to a 10-year ageing effect. Our findings call for targeted prevention strategies for post-Covid VTE in outpatient settings, and suggest an aetiological role of inherited thrombophilia. The clinical utility of genetic testing to stratify infected patients and inform personalized thromboprophylaxis warrants further research.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.22.22272748
  63. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.21.22272698
    1
    1. sciscore 25 Mar 2022

      SciScore for 10.1101/2022.03.21.22272698: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study complies with the Declaration of Helsinki with study approval from the Aga Khan University Nairobi Institutional Ethics Review Committee (Reference: 2020/IERC-74 (v2).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Our study has some limitations. Firstly, although achieving comprehensive phenotyping this was an observational study in a small COVID-19 population. Almost half of the patients received either dexamethasone or remdesevir which may have supressed the inflammatory response and underestimated myocardial inflammation. Scanning, however, was performed early in the clinical course. Secondly, our assessment of vasculitis was based on 18F-FDG-PET/CT uptake in the large vessels. Vascular inflammation in the smaller vessels, due to limited spatial resolution, may be undetected. However, if vascular inflammation was secondary to a systemic cytokine storm or immune response, it would have been expected that this would have been reflected in the aorta and the medium sized carotids. Thirdly, we excluded patients with severe COVID-19 infection who were unable to tolerate imaging limiting the generalizability of our findings in this population. Finally, we did not perform cardiac biopsy. Although this is the gold standard for the diagnosis of myocarditis, we performed deep phenotyping using three different imaging modalities. The combination of myocardial inflammatory cell identifaction by 18F-FDG-PET, and myocarditis detection by CMR (using the strictest criteria to identify oedema), make our findings robust. In conclusions, for the first time in acute COVID-19 infection and with the use of multi-modality imaging we make the following observations. Myocarditis was present in one in three p...

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">ISRCTN12154994</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.21.22272698
  64. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.21.485224
    1
    1. sciscore 24 Mar 2022

      SciScore for 10.1101/2022.03.21.485224: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The studies design and animal usage were reviewed and approved by the Institutional Animal Care and Use Committee under numbers 20-024, 21-006, 21-020 and 21-029 for compliance with regulations prior to study initiation.<br>Field Sample Permit: Experimental protocols were approved by the Institut Pasteur Ethics Committee under number dap210050 and authorized by the French Ministry of Research under number 31816.<br>IRB: Experimental protocols were approved by the Institut Pasteur Ethics Committee under number dap210050 and authorized by the French Ministry of Research under number 31816.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The membrane was incubated with a polyclonal anti-RBD antibody (Sino Biological: 40592-T62) at 1:2000 dilution followed by incubation with HRP conjugated anti-rabbit polyclonal antibody and reaction was detected by chemiluminescence and revealed the expressed protein at the estimated size of the RBD-NP.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The absorbance of the sample was inversely dependent on the titer of the anti-SARS-CoV-2 neutralizing antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 neutralizing antibodies .</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transcribed capped mRNA was electroporated into baby hamster kidney (BHK-21) cells expressing SARS-CoV-2 N protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-21</div><div>suggested: ATCC Cat# CRL-6281, RRID:CVCL_1914)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, progeny virus was used to infect fresh VeroE6-TMPRSS2 cells to generate P.1 stocks for downstream experiments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 delta neutralization assay: Vero-E6 cells were seeded at a density of 1.5x104 cells/100μl per well (in DMEM supplemented with 10% FBS, 1% non-essential amino acids (NEAA) and 1% Penicillin-Streptomycin) in 96-well cell culture plates one day before and incubated over night at 37°C, 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently 100 μl of serum and virus mixtures were added on confluent Vero E6 cells and 96-well plates were incubated for 72 h at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice: CB6F1/J mice and B6.Cg-Tg(K18-ACE2)2Prlmn/J transgenic mice were purchased from The Jackson Laboratory (SN 100007 and 034860, respectively) under a license agreement.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CB6F1/J</div><div>suggested: RRID:IMSR_JAX:100007)</div></div><div style="margin-bottom:8px"><div>B6.Cg-Tg(K18-ACE2)2Prlmn/J</div><div>suggested: RRID:IMSR_JAX:034860)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transient expression of RBD-NP protein: FreeStyle 293 cells (2.106) in 500 ml of SFM media were transfected using 600 μg of pHL-sec plasmid DNA containing RBD-NP cDNA for transient expression of glycosylated RBD-NP according to the manufacturer’s protocol (Life Technology).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHL-sec</div><div>suggested: RRID:Addgene_99845)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The supercoiled pUC19 DNA was upscaled, linearized with BsmBI, and purified.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pUC19</div><div>suggested: RRID:Addgene_50005)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analyses were performed using Prism v9.3.1 (GraphPad Software) (Fig. 2-3, 5, 10-11) or using R Statistical Software v4.1.2</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>R Statistical</div><div>suggested: (R Project for Statistical Computing, RRID:SCR_001905)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04742738</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Safety and Immunogenicity Study of SARS-CoV-2 Nanoparticle V…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04750343</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Safety and Immunogenicity Study of SARS-CoV-2 Nanoparticle V…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT05175950</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Not yet recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Safety, Reactogenicity, and Immunogenicity Study of Heterolo…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04523571</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Safety and Immunogenicity of SARS-CoV-2 mRNA Vaccine (BNT162…</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.21.485224
  65. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.22.485248
    1
    1. sciscore 24 Mar 2022

      SciScore for 10.1101/2022.03.22.485248: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Studies using primary human cells were approved by the University of Queensland Human Medical Research Ethics Committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">THP-1 cells (TIB-202; ATCC) were maintained in RPMI 1640 medium supplemented with 10% heat-inactivated foetal bovine serum (FBS), 2 mM GlutaMAX (Life Technologies) and 50 U/ml penicillin–streptomycin (Life Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>THP-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 cells purchased from ATCC (HTB-55) were maintained in Minimal Essential Media (Invitrogen), containing 10% heat-inactivated foetal bovine serum (Cytiva), 50 U/ml penicillin and streptomycin (Life Technologies Australia), and were seeded at 300 000 cells per well in a 12-well plate 48 h prior to experiments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: ATCC Cat# HTB-55, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK-293T cells were transfected with the expression vectors according to the manufacturer’s protocol with PEI 2500 (BioScientific) and transduced target THP-1 cells were selected with puromycin (1 μg/mL) after 24 h and used for assays after 72 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus was grown on Vero E6 TMPRSS2 cells for 48 h in DMEM with 2% FBS, and cell debris was cleared by centrifugation at 500G for 5 minutes at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6 TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For Calu3 cells, virus was added to cells to give a total volume of 500 μL of RPMI 1640 with 2% FBS (HMDM and THP-1) or MEM with 2% FBS (Calu3) per well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For studies involving SARS-CoV-2 infection of BAL macrophages, the SARS-CoV-2 isolate hCoV-19/Australia/VIC01/2020 (kindly provided by the Victorian Infectious Diseases Reference Laboratory) was grown in Vero cells for 72 h in serum-free MEM with 1 μg/ml TPCK trypsin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentiviral transduction: A lentiviral construct containing human ACE2 (Addgene 155295), or mScarlet (Addgene 85044) was cloned into pLV-CMV-MCS-IRES-Puro-Sin (48) and packaged into lentivirus in HEK-293T cells by means of third generation lentiviral packaging plasmids (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLV-CMV-MCS-IRES-Puro-Sin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Mpro expression vector was generated by cloning the Mpro PCR product into a modified pEF6 plasmid, with an HA-tag N-terminal of the multiple cloning site, by standard restriction digest cloning techniques.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pEF6</div><div>suggested: RRID:Addgene_70765)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: Statistics were calculated using GraphPad Prism using tests indicated in figure legends.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.22.485248
  66. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.22.485299
    1
    1. sciscore 24 Mar 2022

      SciScore for 10.1101/2022.03.22.485299: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293T cells (CRL-3216; ATCC, Manassas, VA, USA) were seeded onto 96-well plates at a density of 5×104 cells per well in 100 μL complete medium (DMEM supplemented with 10% fetal bovine serum).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero-E6 cells (African Green Monkey renal epithelial cells; ATCC cat. no. CRL-1586) engineered to overexpress hACE2/Furin were seeded in 24-well plates to obtain a confluence of 80%.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, Vero E6 cells (European Collection of Authenticated Cell Cultures) were seeded onto 96-well plates at a density of 3×104 cells per well in 100 μL cell culture media that consisted of DMEM (Lonza, Basel, Switzerland), 1% penicillin–streptomycin (Lonza, Basel, Switzerland) and 2% heat-inactivated fetal bovine serum (Gibco, Waltham, MA, USA) the day before the experiment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell fluorescence was detected using an EVOS FL microscope (Life Technologies, Carlsbad, CA, USA) and was quantified in ImageJ (US National Institutes of Health, Bethesda, MD, USA) [26] using the Analyze Particles tool after thresholding for the corresponding colors.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IC50 values were determined using non-linear regression analysis (four-parameter logistic model; GraphPad Prism 8).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As before [12, 23], binding data were converted to percent inhibition and fitted with standard log inhibitor vs. normalized response models [30] using nonlinear regression in GraphPad Prism (GraphPad, La Jolla, CA, USA) to establish half-maximal inhibitory concentrations (IC50).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04619290</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Outpatient Treatment With CoVid-19 With Prexablu</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04635605</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Methylene Blue Treatment of COVID-19</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04370288</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Clinical Application of Methylene Blue for Treatment of Covi…</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.22.485299
  67. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.21.22272728
    1
    1. sciscore 24 Mar 2022

      SciScore for 10.1101/2022.03.21.22272728: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Online informed consent was signed by each participant at the beginning of the FGDs.<br>IRB: The study was approved by the Institutional Review Board at the University of xxxx.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      However, the current study has limitations. Our strategy of utilizing convenience sampling resulted in more than half of the participants being from colleges, resulting in this study capturing the opinions of community leaders in only a portion of the field. Therefore, future studies could utilize stratified sampling to improve the accuracy and representativeness of the results by reducing sampling bias. Future research also needs to expand to other important stakeholders that play an important role in health communication (e.g., AA associations).

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.21.22272728
  68. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.21.22272590
    1
    1. sciscore 24 Mar 2022

      SciScore for 10.1101/2022.03.21.22272590: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We imposed realistic patterns of βt from local COVID-19 data across Arizona, and for mt, we assumed low initial movement (due to, for example stay-at-home orders), which then return rather quickly to a “normal” baseline, which was a pattern seen across the USA (Google 2020; Gibbs et al. 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Google</div><div>suggested: (Google, RRID:SCR_017097)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.21.22272590
  69. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.21.485184
    1
    1. sciscore 24 Mar 2022

      SciScore for 10.1101/2022.03.21.485184: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      The low read depth can be a limitation of the approach presented here and any reference-based genotyping method. The obtained consensus genome of the adenovirus sample covered 99.4 % of the reference genome. The SNP density appeared to be higher in the pVI, ORF22, and ORF17—ORF19A genes relative to the rest of the genome. In total, we observed seven sites with an AB > 0. The phylogenetic reconstruction clustered the consensus genome genotyped here and the publicly available genome of the same sample (Figure 6A), agreeing with the clustering based on pairwise genetic distances. We only observed indel mutations between the two mentioned sequences that could be linked to the automatic masking of low-depth genomic regions (read depth < 5). This low divergence of the reference points out the accuracy of the presented pipeline. This work reports a pipeline capable of rapid and automated analysis of viral genomes obtained by NGS. Unlike proprietary software solutions, this pipeline relies on freely available, open-source bioinformatic software. Using parallel execution of tasks, we could obtain consensus genomes of the SARS-CoV2 dataset generated for this study without the need for laborious manual data curation required by Geneious and with similar accuracy. Our pipeline generated good quality consensus genomes using its default settings in most cases, with the FCoV sample as the only exception. Moreover, we could also investigate the intra-host diversity of samples using the allel...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.21.485184
  70. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.21.22272722
    1
    1. sciscore 24 Mar 2022

      SciScore for 10.1101/2022.03.21.22272722: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.21.22272722
  71. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.19.484981
    1
    1. sciscore 24 Mar 2022

      SciScore for 10.1101/2022.03.19.484981: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.19.484981
  72. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.19.22272644
    1
    1. sciscore 24 Mar 2022

      SciScore for 10.1101/2022.03.19.22272644: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">The ultrasound reviewer was not blinded to the study questions.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used Stata17.0 (Statacorp LLP, College Station, TX) for data analyses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Statacorp</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.19.22272644
  73. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.20.22272664
    1
    1. sciscore 24 Mar 2022

      SciScore for 10.1101/2022.03.20.22272664: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">To ensure consistency in the study selection process 10% of the articles’ titles/abstracts and full texts were randomly selected and screened independently by two researchers (NW and TM).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Search strategy: The databases Medline</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Medline</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, EMBASE, Scopus, Cochrane, and medRxiv were searched in February 2021.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EMBASE</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div><div style="margin-bottom:8px"><div>Cochrane</div><div>suggested: (Cochrane Library, RRID:SCR_013000)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Article selection: Article selection was conducted using Covidence software (9).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Covidence</div><div>suggested: (Covidence, RRID:SCR_016484)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data extraction: Data were extracted from the reviews using Microsoft Excel.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analysed using STATA 12.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Strengths and limitations: This review presents the most comprehensive and systematic overview on the impact using RAAS inhibitors on COVID-19 related clinical outcomes, with a wide range of sensitivity (sub-group) analyses to assess the strength, validity and robustness of the evidence while accounting for potential confounding variables. Furthermore, none of the pooled meta-analysis estimates for the nine studied outcomes was affected/dominated by a single individual study. Although most of the included studies were classified as ‘low’ or ‘critically low’ quality when assessed using AMSTAR 2 tool, it is widely acknowledged that the AMSTAR 2 tool has a high standard with most reviews rated as ‘critically low’ (69, 70). The AMSTAR 2 tool is also prone to subjective biases (71), and assessment results are at the discretion of the reviewers regarding what is a “comprehensive” literature search or “satisfactory” explanation of heterogeneity or risk of bias assessment (71); therefore, quality assessment was conducted fully independent in this review and further criteria were set by the assessors to ensure inter-rater consistency. Alternatives tools to AMSTAR 2 exist such as the ROBIS tool, however the measurement categories are found to be broadly similar with the AMSTAR 2 tool considered more reliable (71). Additionally, we accounted for this issue by conducting a sub-group analysis based on the level of studies’ quality.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.20.22272664
  74. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.19.22272637
    1
    1. sciscore 24 Mar 2022

      SciScore for 10.1101/2022.03.19.22272637: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical statement: The present study was approved by the local ethics review committee from Clementino Fraga Filho University Hospital (<br>Consent: All enrolled participants signed written informed consent. 2.3.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.5 Ag-RDT procedure: Nasal, oral, and saliva specimens were tested immediately following collection using the Panbio™ COVID-19 Ag Test Device (Abbott) according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GraphPad Prism version 9.2.0 (GraphPad Software, San Diego, California USA), and JASP Version 0.16 (JASP Team, 2021, Computer software) were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.19.22272637
  75. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.18.22272503
    1
    1. sciscore 24 Mar 2022

      SciScore for 10.1101/2022.03.18.22272503: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The whole genome sequencing study protocol was reviewed and approved by the Scientific and Ethics Review Committee (SERU) at KEMRI, (SERU #4035).<br>Consent: Individual patient consent requirement was waivered by the committee as the sequenced samples were part of the public health emergency response.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">To ensure global representation of sequences, we downloaded all the sequences (n= 8,916,634) from the Global Initiative on Sharing All Influenza Data (GISAID) database collected before 31st December and used an in-house R script to randomly select a sub-sample of 5,179 genomes while considering Pango lineage (lineages detected in Seychelles only), continent and date of collection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The final library was normalised to 15-70 ng, loaded on a SpotON R9 flow cell and sequenced on a MinION Mk1B or GridION device5.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MinION</div><div>suggested: (MinION, RRID:SCR_017985)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The consensus sequences were then polished using Nanopolish toolkit (version 0.13.3) using the raw signals.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Nanopolish</div><div>suggested: (Nanopolish, RRID:SCR_016157)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A maximum likelihood (ML) phylogeny was inferred using IQTREE version 2.1.3 (http://www.iqtree.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>http://www.iqtree.org/</div><div>suggested: (IQ-TREE, RRID:SCR_017254)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting trees were visualized using the Bioconductor ggTree version 2.2.4 package9 in R10.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bioconductor</div><div>suggested: (Bioconductor, RRID:SCR_006442)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Using the date and location annotated tree topology, we counted the number of transitions between Seychelles and the rest of the world and plotted this using ggplot2 version 3.3.3 12.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      This study had some limitations. First, our import/export inferences can be influenced by sampling biases and low rate of sequencing in Seychelles. Therefore, the true number of international introductions are likely significantly higher than what is reported here. Second, incomplete metadata for some samples limited the scope of our analysis, for example, lack of location of sample collected disallowed us to investigate the transmission pathway of viruses within the country. Third, SARS-CoV-2 sequences from Seychelles are only available from a very small fraction of the number of confirmed cases into the country. These data reinforce the importance of genomic surveillance in Seychelles as a tool for monitoring and providing real-time information on spread of emerging SARS-CoV-2 variants in the population with important implications for public health and immunization strategies. Surge of COVID-19 cases due VOCs during a period of heightened COVID-19 countermeasures raises questions on the optimal timing of the introduction of public health interventions. When the interventions are introduced after a surge has started, it is often too late, and the control strategies should focus on local transmission to understand characteristics and origins of locally circulating SARS-CoV-2 diversity to prevent further spread. Moreover, studies on genomic surveillance would also be useful in investigating vaccine effectiveness against circulating variants which appear to have a high turnover...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.18.22272503
  76. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.18.22272624
    1
    1. sciscore 24 Mar 2022

      SciScore for 10.1101/2022.03.18.22272624: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      This study has several limitations. First, the sampling was not random, but rather a “snowball” recruitment. Although by weighting the data we have narrowed the error margins, it does not neutralize the selection bias completely (Pierce, McManus, et al., 2020). Second, although our cross-sectional data relies on a large sample, our longitudinal data relies on a much smaller body due to high rates of attrition. Although this might expose our study to II type errors and biases, to the best of our knowledge our study is still the first endeavor to examine so many participants over many time points in Israel. Considering the relatively small population and the limited body of current studies on COVID-19 in the country, we believe that our data shed much needed light on the situation in Israel during the first year and a half of COVID-19. Lastly, our study employed online crowdsourcing data gathering, using self-report measures with their inherent limitations (Fadnes, Taube, & Tylleskär, 2009). Still, arguably the robustness of the findings we report, replicated for different time points, cohorts and analyses, mitigates most doubts regarding generalizability of our findings. This study expands our understanding of the unique and dynamic influence of COVID-19 on the public’s mental health. Two years into this ongoing global crisis, we recognize that the mental needs and risks of the public varies at different points in time, and interacts with lockdown orders and the virus’s spread...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.18.22272624
  77. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.20.485044
    1
    1. sciscore 24 Mar 2022

      SciScore for 10.1101/2022.03.20.485044: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: SARS-CoV-2 infection in Syrian Golden Hamsters: Ethics Statement and Animal Exposure: Animal research was conducted under BIOQUAL Institute Institutional Animal Care and Use Committee (IACUC)-approved protocols, 20-152 in compliance with the Animal Welfare Act and other federal statutes and regulations relating to animals and experiments involving animals.<br>Euthanasia Agents: Prior to all blood collections, animals were anesthetized using Ketamine/Xylazine.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">siRNA dosing and SARS-CoV-2 challenge: Syrian Golden hamsters approximately 6-8 weeks of age, male (N=5-6 per group) were dosed intranasal (IN) with a luciferase siRNA (Ctl-siRNA) or COV-siRNA1+2 at Day −7, Day-14, or Day −30 prior to SARS-CoV-2 infection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After blocking in 2% milk powder/PBS for 30 min, cells were incubated with a primary antibody targeting SARS-CoV-2 nucleocapsid protein (Sino Biological) at a 1:3000 dilution for 1h followerd by incubation with a secondary AlexaFluor647-labeled antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 nucleocapsid protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed three times with PBS and then incubated for 1 hour at RT with 50 μL/well of goat anti-rabbit-Alexa647 (Thermo Fisher Scientific) secondary antibody at 1:1,000 in blocking buffer along with 1 μg/ml Hoechst 33342 (Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit-Alexa647</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Dual-luciferase assays: Cos7 cells were co-transfected with any of the reporter plasmids, and siRNAs in 384-well plates format at a density of 5×104 cells per well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cos7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 in vitro infection assay: Vero E6 cells were reverse transfected with the corresponding concentration of siRNA in a 96-well plate format using RNAiMax.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV-2 concatemeric sequences were synthesized and incorporated individually into the psiCHECK2 vector by Blue Heron Biotech [Bothell, WA].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>psiCHECK2</div><div>suggested: RRID:Addgene_40763)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The final vectors are referred to as psiCHECK2-CoV-2A, psiCHECK2-CoV-2B, and psiCHECK-negCoV2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>psiCHECK-negCoV2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The siRNAs with ≥80% target reduction relative to mock-transfected controls in both psiCHECK-CoV2 plasmids were selected for further evaluations.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>psiCHECK-CoV2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Illumina adapters were clipped using Trimmomatic.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Trimmomatic</div><div>suggested: (Trimmomatic, RRID:SCR_011848)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Read alignment to SARS-CoV-2 Wuhan-Hu-1 reference (NCBI: NC_045512.2) was performed with Burrows-Wheeler Aligner (BWA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA</div><div>suggested: (BWA, RRID:SCR_010910)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nucleotide variants were annotated with SnpEff to generate amino acid variants.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SnpEff</div><div>suggested: (SnpEff, RRID:SCR_005191)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Extensive QCs were performed at read, alignment and variant level using FastQC, samtools, picard, mosdepth, bcftools and MultiQC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FastQC</div><div>suggested: (FastQC, RRID:SCR_014583)</div></div><div style="margin-bottom:8px"><div>samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div><div style="margin-bottom:8px"><div>MultiQC</div><div>suggested: (MultiQC, RRID:SCR_014982)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The siRNA sequences directly targeting the SARS-CoV-2 genomic RNA were generated from the exemplar sequence in NCBI Genbank®.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NCBI Genbank®</div><div>suggested: (NCBI GenBank via FTP, RRID:SCR_010535)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The MAFFT application output is a multiple sequence alignment of the lineage sequences relative to the reference genome.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The multiple sequence alignment file was processed using a custom R script and the BioConductor Biostrings library to parse the FASTA alignment file and produce a table of insertions, deletions, and substitutions in the lineage sequences relative to the reference by simple pair-wise comparison of each aligned lineage sequence to the reference.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioConductor</div><div>suggested: (Bioconductor, RRID:SCR_006442)</div></div><div style="margin-bottom:8px"><div>Biostrings</div><div>suggested: (Biostrings, RRID:SCR_016949)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: Statistical analyses were performed where indicated using Prism v7.01 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      To address this limitation, we added a second siRNA (COV-siRNA2) as a two-siRNA combination and found this could prevent the emergence of escape mutants. This is consistent with prior results demonstrating that the use of multiple siRNAs to target other CoVs was more effective than a single siRNA (19). Using deep sequencing and a luciferase reporter assay, we confirmed that viral mutations observed with the single siRNA approach accumulated vRNA mismatches at key positions causing a reduction of siRNA efficacy. This finding highlighted the need to employ a multi-siRNA targeting distinct sites or combinations of orthogonal interventions to minimize the risk of viral resistance in any real-world therapeutic applications. Since late 2020, new SARS-CoV-2 variants have steadily replaced the spike D614G variant highly prevalent in the first wave of the pandemic. We performed an exhaustive in silico evaluation of current WHO VOI and VOC including those encoding the receptor binding motif N501Y spike mutation which emerged simultaneously in the variants Alpha, Beta, Gamma, Delta, and Omicron (20–22). While these variants encode substitutions across the viral genome, they possess similar mutation patterns associated with improved affinity for the ACE2, the known entry receptor for SARS-CoV-2. Favorably, the sequences targeted by COV-siRNA1+2 are located far away from the spike encoding region. Our in-silico analysis of public databases suggests no anticipated loss of activity (target ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.20.485044
  78. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.21.485157
    1
    1. sciscore 24 Mar 2022

      SciScore for 10.1101/2022.03.21.485157: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.21.485157
  79. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.18.22272601
    1
    1. sciscore 24 Mar 2022

      SciScore for 10.1101/2022.03.18.22272601: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: While written consent was obtained in most cases, for some sites the local regulators and ethics committees approved oral consent, or waiver of consent, in the context of the pandemic.<br>IRB: While written consent was obtained in most cases, for some sites the local regulators and ethics committees approved oral consent, or waiver of consent, in the context of the pandemic.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: For both groups (KDIGO and eKDIGO) time to peak AKI from hospital admission and the respective counts for each day were compared by visual inspection of histograms using the first day that a peak stage was reached.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      This study has some key limitations. The exclusion of patients without two sCr measurements may have introduced a degree of selection bias. This could be responsible for the absence of expected geographical differences found between the eKDIGO and no AKI groups and may also have resulted in an underestimation of AKI cases by both definitions [6]. The lack of a time-standardized collection of sCr across all sites also represents a limitation of the study. Patients having more frequent sCr collections may represent a population with more severe illness in whom AKI would be more readily detected, therefore affecting the overall AKI incidence rates and potentially generating a negative survival bias. Nevertheless, it is reassuring that the number of AKI cases are a small proportion of the total sCr collected on any given day (<18%) (S2 Fig), suggesting that the bias introduced by ad hoc sampling was low. The lack of standardization in sCr collection may have also affected the reporting of time to peak AKI, the magnitude of peak AKI reached in each individual patient and, in those experiencing both a rise and fall in sCr during their admission, whether AKI was captured during the former phase (KDIGO) or the latter (eKDIGO). With regards to the distinction between community and hospital acquired AKI, often a 48 hr threshold is used to identify CA-AKI [28]. Such a definition would preclude many patients in this study who were identified as having AKI on day 3 of admission. It is wor...

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04851782</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Effects of ivAED™ Device on "Air-in-line" Alarms and Workflo…</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.18.22272601
  80. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.18.484953
    1
    1. sciscore 24 Mar 2022

      SciScore for 10.1101/2022.03.18.484953: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-human IgG peroxidase antibody produced in goat (Sigma A6029) was used at a 1:5,000 dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-human IgG</div><div>suggested: (Sigma-Aldrich Cat# A6029, RRID:AB_258272)</div></div><div style="margin-bottom:8px"><div>Anti-human IgG peroxidase antibody</div><div>suggested: (Sigma-Aldrich Cat# A6029, RRID:AB_258272)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Titers, LOD, and LOQ were calibrated to the WHO International Reference Panel for anti-SARS-CoV-2 spike, RBD, and nucleocapsid binding antibody units per milliliter (WHO BAU/mL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-human IgG peroxidase antibody produced in goat (Sigma A6029) was used at a 1:5,000 dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-human IgG</div><div>suggested: (Sigma-Aldrich Cat# A6029, RRID:AB_258272)</div></div><div style="margin-bottom:8px"><div>Anti-human IgG peroxidase antibody</div><div>suggested: (Sigma-Aldrich Cat# A6029, RRID:AB_258272)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, cells were incubated at 37°C for 24 hours in the presence of fluorescently labeled chemokine receptor antibodies (anti-CCR6, CXCR5, CXCR3, and CCR7) and the Spike MP (1 μg/ml) in 96-wells U-bottom plates, as previously described (Mateus et al., 2021; Rydyznski Moderbacher et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CCR6</div><div>suggested: (Biotrend Cat# PSI2021(A, RRID:AB_2072795)</div></div><div style="margin-bottom:8px"><div>CXCR5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CXCR3</div><div>suggested: (Thermo Fisher Scientific Cat# 61-1831-80, RRID:AB_2802384)</div></div><div style="margin-bottom:8px"><div>CCR7</div><div>suggested: (Thermo Fisher Scientific Cat# 13-1979-80, RRID:AB_1963563)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 2.5×104 VERO cells (ATCC, Cat. No. CCL-81) were seeded in clear flat-bottom 96-well plates (Thermo Scientific, Cat.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VERO</div><div>suggested: ATCC Cat# CCL-81, RRID:CVCL_0059)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant SARS-CoV-2-S-D614G pseudotyped VSV-ΔG-GFP were generated by transfecting HEK293T cells (ATCC, Cat. No. CRL-321) with plasmid phCMV3-SARS-CoV2-Spike kindly provided by Dr. E. Saphire and then infecting with VSV-ΔG-GFP.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant SARS-CoV-2-S-D614G pseudotyped VSV-ΔG-GFP were generated by transfecting HEK293T cells (ATCC, Cat. No. CRL-321) with plasmid phCMV3-SARS-CoV2-Spike kindly provided by Dr. E. Saphire and then infecting with VSV-ΔG-GFP.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>phCMV3-SARS-CoV2-Spike</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization titers or inhibition dose 50 (ID50) were calculated using the One-Site Fit Log IC50 model in Prism 9.3 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, a Boolean analysis was performed to define the multifunctional profiles on FlowJo 10.8.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Limit of detection was calculated as median + 2x standard deviation (SD) of [1/(number of total B cells recorded)] Correlation and principal component analysis (PCA): Correlograms plotting the Spearman rank correlation coefficient (r) between all paired parameters were created with the corrplot package (v0.84) running in Rstudio (1.1.456) as previously described (Rydyznski Moderbacher et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Rstudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed in GraphPad Prism 9.3.0, unless otherwise stated.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      COVID-19 vaccines have achieved extraordinary success in protection from infection and disease; yet some limitations exist, including differences in VE between vaccines and waning of protection against infection over a period of several months. Here, diverse metrics of adaptive responses were measured to mRNA-1273, BNT162b2, Ad26.COV2.S and NVX-CoV2373, with implications for understanding the protection against COVID-19 associated with each of the vaccines. A strength of this study is that the samples from different vaccine platforms were obtained from the same blood processing facility, from the same geographical location, and were analyzed concomitantly, utilizing the same experimental platform. In the present study, antibody responses were detected in 100% of individuals. At 6 months post-immunization, the neutralizing antibody titer hierarchy between the vaccines was mRNA-1273~BNT162b2~NVX-CoV2373>Ad26.COV2.S. These serological data are consistent with previous reports for single vaccines (Atmar et al., 2022; Doria-Rose et al., 2021; Goel et al., 2021; Naranbhai et al., 2021a; Pajon et al., 2022; Pegu et al., 2021), and serological comparisons between vaccines (Barouch et al., 2021; Carreno et al., 2022; Naranbhai et al., 2021b; Self et al., 2021), though in much large serological studies ~2-fold higher neutralizing antibody titers were discerned with mRNA-1273 compared to BNT162b2 (Atmar et al., 2022; Steensels et al., 2021). Comparisons of NVX-CoV2373 antibody responses...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.18.484953
  81. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.20.22272676
    1
    1. sciscore 24 Mar 2022

      SciScore for 10.1101/2022.03.20.22272676: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Boolean operators technique used for Pubmed/Medline search with (“COVID-19” or “2019-nCoV” or “SARS-CoV” or SARSCOV2 or 2019-nCov or “2019 coronavirus” or covid19) AND (gynecology or gynaecology) AND (tumor or malignancy or cancer) AND (outcomes or outcome) AND (gyn* tum* or gyn *malign* or gyn* cancer) AND (cancer surgery or oncolog* surger*) AND (brachytherapy or radiotherapy).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pubmed/Medline</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used “Gynecologic cancer AND Covid-19” with Google Scholar, Science Direct, and medRxiv.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Google Scholar</div><div>suggested: (Google Scholar, RRID:SCR_008878)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Findings were accumulated and stored in Mendeley and Zotero for management and automated duplicate identification.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Mendeley</div><div>suggested: (Mendeley Data, RRID:SCR_002750)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data Extraction and Quality Assessment: Two authors (YT & AET) extracted data independently and stored them in The Microsoft Excel spreadsheet.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data Analysis & Synthesis: We performed data analysis mainly using Review Manager 5.4.1 (RevMan 5.4.1) by Cochrane collaboration.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Review Manager</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>RevMan</div><div>suggested: (RevMan, RRID:SCR_003581)</div></div><div style="margin-bottom:8px"><div>Cochrane</div><div>suggested: (Cochrane Library, RRID:SCR_013000)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.20.22272676
  82. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.18.22272607
    1
    1. sciscore 24 Mar 2022

      SciScore for 10.1101/2022.03.18.22272607: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Patient Population and Study Design: Recruitment was by response to advertisement or specialist referral to two non-acute sites (Perspectum, Oxford and Mayo Clinic Healthcare, London) from April 2020 to August 2021, based on prior SARS-CoV-2 infection and written informed consent.<br>IRB: Ethical Approval: The protocol was approved by a UK ethics committee (20/SC/0185) and registered (https://clinicaltrials.gov/ct2/show/NCT04369807).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: HRQoL was assessed by validated EQ-5D-5L (EuroQOL), comprising: (1) five health dimensions (mobility, self-care, usual activities, pain and discomfort, and anxiety and depression) each at five severity levels (none, slight, moderate, severe, and extreme); (2) self-rated health using visual analogue scale (VAS) from 0 (worst imaginable) to 100 (best imaginable); (3) derived EQ-5D ‘utility’ or index score from 0 (‘dead’) to 1 (‘full health’)10.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Patient Population and Study Design: Recruitment was by response to advertisement or specialist referral to two non-acute sites (Perspectum, Oxford and Mayo Clinic Healthcare, London) from April 2020 to August 2021, based on prior SARS-CoV-2 infection and written informed consent.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Clinic Healthcare</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Participants underwent a 40-minute MRI scan of lungs, heart, kidney, liver, pancreas and spleen on 1.5T or 3T Siemens scanners at three imaging sites (Oxford: MAGNETOM Aera 1.5T, Mayo Healthcare London: MAGNETOM Vida 3T</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Mayo Healthcare</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Vida</div><div>suggested: (VIDA, RRID:SCR_007111)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Strengths and Limitations: To date, this is the largest, comprehensive, systematic, multi-organ, post-COVID study over 1 year. The study cohort is representative of UK Long COVID populations in terms of risk factors and acute COVID-19 hospitalisation8,9. There are limitations. We did not have history and imaging prior to the pandemic and so it is difficult to determine if COVID-19/Long Covid caused impairment. There was no assessment of brain function. Not all participants had a laboratory-confirmed COVID-19 diagnosis. 38% of participants were not followed up. Generalizability of results from the UK’s first COVID-wave to the global population requires further exploration. We successfully delivered multi-organ MRI to assess organ health, but clinical utility remains to be determined. Health utilisation (e.g. primary care interactions) and economic burden of Long COVID were not assessed. Time off work was not assessed at baseline when the UK was in lockdown with a national furlough scheme in operation. Patients with normal assessment at baseline were not followed up due to resource and funding constraints. Therefore, whilst 222/536 (41%) patients at baseline were defined as normal after assessment, we cannot say they had better outcomes. Nevertheless, we can model cost-saving of a single assessment versus multiple assessments to achieve a discharge decision.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04369807</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Mapping Organ Health Following COVID-19 Disease Due to SARS-…</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.18.22272607
  83. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.18.484436
    1
    1. sciscore 23 Mar 2022

      SciScore for 10.1101/2022.03.18.484436: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.18.484436
  84. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.18.22272605
    1
    1. sciscore 23 Mar 2022

      SciScore for 10.1101/2022.03.18.22272605: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Students provided informed consent for the data collected by questionnaires.<br>IRB: The study was carried out in accordance with the Declaration of Helsinki and was deemed exempt from review after evaluation by the Medical Ethics Committee of Erasmus MC Rotterdam (MEC-2019-0448).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Gender is categorized as male or female.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Further, a limitation of the present study is the lower response-rate for cohort 2019. This was possibly due to the COVID-19 outbreak, which resulted in a fully online data collection instead of a combination of data collection in class and online. Even though we were able to control for student characteristics in the analyses, a bias may still be present due to this lower response-rate. The present study focused on Year-1 students, and this appears to be a relevant group since students in early stages of medical and dental school seem susceptible to the negative impact of the COVID-19 outbreak [19, 50]. Whether the results described in the present study will be similar for students in advanced stages of medical school needs to be further investigated. This also applies to the generalizability of the results to students from other schools, since the relation between social support and perceived stress may be different for medical students compared to students from other schools due to the higher prevalence of mental distress in medical students compared to their age-matched peers [1, 2]. Even though medical schools are not able to change the current COVID-19 crisis or any future crisis, they can help students get through it. Our findings suggest that in times of crisis medical students’ wellbeing can benefit from social support. With the COVID-19 pandemic still not being over and potential new lockdowns are possible, medical schools could play a more active role themselves by...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.18.22272605
  85. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.18.22272631
    1
    1. sciscore 23 Mar 2022

      SciScore for 10.1101/2022.03.18.22272631: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The project was reviewed and approved by the Washington University in St. Louis Institutional Review Board and conducted consistent with applicable federal law and U.S. Centers for Disease Control and Prevention (CDC) policy (<br>Field Sample Permit: Specimens were tested for SARS-CoV-2 by real-time reverse transcription polymerase chain reaction (RT-PCR) as previously described.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All contact tracing data from school officials were collected in Microsoft Excel and entered into a REDCap database (hosted by Washington University in St.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      There are several limitations to this report. First, school contact tracing may have not identified all persons exposed to someone with COVID-19 in a school setting. Second, we did not test all identified contacts for SARS-CoV-2 following exposure, and therefore the observed number and incidence of school-based SARS-CoV-2 infections is possibly an underestimation. However, positive test results outside of the enhanced investigation were reported to school officials and we projected the number of asymptomatic infections among those without test results to minimize underestimation. Third, due to low variability in school-level prevention strategies and the low number of identified school-based transmission events, analyses of the effect of specific prevention strategies on SARS-CoV-2 transmission were underpowered. Fourth, sequencing data and interview data were not available for all identified school index case-positive contact pairs, and in these instances, all persons who received a positive test result during the 14-day window were presumed to have been infected in school. For the six contacts with a positive test result who had paired sequencing data, it was determined that two (33%) were not infected from their school-based index case; it is possible that if sequencing data were available, school-based transmission may have been ruled out for some of the other contacts with a positive test result. Public Health Implications: In this two-month investigation of SARS-CoV-2 t...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.18.22272631
  86. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.18.22272553
    1
    1. sciscore 23 Mar 2022

      SciScore for 10.1101/2022.03.18.22272553: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the Institutional Review Board at BMC (8).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Abbott anti-s IgG (quant) assay became available after the initial time point and bio-banked serum samples were used to examine serum antibody concentrations for the prior timepoints.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-s IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Questionnaires were collected and managed in REDCap electronic data capture tools hosted at Boston University, CTSI 1UL1TR001430 (6,7).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples from all timepoints were analyzed for SARS-CoV-2 anti-spike-1 RBD IgG II (quantitative) and anti-nucleoprotein IgG (qualitative) in the clinical pathology laboratory at BMC using the Abbott Architect i2000sr, using IgG II (quantitative) and IgG (qualitative) assays, respectively (Abbott Laboratories, Abbott Park, IL) following manufacturer’s specifications.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott Architect</div><div>suggested: (Abbott ARCHITECT i1000sr System, RRID:SCR_019328)</div></div><div style="margin-bottom:8px"><div>Abbott Laboratories</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were run using Statistical Analysis Software version 9.4 (SAS Institute, Cary, NC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Statistical Analysis</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.18.22272553
  87. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.21.485084
    1
    1. sciscore 23 Mar 2022

      SciScore for 10.1101/2022.03.21.485084: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The primary antibodies used were mouse anti-SARS-CoV-2 S2 domain (1:1000, GTX632604, GeneTex, Irvine, CA, USA), rabbit anti-Flag-tag (1:1000, PM020, MBL, Woburn, MA, USA), mouse anti-tubulin (1:1000, CP06, Millipore, Billerica, MA, USA), and mouse anti-VSVM (1:1000, 23H12, absolute antibody, Oxford, UK).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 S2 domain</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Flag-tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-tubulin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CP06</div><div>suggested: (Millipore Cat# CP06, RRID:AB_2617116)</div></div><div style="margin-bottom:8px"><div>anti-VSVM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The secondary antibodies used were horseradish peroxidase (HRP)-linked donkey anti-rabbit IgG (NA934; GE Healthcare) and HRP-linked donkey anti-mouse IgG (NA931V; GE Healthcare).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HRP)-linked donkey anti-rabbit IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HRP-linked donkey anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 24 h infection, fixed cells were incubated with anti-SARS-CoV-2 nucleocapsid (1:1000, GTX135357) primary antibody for 16 h at 4 °C and detected with anti-rabbit-Alexa488 (1:200, A11008, Invitrogen, Carlsbad, CA, USA) secondary antibodies for 40 min at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 nucleocapsid (1:1000</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit-Alexa488</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A11008</div><div>suggested: (Molecular Probes Cat# A-11008, RRID:AB_143165)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and viruses: VeroE6 (CRL-1586), 293T (CRL-3216), A704 (HTB-45) and Calu-3 (HTB-55) cells were obtained from American Type Culture Collection (Rockville, MD, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: ATCC Cat# HTB-55, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Caco-2 cells (RCB0988) were obtained from RIKEN BioResource Research Center (Tsukuba, Japan).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunofluorescence staining: Immunofluorescence analysis of HEC50B cells was performed as described previously [21].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEC50B</div><div>suggested: JCRB Cat# NIHS0391, RRID:CVCL_2929)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">OVISE (JCRB1043), HEC50B (JCRB1145), and VeroE6-TMPRSS2 (JCRB 1819) cells were obtained from the Japanese Collection of Research Bioresources Cell Bank (Osaka, Japan).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-TMPRSS2 (JCRB 1819</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VeroE6-TMPRSS2 (JCRB 1819) cells were cultured in DMEM containing 10% FBS and 1 mg/mL G418.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Caco-2 cells (RCB0988) were obtained from RIKEN BioResource Research Center (Tsukuba, Japan).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RIKEN BioResource</div><div>suggested: (RIKEN BioResource Center, RRID:SCR_003250)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.21.485084
  88. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.18.484814
    1
    1. sciscore 23 Mar 2022

      SciScore for 10.1101/2022.03.18.484814: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, all collected plasma and saliva samples were tested for SARS-CoV-2 specific antibodies by enzyme-linked immunosorbent assay (ELISA) and pseudovirus neutralization assay (Fig. 2 and Suppl.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 4X washing, 100 μL of 1:5000 diluted Goat anti-human secondary antibody was added into each well and incubated at 37°C for 1 hr (Goat Anti-Human IgG ɣ Chain Specific HRP conjugated, species Adsorbed (Human IgM, IgD and IgA) Polyclonal Antibody for IgG (Cat# AP504P, EMD Millipore, Burlington, MA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgA</div><div>suggested: (Millipore Cat# AP504P, RRID:AB_805350)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Goat Anti-Human IgA, a-chain specific Peroxidase conjugate for IgA (Cat# 401132-2ML, Calbiochem, San Diego, CA) for IgA, and Goat Anti-Human IgM Fc5µ Fragment specific HRP conjugated secondary antibody for IgM (Cat# AP114P</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Goat Anti-Human IgA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-Human IgA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-Human IgM</div><div>suggested: (Millipore Cat# AP114P, RRID:AB_92449)</div></div><div style="margin-bottom:8px"><div>IgM</div><div>suggested: (Millipore Cat# AP114P, RRID:AB_92449)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells were transfected with pCAGGS.S (30 μg for a T75 flask) using Lipofectamine 3000 (Invitrogen, L3000015) following the manufacturer’s instruction.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, Vero cells were seeded at a density of 2.5 × 104/50 μL in a Greiner Bio-One™ CellStar™ μClear™ 96-Well, Cell Culture-Treated, Flat-Bottom, Half-Area Microplate (Thermo Fisher Scientific, Waltham, MA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: RRID:CVCL_ZW93)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of pseudo-virus (rVSV-GFPΔG*Spike): For pseudoviruses construction, spike genes from strain Wuhan-Hu-1 (GenBank: MN908947) were codon-optimized for human cells and cloned into eukaryotic expression plasmid pCAGGS to generate the envelope recombinant plasmids pCAGGS.S as described previously with slight modifications 73.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_127347)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells were transfected with pCAGGS.S (30 μg for a T75 flask) using Lipofectamine 3000 (Invitrogen, L3000015) following the manufacturer’s instruction.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS.S</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Positive response was determined by the area under the curve (AUC) using GraphPad Prism version 8.3.1 (GraphPad Software, Inc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The neutralizing activity of the plasma sample was determined as pNT50 calculated from a transformed non-linear regression curve generated by GraphPad Prism version 8.3.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Significantly enriched proteins in convalescent samples (p<0.05)(Table 2) were subjected to the network analysis by STRING enrichment analysis (Cytoscape software v</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STRING</div><div>suggested: (STRING, RRID:SCR_005223)</div></div><div style="margin-bottom:8px"><div>Cytoscape</div><div>suggested: (Cytoscape, RRID:SCR_003032)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The heatmap was created using the pheatmap package in R using hierarchical distance matrix and clustering option 80.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pheatmap</div><div>suggested: (pheatmap, RRID:SCR_016418)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Correlation among different parameters (antibody titers, proteomic marker expression levels, categorized demographic information, and salivary protein subgrouping) was evaluated by both Pearson’s R and simple linear regression analyses using Graphpad Prism-8 suites of software (GraphPad Software, Inc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pearson’s</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Limitation of our study consists of selection bias of donors enrolled in our study with inclusion criteria that considered most donors that had SARS-CoV-2 RT-qPCR-positive results and not healthy donors. The control population came from a pre-COVID era, and did not include an RT-qPCR, but attempted to match most of the demographics. Since our analysis was based on convalescent samples passively collected from persons with COVID-19 in the recovery phase, our study result does not directly reflect responses during the active disease phase of the viral infection. Some parameters, such as RBD binding IgG responses, seem to be already waned and did not display significant differences from healthy. While we could detect unresolved inflammatory status lagged from the acute phase of COVID-19, our study setting was not optimal to elucidate innate immunopathogenesis. As our data set was missing critical information, such as viral load, we cannot fully exclude the confounding factors that could possibly impact the antibody and proteomic alterations. Also, the samples were collected at only a one-time point, and antibody levels or proteomic responses were not adjusted by the different baseline of each individual and it was not possible to draw predictive conclusions on our findings but instead correlations. Most importantly, this is our cross-sectional study investigating one time point comparing health vesus disease and saliva versus plasma.Future longitudinal studies should investigate...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.18.484814
  89. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.20.485050
    1
    1. sciscore 23 Mar 2022

      SciScore for 10.1101/2022.03.20.485050: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Five square fields with an area of 1×10−6 μm were randomly placed on each imaged.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">The person performing the analysis were blinded to the experimental design and tracer used.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-ACE2 antibody (R&D Systems, Cat# AF933) was labeled with Alexa Fluor 488 by following the manufacturer instructions (Microscale protein labeling kit; ThermoFisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-ACE2</div><div>suggested: (Millipore Cat# AB9896, RRID:AB_805247)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These include, anti ACE2 antibody (R&D Systems, Cat# AF933) used at a low (10 μg/m)l and high (60 μg/ml) concentration; anti TMPRSSE2 antibody (Invitrogen, Cat# PA5-14264) used at 13 μg/ml; anti CD147 antibody (Invitrogen, Cat# 34-5600) used at 2.5 μg/ml; anti NP-1antibody (Invitrogen, Cat# PA5-47027) used at 2 μg/ml and anti GM1 antibody (Abcam, Cat# Ab23943) used at 5 μg/ml.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti ACE2</div><div>suggested: (Acris Antibodies Cat# BP2275, RRID:AB_972872)</div></div><div style="margin-bottom:8px"><div>anti TMPRSSE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti CD147</div><div>suggested: (Acris Antibodies Cat# SM2094P, RRID:AB_975010)</div></div><div style="margin-bottom:8px"><div>anti NP-1antibody</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti GM1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The secondary antibodies, which were conjugated to Alexa Fluor 488, were donkey anti-rabbit (Thermofisher Scientific #A32790), anti-goat (Thermofisher Scientific #A32814) and anti-mouse (Thermofisher Scientific #A32766), and used at 1:200 dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (Thermo Fisher Scientific Cat# A32790, RRID:AB_2762833)</div></div><div style="margin-bottom:8px"><div>anti-goat</div><div>suggested: (Thermo Fisher Scientific Cat# A32814, RRID:AB_2762838)</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Thermo Fisher Scientific Cat# A32766, RRID:AB_2762823)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 Spike proteins (recombinant SARS-CoV-2 Spike Protein (SP-RBD, Arg319-Phe 541; cat# RP-87678, HEK293 cell expressed and binds ACE2) was obtained from Life Technologies Corporation, Carlsbad CA, USA. Mutants SPs and its control wild type protein were obtained from RayBiotech Inc, Peachtree Corners, GA, USA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All SPs were labeled separately with Alexa Fluor 555, using a kit (Microscale protein labeling kit; ThermoFisher Scientific; Waltham, MA, USA) and by following the manufacturer instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher Scientific</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistic: All analysis were performed using Graphpad Prims version 9.2.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Outliers were identified and removed using ROUT method with Q= 10% in GraphPad Prism version 9.2.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Limitations of the study: Since RBD of the SPs were used as a model of SARS-CoV-2, uptake of the actual virus might be different. However, the SP of SARS-CoV-2 is essential for viral entry into host cells. Thus, the attachment part of the viral life cycle can be explored with the SP. Also other cell types of the neurovascular unit, such as astrocytes, microglia and neurons need to be explored for SP uptake mechanisms. However, it is likely that there will be similar mechanisms since these cell types also express ACE2 and have glycans, including GM1.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.20.485050
  90. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.21.22272687
    1
    1. sciscore 23 Mar 2022

      SciScore for 10.1101/2022.03.21.22272687: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Limitations: This study had important limitations, especially regarding uncertainty in key inputs such as the viral kinetics of SARS-CoV-2 and sensitivity of antigen tests. First, we distributed Reff over the 10 days following COVID-19 confirmation, but a portion of transmissions occur prior to the index case learning their COVID-19 status and entering isolation. As such, we have overestimated the number of secondary infections in our model and underestimated ICER values. Decreasing the residual R would increase ICERs but given favorable ICERs even in the low-risk scenario, we believe the implications of our findings would not be affected. More importantly, given the novelty of the Omicron variant, we had to rely on studies of prior variants for these two important factors. While variance in neither of these inputs changed cost-effectiveness results qualitatively, they did have an impact on the number of further transmissions after isolation and thus the level of cost-effectiveness. Additional studies on the viral kinetics of the Omicron variant are necessary to refine these estimates.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.21.22272687
  91. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.18.22272462
    1
    1. sciscore 23 Mar 2022

      SciScore for 10.1101/2022.03.18.22272462: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 Spike Glycoprotein (Full-Length) expressed in CHO cells from Native Antigen, Synthetic Sputum from LGC and PolyQuant Cov-MS from PolyQuant were received as part of the Covid Moonshot Consortium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO</div><div>suggested: CLS Cat# 603479/p746_CHO, RRID:CVCL_0213)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MaxQuant 1.6.10.43 was used for peptide and protein identification [20] using UniprotKB/Swissprot databases for Homo Sapiens containing 42437 sequences downloaded on September 2020 and a combined viral database SARS and influenza viruses including the SARS-Cov-2 virus sequences.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UniprotKB/Swissprot</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.18.22272462
  92. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.19.22272532
    1
    1. sciscore 23 Mar 2022

      SciScore for 10.1101/2022.03.19.22272532: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the Local Ethics Committee of the Canton of Zurich, Switzerland (Kantonale Ethikkommission Zurich BASEC ID 2020-00646) in accordance with the provisions of the Declaration of Helsinki and the Good Clinical Practice guidelines of the International Conference on Harmonisation.<br>Field Sample Permit: Sample Collection, Processing and Testing (Virus Diagnostics): SARS-CoV-2 was detected by real-time RT-PCR as previously described [15].</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bead coating was assessed using mouse monoclonal antibodies against IFNα2, IFNβ or IFNω (anti-IFNα2: Novusbio</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IFNα2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sample Processing and Testing (IFN-Neutralizing Antibodies): 2.4 × 104 human embryonic kidney HEK293T cells (ATCC CRL-3216) per well in 96-well plates were reverse-transfected with 30ng of a plasmid containing the firefly luciferase (FF-Luc) gene under control of the IFN-inducible mouse Mx1 promoter (pGL3-Mx1P-FFluc) (kindly provided by Georg Kochs), together with 4ng of a control plasmid expressing Renilla luciferase (Ren-Luc) under a constitutively active promoter (pRL-TK-Renilla).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IFN-Neutralizing</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Antibodies)</div><div>suggested: (BioVision Cat# 3754-100, RRID:AB_2192485)</div></div><div style="margin-bottom:8px"><div>Mx1 promoter ( pGL3-Mx1P-FFluc )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analyses: The association of anti-IFN autoantibodies and herpesvirus reactivations, with the additional analyses of only CMV or HSV-1/2 reactivation, was examined using logistic regression models.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IFN</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sample Processing and Testing (IFN-Neutralizing Antibodies): 2.4 × 104 human embryonic kidney HEK293T cells (ATCC CRL-3216) per well in 96-well plates were reverse-transfected with 30ng of a plasmid containing the firefly luciferase (FF-Luc) gene under control of the IFN-inducible mouse Mx1 promoter (pGL3-Mx1P-FFluc) (kindly provided by Georg Kochs), together with 4ng of a control plasmid expressing Renilla luciferase (Ren-Luc) under a constitutively active promoter (pRL-TK-Renilla).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sample Processing and Testing (IFN-Neutralizing Antibodies): 2.4 × 104 human embryonic kidney HEK293T cells (ATCC CRL-3216) per well in 96-well plates were reverse-transfected with 30ng of a plasmid containing the firefly luciferase (FF-Luc) gene under control of the IFN-inducible mouse Mx1 promoter (pGL3-Mx1P-FFluc) (kindly provided by Georg Kochs), together with 4ng of a control plasmid expressing Renilla luciferase (Ren-Luc) under a constitutively active promoter (pRL-TK-Renilla).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pGL3-Mx1P-FFluc</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pRL-TK-Renilla</div><div>suggested: RRID:Addgene_123656)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data Collection and Covariates: Clinical and laboratory data were obtained as previously described [15].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Covariates</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SPSS Science, Chicago, IL, USA) and Stata 16 (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      A clear limitation of our study is the low patient sample size in our cohort and single-center study design, that did not provide us with sufficient statistical power to allow detection of small differences in clinical outcomes. This could be improved in future studies with higher participant numbers, and in studies with a pre-defined systematic sampling procedure for the detection of herpesvirus reactivations. Moreover, studies should perhaps investigate associations between the amount of reactivated herpesvirus load, the magnitude of IFN system suppression by anti-IFN autoantibodies, immunomodulation induced by clinicians, and multiple relevant patient outcomes (e.g. length of stay in ICU, length of stay in hospital, duration of mechanical ventilation, duration of ARDS, and mortality). We also acknowledge that our study is limited by the inability to assess levels of anti-IFN autoantibodies in patients prior to SARS-CoV-2 infection. Thus, we can currently only speculate that an immunodeficient state was pre-existing in certain patients and exacerbated COVID-19 severity and the likelihood of herpesvirus reactivations. In conclusion, detection of anti-IFN autoantibodies that bind and neutralize the antiviral type I IFNs can be performed relatively easily and rapidly, and could be used in future diagnostic efforts to understand the underlying causes of severe disease in both COVID-19 and other infectious disease manifestations [32]. While there are currently no specific therap...

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04410263</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Microbiota in COVID-19 Patients for Future Therapeutic and P…</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.19.22272532
  93. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.18.484178
    1
    1. sciscore 23 Mar 2022

      SciScore for 10.1101/2022.03.18.484178: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Cells were maintained in a humidified incubator with 5% CO2 at 37°C and were tested negative for mycoplasma. 2.2. Compounds: The following reagents were used: (5Z)-7-oxozeaenol (Cayman Chemical), sunitinib malate, (Selleckchem), erlotinib (LC Laboratories), gefitinib (Selleckchem), baricitinib (a gift from Dr. Chris Liang), SGC-GAK-1 and STK16-IN-1 (MedChemExpress).</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK-293T (ATCC) cells were grown in DMEM supplemented with 10% FCS, 1%L-glutamine, and 1% Pen-strep.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, Vero E6 cells were transfected using Lipofectamine 2000 (Thermo Fisher) with 4 mg/well of pBeloBAC11-SARS-CoV-2/WT or – Nluc-2A.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">P1 virus was passaged twice in Vero E6-TMPRSS2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Twenty-four hours later, culture supernatant was harvested, clarified by centrifugation, filtered (0.22 μm) and stored at −80°C. rVSV-SARS-CoV-2-S was titrated on Vero cells via luciferase assay, and TCID50 was determined.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Entry assays: Calu-3 cells were infected with WT rSARS-CoV-2/WT (MOI=1) or a high inoculum of rVSV-GP SARS-CoV-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: KCLB Cat# 30055, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293 cells were transiently transfected with the NanoLuc® Fusion DNA and incubated at 37°C. 20 hours post-transfection, NanoBRET™ tracer reagent and RMC-242 were added to the cells and incubated at 37°C for 2 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, Vero E6 cells were transfected using Lipofectamine 2000 (Thermo Fisher) with 4 mg/well of pBeloBAC11-SARS-CoV-2/WT or – Nluc-2A.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBeloBAC11-SARS-CoV-2/WT</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Kinase abundance was quantified label-free using MaxQuant software. 2.16.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MaxQuant</div><div>suggested: (MaxQuant, RRID:SCR_014485)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: All data were analyzed with GraphPad Prism software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Our findings suggest that the benefit demonstrated with baricitinib clinically likely does not result from its predicted anti-NAK effect and point out a limitation of the artificial intelligence approach for drug discovery in predicting antiviral activity. Lastly, we show that combining compounds with anti-AAK1/BIKE and anti-GAK activities may provide a synergistic antiviral effect against SARS-CoV-2 in vitro. This finding is in agreement with our prior data with sunitinib/erlotinib combinations in HCV, DENV, and EBOV in vitro (Neveu et al., 2015; Bekerman et al., 2017) and the finding that their combination protected 85% and 50% of mice from DENV and EBOV challenges, respectively (Bekerman et al., 2017; Pu et al., 2018). AAK1/BIKE and GAK have partially overlapping functions (Zhang et al., 2005; Neveu et al., 2015; Pu et al., 2020), which may explain moderate or no antiviral effect with drug alone, yet synergistic activity upon treatment with sunitinib/erlotinib combinations. The observed synergistic effect may also result from inhibition of additional targets by these drugs. In summary, these findings validate NAKs as candidate druggable targets for antiviral therapy against SARS-CoV-2 infection and provide a proof of concept that anti-NAKs approaches may have a utility for treating SARS-CoV-2 and possibly other coronavirus infections.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.18.484178
  94. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.18.484954
    1
    1. sciscore 23 Mar 2022

      SciScore for 10.1101/2022.03.18.484954: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Each downloaded genome was aligned to reference using MAFFT (52).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      A key limitation of this study is that our analysis is built upon predictions of peptide binding to HLA-I and HLA-II molecules, which is known to be necessary but not sufficient, for T-cell recognition. Not all predicted binders are likely to be T-cell epitopes, and thus not all changes in HLA binding prediction are guaranteed to lead to epitope loss. We aimed to minimize this disparity with our approach to integrating predictions across peptides, lengths, and HLAs; and by focusing on relative change at hotspots of potential epitopes. But ultimately there are unmodeled factors between HLA presentation and T-cell response, and an additional layer of predictive tools trained directly for the task may be necessary to improve precision in the future. A secondary limitation to the analyses presented herein is that our conclusions are based around a representative set of HLAs selected to cover the most general picture of the world population (and be inclusive of any minority but distinctly functioning HLA groups). Thus conclusions may vary if the analysis were to be repeated with a different HLA set, for example one specific to a population or region. We also encountered very sparse coverage in population statistics of HLA-II alpha-beta haplotypes. To overcome this, we selected our HLA-II set based on all individual alpha and beta chain frequencies and considered all permutations, and may have incurred a risk of overrepresenting the impact of some alleles. Finally, it is important ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.18.484954
  95. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.20.485024
    1
    1. sciscore 23 Mar 2022

      SciScore for 10.1101/2022.03.20.485024: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were successively stained for 30 minutes on ice with the cocktail of fluorescently conjugated antibodies in 200 μl staining buffer (1X PBS + 2% FBS): 2 μg/ml biotinylated-RBD-Streptavidin-PE and FITC-anti-human IgG antibody (Biolegend, clone: M1310G05) and DAPI.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FITC-anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells were seeded in a T-75 flask at a density of 4.5×106 cells/flask/15ml media.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For pseudovirus-based neutralization assay, HEK293 cells stably expressing ACE-2 receptor (HEK293-ACE2) were plated into a tissue culture treated opaque white 96-well microplate in complete medium at a density of 5000 cells/well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody and pseudovirus suspension was then added to the HEK293-ACE2 cells and 10μl of 50μg/ml (10X) of polybrene to the cells (5μg/ml final concentration).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The next day plasmid DNA was diluted in 500μl OptiMEM at a ratio of Transfer vector (CMV-GFP-T2A-Luciferase, BLIV101PA-1, System-bio)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CMV-GFP-T2A-Luciferase</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples showing the correct size band for heavy and light chain amplification in the respective wells were subsequently cloned into pAb20-hCHIgG1 (Synbio; for heavy chain) and pAb20-hCK (Synbio; for light chains) through in-fusion cloning (Takara).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pAb20-hCHIgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">24 hours later, pAb20-hCHIgG1 and pAb20-hCK plasmids separately expressing heavy and light chain of antibodies were transiently cotransfected into Freestyle-293F cells (R79007; Thermo Fisher) using purefection reagent (LV750A-1; System Bio) followed by manufacturer protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pAb20-hCK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">viral packaging (psPAX2): viral envelope (pMD2G) or Sars-CoV-2 envelope (pMT1-SARS-CoV-2-S, custom gene synthesis; Synbio) at 4:2:1 ratio (6:3:1.5ug, respectively).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMD2G</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pMT1-SARS-CoV-2-S</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lastly, the half-maximal inhibitory concentrations (IC50) were measured using the four-parameter logistic regression in GraphPad Prism 8.0. 2.7 Statistical analysis: All grouped data are expressed as the mean ± standard deviation (SD) of a demonstrative experiment executed at least in triplicate, and almost similar data were obtained in at least three independent experiments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.20.485024
  96. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.18.484950
    1
    1. sciscore 23 Mar 2022

      SciScore for 10.1101/2022.03.18.484950: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animal subjects and experimentation: Twenty one male rhesus macaques (Macaca mulatta) of Indian origin, aged 5 – 15 years, including 11 animals from the previous study(Arunachalam et al., 2021) were housed and maintained as per National Institutes of Health (NIH) guidelines at the New Iberia Research Center (NIRC) of the University of Louisiana at Lafayette in accordance with the rules and regulations of the Committee on the Care and Use of Laboratory Animal Resources.<br>Field Sample Permit: For the challenge, the animals were transferred to the Regional Biosafety Level 3 facility at the Tulane National Primate Research Center, where the study was reviewed and approved by the Tulane University IACUC (protocol 3930)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animal subjects and experimentation: Twenty one male rhesus macaques (Macaca mulatta) of Indian origin, aged 5 – 15 years, including 11 animals from the previous study(Arunachalam et al., 2021) were housed and maintained as per National Institutes of Health (NIH) guidelines at the New Iberia Research Center (NIRC) of the University of Louisiana at Lafayette in accordance with the rules and regulations of the Committee on the Care and Use of Laboratory Animal Resources.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were incubated with an anti-SARS-CoV spike primary antibody directly conjugated to Alexaflour-647 (CR3022-AF647) for 4 hours at room temperature or overnight at 4° C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody half-life calculations: Mixed-effects models implemented in MonolixSuite 2021R1 (Lixoft) were used to estimate the corresponding half-lives of antigen-specific antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">741172), CD3 BV650 (BD Biosciences, 563916), CD21 PE-CF594 (BD Biosciences, 563474) and Alexa Fluor 488-labeled Beta spike (antibodies-online, ABIN6963740),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD3</div><div>suggested: (BD Biosciences Cat# 563916, RRID:AB_2738486)</div></div><div style="margin-bottom:8px"><div>antibodies-online , ABIN6963740</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To perform neutralization assay, Vero E6-TMPRSS2-T2A-ACE2 cells (BEI Resources, NIAID; NR-54970) were seeded at a density of 1×104 per well in half area 96-well black opaque plates (Greiner Bio-One) and were grown overnight at 37°C in a 5% CO2 atmosphere.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6-TMPRSS2-T2A-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viruses and cells: VeroE6-TMPRSS2 cells were described previously and cultured in complete DMEM in the presence of Gibco Puromycin 10 mg/ml (#A11138-03). nCoV/USA_WA1/2020 (WA/1) was propagated from an infectious SARS-CoV-2 clone as previously described(Xie et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animal subjects and experimentation: Twenty one male rhesus macaques (Macaca mulatta) of Indian origin, aged 5 – 15 years, including 11 animals from the previous study(Arunachalam et al., 2021) were housed and maintained as per National Institutes of Health (NIH) guidelines at the New Iberia Research Center (NIRC) of the University of Louisiana at Lafayette in accordance with the rules and regulations of the Committee on the Care and Use of Laboratory Animal Resources.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NIRC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The FRNT-50 titers were interpolated using a 4-parameter nonlinear regression in GraphPad Prism 9.2.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All flow cytometry data were analysed using Flowjo software v10 (TreeStar Inc.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flowjo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All the figures were made in GraphPad Prism or R and organized in Adobe Illustrator.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Adobe Illustrator</div><div>suggested: (Adobe Illustrator, RRID:SCR_010279)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT05007951</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Immunogenicity and Safety Study of SK SARS-CoV-2 Recombinant…</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.18.484950
  97. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.18.484956
    1
    1. sciscore 23 Mar 2022

      SciScore for 10.1101/2022.03.18.484956: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: All the studies involving live viruses were conducted in the Vitalant Research Institute BSL-3 under approved safety protocols.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Image Analysis: To measure the frequency of infected cells, randomly-selected areas were imaged.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All cells had been previously tested for mycoplasma contamination and incubated at 37°C in a humidified atmosphere with 5% CO2.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then incubated with a primary antibody (monoclonal rabbit anti-SARS-CoV-2 nucleocapsid antibody (GeneTex, GTX135357)) in 1 X PBS (1:1,000) overnight at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following day, cells were washed three times with 1 X PBS and incubated with a secondary antibody (Goat anti-Rabbit IgG (H+L) secondary antibody, FITC (Thermo Fisher, 65-6111)) in 1 X PBS (1:200) for 1 h at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Rabbit IgG</div><div>suggested: (Thermo Fisher Scientific Cat# 65-6111, RRID:AB_2533966)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An unrelated anti-goat IgG antibody was used as a control.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-goat IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The amount of captured ACE2, which is proportional to ACE2 binding activity, is then recognized by an ACE2 detection antibody and measured by reading the absorbance at a wavelength of 450 nm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viruses were propagated in Vero E6-TMPRSS2 cells in DMEM with 2% FBS and 1% penicillin/streptomycin and viral stocks were stored at −80°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus titer was measured in Vero E6 cells by TCID50 assay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, Calu-3 cells cultured in 96-well cell culture plates were incubated with different concentrations of Gal-9 (0-5,000 nM).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus production: VSVΔG-luciferase-based viruses, in which the glycoprotein (G) gene has been replaced with luciferase, were produced by transient transfection of viral glycoprotein expression plasmids (pCG SARS-CoV-2 Spike and pCAGGS VSV-G) or no glycoprotein control into HEK293T cells by TransIT-2020 as previously described (Ng et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus production: VSVΔG-luciferase-based viruses, in which the glycoprotein (G) gene has been replaced with luciferase, were produced by transient transfection of viral glycoprotein expression plasmids (pCG SARS-CoV-2 Spike and pCAGGS VSV-G) or no glycoprotein control into HEK293T cells by TransIT-2020 as previously described (Ng et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCG</div><div>suggested: RRID:Addgene_51476)</div></div><div style="margin-bottom:8px"><div>pCAGGS VSV-G</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data from three independent experiments was used to calculate the CC50 by nonlinear regression using GraphPad Prism 8.0 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RNA-seq and Ingenuity Pathway Analysis (IPA): RNA concentration and quality was measured using High Sensitivity RNA ScreenTape Analysis (Agilent, 5067-1500). cDNA libraries were prepared using the Illumina TruSeq Stranded total RNA library prep kit (Illumina, 20020597) and sequencing was performed on the Illumina Nextseq 550 platform generating 75 bp paired-end reads.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ingenuity Pathway Analysis</div><div>suggested: (Ingenuity Pathway Analysis, RRID:SCR_008653)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The quality of raw sequencing reads was assessed using FastQC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FastQC</div><div>suggested: (FastQC, RRID:SCR_014583)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differentially-expressed genes were identified by GSA or ANOVA in Partek® Flow® imported into the QIAGEN Ingenuity Pathway Analysis (IPA) software application.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>QIAGEN Ingenuity Pathway Analysis</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Ingenuity</div><div>suggested: (Ingenuity Pathway Analysis, RRID:SCR_008653)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data was analyzed using FlowJo.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analyses were performed using Bio-Plex Manager™ 6.1.1 (Bio-Rad Laboratories, Hercules, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bio-Plex</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Bio-Rad Laboratories</div><div>suggested: (Bio-Rad Laboratories, RRID:SCR_008426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantitative analysis of synergy: The combinatorial effects of Gal-9 treatment and SARS-CoV-2 infection on pro-inflammatory cytokine expression were analyzed using the SynergyFinder web application, implementing the Bliss Independence model.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SynergyFinder</div><div>suggested: (SynergyFinder, RRID:SCR_019318)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Our study has limitations that must be considered. Firstly, we focused exclusively on the airway epithelium, and it is now established that SARS-CoV-2 is capable of infecting other cell lineages including monocytes, monocyte-derived macrophages, and microglia (Boumaza et al., 2021; Jeong et al.; Liu et al., 2021). It is possible that Gal-9 does not exert similar effects on viral replication or immune signaling in other target cell types. Secondly, our studies were all performed in vitro or in transplant tissue-derived primary epithelial cells ex vivo. As it is well-established that Gal-9 exerts conditional, pleiotropic immunomodulatory effects, the net effect of Gal-9 signaling on SARS-CoV-2 pathogenesis cannot be fully appreciated outside of an animal model with a functional immune system. Validation and extension of our observations in murine, hamster or nonhuman primate models of SARS-CoV-2 infection will help in evaluating the clinical relevance of our reported findings. In relevance to the implementation of animal models, our study did not elucidate the principal cell or tissue sources responsible for secreting Gal-9 in the setting of SARS-CoV-2 infection. Leveraging an animal model to identify these source compartments will be critical in developing interventions to manipulate Gal-9 signaling as a therapeutic approach. To our knowledge, the data presented here are the first to show that Gal-9 is directly involved in enhancing SARS-CoV-2 infection and virus-induced pro-i...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.18.484956
  98. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.17.22272557
    1
    1. sciscore 22 Mar 2022

      SciScore for 10.1101/2022.03.17.22272557: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: cohort, IRB approval ref CEIm 20/157) and were recruited after informed consent and randomly selected among those with serum samples available for the study period.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">cohort, IRB approval ref CEIm 20/157) and were recruited after informed consent and randomly selected among those with serum samples available for the study period.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RBD-binding antibodies: Anti-RBD Ig titers were determined by an electrochemiluminescence commercial assay (Elecsys Anti-SARS-CoV-2, Roche Diagnostics, Basel, Switzerland) and were converted to WHO International Standard Binding Antibody Units and expressed as BAU/mL following the manufacturer instructions</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-RBD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike sequences from SARS-CoV-2 variant Alpha (B.1.1.7, GISAID: EPI_ISL_608430), SARS-CoV-2 variant Beta (B.1.351, GISAID: EPI_ISL_712096), SARS-CoV-2 variant Gamma (P.1, GISAID: EPI_ISL_833140), SARS-CoV-2 variant Delta (B.1.617.2, GISAID: EPI_ISL_1970335) and SARS-CoV-2 variant Omicron (B.1.1.529, GISAID: EPI_ISL_6640917) were synthesized and cloned into pcDNA3.1 by GeneArt technology (Thermo Fisher Scientific GENEART GmbH, Regensburg, Germany).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.17.22272557
  99. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.18.22272582
    1
    1. sciscore 22 Mar 2022

      SciScore for 10.1101/2022.03.18.22272582: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Date of the last search was January 22 (for PubMed and Web of Science Core Collection) and January 25 (for L·OVE and EPPI-Centre), 2022.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Some studies aimed to investigate the role of prognostic risk factors (such as severity of acute COVID-19) on absolute risks, but these assessments are subject to the same crucial limitations. The exact relationships and interrelationships of the various factors that influence both the risk of infection and the risk of symptomatic disease need to be understood. These may include age, social factors (e.g., housing conditions, education level of children but also of parents and guardians, family situation), psychological and mental factors (e.g., mental illness or impairment, at least of the children themselves), economic factors (e.g., financial situation and additional financial burden on the family due to the pandemic). This may also include information on the parents as they most likely have serious impact on the children’s risk to be infected and becoming aware of symptoms. The precise influence of such factors on individual risk behaviour is unclear and difficult to model. Moreover, it is difficult to collect very detailed data that would allow such analyses. Of 21 studies, only 6 used control groups, and only two adjusted for some confounders but their results were likely at risk of unmeasured or residual confounding. Hence, for all studies, the risk of confounding was critical. Another level of complexity is the detection of outcomes due to the inconsistently used and non-standardized definition of “long COVID”, but also, and above all, the recording of the outcomes the...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.18.22272582
  100. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.17.22272574
    1
    1. sciscore 22 Mar 2022

      SciScore for 10.1101/2022.03.17.22272574: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the Institutional Review Board of Northwestern University (reference number STU00212232) with a waiver of informed consent was obtained prior to initiation of this research.<br>Consent: This study was approved by the Institutional Review Board of Northwestern University (reference number STU00212232) with a waiver of informed consent was obtained prior to initiation of this research.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study design and patient cohort: This is a prospective observational cohort study of pregnant people who delivered at Northwestern Medicine Prentice Women’s Hospital in Chicago, IL, USA (April 2020-July 2021).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 IgM and IgG were measured in maternal and infant plasma using the Access SARS-CoV-2 IgG and IgM Antibody tests (DXI Platform, Beckman Coulter, Brea CA) in the Northwestern Memorial Hospital CAP/CLIA certified clinical laboratory.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were conducted using STATA/IC version 16.0 (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA/IC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statacorp), R software, and Python 3.10.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Statacorp</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Limitations include the single timepoint of antibody measurements at delivery per patient and the single center study. Circulating anti-S1 RBD antibody is also only one measure of immune protection and does not account for aspects of immunologic memory. Although we did not specifically measure neutralizing antibody, anti-S IgG correlates closely with neutralizing activity patterns16,38. In addition, given the timeframe of the cohort, the effects of 3rd dose booster vaccination during pregnancy are not assessed. In conclusion, COVID-19 vaccination in pregnancy leads to higher and longer lasting maternal IgG and higher infant IgG levels than natural SARS-CoV-2 infection. Vaccination results in higher transplacental antibody transfer ratios than infection after longer latency. Severity of infection is associated with higher and longer lasting antibodies. Maternal IgG antibody levels decrease over time in pregnant patients following both vaccination and natural infection, reinforcing the importance of vaccination even after infection and booster doses if 5 months have elapsed from initial series, to optimize protection of pregnant individuals and their infants.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.17.22272574
  101. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.17.22272561
    1
    1. sciscore 22 Mar 2022

      SciScore for 10.1101/2022.03.17.22272561: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: This study was conducted under review of the University of Florida (UF) IRB and the Haitian Comite National de Bioethique of the Ministere De La Sante Publique Et De La Population.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Many mothers were also hesitant about allowing a heel-stick for blood collection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">We estimated that with 50 samples collected before the pandemic and 50 after, we had 80% power to detect a difference in seroprevalence assuming 15% of babies would be seropositive after the beginning of the pandemic and 0% before (with 95% confidence).</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.17.22272561
  102. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.17.22272401
    1
    1. sciscore 22 Mar 2022

      SciScore for 10.1101/2022.03.17.22272401: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Informed consent was obtained from all participants prior to inclusion.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Combined nose/throat swabs for microbiome analysis, determination of SARS-CoV-2 viral loads and detection of administered Lactobacillaceae strains via qPCR and MiSeq amplicon sequencing were self-sampled, as well as blood fingerprick samples (dried blood spots) to analyze SARS-CoV-2 IgG antibodies (Figure S1 and supplementary methods).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 IgG</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Our data on viral loads should be further substantiated, because our study had several limitations. In addition to the already discussed high biological variation of COVID-19 disease progression and the rather small study population, we also experienced a suboptimal timepoint of intervention. The start point appeared too late after disease onset. This has also been observed in other trials with antivirals for respiratory infections [24,25]. For local applications of probiotics or microbiome therapeutics [6] compared to oral applications such as [8], it is especially important that the antiviral bacteria are provided early enough in the viral infection process, considering the more local mode of action. Oral probiotics target the gut and systemic immunity to reduce symptoms in later phases [26]. Here, we had to rely on the standard government PCR testing procedures in Belgium, resulting in a delay between testing and inclusion. Most participants started within 2-5 days after their first symptoms, when the viral loads were highest. A study design with a more preventive set-up might be more suitable to evaluate a microbiome throat spray with a mode of action early in the viral infection process. Moreover, we also observed that most patients still experienced symptoms at the end of the monitoring (5% still reported acute symptoms, 39% systemic symptoms and 41% URT symptoms), so that follow-up work with any potential therapeutic or nutritional interventions in outpatients preferab...

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04793997</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Suspended</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Microbiome Therapy in Covid-19 Primary Care Support</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.17.22272401
  103. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.17.22272577
    1
    1. sciscore 22 Mar 2022

      SciScore for 10.1101/2022.03.17.22272577: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Subjects provided consent to participate and the INSPIRE registry collected clinical data, survey information, biological samples, and longitudinal outcomes of patients seen at Intermountain Medical Center in Salt Lake City, UT, USA.<br>IRB: This study of periodic fasting and COVID-19 outcomes evaluated INSPIRE data and was approved by the Intermountain Healthcare institutional review board.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">They were adult women and men unrestricted with respect to age, sex, race, or ethnicity who underwent cardiac catheterization due to cardiac symptoms or clinical evaluation needs.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">(15) No subject was randomized in this study, but instead the long-term databasing and longitudinal surveillance of the INSPIRE registry were utilized.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were conducted with SPSS v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT02450006</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Intermountain INSPIRE Registry</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.17.22272577
  104. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.19.22272575
    1
    1. sciscore 22 Mar 2022

      SciScore for 10.1101/2022.03.19.22272575: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: All procedures complied with the Helsinki Declaration and were approved by the local Institutional Review Board (comité d’éthique, Université de Strasbourg, Strasbourg, France, reference number: CE-2021-9).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.19.22272575
  105. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.17.22272008
    1
    1. sciscore 22 Mar 2022

      SciScore for 10.1101/2022.03.17.22272008: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Membranes were probed with primary antibodies anti-Nucleocapsid (cat n°: 26369, Cell Signaling) and Anti-Spike (cat n°: 56996, Cell Signaling).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Nucleocapsid</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-Spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The secondary antibodies used were the horseradish peroxidase HRP-conjugated Anti-Rabbit (KPL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Rabbit</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plates were washed five times with PBST, and polyclonal anti-human IgG antibody conjugated to HRP (Promega) added for one hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For viral titration, 10-fold dilutions of each sample from passage #2 were used to infect Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Afterwards, to further contextualize the novel genome sequences, a maximum likelihood phylogenetic inference was performed with IQ-Tree v2.0.3 (28), under the GTR+F+I+G4 model.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IQ-Tree</div><div>suggested: (IQ-TREE, RRID:SCR_017254)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GraphPad Prism version 9.2.0 (GraphPad Software, San Diego, California USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.17.22272008
  106. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.16.22271361
    1
    1. sciscore 22 Mar 2022

      SciScore for 10.1101/2022.03.16.22271361: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.16.22271361
  107. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.18.484843
    1
    1. sciscore 22 Mar 2022

      SciScore for 10.1101/2022.03.18.484843: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Tissue collection was approved by the Ethics committee of Northern and Central Switzerland (study ID 2020-00969).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">anti-CD48 antibody (EPR4108; ab134049; Abcam, Cambridge, UK), washed, and counterstained with hematoxylin (Gill II).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD48</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene Expression Programming (GEP) of lung tissue: GEP of the lung tissue obtained at autopsy and used for the TMA construction was performed by HTG according to established protocols (https://www.htgmolecular.com/assets/htg/resources/BR-05-HTG-EdgeSeq-System.pdf).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene Expression Programming</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A PCA analysis was then performed using the pcomp function in R©, version 4.0.3 (R-Project for Statistical Computing, Vienna, Austria) and differential expression analysis of COVID-19 cases against controls was conducted with the DESeq2 package using default settings.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The heatmap was produced with the pheatmap package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pheatmap</div><div>suggested: (pheatmap, RRID:SCR_016418)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Thereafter, cells were washed twice (250g, 5 min, 4°C) with 0.1% BSA/PBS, and FC data were acquired by BD LSR II Flow Cytometer and analyzed with FlowJo software (Tree Star, OR, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed by Prism version 9.0 (GraphPad Software, San Diego, California, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.18.484843
  108. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.15.22272434
    1
    1. sciscore 22 Mar 2022

      SciScore for 10.1101/2022.03.15.22272434: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: This study was approved by the Ethical Review Committee for Research in Human Subjects at the Thailand Ministry of Public Health approval No. 15/2564.<br>Consent: The requirement for informed consent was waived due to the retrospective nature of the current study and the fact that we conducted a secondary analysis of anonymized and deidentified data.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were performed using GraphPad Prism 9 software (San Diego, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      This caveat provides precautionary information and informs the provision of appropriate timely treatment (vs. empirically treating ISRR in the absence of differential diagnosis). We acknowledge several limitations of this report. Specifically, this evaluation was based on a retrospective study within the secondary data and we may have therefore missed some critical information (especially with respect to outcome data). The reported data regarding female predominance could be due to the initial target population of the nationwide vaccine campaign, which initially comprised HCWs who received preferential vaccination at the start of the vaccine campaign, most of whom were young females (e.g., nurses, therapists). Moreover, we were unable to identify the factors associated with ISRR in this descriptive study and instead present a descriptive evaluation only. Future studies should evaluate risk factors and causality more comprehensively using multivariate modeling and a prospective design.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.15.22272434
  109. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.14.22272342
    1
    1. sciscore 21 Mar 2022

      SciScore for 10.1101/2022.03.14.22272342: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Informed consent was obtained from healthy participants and non-COVID febrile subjects, but was waived for COVID subjects due to the retrospective nature of the study and the exceptional circumstances.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The remaining control subjects (n=41), whose data were retrieved randomly from a tongue image database of our previous studies [12], were from Guangdong and Hong Kong.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">The raters consisted of three Chinese medicine practitioners (CYC, YYC, BNL) and three Chinese medicine students (XTC, QYC, JC), who were blinded to the source and diagnosis of the images.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(Adobe Photoshop CC 2019) to reduce the influence of different light sources.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Adobe Photoshop</div><div>suggested: (Adobe Photoshop, RRID:SCR_014199)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Data were analyzed with IBM SPSS Statistics (version 26.0) and GraphPad Prism (version 8.0.2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      There are a number of limitations in this study that are worth noting. For example, the source of COVID-19 patients are all from Wuhan at a particular time period. Thus, it is not known whether new COVID variants could produce specific tongue coating patterns not seen in the current study. Due to the lack of matching subjects, we have to exclude many older age COVID-19 patients, resulting in a relatively small sample size. As well, because the medical records of COVID-19 patients are incomplete, it is not possible to control for any comorbid disease in the study population. Therefore, findings from the current study should be interpreted with the above limitation in mind. In conclusion, COVID-19 patients have pathological tongue coating that is associated with inflammatory responses, and their coating changes may indicate the direction of disease development. Further studies are warranted to explore the application of tongue imaging as an adjunct diagnostic method in monitoring the development of COVID-19.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.14.22272342
  110. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.16.22272485
    1
    1. sciscore 21 Mar 2022

      SciScore for 10.1101/2022.03.16.22272485: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Our project received ethics approval from the Institutional Review Boards of the respective institutions (Drexel University and University of Nevada, Las Vegas).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Our work suffers from numerous limitations arising from cross-sectional design, even though we did control for health history and demographics. Notably, principal component analysis shows that both difficult and pride-full experiences are not exclusively clustered among persons with history of mood disorders. However, all data is self-reported, thus being subject to biases from social desirability and correlated errors. Lack of responses in shared narratives cannot be interpreted as absence of relevant events and our conclusions are thus tempted by bias due to willingness to share experiences. Some of the experiences, such as those arising from management environment and economic situation must have been shared by all respondents within healthcare systems and professions, but only reported by some. Therefore, our conclusions are limited to perception of events and willingness to share them; we mitigated bias from shared working conditions by controlling for healthcare system and profession in statistical models. We lacked some of the information that would have been helpful in interpreting data, such as availability and utilization of mental health supports. We only studied two healthcare systems and struggled with (typically) low participation rates, undermining generalizability of the findings. Despite limitations, we believe that our work offers some valuable insights and can help manage mental health challenges experienced by nurses and physicians during response to epide...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.16.22272485
  111. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.16.22272463
    1
    1. sciscore 21 Mar 2022

      SciScore for 10.1101/2022.03.16.22272463: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical approval: The surveys received ethical approvals from University of Southampton Ethics Committee (ERGO ID: 57267).<br>Consent: All participants provided informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Demographic variables: Finally, participants indicated their age, gender (female, male), marital status (single, in a relationship, married, separated, widowed), and religion (Christian, Muslim, other, no religion).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis: The data captured in Qualtrics were examined for errors, cleaned, and exported into IBM SPSS Statistics 28 for further analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Limitations and strengths: The core strength of this study relates to its relatively large number of participants, including its comparison with hesitancy rates collected from previous surveys. The three surveys allows capture of changes in temporal trends. However, a significant limitation relates to the representativeness of the sample population, since only individuals with access to the internet could participate. Thus, certain demographic were under-represented, including individuals in rural areas and people of lower socio-economic status. Further, since our recruitment was conducted using cross-sectional convenience sampling methods, the presence of respondent bias (e.g., those who closely follow COVID-19-related news) may limit its findings. The efficiency of data collection, the lower cost to advertise, and the acceptability of online survey recruitment may provide a useful alternative than formal regional or national surveys – especially during a global pandemic where new information from population surveys via remote or virtual methods may be urgently required. This research team completed this same survey via in-person data collection in Nkwanta South (January 2022), a rural district in the Oti region. This will capture different demographics and allow for comparisons between datasets.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.16.22272463
  112. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.16.22272510
    1
    1. sciscore 21 Mar 2022

      SciScore for 10.1101/2022.03.16.22272510: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis: Data were analyzed using STATA/MP version 14 (Stata Corp 2015, College Station, TX, USA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA/MP</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Strengths and limitations: This is the first large scale study to compare acceptance of COVID-19 vaccines between sub-Saharan African local residents and those in the diaspora. The study employed robust analyses to control for potential confounders to reduce the possibility of a bias. The distribution of the questionnaire in both English and French languages using an internet-based methodology, which was the only reliable means to disseminate information at the time of this study to a wider audience. Notwithstanding these strengths, the study has some limitations. For example, the study did not explore concerns about vaccine safety which may be an important determinant of vaccine hesitancy. The cross-sectional nature of the study means that causation cannot be determined. The survey was distributed electronically using social media platforms and emails, and this may have inadvertently excluded some potential participants whose opinions may have differed, such as those without internet access and people living in rural areas, where internet penetration remains relatively low.[65] The survey was presented in English and French and thus inadvertently excluding some of the Portuguese or Arabic-speaking SSA countries from participating. Although the study showed satisfactory internal validity, its generalization or transferability to all SSA countries may be limited.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.16.22272510
  113. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.16.22272497
    1
    1. sciscore 21 Mar 2022

      SciScore for 10.1101/2022.03.16.22272497: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      The results should be interpreted in the context of multiple other limitations. 1) We were unable to account for reinfection, and prior infection was assumed to be independent of the likelihood of being vaccinated. 2) We relied on Michigan-specific data from the Nationwide Commercial Lab Seroprevalence study to calculate case adjustment factors to correct for under-detection. That seroprevalence study has its own limitations4,8, and the representativeness of its sample to the Michigan population as a whole is unclear. 3) The calculated case adjustment factors were sensitive to assumptions about the rate of antibody waning. We found that the average time from seroconversion to seroreversion could not be estimated simultaneously with the adjustment factors due to identifiability issues, so we specified the former parameter from the existing literature. It is possible that rates of antibody waning could differ by age which is something we were unable to account for. 4) The case adjustment factors were our main source of uncertainty in this analysis. There are other sources of uncertainty that we were unable to propagate or account for. 5) SARS-CoV-2 sequence data reported to GISAID may not reflect true community variant proportions, particularly shortly after emergence when sampling may be biased toward outbreaks. Our results highlight the ongoing risk of periods of high SARS-CoV-2 incidence despite widespread prior infection and vaccination in the population. This underscores t...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.16.22272497
  114. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.16.22272521
    1
    1. sciscore 21 Mar 2022

      SciScore for 10.1101/2022.03.16.22272521: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Thus, the infection cases can be modeled by the following equation (5) (community model):The Monte Carol simulation was built in Excel (Microsoft, Redmond, WA) with ModelRisk version 6.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      There are two limitations of this study. First, SARS-CoV-2 was replaced by IBV to understand the dynamics of CoV in the wastewater pipeline. Ideally, it would be much better to use intact SARS-CoV-2 seeding in the pipeline; however, this is not possible due to high biological safety level requirements for working with SARS-CoV-2 in a pilot-scale wastewater treatment plant. Therefore, a comparative study using SARS-CoV-2 as seeding material is needed to assure the reproducibility of the modeling. However, the results from Ahmed et al. (2020) showed that the decay rates of MHA and SARS-CoV-2 were comparable across all treatments with no significant difference, indicating the feasibility of using other CoVs for such analysis[22]. Nevertheless, comprehensive comparative studies are needed to reach a consensus on the surrogate virus used in modeling. Another limitation is that there is also significant uncertainty and variations in the model input parameters, especially for the distribution of SARS-CoV-2 RNA concentrations in stool and urine and the volume of excreta produced to the sewer system. This paper is largely limited to currently available data, and future modeling with updated input parameters with more specific and representative data would further improve the accuracy. However, uncertainty and variations do not preclude the usefulness of the Monte Carol model to infer the person infected. Despite the high variability within and between individuals, both the community m...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.16.22272521
  115. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.17.22272414
    1
    1. sciscore 21 Mar 2022

      SciScore for 10.1101/2022.03.17.22272414: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      The model developed has several limitations which are important for the interpretation of the results presented. First, the contact model has been developed based on a mix of quantitative (survey data, staff numbers and demand levels) and qualitative data (consultations). Novel insight was gained by speaking directly to representatives from the sector, but their position was not objective and so there may have been implicit biases in the descriptions of the nature of workplace contacts and some potential routes of infection contacts could have been missed. Furthermore, simplifying assumptions, such as all contact durations being identical for the same mode of contact, mean that this model is idealised compared to reality. Third, the transmission rate and the modifiers used for different types of contact are uncertain, and is based on a combination of peer-reviewed [23, 24, 34] and non-peer-reviewed literature [22]. Improvements to this transmission model from the adaption of more mechanistic modelling approaches that predict explicitly the infectious dose associated with different modes of contact [24, 34–41], as well as updating with data on new variants and vaccines, will mean that this model could be applied to numerous future workplace scenarios to test the impact of different non-pharmaceutical interventions. There are also some complicating factors we choose to ignore in this model, that may be important to consider when interpreting these results. First, we do not mode...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.17.22272414
  116. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.16.22272523
    1
    1. sciscore 21 Mar 2022

      SciScore for 10.1101/2022.03.16.22272523: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.16.22272523
  117. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.17.22272529
    1
    1. sciscore 21 Mar 2022

      SciScore for 10.1101/2022.03.17.22272529: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Oversight: Hamad Medical Corporation and Weill Cornell Medicine-Qatar Institutional Review Boards approved this retrospective study with waiver of informed consent.<br>Consent: Oversight: Hamad Medical Corporation and Weill Cornell Medicine-Qatar Institutional Review Boards approved this retrospective study with waiver of informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The hazard ratio, comparing incidence of infection in both cohorts and the corresponding 95% CIs, was calculated using Cox regression adjusted for the matching factors with the STATA 17.0 stcox command.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      This study has limitations. We investigated incidence of documented infections, but other infections may have occurred and gone undocumented, perhaps because of minimal/mild or no symptoms. While the vaccinated cohorts excluded those with a prior documented infection, some of those vaccinated may have experienced an undocumented prior infection. Therefore, the higher protection of natural infection compared to vaccination may have been underestimated. With the high and durable effectiveness of natural infection5,6 and mRNA primary-series vaccination3,4 against COVID-19 hospitalization and death and the young population of Qatar,25 case numbers were insufficient for precise estimation of differences in protection between natural infection and vaccination against COVID-19 hospitalization and death. Depletion of the natural-infection cohort by COVID-19 mortality at time of primary infection may have biased this cohort toward healthier individuals with stronger immune responses. However, COVID-19 mortality has been low in Qatar’s predominantly young, working-age population,25,46 totaling 677 COVID-19 deaths (∼0.1% of primary infections) from the onset of the pandemic in early 2020 until March 14, 2022. Therefore, this seems unlikely to explain the study findings. As an observational study, investigated cohorts were neither blinded nor randomized, so unmeasured or uncontrolled confounding cannot be excluded. While matching was done for sex, age, nationality, and timing of prior in...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.17.22272529
  118. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.16.22272519
    1
    1. sciscore 21 Mar 2022

      SciScore for 10.1101/2022.03.16.22272519: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.16.22272519
  119. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.17.22272446
    1
    1. sciscore 21 Mar 2022

      SciScore for 10.1101/2022.03.17.22272446: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Visualizations and Statistical Analyses: We generated visualizations in RStudio (v 1.4.1106) using packages ggplot2 (v 3.3.5), ggpubr (v 0.4.0), tidyverse (v 1.3.1), and lubridate (v 1.7.10).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.17.22272446
  120. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.15.22272441
    1
    1. sciscore 21 Mar 2022

      SciScore for 10.1101/2022.03.15.22272441: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: We collected blood samples at the time of admission of patients to the clinic by taking informed consent.<br>IRB: This study was approved by institutional Human Ethics committee All India Institute of Medical Sciences (</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">NCBI-BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi) was carried out to confirm primer specificity prior to synthesizing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://blast.ncbi.nlm.nih.gov/Blast.cgi</div><div>suggested: (TBLASTX, RRID:SCR_011823)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis and the application of algorithms for the selection of the most suitable reference gene: Statistical analysis was performed using modules available in GraphPad ver 5.01.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Different statistical tools namely delta Ct, Bestkeeper, Normfinder, GeNorm, and RefFinder to calculate stability of each reference gene across the disease’s severity.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Normfinder</div><div>suggested: (NormFinder, RRID:SCR_003387)</div></div><div style="margin-bottom:8px"><div>GeNorm</div><div>suggested: (geNORM, RRID:SCR_006763)</div></div><div style="margin-bottom:8px"><div>RefFinder</div><div>suggested: (RefFinder, RRID:SCR_000472)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.15.22272441
  121. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.16.22272509
    1
    1. sciscore 21 Mar 2022

      SciScore for 10.1101/2022.03.16.22272509: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">[11] Search strategy: The following databases were searched on 31/05/2021 for relevant studies: Embase, PubMed/MEDLINE, Cochrane COVID-19 Study register and CINAHL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Embase</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The top 500 most relevant results on Google scholar were also searched as well as references within relevant articles and reviews.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Google scholar</div><div>suggested: (Google Scholar, RRID:SCR_008878)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.16.22272509
  122. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.16.22272508
    1
    1. sciscore 21 Mar 2022

      SciScore for 10.1101/2022.03.16.22272508: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.16.22272508
  123. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.18.484873
    1
    1. sciscore 21 Mar 2022

      SciScore for 10.1101/2022.03.18.484873: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study design and use of subject samples were approved by the Institutional Review Board of the Lausanne University Hospital and the ‘Commission d’éthique du Canton de Vaud’ (CER-VD).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Four female cynomolgus macaques aged 3–6 years were randomly assigned between the control and treated groups to evaluate the efficacy of P2G3 LS in the prophylaxis challenge study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Four female cynomolgus macaques aged 3–6 years were randomly assigned between the control and treated groups to evaluate the efficacy of P2G3 LS in the prophylaxis challenge study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike and RBD tetramers were prepared fresh before use and formed by combining biotinylated proteins with PE-conjugated Streptavidin (BD Biosciences) at a molar ratio of 4:1. Binding and ACE2 blocking studies with SARS-CoV-2 Spike: Luminex beads used for the serological and purified antibody binding assays were prepared by covalent coupling of SARS-CoV-2 proteins with MagPlex beads using the manufacturer’s protocol with a Bio-Plex Amine Coupling Kit (Bio-Rad, France).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Biotinylated P5C3, P2G3, REGN10933, REGN10987, AZD8895, AZD1061, ADG-2 or S309 antibodies (prepared as described above) were added to each well at 1 μg/ml followed by a further 20-minute incubation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AZD8895</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S309</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Freshly isolated cells were stained with the cocktail of fluorescent conjugated antibodies containing anti-CD19 APC-Cy7, anti-CD3-BV510, anti-IgM-FITC, anti-IgD PE-CF594, anti-CD27-APC, anti-CD38-V450 (BD Biosciences) along with the pre-complexed Beta variant Spike tetramer (2 μg in 100μl) coupled to PE-streptavidin (BD Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD19 APC-Cy7, anti-CD3-BV510, anti-IgM-FITC, anti-IgD PE-CF594</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IgD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD27-APC</div><div>suggested: (Sigma-Aldrich Cat# SAB4700132, RRID:AB_10896618)</div></div><div style="margin-bottom:8px"><div>anti-CD38-V450</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The treated group (n = 2 [MF1 and MF2]) received one dose at 10 mg/kg of P2G3 LS human IgG1 monoclonal antibody delivered by intravenous injection three day prior to challenge, while control animals (n = 2 in parallel [MF3 and MF4] and n=2 historical [MF5 and MF6]) received no treatment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>MF4</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In the ADCC assay, CEM-NKR-Spike-Luc cells were incubations with anti-Spike antibody at 0.3 μg/ml, isotype control antibodies at 0.3 μg/ml or an anti-HLA class I (MHC) positive control antibody (Invivogen) at 0.005 μg/ml.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Spike</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>I (MHC) positive control antibody (Invivogen) at 0.005</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To monitor cell killing, co-cultured cells were washed and stained with fluorescent conjugated antibodies, CD56-AF488 (BD Biosciences,), CD16-FITC (BD Biosciences), Aqua Live/Dead cell stain (Invitrogen), CD4-PECF594 (BD Biosciences) and Annexin V-APC (BD Biosciences), and then analysed using a FACS LSR II cytometer instrument.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Annexin V-APC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Positive control anti-MHC (anti-HLA class I) antibody gave strong antibody dependent cell killing of 60-80% and anti-Spike antibodies gave intermediate responses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-MHC</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-HLA class I</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral stocks were prepared in EPISERF on VeroE6 or Calu-3 (for Omicron), aliquoted, frozen and titrated on VeroE6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Rev and pUltra-Chili-Luc vectors (Addgene) into 293T cells in DMEM medium + 10% FCS using Fugene 6 (Promega) for pseudoviruses production.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: KCB Cat# KCB 200744YJ, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All animals were then exposed to a total dose of 105 TCID50 of Omicron B.1.1.529 SARS-CoV-2 virus produced in Calu-3 cells (NIH/BEI reference: NR-56462) via the combination of intranasal and intratracheal routes (day 0) with sample collection and testing performed as previously described 36.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">U937 cells incubated with Spike beads in the absence of antibody generally showed <5% phagocytic activity while increased ADCP activity was observed with increasing concentration of anti-Spike antibody with a maximum of 100% of cells exhibiting fluorescence associated with Spike bead phagocytosis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>U937</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Omicron Spike ectodomain was amplified by PCR with primers (listed in Table 3) designed on consensus sequence from available Omicron sequences, and introduced by In-Fusion cloning into the nCoV-2P-F3CH2S plasmid, replacing the original wild-type Spike29.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>nCoV-2P-F3CH2S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudoviruses were alternatively produced with the original 2019-nCoV (Cat #100976), Alpha / B.1.1.7 (Cat #101023) and Beta/B.1.351 (Cat #101024) pCAGGS-SARS2-Spike vectors obtained from NIBSC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS-SARS2-Spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These vectors were co-transfected with pMDL p.RRE, pRSV.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMDL p.RRE</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pRSV</div><div>suggested: RRID:Addgene_106453)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Rev and pUltra-Chili-Luc vectors (Addgene) into 293T cells in DMEM medium + 10% FCS using Fugene 6 (Promega) for pseudoviruses production.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pUltra-Chili-Luc</div><div>suggested: RRID:Addgene_48688)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To monitor cell killing, co-cultured cells were washed and stained with fluorescent conjugated antibodies, CD56-AF488 (BD Biosciences,), CD16-FITC (BD Biosciences), Aqua Live/Dead cell stain (Invitrogen), CD4-PECF594 (BD Biosciences) and Annexin V-APC (BD Biosciences), and then analysed using a FACS LSR II cytometer instrument.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Biosciences</div><div>suggested: (BD Biosciences, RRID:SCR_013311)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The soft mask volume were generated manually in UCSF Chimera and cryoSPARC 40.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cryo-electron microscopy model building: A model of a Spike trimer (PDB ID 7QO7) or AlphaFold2 (ColabFold implementation) models of the P5C3 and P2G3 Fabs were fit into the cryo-EM maps with UCSF Chimera These docked models were extended and rebuilt manually with refinement, using Coot and Phenix41,42.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Buried surface area measurements and centroid measurements were calculated within ChimeraX.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ChimeraX</div><div>suggested: (UCSF ChimeraX, RRID:SCR_015872)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were performed in GraphPad Prism (GraphPad Software, Inc.) and Microsoft Excel.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.18.484873
  124. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.17.484786
    1
    1. sciscore 21 Mar 2022

      SciScore for 10.1101/2022.03.17.484786: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody Assays: ELISA for anti-S1 and anti-S2 antibodies: Sera from individual hamsters were tested for S-specific antibodies by ELISA on plates coated overnight with 100 µl of a mixture of S1 and S2 (Native Antigen Company, Kidlington, UK) each diluted to 1 µg/ml in bicarbonate buffer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-S2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An anti-hamster IgG (H+L)-Alkaline Phosphatase antibody produced in goat (Sigma-Aldrich, St Louis, MO) diluted to 1:1000 in 3% BAS-PBS was added at 60 µl/well for 1 hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>An anti-hamster IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-hamster IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>H+L)-Alkaline Phosphatase</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA for RBD-binding antibodies: Sera were tested for inhibition of ACE binding to the RBD of the S protein by the Anti-SARS-CoV-2 Neutralizing Antibody Titer Serologic Assay Kit from Acro Biosystems (Newark, DE) following the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A positive standard with a known concentration provided by the kit was used to extrapolated anti-S antibody concentrations into µg per ml of serum.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The VSV-S vector was diluted in medium containing 1 µg/ml of a mouse monoclonal antibody against VSV glycoprotein (sc-365019, Santa Crusz Biotechnology, Dallas, TX) and then incubated with the serum dilutions for 90 min at room temperature under gentle agitation starting with a serum dilution of 1 in 40.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody against VSV glycoprotein (sc-365019, Santa Crusz Biotechnology, Dallas, TX)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A monoclonal antibody to N protein (Abbexa, MCA6373, lot# 156962) served as a positive control (data not shown).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MCA6373</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then incubated with an anti-INF-γ-FITC antibody (clone XMG1.2 BioLegend, San Diego, CA) at 4°C for 30 min in the dark.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-INF-γ-FITC</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: HEK 293 cells were grown in Dulbecco’s Modified Eagles medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and antibiotics.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Challenge virus: Challenge was conducted with the WT WAS stock, which was generated from seed stock (2019-nCoV/USA-WA1/2020), obtained from Biodefense and Emerging Infections Research (BEI) resources (Cat # NR-52281, Lot # 70036318) and expanded in Calu-3 cells at 37°C for 3 days.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The stock (Lot # 12152020-1235) titers in Vero TMPRSS2 cells are 2.34×109 Median Tissue Culture Infectious Dose (TCID50)/mL and 3.68 × 107 plaque forming units (PFU)/mL, and 6 × 105 PFU/mL in Vero76 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero TMPRSS2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Vero76</div><div>suggested: JCRB Cat# IFO50410, RRID:CVCL_0603)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of VSV-S vectors: VSV vectors pseudotyped with S of SARS-CoV-2 were generated in BHK-21/WI-2 cells using a the ΔG-GFP (G*ΔG-GFP) rVSV kit (Kerafast, Boston, MA, USA) and S sequences cloned into an expression plasmid under the control of the CMV promoter as described previously [51].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-21/WI-2</div><div>suggested: RRID:CVCL_HB78)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549A/T cells were plated into Terasaki plate wells as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549A/T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549-hACE-TMPRSS2 (A549A/T) cells (InvivoGen, cat no. a549-hace2tpsa) were maintained in DMEM with 10%FBS, 300µg/ml of hygromycin, 0.5 µg/ml of puromycin and antibiotics.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-hACE-TMPRSS2 (A549A/T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the neutralization assay a dose of VSV-S vector that infected ∼20-40 cells/well was selected.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VSV-S</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Post-acquisition analyses were performed with FlowJo (TreeStar, Ashland, OR).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The analyses were carried out by GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.17.484786
  125. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.17.22272538
    1
    1. sciscore 21 Mar 2022

      SciScore for 10.1101/2022.03.17.22272538: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Informed consent and questionnaire (assessing eating, drinking, chewing or smoking 30 minutes before test and test indication) were completed under the guidance of the researcher.<br>Field Sample Permit: Based on the Belgian Sciensano guidelines for saliva collection [6], the participant collected the saliva sample in a CE-labeled sterile buffer-free recipient by spitting.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief: WGS was performed using the Research Use Only AmpliSeq for Illumina SARS-CoV-2 Research Panel on Illumina MiSeq (80 samples on V2 flow cell) according to the manufacturer’s standard protocol: 8 µl RNA extract was reverse transcribed using Lunascript RT SuperMix Kit (New England Biolabs, MA, USA), followed by amplification of 237 virus specific amplicons covering > 99% of the 30kb reference genome aiming at a median coverage above 500x, minimal coverage for mutation calling of 10x and variant allele frequency > 90% and a minimum of 30,000 reads per sample and a maximum of 1kb bases below minimal coverage.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>WGS</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A consensus sequence was constructed using an in-house pipeline containing Trimomatic for trimming, alignment by BWA, mutation calling by Freebayes and inspection of sequence quality by IGV.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA</div><div>suggested: (BWA, RRID:SCR_010910)</div></div><div style="margin-bottom:8px"><div>Freebayes</div><div>suggested: (FreeBayes, RRID:SCR_010761)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.17.22272538
  126. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.16.22272527
    1
    1. sciscore 21 Mar 2022

      SciScore for 10.1101/2022.03.16.22272527: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study protocol was approved by the local ethics committee.<br>Consent: Written informed consent was obtained.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Pregnant women and individuals with known SARS-CoV-2 infection in the past (diagnosed via patient history and test for nucleocapsid (N) antibody, see Section 2.3.2) were excluded from the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Some were then randomly selected to receive an INF-γ release assay (IGRA) test due to the limited availability of test kits.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We conducted a prospective cohort study to elucidate the antibody and INF-γ response to vaccination with Comirnaty (BNT-162b2, BioNTech/Pfizer, two doses) and a booster dose of an mRNA vaccine (either Spikevax (mRNA-1273), Moderna or Comirnaty) administered 6 months after the second vaccine dose in HD patients versus healthy controls vaccinated with the same regimen.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BNT-162b2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibody response elicited by vaccination was measured using an Elecsys ® Anti-SARS-CoV-2 S on a Cobas e 801 platform according to specifications, diluted 100-fold.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      This could be viewed as a limitation; however, antibody titers are relevant, as demonstrated by recent studies focusing on the correlates of protection from severe infection. In nonhuman primates, after mRNA vaccine immunization16 and in adoptive transfer studies17, antibodies were identified as one such correlate. The assay we used in this paper, an RBD-specific S antibody ELISA, not only correlates with neutralization tests, it was concluded that S-specific and/or RBD-specific antibody tests can be used as a correlate of protection from severe infection16. This conclusion is further reinforced by data on immunization with the AstraZeneca18 and mRNA-127319 vaccines. Another study showed a better correlation of the vaccine efficacy of seven different COVID-19 vaccines with binding (S) antibody titers than with neutralization assays20. It also provides data from human monoclonal therapy that proves the protective role of antibodies in COVID-1920. The RBD antibody test used in our study also showed good correlation with the WHO International Standard and Reference Panel for anti-SARS-CoV-2 antibody21,22, thus providing standardized results. Cut-offs to quantify antibody titers were determined as in our previous study7 according to correlation with a neutralization test10. Briefly, a serum antibody titer of 29 U/ml 3 weeks after the second vaccine dose was used as the cut-off to divide responder HD patients and low/non-responder HD patients. We feel that these data support the u...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.16.22272527
  127. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.17.22272555
    1
    1. sciscore 21 Mar 2022

      SciScore for 10.1101/2022.03.17.22272555: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Approval: The study protocol was approved by the institutional review board of the VA Medical Center in White River Junction, VT and was granted an exemption of consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were conducted using SAS, version 9.4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS</div><div>suggested: (SASqPCR, RRID:SCR_003056)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.17.22272555
  128. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.16.22272515
    1
    1. sciscore 21 Mar 2022

      SciScore for 10.1101/2022.03.16.22272515: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GeoPandas is a Python module based on the Pandas library that makes it easier to work with spatial data.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lastly, by using the GeoDataFrame, we visualized the map using ArcMAP software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ArcMAP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Rt values for different districts were calculated by using Python and the collected data were visualized in R, with RStudio as the IDE.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RStudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.16.22272515
  129. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.16.22272511
    1
    1. sciscore 21 Mar 2022

      SciScore for 10.1101/2022.03.16.22272511: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Limitations of this study include its observational nature, small sample size at a single center, short follow up period and the possibility that not all adverse events and outcomes were reported in the medical record. As symptomatic patients with severe underlying conditions were more likely to have therapies requested and approved, true assessment of treatment impact on outcomes on a broader population is not possible. Though we saw no clear indicator of disparities in our approval process, we are doing further work to explore potential equity issues as have been seen in the distribution of Covid-19 therapies for adult populations nationwide [9].

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.16.22272511
  130. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.17.22272389
    1
    1. sciscore 21 Mar 2022

      SciScore for 10.1101/2022.03.17.22272389: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Goat Anti-Human IgG/IgA/IgM Fc crossed-absorbed secondary antibody HRP, Invitrogen, used at 1:3000 dilution) antibody solution in 1% milk powder and PBS-T solution was added to each well and incubated in the dark at room temperature for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Human IgG/IgA/IgM</div><div>suggested: (Sigma-Aldrich Cat# S4893, RRID:AB_10625701)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following 1hr incubation at 37°C, virus was used to infect HEK293T-ACE2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The codon-optimized D614G and Omicron (B.1.1.529) SARS-CoV-2 S constructs were synthesized by GenScript (Piscataway, NJ) and subsequently cloned into a pcDNA3.1 vector by restriction enzyme cloning with Kpn I and BamH I. Cell Lines and Maintenance: HEK293T cells (ATCC CRL-11268, CVCL_1926) and HEK293T-ACE2 cells (BEI, NR-52511) were maintained in DMEM (Gibco, 11965-092) supplemented with 10% FBS (Sigma, F1051) and 1% penicillin/streptomycin (HyClone, SV30010).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: ATCC Cat# CRL-11268, RRID:CVCL_1926)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Constructs: The construct used for the production of lentiviral pseudotypes was pNL4-3-ΔEnv-inGluc (49), which was originally obtained from David Derse’s lab at NIH (National Cancer Institute, Frederick, Maryland, USA) and Marc Johnson’s lab at the University of Missouri (Columbia, Missouri, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNL4-3-ΔEnv-inGluc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This construct is based on a ΔEnv pNL4.3 HIV-1 vector and contains an anti-sense Gaussia luciferase (Gluc) gene with a sense intron.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNL4.3 HIV-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The codon-optimized D614G and Omicron (B.1.1.529) SARS-CoV-2 S constructs were synthesized by GenScript (Piscataway, NJ) and subsequently cloned into a pcDNA3.1 vector by restriction enzyme cloning with Kpn I and BamH I. Cell Lines and Maintenance: HEK293T cells (ATCC CRL-11268, CVCL_1926) and HEK293T-ACE2 cells (BEI, NR-52511) were maintained in DMEM (Gibco, 11965-092) supplemented with 10% FBS (Sigma, F1051) and 1% penicillin/streptomycin (HyClone, SV30010).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization curves were plotted in GraphPad Prism 5 using least-squares fit non-linear regression to determine neutralizing titers 50%.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: GraphPad Prism 9 and R 4.1.1 were used for statistical analyses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Limitation of our study: An important limitation in our study is that while active therapy is associated with blunted antibody responses, we cannot formally determine whether reduced antibody responses are due to therapy or more advanced disease. Other limitations of our study include a relatively low patient number, the inherent heterogeneity in patients both in terms of disease and treatment, and the range in time between vaccination and blood draws. While we excluded patients with SARS-CoV2 therapeutic mAb treatment within 6 months of the post-booster blood draw, as our patient population is highly vulnerable, medical records may not have reflected mAb therapy performed at other sites. We also did not assess other immune correlates that may be impactful for protection including memory B cells, the presence of which may be more critical than antibody levels. Finally, while our data suggest that it may be important to vaccinate prior to initiating B cell targeted therapy, clinical studies will be necessary to further validate this possibility.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.17.22272389
  131. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.17.22272589
    1
    1. sciscore 21 Mar 2022

      SciScore for 10.1101/2022.03.17.22272589: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gp32 and uvsX were cloned into the pET28a backbone using Type IIS assembly (Engler et al., 2008).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET28a</div><div>suggested: RRID:Addgene_139598)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmid #163912); pET28a- uvsX-H6</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET28a-</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(Plasmid #163913); and pET28a-MH6-uvsY (Plasmid #163914).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET28a-MH6-uvsY</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression and purification of Cas enzymes: LwaCas13a expression and purification: LwaCas13a was expressed from pC013-His6-Twinstrep-SUMO-LwaCas13a (Addgene: #90097) and purified as previously described (Patchsung et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pC013-His6-Twinstrep-SUMO-LwaCas13a</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PsmCas13b expression and purification: Escherichia coli BL21 (DE3) transformed with pC0061-His6-Twinstrep-SUMO-PsmCas13b (Addgene: #115211) were grown in LB media containing 25 µg/mL ampicillin, and the protein expression induced by the addition of 500 µM IPTG at 16 °C for overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pC0061-His6-Twinstrep-SUMO-PsmCas13b</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression and purification of Cas enzymes: LwaCas13a expression and purification: LwaCas13a was expressed from pC013-His6-Twinstrep-SUMO-LwaCas13a (Addgene: #90097) and purified as previously described (Patchsung et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Addgene</div><div>suggested: (Addgene, RRID:SCR_002037)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Four picomoles of the purified dsDNA crRNA template were used in in vitro transcription reactions using RiboMAX Large Scale RNA Production System–T7 (ProMega) or MEGAshortscript™ T7 Transcription Kit (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGAshortscript™</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gels were imaged on ImageQuant™ LAS 4000 (GE Healthcare); quantifications of produced crRNAs were performed by measuring band densitometries using Fiji ImageJ software (Schindelin et al., 2012) and comparing to RNA standards.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji ImageJ</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Retrieved sequences were aligned using MAFFT (Katoh & Standley, 2013).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The four consensus sequences along with the SARS-CoV- 2 isolate Wuhan-Hu-1 NCBI reference genome (Accession ID NC_045512.2) were re-aligned using MAFFT and visualized in SnapGene software (Insightful Science).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SnapGene</div><div>suggested: (SnapGene, RRID:SCR_015052)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Exclusivity evaluation of designed crRNAs: crRNA spacer sequences and their complementary sequences were searched against a BLAST database of Betacoronavirus nucleotide sequences (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Betacoronavirus BLAST, https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&BLAST_SPEC=Betacoronavirus), with the maximal number of target sequences set to 5000.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://blast.ncbi.nlm.nih.gov/Blast.cgi</div><div>suggested: (TBLASTX, RRID:SCR_011823)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulted alignments were visualized and inspected using JalView (Aksamentov et al., 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>JalView</div><div>suggested: (Jalview, RRID:SCR_006459)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.17.22272589
  132. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.16.22272493
    1
    1. sciscore 21 Mar 2022

      SciScore for 10.1101/2022.03.16.22272493: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.16.22272493
  133. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.16.22272467
    1
    1. sciscore 21 Mar 2022

      SciScore for 10.1101/2022.03.16.22272467: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Participants: The recruitment of participants was approved by the Institutional Review Board of Universidade Federal de Minas Gerais (UFMG<br>Consent: Written informed consent (digital and printed versions) was provided by all participants in the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Initial data collection was conducted using the Research Electronic Data Capture Platform (REDCap) and followed the Brazilian General Data Protection Law (LGPD) [27] for data collection, storage and use.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All valid FDG-PET and T1-MRI datasets were converted from DICOM format to NIfTI format using DCM2NII software (http://www.cabiatl.com/mricro/mricron/dcm2nii.html), and images were oriented manually to place the anterior commissure at the origin of the three-dimensional Montreal Neurological Institute (MNI) coordinate system.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DCM2NII</div><div>suggested: (dcm2nii, RRID:SCR_014099)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Using Statistical Parametric Mapping (SPM), version 12 (Wellcome Trust Center of Neuroimaging, London, United Kingdom), running in MATLAB R2012a (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Statistical Parametric Mapping</div><div>suggested: (Spatial Statistical Parametric Mapping, RRID:SCR_002592)</div></div><div style="margin-bottom:8px"><div>MATLAB</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tests were performed using SPSS 25.0 and GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Grouping was performed with the hierarchical clustering algorithm parameterized with Spearman’s correlation and complete linkage, implemented in GenePattern [43].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GenePattern</div><div>suggested: (GenePattern, RRID:SCR_003201)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Functional enrichment analysis was performed with the Ingenuity Pathway Analysis (IPA) software (Qiagen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ingenuity Pathway Analysis</div><div>suggested: (Ingenuity Pathway Analysis, RRID:SCR_008653)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      It is mediated by the increase of cytokines and chemokines, reactive oxygen species (ROS) and second lipid messengers produced by astrocytes and microglia, endothelial and peripheral immune cells [78], with self-limitation after resolution [79, 80]. On the other hand, chronic neuroinflammation implies persistent activation of microglia and other immune cells in the CNS with potential damage [81–83]. Amplified or chronic inflammatory activation can lead to pathological changes and neurobehavioral complications, such as depression and cognitive deficits [77, 84, 85]. In this study, we measured peripheral blood immunity associated factors, which might partially correspond to the CNS findings discussed above. Among the 11 upregulated plasma biomarkers in individuals with visuoconstructive deficit, 10 composed a functional network based on experimental observation or high confidence computational predictions that they interact by up-or downregulating each other (Figure 6). These interactions are represented by the broken edges of the network connecting the nodes, which, in turn, represent the protein biomarkers. Furthermore, six of the 10 biomarkers in the network are related to the clinical pathology endpoints hepatic necrosis and five to cardiac necrosis, events that can result in the upregulation of these associated biomarkers. Finally, four biomarkers are components of the canonical “Neuroinflammation Signaling Pathway” and four of the “IL-17 Signaling pathway”. The fact that ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.16.22272467
  134. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.16.22272513
    1
    1. sciscore 21 Mar 2022

      SciScore for 10.1101/2022.03.16.22272513: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants provided written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">PROFISCOV phase 3 clinical trial: To assess the safety and efficacy of the CoronaVac vaccine in Brazil, a randomized, double-blind, placebo-controlled phase 3 multicenter clinical trial was performed in healthy healthcare professionals on the front line of COVID-19 patients treatment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study design and participants: After the breaking of the participants’ blinding code, these 120 individuals were filtered based on vaccination status, age and specimen availability to compose the cohort used to assess cellular and humoral response after immunization with CoronaVac.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were incubated with 0,5μg/mL anti-CD40 antibody (Miltenyi Biotec, NRW, Germany) and then stimulated in the presence of specific MPs (1μg/mL), 10μL/mL positive control phytohemagglutinin (PHA, Sigma-Aldrich, Darmstadt, Germany) or 0.1% negative control dimethyl sulfoxide (DMSO, Sigma-Aldrich, Darmstadt, Germany).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD40</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CoronaVac (Sinovac Life Sciences, Beijing, China) is an inactivated vaccine derived from the CN02 strain of SARS-CoV-2 grown in Vero cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Acquisition was performed with the BD FACSDiva™ Software v6.0 and FlowJo™ v10.8 was used for data analysis (both from BD Biosciences, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD FACSDiva™</div><div>suggested: (BD FACSDiva Software, RRID:SCR_001456)</div></div><div style="margin-bottom:8px"><div>FlowJo™</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Binding antibody (bAb) assay: Plasma samples were tested for quantitative IgG bAbs against nine SARS-CoV-2 antigens: S, RBD and N from the Wuhan/WH04/2020 strain and S and RBD from the VOCs Alpha (B.1.1.7), Beta (B.1.351) and Gamma (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gamma</div><div>suggested: (GAMMA, RRID:SCR_009484)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Graphs and statistical analysis were performed at GraphPad Prism version 9.0.0 for Windows (GraphPad Software, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04456595</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Clinical Trial of Efficacy and Safety of Sinovac's Adsorbed …</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.16.22272513
  135. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.17.22272516
    1
    1. sciscore 21 Mar 2022

      SciScore for 10.1101/2022.03.17.22272516: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Wells were seeded with Vero E6-TMPRSS2 cells, to which 100μl of participant specimen was added.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All specimens were tested by RT-PCR using either the CDC 2019-Novel Coronavirus Real-Time RT-PCR Diagnostic Panel (EUA CDC-006-00019; with N1 and N2 gene targets and RNase P control; CDC assay) or the ThermoFisher TaqPath™ COVID-19 ComboKit (with S and N gene and ORF1ab targets and MS2 spike control; ThermoFisher assay).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher TaqPath™</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Sample size and study period are also limitations, especially in our ability to assess the impact of vaccination status or dissociate vaccination or other demographics from age. Ct values also cannot be converted to a quantitative representation of viral load, and cannot be used to directly infer differences in infectiousness. However, despite these limitations, clinical interpretation of Ct values (or their trajectories) may be “tempting “ (IDSA and AMP joint statement on the use of SARS-CoV-2 PCR cycle threshold (Ct) values for clinical decision-making, page 3) [14]. The present data are directly relevant to these interpretations. Specifically, specimens that were collected within 4 days of symptom onset may represent periods when Ct values are still declining. These findings contribute to our understanding of RT-PCR Ct values during SARS-CoV-2 infections over a broad range of ages, in a community setting with mostly mildly symptomatic illness, and among individuals with a known date of first shedding. While these data were collected prior to Delta and Omicron circulation, and prior to widespread vaccination, they may provide context for interpreting trajectories in Ct values in similar populations during later SARS-CoV-2 outbreaks.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.17.22272516
  136. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.16.22272440
    1
    1. sciscore 21 Mar 2022

      SciScore for 10.1101/2022.03.16.22272440: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants provided informed consent, and the study was approved by the University of Calgary’s Conjoint Health Research Ethics Board (REB20-1082).<br>IRB: All participants provided informed consent, and the study was approved by the University of Calgary’s Conjoint Health Research Ethics Board (REB20-1082).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nucleocapsid antibody levels were assessed for serosurveillance of natural infection to SARS-CoV-2 with seroconversion defined as an anti-N antibody concentration of ≥0.7 signal/cutoff index.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-N</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">15 The sensitivity and specificity of the SARS-CoV-2 IgG II Quant assay was 98.1% and 99.6%, respectively.16 Additionally, antibody levels are reported in the World Health Organization binding antibody units (BAU) to allow for comparison across assays.17,18 Serum samples were drawn for assessment of anti-S and anti-N antibodies to SARS-CoV-2 following the 1st, 2nd, and/or 3rd dose of a SARS-CoV-2 vaccine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mean within-individual differences in antibody concentration were calculated for each subset and stratified by prior infection to SARS-CoV-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies to the RBD of the S1 subunit of the spike protein (anti-S) were assessed using the Abbott Architect SARS-CoV-2 IgG II Quant assay (Abbott, Abbott Park, Illinois, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott Architect</div><div>suggested: (Abbott ARCHITECT i1000sr System, RRID:SCR_019328)</div></div><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: Statistical analyses were performed using STATA v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">0 (StataCorp) with a significance threshold of 0.05 and two-sided testing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Several limitations of our study should be considered. Due to a low number of patients with breakthrough COVID-19 infections, we were unable to assess the effectiveness of SARS-CoV-2 vaccination or evaluate whether antibody titres were associated with breakthrough infections. In addition, we did not assess other immune responses to SARS-CoV-2 vaccination, including neutralizing antibodies or T-cell immunity, which may serve as more functional proxies of immune protection over antibody titres.24,29 Due to logistical constraints in data collection during the pandemic, we were unable to obtain samples corresponding to all vaccine doses for all patients, resulting in semi-independent vaccine dose groups. While a community-based recruitment strategy involving all gastroenterologists in the Calgary zone was utilized, population-based sampling was not possible. Further, we did not compare those with IBD to healthy controls; however, a recent serology study performed in the general population within the same jurisdiction and using the same antibody assay demonstrated higher antibodies than our IBD population after 1st and 2nd dose of the vaccine.30 We used the Abbott Architect SARS-CoV-2 IgG II Quant assay, but also converted antibody levels to the World Health Organization BAU/ml (Supplementary Table 4) to support standardization across assays.17,18 Timing and type of vaccination was variable due to changing vaccine availability in Canada. We conducted a sensitivity analysis compari...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.16.22272440
  137. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.17.22272479
    1
    1. sciscore 21 Mar 2022

      SciScore for 10.1101/2022.03.17.22272479: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical approval was granted by the University of Liverpool Central Research Ethics Committee (7739).<br>Consent: Informed consent was collected at the beginning of the first survey.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Automated reminders to complete the current wave of the survey were generated through the JISC software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>JISC</div><div>suggested: (JISC, RRID:SCR_011331)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The analyses were conducted in IBM SPSS Statistics version 26.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Strengths and Limitations: In addition to inviting participants from the CLAHRC NWC HHS 43, recruitment was extended to utilise local and social media which boosted participation in the study. This recruitment strategy ensured the recruitment of a sample from varied neighbourhoods (Table 1) including the most deprived areas of the city region, 55. The high levels of IMD in this sample may reflect the high levels of IMD in this region compared to the national profile, which may explain the lack of significant findings with regard to sociodemographic characteristics 55. Despite the extended recruitment, the week 1 survey sample was relatively small (N=290) and it was further reduced by high attrition in the 12-week follow-up (N=163). Additionally, a high proportion of the participants were women, individuals of white ethnic background (representative of the city region demographic), higher educated, and only the digitally enabled would have the capacity to complete the survey. These are common features of online surveys, which reduce the representativeness of the sample 56. The survey included only self-report measures, which are prone to bias. There was a very low rate of COVID-19 infections among the participants. A sample with a higher infection rate might have struggled more to cope and presented with worse mental health. Additionally, those with more mental health or other adversity, and those who have returned to work when restrictions were eased might have been less like...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.17.22272479
  138. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.16.22271100
    1
    1. sciscore 21 Mar 2022

      SciScore for 10.1101/2022.03.16.22271100: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Between November 25, 2020, and January 9, 2021, participants provided written informed consent and completed a baseline questionnaire about their demographics and role in the hospital (self-report exposure to COVID-19 patients (yes/no), work in intensive care unit (ICU) (yes/no), emergency department (ED) (yes/no)).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      This study had at least four limitations. The high vaccine effectiveness we observed may be related to the short follow-up period after vaccination (range: 1-11 weeks after the two-week post-vaccination period; median of 2 weeks); a longer follow-up period is necessary to fully evaluate the long-term effectiveness of the vaccine among this study population. In addition, the study was not sufficiently powered to stratify VE estimates by variant or symptomatic vs asymptomatic infection. Moreover, because of the limited availability of laboratory staff and high volume of weekly respiratory specimens, we implemented a pooling strategy for SARS-CoV-2 testing which may have decreased sensitivity to detect those with low viral shedding. Last, our study could not distinguish nasal carriage of the virus from lower respiratory tract infection. In summary, one in ten healthcare personnel in our study in Peru tested positive for SARS-CoV-2 during February to May 2021. Vaccination of healthcare personnel with BBIBP-CorV vaccine was effective at reducing SARS-CoV-2 infections in the weeks immediately following vaccination. The data presented in this study supports the Peruvian Government’s ongoing COVID-19 vaccination efforts for reducing SARS-CoV-2 infections, especially among this critical workforce of healthcare professionals.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.16.22271100
  139. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.17.484837
    1
    1. sciscore 21 Mar 2022

      SciScore for 10.1101/2022.03.17.484837: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical considerations: The study was approved by departmental research ethics and review committee of the Department of Biochemistry, CHS, AAU (Ref.No.SoM/BCHM/068/2013) and by the institutional review board of College of Health Sciences, Addis Ababa University (Meeting 01/2021, Protocol 004/21/Biochem).<br>Field Sample Permit: Permission to conduct the study was also obtained from TASH.<br>Consent: All participants in the study (both COVID-19 patients and healthy controls) signed a written informed consent form.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Participants who were anemic, pregnant or had taken a corticosteroid or immunosuppressant within 14 days of admission were all excluded from the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: IBM SPSS version 25.0 (Chicago, IL) and Prism version 8 were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      The discrepancy could be due to the data limitations that were revealed during the meta analysis. Similarly, TGF-β levels were found to be decreased in severe patients compared to mild or moderate patients and healthy controls (Table 3 and 4). This is consistent with the concept that serum TGF-β levels peak during the first two weeks of acute COVID-19 infection and limit NK cell function in a TGF-dependent way (43). As a result, premature TGF-β production is thought to be a characteristic of severe COVID-19. TGF-β is released from a variety of sources in response to SARS-CoV-2 infection, including dysregulated coagulation and fibrinolytic pathways; neutrophils infiltrating the lungs in large numbers and macrophages migrating to the lungs to phagocytize apoptotic bronchial epithelial cells, pneumocytes, T-lymphocytes and neutrophils (44). The potential of this cytokine to recruit more neutrophils and remodel the airways through modulating processes used by the virus to generate pulmonary fibrosis explains its influence in SARS-CoV-2 infection. The severe group had significantly greater levels of VEGF-D than the mild or moderate group. There was a data shortage for this biomarker, but it was consistent with the prior research, which compared critical and severe group (45). We hypothesized that a high level of VEGF-D is linked to a storm of blood clots in COVID-19 patients, which eventually leads to disease severity. The ROC curve data further revealed that CRP, SAA and IL-6 lev...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.17.484837
  140. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.17.484787
    1
    1. sciscore 21 Mar 2022

      SciScore for 10.1101/2022.03.17.484787: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The protocols were approved by the Institutional Animal Care and Use Committee at the Washington University School of Medicine (assurance number A3381–01).<br>Consent: Fc-mediated effector functions: Primary cells were collected from healthy human donors with informed consent and authorization via the Comitato Etico Canton Ticino (Switzerland)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">For experiments with K18-hACE2 mice, eight- to ten-week-old female mice were administered the indicated doses of the respective SARS-CoV-2 strains (see Figure legends) by intranasal administration.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">In vivo studies were not blinded, and mice were randomly assigned to treatment groups.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">In vivo studies were not blinded, and mice were randomly assigned to treatment groups.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All cells routinely tested negative for mycoplasma using a PCR-based assay.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monoclonal antibody purification: The mAbs studied in this paper, S309, AZD8895, AZD1061, and the AZD7442 cocktail have been described previously4,11,18.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AZD8895</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells: Vero-TMPRSS240 and Vero-hACE2-TMPRRS241 cells were cultured at 37°C in Dulbecco’s Modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 10□mM HEPES pH 7.3, □mM sodium pyruvate, 1× non-essential amino acids, and 100□U/ml of penicillin–streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-hACE2-TMPRRS241</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero-hACE2-TMPRSS2 cells were supplemented with 10 µg/mL of puromycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-hACE2-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All virus stocks were generated in Vero-TMPRSS2 cells and subjected to next-generation sequencing as described previously41 to confirm the presence and stability of expected substitutions (see Supplementary Table 1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral plaque assay: Vero-TMPRSS2-hACE2 cells were seeded at a density of 1×105 cells per well in 24-well tissue culture plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-TMPRSS2-hACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Heterozygous K18-hACE2 C57BL/6J mice (strain: 2B6.Cg-Tg(K18-ACE2)2Prlmn/J) and wild-type C57BL/6J (strain: 000664) mice were obtained from The Jackson Laboratory.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: RRID:IMSR_JAX:000664)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human FcγR transgenic mice20 (FcγR -/- /hFcγRI+/hFcγRIIAR131+/hFcγRIIB+/hFcγRIIIAF158+/hFcγRIIIB+) were a generous gift (J. Ravetch, Rockefeller University) and bred at Washington University.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FcγR -/- /hFcγRI+/hFcγRIIAR131+/hFcγRIIB+/hFcγRIIIAF158+/hFcγRIIIB+</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following day, cells were transfected with SARS-CoV-2 spike glycoprotein-encoding pcDNA3.1(+) plasmids (BetaCoV/Wuhan-Hu-1/2019, accession number MN908947, Wuhan D614; Omicron BA.1 and BA.2 generated by overlap PCR mutagenesis of the Wuhan D614 plasmid) harboring the △19 C-terminal truncation26.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1 ( + )</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, a TaqMan assay was designed to target a highly conserved region of the N gene (Forward primer: ATGCTGCAATCGTGCTACAA; Reverse primer: GACTGCCGCCTCTGCTC; Probe: /56- FAM/TCAAGGAAC/ZEN/AACATTGCCAA/3IABkFQ/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GACTGCCGCCTCTGCTC</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Probe</div><div>suggested: (UniPROBE, RRID:SCR_005803)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed using FlowJo software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Limitations of study: We note several limitations of our study: (a) Female K18-hACE2 mice were used to allow for group caging. Follow-up experiments in male mice to confirm and extend these results are needed. (b) The BA.1, BA.1.1., and BA.2 viruses are less pathogenic in mice than the D614G virus16,33-35. This could lead to an overestimation of protection compared to other more virulent strains in mice. (c) We only evaluated the efficacy of S309 or AZD7442 as prophylaxis. Whereas AZD7442 is authorized only as preventive agent, post-exposure therapeutic studies with both mAbs and Omicron variants may provide further insight as to effects on potency. Moreover, the relationship between initial viral dosing and antibody protection against Omicron variants was not explored. (d) Several experiments were performed in transgenic mice that over-express human ACE2 receptors. High levels of cellular hACE2 can diminish the neutralizing activity of mAbs that bind non-RBM sites of the SARS-CoV-2 spike36,37. Thus, studies in hACE2-transgenic mice could underestimate the efficacy of mAbs binding outside of the RBM. Challenge studies in other animal models and ultimately humans will be required for corroboration, including the contribution of Fc effector functions to mAb efficacy. Collectively, our data expand on recent in vitro findings with BA.1 strains by evaluating the level of protection conferred by treatment with two EUA mAbs against the three currently dominant Omicron variants. Whil...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.17.484787
  141. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.17.484817
    1
    1. sciscore 21 Mar 2022

      SciScore for 10.1101/2022.03.17.484817: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Replication, randomization, blinding and reagent validations: Sample size: Sample size determination was performed according to similar work in the field.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Replication, randomization, blinding and reagent validations: Sample size: Sample size determination was performed according to similar work in the field.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All cell lines tested negative for mycoplasma.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Thereafter, memory B cells were labeled with memory B cell biotin-antibody cocktail combined with anti-biotin microbeads and isolated using a magnetic rack.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-biotin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation, the complex was washed and respectively incubated with anti-his-APC antibody and anti-APC microbeads.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-his-APC</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-APC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody binding kinetics, epitope mapping by bio-layer interferometry (BLI): Antibody binding kinetics for anti-Omicron RBD mAbs were evaluated by BLI on an Octet RED96e instrument (FortéBio) at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Omicron RBD</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, full length Omicron spike gene was constructed into GFP encoding (pCCNanoLuc2AEGFP) human immunodeficiency vector backbone, then Omicron spike protein expression vectors were combined with HIV-1 structural corresponding plasmids and co-transfected into HEK-293T cells with PEI (1mg/ml, PEI MAX, Polyscience)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Thereafter, the virus-antibody mixture was added triplicate onto HEK-293T-hACE2 cells and incubated at 37°C for additional 24 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T-hACE2</div><div>suggested: RRID:CVCL_A7UK)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, full length Omicron spike gene was constructed into GFP encoding (pCCNanoLuc2AEGFP) human immunodeficiency vector backbone, then Omicron spike protein expression vectors were combined with HIV-1 structural corresponding plasmids and co-transfected into HEK-293T cells with PEI (1mg/ml, PEI MAX, Polyscience)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCCNanoLuc2AEGFP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Half-maximal inhibitory concentration (IC50) for mAbs was calculated with a four-parameter logistic regression using GraphPad Prism (GraphPad Software Inc.)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Half-maximal inhibitory concentration (IC50) for mAbs was calculated with a four-parameter logistic regression using GraphPad Prism (GraphPad Software Inc.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Schematic illustrations: Schematic illustrations were created with Affinity Designer or BioRender.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioRender</div><div>suggested: (Biorender, RRID:SCR_018361)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Replication: Biological or technical replicate samples were randomized where appropriate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Replication: Biological</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.17.484817
  142. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.17.22272535
    1
    1. sciscore 21 Mar 2022

      SciScore for 10.1101/2022.03.17.22272535: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.17.22272535
  143. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.17.484640
    1
    1. sciscore 19 Mar 2022

      SciScore for 10.1101/2022.03.17.484640: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: The participants were ≥18-years-old male and female subjects who provided written informed consent before enrollment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">The participants were ≥18-years-old male and female subjects who provided written informed consent before enrollment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow Cytometry of Whole Blood: The levels of CD3+ CD4+ T cells and CD3+ CD8+ T cells/µl were measured using BD Trucount™ Tubes (BD Multitest™ 340491, BD Biosciences) with FITC-conjugated anti-CD3, PE-conjugated anti-CD8, PerCP-conjugated anti-CD45 and APC-conjugated anti-CD4 antibodies (BD Multitest™, 342417, BD Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD8,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>PerCP-conjugated</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD45</div><div>suggested: (BD Biosciences Cat# 342417, RRID:AB_2868785)</div></div><div style="margin-bottom:8px"><div>anti-CD4</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IFNγ-ELISPOT Assay: 96-well plates (Millipore Multiscreen Filtration, Merck Millipore, Sweden) were pre-treated with coating buffer (0.1M Na-Carbonate–Bicarbonate buffer pH 9.5), after which, wells were coated with human anti-IFN-γ monoclonal antibodies (1-D1K, Mabtech Sweden) at a concentration of 5μg/ml and diluted with the same coating buffer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IFN-γ</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 48 hours of incubation, the plates were washed four times with 0.05% Tween 20 in PBS, followed by 2 hours of incubation at 37°C with biotinylated anti-human IFN-γ monoclonal antibodies (clone 7-B6-1, Mabtech) diluted at 1μg/ml in PBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IFN-γ</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-SARS-CoV-2 Spike and Nucleocapsid IgG: Qualitative measurement of anti-SARS-CoV-2 spike IgG, including anti-spike neutralizing IgG antibodies directed against the receptor binding domain (RBD) of S1 subunit was performed using a commercial chemiluminescent microparticle-based immune assay (Abbott SARS-CoV-2 IgG II Quant/6S60 ARCHITECT SARS-CoV-2 IgG kit) and anti-SARS-CoV-2 nucleocapsid IgG (6R86 ARCHITECT SARS-CoV-2 IgG) using a commercial ARCHITECT Abbott (Abbott Laboratories Diagnostics Division, Abbott Scandinavia AB) kit.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Nucleocapsid IgG: Qualitative measurement of anti-SARS-CoV-2 spike IgG, including anti-spike neutralizing IgG antibodies</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 spike IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-spike neutralizing IgG</div><div>suggested: (Sino Biological Cat# 40592-R001, RRID:AB_2857936)</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 nucleocapsid IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The anti-SARS-CoV-2 spike IgG are expressed as standardized binding antibody units (BAU)/mL, calibrated to the WHO International Standards for anti-SARS-CoV-2 immunoglobulin (human) (NIBSC Code 20-136) [43] with a positivity cut-off of 7.1 BAU/mL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 immunoglobulin</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The PBMCs were washed again and resuspended in 200μl FACS buffer and run/acquired on a Cytek® Aurora (Cytek Biosciences, France) flow cytometry system.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cytek Biosciences</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The spectral flow data was analyzed/processed using OMIQ (OMIQ, Inc, Santa Clara, CA, USA) and FlowJo™ v10.8 Software (BD Life Sciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo™</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After overnight incubation at 4°C, the wells were washed 4 times with PBS (Cytiva HyClone™ Dulbecco’s PBS, Fisher Scientific), and quenched in 5% PHS in RPMI supplemented with gentamicin (20 µg/ml) and HEPES (10 mM), before seeding the wells with PBMCs at up to 300,000 per well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fisher Scientific</div><div>suggested: (Thermo Fisher Scientific, RRID:SCR_008452)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-SARS-CoV-2 Spike and Nucleocapsid IgG: Qualitative measurement of anti-SARS-CoV-2 spike IgG, including anti-spike neutralizing IgG antibodies directed against the receptor binding domain (RBD) of S1 subunit was performed using a commercial chemiluminescent microparticle-based immune assay (Abbott SARS-CoV-2 IgG II Quant/6S60 ARCHITECT SARS-CoV-2 IgG kit) and anti-SARS-CoV-2 nucleocapsid IgG (6R86 ARCHITECT SARS-CoV-2 IgG) using a commercial ARCHITECT Abbott (Abbott Laboratories Diagnostics Division, Abbott Scandinavia AB) kit.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott Laboratories</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: Data and statistical analyses were carried out using GraphPad PRISM v9.0 (GraphPad Software, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad PRISM</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      It is important to note that the current investigation has limitations. A critical factor to consider is the pre-selection of patients for this cohort, with most of the patients included already having moderate to severe COVID-19. It is also noteworthy to consider that health systems vary across geographical locations so patients in other counties might be more diverse due to different thresholds of illness required for hospital admission. Additionally, due to severe disease presentations, there were challenges with obtaining clinical samples from some patients and, in some cases, the cell numbers were low and/or of poor quality. During the study some COVID-19 patients were vaccinated against SARS-CoV-2 and therefore were excluded from our data set as this interfered with some results. Despite the immensely challenging conditions during the pandemic, we do believe that the cohort presented in this investigation is well characterized and of high quality and value. Altogether, this study highlights the alterations in the immune response incurred during hospital treated SARS-CoV-2 infection and convalescence. These novel longitudinal data illustrate the substantial changes to the T cell landscape, with a persistent increase in markers of activation, exhaustion and senescence lasting for more than 6 months. We further showed an accompanying decay in SARS-CoV-2-specific antibody responses at the same time. Our findings, in combination with others, are valuable in providing insight...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.17.484640
  144. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.14.22272314
    1
    1. sciscore 19 Mar 2022

      SciScore for 10.1101/2022.03.14.22272314: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Since there are two access points to YLV, we conducted daily (active) air sampling and surface swab sampling in both lobbies.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">COVID-19 surveillance: Students residing at the YLV dormitory were randomly screened 2-3 days/week using nasal swabs which were analyzed using RT-PCR.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Results of this research must be interpreted with caution due to the following limitations. First, some of the samples analyzed could be false negatives due to low concentrations of virus quantified from the sample or due to inhibition during sample preparation and analysis. Second, SARS-CoV-2 recovery from the samples can be subject to bias due to a low recovery rate from air, surface swab and wastewater samples. Third, COVID-19 case data can also be subject to bias because of the limited testing of students. For example, many days when SARS-CoV-2 was detected in the environmental samples, but COVID-19 cases were not reported. Routine daily testing of students was not implemented, especially during weekends. Finally, SARS-CoV-2 concentrations in the environmental samples were not adjusted for potential confounders, such as local meteorological conditions, ventilation and airborne particulate matter which have been shown to impact SARS-CoV-2 concentrations in air and on surface swabs [23, 25]. Despite these limitations this research provides insight into the merit and application of environmental microbiome surveillance for emerging disease-causing pathogens and their management.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.14.22272314
  145. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.17.484759
    1
    1. sciscore 19 Mar 2022

      SciScore for 10.1101/2022.03.17.484759: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Mouse immunization: Mouse experiments were performed under the Animal Ethics approved by Faculty of Science, Mahidol University (MUSC63-016-524).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blotted proteins were detected with a rabbit polyclonal antibody that recognizes SARS-CoV-2 spike RBD (40592-T62, SinoBiological) and a donkey anti-rabbit IgG-HRP antibody (sc-2077, Santa Cruz Biotechnology).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit IgG-HRP</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-2077, RRID:AB_631745)</div></div><div style="margin-bottom:8px"><div>sc-2077</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry: To detect surface protein expression, transfected HEK293T cells were stained with a rabbit polyclonal antibody that recognizes SARS-CoV-2 spike RBD (40592-T62, SinoBiological) and an Alexa Fluor 488-conjugated goat anti-rabbit IgG (A11034, Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A11034</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then blocked with 20% FBS in PBS and incubated with a rabbit polyclonal antibody that recognizes SARS-CoV-2 spike RBD (40592-T62, SinoBiological) followed by an Alexa Fluor 594-conjugated goat anti-rabbit IgG (A11037, Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A11037</div><div>suggested: (Thermo Fisher Scientific Cat# A-11037, RRID:AB_2534095)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1.1.529 S 15-mer (overlapping by 11 amino acids) peptide pool (GenScript) in plates pre-coated with anti-IFN-γ or anti-IL-4 antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IFN-γ</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IL-4</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T-hACE2 cells were cultured with 1 μg/ml puromycin to maintain stable expression of hACE2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-hACE2</div><div>suggested: RRID:CVCL_A7UK)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunofluorescence assay: Transfected HEK293T cells were fixed with 4% paraformaldehyde (PFA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: RRID:CVCL_HA71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, serially diluted heat-inactivated sera (starting with a dilution of 1:20) were pre-incubated with equal volumes of 100 TCID50 of SARS-CoV-2 for one hour at 37°C. 100 ml of the virus-serum mixtures were added to pre-seeded Vero E6/TMPRSS2 cell monolayers (1×104 cells/well) in duplicate on a 96-well microtiter plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6/TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In vivo bioluminescence imaging: For detection of in vivo expression of FLuc-encoding circRNA-LNP, 7-week-old female BALB/c mice were inoculated with 1 μg of the circRNA-LNP via intramuscular route.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the SARS-CoV-2 pseudovirus were produced by co-transfection of plasmids pHAGE-CMV-Luc2-IRES-ZsGreen-W, HDM-Hgpm2, HDM-tat1b, pRC-CMV-Rev1b, and SARS-CoV-2 spike expressing plasmid into HEK293T cells using jetPRIME transfection reagent.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHAGE-CMV-Luc2-IRES-ZsGreen-W</div><div>suggested: RRID:Addgene_164432)</div></div><div style="margin-bottom:8px"><div>pRC-CMV-Rev1b</div><div>suggested: RRID:Addgene_164443)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An unrooted phylogenetic tree comparing amino acid sequences derived from wildtype spike, SARS-CoV-2 spike variants of concern (VOCs) and variants of interest (VOIs), and wildtype-X spike (wildtype spike with the six rationally substituted amino acids) was constructed by maximum likelihood using IQ-TREE software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IQ-TREE</div><div>suggested: (IQ-TREE, RRID:SCR_017254)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then acquired on a BD Accuri C6 plus and analyzed by FlowJo software version 10.6.2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.17.484759
  146. www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
    https://biorxiv.org/cgi/content/10.1101/2022.03.16.484099
    1
    1. sciscore 19 Mar 2022

      SciScore for 10.1101/2022.03.16.484099: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: SPARTA participants: Eligible participants between 18 and 90 years old were enrolled starting in April 2020 with written informed consent in Athens and Augusta, GA, Memphis, TN, and Los Angeles, CA.<br>IRB: The study procedures, informed consent, and data collection documents were reviewed and approved by the WIRB Copernicus Group Institutional Review Board (WCG IRB #202029060).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Of the ∼3,800 SPARTA enrolled participants, 1,081 were randomly selected to be included in this study (Table S1). 68.5% of them identified as females, and 31.4% as males.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Of the ∼3,800 SPARTA enrolled participants, 1,081 were randomly selected to be included in this study (Table S1). 68.5% of them identified as females, and 31.4% as males.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IgG antibodies were detected using horseradish peroxidase (HRP)-conjugated goat anti-human IgG detection antibody (Southern Biotech, Birmingham, AL, USA) at a 1:4,000 dilution and colorimetric development was accomplished using 100 μL of 0.1% 2,2’-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS, Bioworld, Dublin, OH, USA) solution with 0.05% H2O2 for 18 minutes at 37ºC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>2,2’-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The conditioned cell culture supernatants were serially diluted to assess total and antigen-specific IgG antibody levels by ELISA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The USA-WA1/2020 SARS-CoV-2 strain (100 TCID50/50µl; NCBI accession number: PRJNA717311) was co-incubated with serially diluted serum samples for 1 hour at 37°C and then added to a monolayer of Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were acquired on Agilent NovoCyte Quanteon and analyzed using FlowJo v10.2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Comparison of the four groups (naïve unvaccinated, infected unvaccinated, naïve vaccinated, infected vaccinated) based on previous infection and vaccination as well as different timepoints were investigated by one-way ANOVA and paired t tests using GraphPad Prism 9.3.1 (RRID: SCR_002798).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>detected: GraphPad Prism ( RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      One of the limitations of this study is that we relied on accurate reporting of demographic information, comorbidities, previous SARS-CoV-2 testing and symptoms, and vaccine information by the participants. While the sample size for each of the four infected/vaccinated groups compared is robust, not all timepoints were available for all participants. Only participants who were convalescent prior to vaccination were reported in the infected vaccinated group, participants who had breakthrough infections after vaccination will be included in a future study. The sample size for the in vitro differentiation experiment was low due to the uncommon nature of losing seroprotective status amongst our participants. All participants who lost their confirmed seroprotected status were included in the analysis; future studies are necessary to strengthen our findings with additional participants. In conclusion, vaccinated groups seroconverted to higher antibody levels and experienced significant antibody waning regardless of pre-immunity. In contrast, infected unvaccinated participants had no significant waning during the first 14 months after infection. The rate of antibody waning was not significantly different between pre-immune and immunologically naïve participants. Antibody levels are greatly increased by the administration of a booster dose, to a level 3-fold higher than their previous peak antibody level 2-4 weeks after the second dose. Memory B cell recall responses were absent in a...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    ncbi.nlm.nih.gov/pmc/articles/PMC8936119/
  147. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.14.22272394
    1
    1. sciscore 19 Mar 2022

      SciScore for 10.1101/2022.03.14.22272394: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Other limitations of our study include the fact that this study was conducted at a single center and used biobanked blood samples obtained from a limited cohort of 161 patients. As only PCR confirmed COVID-19 positive patients were enrolled we could not determine the IMX-BVN-3 classifier’s specificity. We were also unable to clinically adjudicate the entire patient cohort for bacterial infections and thus calculated sensitivity for a subset of patients only. Lastly, since bacterial co-or superinfections are defined based on when the patient presents to the ED1,2 and not when in the course of the infection the patient presents, we were unable to determine the timeline of the infection to distinguish between the two. Additionally, the host response-based classifier detects any bacterial infection and, hence, does not allow differentiating between co-or superinfections. In conclusion, once the IMX-BVN-3 and SEV-3 classifiers are introduced as a rapid point of care host RNA detection platform with a turnaround time of less than 30 min (currently in development), results at the point of care could guide decisions about starting or withholding antibiotics allowing escalation of therapy or antimicrobial stewardship but also the initiation of contact precaution measures and/or viral therapy and choosing the appropriate level of care for SARS-CoV-2 positive patients.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.14.22272394
  148. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.15.22271255
    1
    1. sciscore 19 Mar 2022

      SciScore for 10.1101/2022.03.15.22271255: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">“My work and experience with the criminal justice system has been the impetus that motivates me to seek solutions that can help reduce recidivism by providing essential resources to formerly incarcerated individuals … I believe in working with the gatekeepers to ensure that funding is directed to critical areas that are needed most, and will have a significant impact on the population and the communities we work with.” —Arthur Bembury “Because of the things I saw during my 19 years of incarceration I have become an advocate for the women I had to leave behind and the women that will sleep in a prison bed tomorrow.” —CAB Member “Surviving the Federal carceral punishment system is the motivation that drives the work I do today.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: At Justice 4 Housing we advocate for the abolishment of discriminatory housing policies and ending incarceration of women.” —Leslie Credle At study onset, there were no validated instruments to examine confinement conditions among incarcerated individuals during the pandemic; therefore, we developed a novel survey across four domains: COVID-19 safety, basic needs, support, and demographics factors.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were collected anonymously using REDCap and the survey was distributed using a snowball sampling method through Twitter and Facebook and by email to community-partner organizations, medical and legal professionals, and local politicians.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Despite this limitations, general comparisons with other studies and anecdotal reports support the patterns we observed. In addition, generalizability of our sample by race and ethnicity is uncertain due to missing data for these variables. Although our sample is likely to overrepresent conditions in female facilities given our CAB member’s networks; there is no evidence to suggest that conditions would be improved for incarcerated males or individuals of color. Furthermore, our novel data collection methods were developed early in the pandemic based on public health priorities at that time which have changed with respect to sanitation procedures over the course of the pandemic. Furthermore, data from proxies may not be optimally reported for all variables due to the proportion of “I don’t know” or “Skip” responses to some questions, such as mental healthcare access. Lastly, two of our variables (facility on lockdown and ability to shower when wanted) demonstrated low internal validity; significantly more FII reported ability to shower daily if wanted, compared to proxies, while more proxies reported lockdown conditions compared to FII. However, 15.8% of FII who answered the questions regarding showering and lockdown were released before May 2020, prior to widespread response in all states. Additionally, all were incarcerated in Florida, which may reflect variability in different states’ responses. However, we observed high internal validity for other variables, suggesting th...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.15.22271255
  149. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.16.484554
    1
    1. sciscore 19 Mar 2022

      SciScore for 10.1101/2022.03.16.484554: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies and Drugs: Goat polyclonal antibody against human ACE2 (AF933) and rabbit polyclonal antibody against SARS CoV-2 Spike protein (NB100-56578) were obtained from Novus Biologicals (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antibody against SARS CoV-2 Spike protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then washed two times with PBS and incubated with an anti-spike antibody diluted (1:200) in PBS for 1 h at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Proteins were transferred to PVDF membrane, probed using anti SARS CoV-2 S antibody (Novus Biologicals, USA) and visualized with Chemiluminescent Reagent (Pierce).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti SARS CoV-2 S</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: Human embryonic kidney (HEK) 293T cells (ATCC #CRL-3216), Madin Darby Canine Kidney (MDCK) cells (ATCC #CCL-34), and African green monkey kidney epithelial (Vero) cells (ATCC #CCL-81) were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) along with penicillin and streptomycin antibiotics (Gibco) at 37°C and 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: ATCC Cat# CRL-3216, RRID:CVCL_0063)</div></div><div style="margin-bottom:8px"><div>293T</div><div>suggested: ATCC Cat# CRL-3216, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All SARS-CoV-2 stocks were produced and purified from supernatants of Vero-E6 ACE2 cells, infected with different variants of SARS-CoV-2 or SARS-CoV-2-mNG virus, at MOI of 0.1 in 10 ml MEM supplemented with 5% FBS. 72 hpi, virus-containing supernatants were harvested, centrifuged (500g, 10 min), filtered (0.45 μm), mixed with 10% SPG buffer (ATCC #MD9692), aliquoted and stored at −80°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6 ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For quantification of virus titers, viral stocks were serially diluted (10-fold) in serum-free medium and inoculated on 1×105 Vero E6-ACE2 cells, followed by determination of plaques forming units (PFU) after 72 h of infection on confluent Vero-E6-ACE2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Vero-E6-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Herpes Simplex Virus 1 (HSV-1 KOS) was propagated and purified from Vero cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 S and VSVG pseudotyped lentivirus generation: Lentivirus virus particles pseudotyped with full-length WT and mutant SARS-CoV-2 S protein were generated by transfecting HEK293T cells as described by Katharine et. al (Crawford et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the influenza A reporter virus was preincubated with Posaconazole for 30 min at RT and subsequently used to infect MDCK cells seeded in a 96-well plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDCK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For evaluation of the effect of posaconazole on the surface localization of the spike protein, Caco-2 cells were pre-treated with the drug or the vehicle control for 12 h and then infected with SARS-CoV-2 in the presence of the drug.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids: Plasmid HDM-IDTSpike-fixK, expressing a codon-optimized spike protein from SARS-CoV-2, Wuhan-Hu-1 strain (Genbank NC_045512) under a CMV promoter (BEI catalog number NR-52514), was used in this study.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Wuhan-Hu-1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmid pHAGE2-EF1aInt-ACE2-WT, expressing the human ACE2 gene (BEI #NR-52514) was used for all ACE2 overexpression studies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHAGE2-EF1aInt-ACE2-WT</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids pCMV VSV-G, expressing the VSV-G (addgene#138479) (Gee et al., n.d.), pcDNA3.3-SARS2-B.1.617.2 SARS-CoV-2, expressing the spike protein of the Delta variant (addgene#172320), pcDNA3.3-SARS2-B.1.617.1, expressing the spike protein of the Kappa variant (addgene#172319)(Cho et al., 2021), and SARS-CoV-2 Omicron Strain S gene Human codon_pcDNA3.1(+) expressing the spike protein of the Omicron variant (GenScript# MC_0101274) were used as indicated.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV VSV-G</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pcDNA3.3-SARS2-B.1.617.2 SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pcDNA3.3-SARS2-B.1.617.1</div><div>suggested: RRID:Addgene_172319)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the lentiviral backbone plasmid pHAGE-CMV-Luc2-IRES-ZsGreen-W (BEI #NR-52516) that uses a CMV promoter to express luciferase followed by an IRES and ZsGreen, was co-transfected with plasmids pHDM-Hgpm2, expressing the HIV-1 gag and pol (BEI #NR-52517), pRC-CMV-rev1b, expressing the HIV-1 rev (BEI #NR-52519), pHDM-tat1b, expressing the HIV-1 Tat (BEI #NR NR-52518), and HDM-IDTSpike-fixK or its mutants at a 4.6:1:1:1:1.6 ratio.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHAGE-CMV-Luc2-IRES-ZsGreen-W</div><div>suggested: RRID:Addgene_164432)</div></div><div style="margin-bottom:8px"><div>pHDM-Hgpm2</div><div>suggested: RRID:Addgene_164441)</div></div><div style="margin-bottom:8px"><div>pRC-CMV-rev1b</div><div>suggested: RRID:Addgene_164443)</div></div><div style="margin-bottom:8px"><div>pHDM-tat1b</div><div>suggested: RRID:Addgene_164442)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell-cell fusion assay: HEK293T cells were transfected with plasmids expressing hACE2 or co-transfected with plasmids expressing SARS-COV-2 S protein (WT or mutants as mentioned) and Green Fluorescence Protein (GFP).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>hACE2</div><div>suggested: RRID:Addgene_1786)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bioinformatics and structural analysis: Multiple sequence alignment was performed in Bioedit software using clustalW multiple alignment function.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>clustalW</div><div>suggested: (ClustalW, RRID:SCR_017277)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Multiple sequence alignment data was used to calculate amino acid identity matrix in Bioedit for HR1 and HR2 regions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bioedit</div><div>suggested: (BioEdit, RRID:SCR_007361)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Identified regions are aligned and logoplots were generated using WebLogo website (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>WebLogo</div><div>suggested: (WEBLOGO, RRID:SCR_010236)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structural alignment was performed in Pymol using specific PDB files of post-fusion spike protein structures of different human infecting coronaviruses (PDB id: 6LXT,1WYY,4NJL,5YL9 and 2IEQ).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pymol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Molecular Dynamics Simulations: The HR1-HR2 peptide complexes harboring either WT or different mutant variants of the HR2, were subjected to molecular dynamics simulations for a period of 100 ns using Gromacs software (Abraham et al., 2015).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gromacs</div><div>suggested: (GROMACS, RRID:SCR_014565)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MMGBSA values were then plotted using Origin software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Origin</div><div>suggested: (Origin, RRID:SCR_014212)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Ligand PDB structures were built up using Chem 3D Pro or procured as SDF file data bases like PubChem, Drugbank online etc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PubChem</div><div>suggested: (PubChem, RRID:SCR_004284)</div></div><div style="margin-bottom:8px"><div>Drugbank</div><div>suggested: (DrugBank, RRID:SCR_002700)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Kollman charges were calculated with AutoDock Tools (ADT)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AutoDock</div><div>suggested: (AutoDock, RRID:SCR_012746)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Grid potential maps were calculated using module AutoGrid 4.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AutoGrid</div><div>suggested: (Autogrid, RRID:SCR_015982)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The 2D-interactions were interpreted from the image obtained through LigPlot v2.2.4(Wallace et al., 1995).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>LigPlot</div><div>suggested: (LigPlot+, RRID:SCR_018249)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">36 h post-transfection both the cell lines were trysinised and co-cultured in 1:1 ratio for 12 h followed by fixing permialization and subsequent imaging using fluorescence microscope (Leica Microsystems) and subsequent analysis by ImageJ software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Graphs are plotted using Microsoft Excel and Origin and represented as mean standard deviations (n = 3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      While these peptides show high efficacy in inhibiting virus replication, their widespread implementation as antiviral drugs will be challenging owing to the inherent limitations of peptide-based therapeutics (Fosgerau & Hoffmann, 2015; Otvos & Wade, 2014). On the other hand, bioavailable small molecule fusion inhibitors, which are both easier to produce and deliver than peptides, have been disappointingly scarce and only a handful have been described for IAV and HIV (Dongen et al., 2019; Zhoua et al., 2011) and more recently against CoVs (Hu et al., 2021; Park et al., 2022; Yang et al., 2020). Successful targeting of viral infection with small molecules requires identification of a suitable “molecular target” possessing the following characteristics, (i) it should represent a structural element or a sequential motif or a combination of both, which would offer a suitable interaction interface for the small molecule; (ii) the target region should be critical for the activity of the viral protein and (iii) it should be minimally tolerant towards evolutionary changes acquired through antigenic drifts or shifts. Considering these parameters, in this study, we identified a highly conserved motif, E1182-L1186-L1193 present within the HR2 helix of SARS-CoV-2 S protein, whose side chains participate in essential molecular interactions indispensable for the stability of the 6-HB (Figure 1 B, C, E and F). MD simulation analysis suggested that mutation of these residues perturb the HR1-H...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.16.484554
  150. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.15.484467
    1
    1. sciscore 19 Mar 2022

      SciScore for 10.1101/2022.03.15.484467: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Human subjects: Patients, or a designated surrogate, provided informed consent to participate in the study.<br>IRB: The study is approved by the UCSF Institutional Review Board: IRB 20-30497.<br>Field Sample Permit: Peripheral blood sample collection and processing: Blood samples were collected in one EDTA tube and processed within 6 hours of collection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.15.484467
  151. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.15.22272448
    1
    1. sciscore 19 Mar 2022

      SciScore for 10.1101/2022.03.15.22272448: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.15.22272448
  152. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.14.484208
    1
    1. sciscore 19 Mar 2022

      SciScore for 10.1101/2022.03.14.484208: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Handling and working with SARS-CoV-2 were conducted in a BSL3 facility in accordance with the biosafety guidelines of the Israel Institute for Biological Research (IIBR), or in a BSL3 facility at The University of Texas Medical Branch (UTMB).<br>Euthanasia Agents: Golden Syrian hamsters (females; 4-5 weeks old) were intranasally infected with 1000 pfu of virus in 50 μl of inoculum while under isoflurane anesthesia.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">A DIG-labeled random-primed probe, corresponding to nucleotides 28,999 to 29,573 of the SARS-CoV-2 genome (Kamitani et al., 2006; Xie et al., 2020), was used to detect SARS-CoV-2 mRNAs and visualized by DIG luminescent detection kit (Roche, Indianapolis, IN), according to the manufacturer’s protocol.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Calu3 and 293T cells were authenticated by ATCC using STR profiling.<br>Contamination: All cell lines tested negative for mycoplasma.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, paraffin-embedded sections were firstly subjected to immunostaining with a commercially available and diluted (1:5,000) rabbit-anti-SARS-CoV-2 spike (S) protein (ab272504, Abcam Plc., Cambridge, UK), followed by staining with a peroxidase-conjugated secondary antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>rabbit-anti-SARS-CoV-2 spike ( S ) protein ( ab272504</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the detection of N protein, an affinity-purified rabbit anti-SARS-CoV N polyclonal antibody (Harcourt et al., 2020) was used as the primary antibody, followed by Alexa Fluor 488-conjugated secondary antibody (Invitrogen) and DAPI counterstaining, using SlowFade Gold antifade reagent (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the detection of nsp1 protein, the anti-SARS-CoV-1 nsp1 antibody was used as the primary antibody, followed by Alexa Fluor 594-conjugated secondary antibody (Invitrogen) and DAPI counterstaining.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-1 nsp1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed and labeled with anti-rabbit FITC conjugated antibody at a 1:200 dilution and with DAPI (4′,6-diamidino-2-phenylindole) at a 1:200 dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit FITC</div><div>suggested: (Bioss Cat# bs-0708R-FITC, RRID:AB_11075028)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies used were Goat anti-rabbit or Goat anti-mouse (IRDye 800CW or IRDye 680RD, Li-Cor).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An affinity-purified rabbit anti-SARS-CoV-1 nsp1 polyclonal antibody (Narayanan et al., 2015) was used as the primary antibody, and an HRP-linked anti-rabbit IgG (Cell Signaling Technology) was used as the secondary antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG ( Cell Signaling Technology )</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">African green monkey kidney clone E6 cells (Vero E6, ATCC® CRL-1586™) were grown in growth medium DMEM containing 10% FBS, MEM NEAA, 2 mM L-glutamine, 100 Units/ml penicillin, 0.1 mg/ml streptomycin, 12.5 Units/ml nystatin (P/S/N), all from Biological Industries, Israel]</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu3 and 293T cells were authenticated by ATCC using STR profiling.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: KCB Cat# KCB 200744YJ, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral titers: For determination of growth rate of SARS-CoV-2 WT or SARS-CoV-2 mut viruses, Vero E6 and Calu3 cells were seeded in 12-well plates (5E5 and 1E6 cells/well respectively).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu3</div><div>suggested: RRID:CVCL_EQ19)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus titers in the tissues were determined on confluent Vero E6/TMPRSS2 cells obtained from the Japanese Collection of Research Bioresources (JCRB) Cell Bank (1819).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6/TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 nsp1 ORF, carrying a C-terminal myc-tag, was cloned into pCAGGS-MCS, resulting in pCAGGS-nsp1-WT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS-MCS</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCAGGS-nsp1-WT</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Similarly, SARS-CoV-2 nsp1 carrying a deletion of the amino acids 155 to 165, and SARS-CoV-2 nsp1 carrying R124A and K125A mutations, were cloned into pCAGGS to generate pCAGGS-nsp1-ΔRB and pCAGGS-nsp1-CD, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_127347)</div></div><div style="margin-bottom:8px"><div>pCAGGS-nsp1-ΔRB</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCAGGS-nsp1-CD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Luciferase assay: Vero E6 cells in 24-well plates were co-transfected, in triplicate, with pRL-EMCV-FL reporter plasmid and the indicated pCAGGS-based nsp1 expression plasmids using TransIT-LT1 reagent (Mirus).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pRL-EMCV-FL</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids and cloning: pLVX-EF1alpha-SARS-CoV-2-nsp1-2XStrep-IRES-Puro (nsp1-WT) was kindly provided by N. Krogan.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLVX-EF1alpha-SARS-CoV-2-nsp1-2XStrep-IRES-Puro</div><div>suggested: RRID:Addgene_141367)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mutations to generate nsp1-ΔRB and nsp1-CD were introduced by amplifying the nsp1-WT plasmid so that it became a linear fragment containing the desired mutations (primers 1-4 listed in Supplementary Table 1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>nsp1-WT</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The images for SARS-CoV-2 N protein were collected using an Olympus BX53 microscope with a 40X objective lens at UTMB and processed with ImageJ (NIH) software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UTMB</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alignment was performed using Bowtie v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bowtie</div><div>suggested: (Bowtie, RRID:SCR_005476)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differential expression analysis was done using DESeq2 (Love et al., 2014)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Output.bam files from STAR were used as input for the GRAND-SLAM analysis(Jürges et al., 2018) with default parameters and with trimming of 5 nucleotides in the 5′ and 3′ends of each read.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_004463)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reactive bands were detected by Odyssey CLx infrared imaging system (Li-Cor) and quantified using Fiji (ImageJ) as detailed in https://imagej.nih.gov/nih-image/manual/tech.html.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Graphics: Figure 1a and extended figure 2c were created using BioRender.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioRender</div><div>suggested: (Biorender, RRID:SCR_018361)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fluorescence-activated cell sorting figures were created with FlowJo and the rest of the figures were drawn with ggplot2 in R.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      However, a major limitation of these measurements is that viral mRNA replication and transcription is massive, and occurs within a unique endomembrane system (Wolff et al., 2020) that would thus render much of the viral mRNA inaccessible to ribosomes. This inaccessibility of potentially large portions of viral RNA will skew our measurements and it is likely the true translation efficiency of viral transcripts is significantly higher. Comparing the translation efficiencies of viral and cellular transcripts in cells infected with CoV2-wt or with CoV2-mut allowed us to overcome this limitation and to demonstrate that in infected cells nsp1 indeed specifically promotes the translation of viral transcripts compared to cellular transcripts, as we observed that in cells infected with CoV2-mut, viral genes are translated even less efficiently compared to their cellular counterparts. However, at the same time our measurements of the overall translation capacity in infected cells, using incorporation of OPP into nascent chains, show that nsp1-WT leads to a major reduction in the absolute levels of translation in infected cells. Since the vast majority of mRNA in infected cells is viral mRNA this means that viral mRNAs translation is likely also inhibited in the presence of nsp1. Together these results support a model in which nsp1 acts as a strong inhibitor of translation that tightly binds to ribosomes and thus inhibits the translation of both viral and cellular mRNAs. Viral transcrip...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.14.484208
  153. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.15.22272432
    1
    1. sciscore 19 Mar 2022

      SciScore for 10.1101/2022.03.15.22272432: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study and all the protocols were approved by the Institutional Review Board of the University of Louisville (IRB # 20.0393)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(5) Serostatus was determined by measuring levels of SARS-CoV-2 Spike protein specific immunoglobulin (Ig) G (Spike IgG) antibodies in peripheral blood samples as reported previously.(6) Serostatus was a qualitative assessment (positive or negative) based on the enzyme-linked immunoassay (ELISA) results from above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 Spike protein specific immunoglobulin ( Ig ) G ( Spike IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were performed using SAS, version 9.4 (SAS Institute, Inc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS</div><div>suggested: (SASqPCR, RRID:SCR_003056)</div></div><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Limitations: Limitations of the study include a lack of SARS-CoV-2 titer or neutralization data, which was not the primary objective of the study, but can evaluate a continuous relationship between co-morbid conditions and antibody titer and neutralization efficacy. Serological assessment is not a definitive method to measure antibody efficacy, but seropositive status has a strong correlation with virus neutralization potential. The main goal of this study was to identify differences in serostatus among fully vaccinated individuals and was not powered to study the difference between individual vaccines. Finally, this study is cross-sectional in design, which does not allow us to report change over-time.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.15.22272432
  154. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.15.484484
    1
    1. sciscore 19 Mar 2022

      SciScore for 10.1101/2022.03.15.484484: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In parallel, the compounds were tested in a cytotoxicity counterscreen against the A549-ACE2 cell line.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Computational: Data Curation: UNC protocol: All chemical structures and correspondent activity information were analyzed and prepared according to data curation protocols proposed by Fourches et al.34–36 All steps of data curation were performed in KNIME37 integrated with ChemAxon Standardizer38.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ChemAxon</div><div>suggested: (ChemAxon, RRID:SCR_004111)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Six of these (RDKit whole-molecule descriptors, Morgan fingerprint, HashedAtomPairFingerprint, HashedTopologicalTorsionFingerprint, and MACCS Keys) were generated using the RDKit41 Python package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In this study, the generation of LBP models, their subsequent refinement, and VS were performed with LigandScout 4.4 Advanced, available by Inte:Ligand GmbH.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>LigandScout</div><div>suggested: (LigandScout, RRID:SCR_014889)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.15.484484
  155. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.15.484550
    1
    1. sciscore 19 Mar 2022

      SciScore for 10.1101/2022.03.15.484550: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the Institutional Review Board (IRB) of the Korea University Guro Hospital (IRB number:</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Multiple sequence alignment was performed using the nucleotide sequences of the HN gene obtained in this study with those of the reference strains, using the MUSCLE algorithm (16) implemented in MEGA X software (17).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MUSCLE</div><div>suggested: (MUSCLE, RRID:SCR_011812)</div></div><div style="margin-bottom:8px"><div>MEGA X</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The best-fit substitution model was determined using ModelFinder with TIM+F+I+G4 based on the minimum Bayesian information criterion value (19).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ModelFinder</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The best model among the six clock-tree model combinations, the relaxed clock log-normal and constant coalescent population, was chosen by path sampling and stepping stone, using the model-selection package implemented in BEAST.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BEAST</div><div>suggested: (BEAST, RRID:SCR_010228)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Tracer program v1.7.1 (20) was used to ensure that the effective sample size was greater than 200 for all the parameters.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Tracer</div><div>suggested: (Tracer, RRID:SCR_019121)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The maximum clade credibility tree information was summarized using TreeAnnotator v2.6.6 (21) after burning in 10% of the trees.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TreeAnnotator</div><div>suggested: (BEAST2, RRID:SCR_017307)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Bayesian MCMC phylogenetic tree was visualized using FigTree v1.4.4 (22).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FigTree</div><div>suggested: (FigTree, RRID:SCR_008515)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Amino acid sequence analysis: The amino acid sequences were obtained by translating the nucleotide sequences of the partial nucleotide sequence of the HN gene using the standard genetic code in MEGA X.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGA</div><div>suggested: (Mega BLAST, RRID:SCR_011920)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The crystal structure of HN protein was visualized using PyMOL 2.0 (24), based on the previously published crystal structure of HN (PDB ID: 1V3B).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Entropy analysis by Shannon entropy plot was performed using BioEdit, with a threshold value of 0.2 (25). 2.5.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioEdit</div><div>suggested: (BioEdit, RRID:SCR_007361)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Selection pressure analysis: The selection pressure on the HN gene of HPIV3 was estimated using the Datamonkey server (http://www.datamonky.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Datamonkey server</div><div>suggested: (DataMonkey, RRID:SCR_010278)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.15.484550
  156. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.15.484542
    1
    1. sciscore 19 Mar 2022

      SciScore for 10.1101/2022.03.15.484542: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: donors: Convalescent plasma, Ad26.COV2.S, and some BNT162b2 samples were obtained from the HAARVI study approved by the University of Washington Human Subjects Division Institutional Review Board (STUDY00000959).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: None of the cell lines used were authenticated or tested for mycoplasma contamination.<br>Contamination: None of the cell lines used were authenticated or tested for mycoplasma contamination.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infected cells were then washed an additional five times with DMEM prior to adding media supplemented with anti-VSV-G antibody (I1-mouse hybridoma supernatant diluted 1:25, from CRL-2700, ATCC) to reduce parental background.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-VSV-G</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: Cell lines used in this study were obtained from ThermoFisher Scientific (HEK293T) or were kindly gifted by Florian</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: RRID:CVCL_HA71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK-293T cells seeded in poly-D-lysine coated 100 mm dishes at ∼75 % confluency were washed five times with Opti-MEM and transfected using 24 μg of the S glycoprotein plasmid with Lipofectamine 2000 (Life Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudotyped VSV neutralization assay: To evaluate neutralization of SARS-CoV-2 G614 and Omicron BA.1 and BA.2 pseudotypes by plasma of vaccinees or previously infected individuals, Vero-TMPRSS2 cells in DMEM supplemented with 10% FBS, 1% PenStrep, and 8 ug/mL puromycin were seeded at 60-70% confluency into white clear-bottom 96 well plates (Corning) and incubated at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Media was removed from the cells and 40 μL from each well (containing plasma and pseudovirus) was transferred to the 96-well plate seeded with Vero-TMPRESS2 cells and incubated at 37°C for 2 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-TMPRESS2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plasmids encoding the SARS-CoV-2 Omicron S variants BA.1 and BA.2 were generated by overlap PCR mutagenesis of the wildtype plasmid, pcDNA3.1(+)-spike-D19 (Table S1) (64)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Relative luciferase units were plotted and normalized in Prism (GraphPad): 100% neutralization being cells lacking pseudovirus and 0% neutralizing being cells containing virus but lacking plasma.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Prism (GraphPad) nonlinear regression with “[inhibitor] versus normalized response with a variable slope” was used to determine ID50 values from curve fits with 2-3 repeats.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.15.484542
  157. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.15.484439
    1
    1. sciscore 18 Mar 2022

      SciScore for 10.1101/2022.03.15.484439: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Animal experiments were carried out in the animal biosafety level 3 facility of the UMR Virologie (ENVA, Maisons-Alfort); approved by the ANSES/EnvA/UPEC Ethics Committee (CE2A16) and authorized by the French ministry of Research under the number APAFIS#25384-2020041515287655.<br>IRB: Animal experiments were carried out in the animal biosafety level 3 facility of the UMR Virologie (ENVA, Maisons-Alfort); approved by the ANSES/EnvA/UPEC Ethics Committee (CE2A16) and authorized by the French ministry of Research under the number APAFIS#25384-2020041515287655.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animals: Fifty-six 8 weeks-old male hamsters were purchased from Janvier’s breeding Center (Le Genest, St Isle, France).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animals were randomized to the experimental groups.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">All analyses were performed blindly of the treatment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sections were then incubated overnight with primary antibodies directed against SARS Nucleocapsid protein (1/500; mouse monoclonal; clone 1C7C7;</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS Nucleocapsid protein</div><div>suggested: (LSBio (LifeSpan Cat# LS-C59557-500, RRID:AB_1510641)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Measure of antiviral activity of cyclophosphamide and cathepsin C inhibitor against SARS-CoV-2 in cell culture: Vero E6 cells (CRL-1586, ATCC maintained at 37 °C; 5% CO2) were seeded at 2.104 cells per well in a 96-well plate in Dulbecco’s Modified Eagle’s Medium, 5% foetal bovine serum (FBS-12A, Capricorn Scientific, Clinisciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All quantifications were made with ImageJ (Rasband, W.S., ImageJ, U.S. National Institutes of Health, Bethesda, Maryland, USA, http://imagej.nih.gov/ii/, 1997–2012) to threshold specific staining.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">iTaq Universal Sybr Green SuperMix (BioRad; #1725124), and primers at 500 nM (sequences in Supp.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioRad</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: All comparisons were made using Prism 5.0 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.15.484439
  158. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.15.22272426
    1
    1. sciscore 18 Mar 2022

      SciScore for 10.1101/2022.03.15.22272426: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Stanford University investigators received anonymized data, and the Institutional Review Board waived the requirement for consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Laboratory Testing for RBD Antibodies: We tested remainder samples using the Siemens total RBD Ig assay, which measures IgG and IgM antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were conducted using SAS, version 9.4 (SAS Institute), or Stata/MP 17 (StataCorp).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS</div><div>suggested: (SASqPCR, RRID:SCR_003056)</div></div><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.15.22272426
  159. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.16.22271983
    1
    1. sciscore 18 Mar 2022

      SciScore for 10.1101/2022.03.16.22271983: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Approximately 0.14% of these tests (896) showed detectable SARS-CoV-2 by reverse transcriptase real-time PCR (rRT-PCR) using the Centers for Disease Control and Prevention (CDC) primers for N1, N2[5].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>N2</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Limitations of our analysis include some inherent subjectivity in traditional epidemiologic investigations that center on an individual remembering all relevant interactions. This study occurred during a phase of the pandemic when the only variants circulating were associated with delta sublineages, and the findings may not apply to other SARS-CoV-2 variants. However, it does not at this point appear that the subsequent rise of the omicron variant increased the risk of in-class transmission. The omicron peak took place during a time when classes were not in session, and the return to class in 2022 was marked by rapidly falling disease incidence on campus despite in-person classes. This pattern is unlike the fall 2021 transmission pattern, where consistent transmission levels were seen over months of in-person classes.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.16.22271983
  160. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.16.22272465
    1
    1. sciscore 18 Mar 2022

      SciScore for 10.1101/2022.03.16.22272465: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: As this method has only been validated for non-enveloped viruses (34), via RNA detection, to validate it for assessing the presence and infectivity of SARS-CoV-2, 10 l of Milli-Q water was spiked with murine hepatitis virus (MHV-A59) to a final concentration of 1.5 × 104 gc/L, and run through the TFUF to test processing efficiency.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">NCTC 1469 cells were used for propagation and infectivity assays of MHV using the manufacturers protocol using DMEM high glucose with 10% horse serum.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NCTC 1469</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation, samples were vortexed, filtered through a 0.22 μM filter and serially diluted to achieve a starting dilution of 200 TCID50/well on Vero E6 cells (41).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      The positive sample was collected downstream from the largest CSO on the Danube River (Pančevo Bridge), where there is a high dilution potential due to an average discharge of 5,600 m3/s in this section of river (13), highlighting the limitations of point samples from surface water for environmental monitoring. Research suggests that high percentages of enveloped viruses (26%) can adsorb to the solid fraction of wastewater (43), that suspended solids may protect viruses from inactivation (44), and that sediments can provide a source of pathogens to the water column (45). Studying the presence of viruses in sediments, rather than water, may provide greater insight into sites that are susceptible to accumulating and harbouring potential pathogens, rather than taking water column point samples, that can suffer from high variability (46). While most studies have focused on the presence of SARS-CoV-2 RNA in wastewater (reviewed by (5), and river water (13,14), very little is known about the potential survival of SARS-CoV-2 in aquatic environments (47,48). Here we tested whether a validated TFUF protocol for the concentration of human non-enveloped enteric viruses from river water (34) could also be used to concentrate an enveloped betacoronavirus, Murine hepatitis virus (MHV). Considering the rigorous biosafety requirements necessary for working with infectious SARS-CoV-2, surrogate viruses, such as MHV, are useful for assessing method performance during monitoring campaigns (49)....

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.16.22272465
  161. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.15.22272362
    1
    1. sciscore 18 Mar 2022

      SciScore for 10.1101/2022.03.15.22272362: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Our study has some limitations: some of the community-level covariates considered are not up-to-date; for instance information on BME population are related to the 2011 Census, hence we are implicitly assuming that the ethnic composition at MSOA level remains the same in the last decade. Furthermore, some variables are available at a coarser spatial resolution: COVID-19 mortality is at Local Authority districts (LAD), while political views are available at constituency level. In the analysis we assign the same value to all the MSOAs within the same LAD or constituency, leading to an underestimate of the variability at MSOA level and potentially a reduction in the association with those variables. Finally, the ecological nature of the study means that we cannot infer causal links between covariates and vaccination uptake [27]. Despite the good coverage of COVID-19 vaccine uptake at the national level, our results suggest that a year after the start of the vaccination campaign there are still substantial inequalities, most importantly related to deprivation and ethnicity. These have been highlighted from the beginning of the campaign (e.g. [14]) and have been later linked to general distrust in vaccines, low perception of risk as well as cultural/religious barriers [12, 52]. As they persist while the pandemic evolves, it is necessary to prioritise engagement through relevant figures, such as general practitioners, scientists and a wide spectrum of role models coming from these ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.15.22272362
  162. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.15.22272438
    1
    1. sciscore 18 Mar 2022

      SciScore for 10.1101/2022.03.15.22272438: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The proposed scoping review is guided by the framework described by Arksey and O’Malley [70], and further developed by the Joanna Briggs Institute [71].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>O’Malley</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The research sub-questions are: Information sources and search strategy: We developed the following list of databases to search in consultation with a specialist research librarian: Medline, Embase,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Medline</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div><div style="margin-bottom:8px"><div>Embase</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cochrane CENTRAL, Cochrane Covid-19 Study Register, PsychINFO, Sociological Abstracts, and the International Bibliography of the Social Sciences (IBSS).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cochrane CENTRAL</div><div>suggested: (Cochrane Central Register of Controlled Trials, RRID:SCR_006576)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Based on Cochrane Rapid Reviews Methods Group guidance [74], once a threshold of ≥ 90% is achieved, remaining titles and abstracts will be assessed by one reviewer; all excluded titles and abstracts will then be reviewed by the lead researcher.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cochrane Rapid Reviews</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Strengths and limitations: This scoping review will only include peer-reviewed articles published from January 2020 focused on COVID-19 vaccines; however previous and concurrent research on the phenomenon of VH for other vaccines may provide helpful information. WHO [44,64], the Vaccine Confidence Project [63,65], and other researchers [46] indicate the importance of examining VH specific to a particular vaccine and contextual factors. The review will be inclusive of the U.S. and Canada given similarities as high-income countries and western democracies with the world’s longest international border and a high degree of economic integration, and their collaboration in response to the COVID-19 pandemic, including availability of free COVID-19 vaccination [80]; nevertheless, distinct healthcare systems, histories, and ideologies may constitute important differences around VH among marginalized populations, which we will also explore. Finally, challenges in determining which populations may be most accurately characterized by marginalization may result in omission of some subpopulations. In order to support rigor, we apply an a priori definition of “marginalization” and an initial list of potential populations subsumed within this definition (based on peer-reviewed and government sources [76,79]); and we will use a rigorous process of screening and consensus in the context of ongoing team meetings to adjudicate conflicts in inclusion/exclusion.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.15.22272438
  163. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.15.484448
    1
    1. sciscore 18 Mar 2022

      SciScore for 10.1101/2022.03.15.484448: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animals and experimental setup: Female Syrian golden hamsters (Mesocricetus auratus; 6 weeks old; Janvier, France) were handled in an ABSL-3 biocontainment laboratory (Supplementary material).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Cells were tested negative for mycoplasma.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plaque assay: All throat swabs, nasal washes and tissue samples that were taken post mortem at 5 dpi were used for quantification of viral loads via a plaque assay on Calu-3 cells as described before [15] (Supplemental material).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: KCLB Cat# 30055, RRID:CVCL_0609)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plaque assay analysis was performed using ImageQuant TL 8.2 software (GE Healthcare).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageQuant</div><div>suggested: (ImageQuant, RRID:SCR_014246)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: All statistical analyses were performed using GraphPad Prism 9 software (La Jolla, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.15.484448
  164. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.14.22272325
    1
    1. sciscore 18 Mar 2022

      SciScore for 10.1101/2022.03.14.22272325: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Finally, participant and/or the participant’s legal representative must have provided written informed consent.<br>IRB: The trial protocol and informed consent form were approved by Taiwan Food and Drug Administration (TFDA) and the ethics committees at the conducting sites: Mackay Memorial Hospital Hsinchu (Hsinchu City), Chang-Gung Memorial Hospital Linkou (New Taipei City), Mackay Memorial Hospital (Taipei City), National Taiwan University Hospital Hsinchu (Hsinchu City), and National Taiwan University Hospital (Taipei City).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Additional criteria applied to females only: negative pregnancy test, non-childbearing potential or, if with childbearing potential, abstinence or agreement to use medically effective contraception from 14 days before screening to 30 days following the last injection of study intervention.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Eligible participants were those aged 12 (inclusive) to 17 (not legible if the participant turned 18 years old) at the time of randomization, with body mass index (BMI) at or above the third percentile according to World Health Organization (WHO) at the screening visit, and lack of travel within 14 days of screening and lack of any oversea travelling throughout the study period.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Randomization and blinding: All eligible participants were randomized to receive either MVC-COV1901 or placebo in a 6:1 ratio.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For secondary immunogenicity outcomes, comparisons of MVC-COV1901 against placebo were performed by measuring and expressing antigen-specific immunoglobulin titers and neutralizing antibody titers in samples taken at Visit 4 (28 days after the first dose of study intervention), Visit 6 (28 days after the second dose of study intervention), Visit 8 (90 days after the second dose of study intervention) and Visit 9 (209 days after the second dose of study intervention).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific immunoglobulin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunogenicity was analyzed with the per protocol set (PPS) population, which consisted of the individuals who received the planned doses of randomized study intervention per schedule, were seronegative at baseline (neutralizing antibody titer < lower limit of detection at Visit 2), anti-N antibodies negative at Visit 2 and Visit 6, and did not have a major protocol deviations that were judged to impact the critical or key study data.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-N</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The serum-virus mixture was incubated and then added to the plates containing Vero E6 cells, followed by further incubation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Limitations apply to this study. The main limitation is that as this is a phase 2 study where efficacy was not assessed directly, but can only be inferred by established correlates of protection against SARS-CoV-2 [21, 22]. The data presented here make the case for further clinical assessment. Secondly, even though most safety events were grade 1, a small number of grade 3 events were observed that need to be evaluated in a greater study population. Notably, though, no grade 4 events were observed and there were also no cases of AESI and VAED. Other limitations relate to questions regarding the evolution of COVID-19 over the last year that clinical trials are in the process of catching up with. These questions include the duration of the antiviral response over several months after the second dose, the suitability of any given vaccine for current and future virus variants and if there is any additional protection afforded by booster shots. As Taiwan has started administering booster doses for adults including MVC-COV1901, future studies will investigate the suitability of MVC-COV1901 as homologous or heterologous booster after primary vaccination of adolescents.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04951388</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Study to Evaluate MVC-COV1901 Vaccine Against COVID-19 in …</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.14.22272325
  165. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.14.22271847
    1
    1. sciscore 18 Mar 2022

      SciScore for 10.1101/2022.03.14.22271847: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The NIS-ACM conducts telephone interviews from a random-digit-dialed sample of cell telephone numbers stratified by state and the District of Columbia as well as Puerto Rico and the U.S. Virgin Islands.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Even for employees who reported employer requirements, 9.4% remained unvaccinated – this may be the result of the time between the announcements and enforcement of employer requirements, the presence of religious and medical exemptions, degree of enforcement in employer policies, as well as limitations in survey self-report. Vaccination requirements were associated with greater confidence in the importance and safety of COVID-19 vaccines. NIS-ACM’s cross-sectional design precludes conclusions on the directionality of vaccination attitudes and vaccination status – it is possible that vaccination requirements were imposed on HCP with greater confidence in COVID-19 vaccines. However, it is also possible that receipt of COVID-19 vaccines induces greater confidence in its safety and importance, a pattern of post-hoc attitudinal changes seen in other vaccinations and health behavior (Levy-Bruhl, 2019; Hall, 2018). Employer vaccination requirements may also have a role in converting vaccination intent into action. For HCP who report employer requirements, the percentage of vaccinated HCP approximates the percentage who said that the vaccination is important to protect themselves – at 90.5% and 89.6% respectively. For HCP without employer requirements, while 79.6% said that the COVID-19 vaccine is important to protect themselves, only 73.3% are vaccinated. Finally, employer requirements for HCP vaccinations have come months after the initial availability of COVID-19 vaccines in the U...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.14.22271847
  166. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.15.22272348
    1
    1. sciscore 18 Mar 2022

      SciScore for 10.1101/2022.03.15.22272348: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Data gathered through the platform was fully anonymised and made available to the research team by permission of the Ministry of Health, Malawi and the College of Medicine Research Ethics committee (COMREC, P.11/20/3186).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">This is a facility-based cohort study of pregnant and recently pregnant women in Malawi who were suspected and tested for SARS-CoV-2 from the MATSurvey platform from 2nd June 2020 to 1st December 2021 (inclusive of the second and third wave of the COVID-19 Pandemic in Malawi-https://covid19.who.int/region/afro/country/mw) in 33 health facilities.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.15.22272348
  167. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.15.484404
    1
    1. sciscore 18 Mar 2022

      SciScore for 10.1101/2022.03.15.484404: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cleaned FASTA files were uploaded onto SnapGene (version 6.0.2) for multisequence alignment via the MAFFT tool, manual assessment of sequence coverage and inspection of individual mutations.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SnapGene</div><div>suggested: (SnapGene, RRID:SCR_015052)</div></div><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.15.484404
  168. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.15.484379
    1
    1. sciscore 18 Mar 2022

      SciScore for 10.1101/2022.03.15.484379: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Euthanasia Agents: Viral inocula were made in sterile phosphate buffered saline (PBS) and delivered via intranasal instillation (200μL total with 100μL per nare) with animals sedated using isoflurane.<br>IACUC: UKHSA) Porton Down by the Animal Welfare and Ethical Review Body (AWERB) as required by the Home Office Animals (Scientific Procedures) Act 1986.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">The animals were randomly assigned into groups and individually housed, with equal allocation of male and female animals to each study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The animals were randomly assigned into groups and individually housed, with equal allocation of male and female animals to each study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">All slides were evaluated subjectively by a qualified pathologist, blinded to treatment details and were randomised prior to examination to limit bias (blind evaluation).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Staining was performed with the BOND Polymer Refine Detection kit, a rabbit anti-SARS-CoV-2 nucleocapsid antibody (Sinobiological; clone: #001; dilution: 1:5000) and counterstained with haematoxylin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: (Leinco Technologies Cat# LT5000, RRID:AB_2893962)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Membranes were blocked in 5% milk in PBS/0.1% Tween-20 and incubated with anti-HIF-1α (BD Biosciences), anti-β-Actin (Sigma) or SARS-CoV-2 nucleocapsid (EY-2A, a kind gift from Prof Alain Townsend) primary antibodies and appropriate HRP-conjugated secondary antibodies (DAKO).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HIF-1α</div><div>suggested: (Cayman Chemical Cat# 10006421, RRID:AB_409037)</div></div><div style="margin-bottom:8px"><div>anti-HIF-1α (BD Biosciences), anti-β-Actin (Sigma)</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-β-Actin</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus infectivity was determined by plaque assay on Vero-TMPRSS2 cells as previously reported (Wing et al., 2021a)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 cells were infected with the above strain of SARS-CoV-2 at an MOI of 0.01 for 2h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: KCLB Cat# 30055, RRID:CVCL_0609)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FPKM values were enumerated, and differential expression quantified using the DeSeq2 package (Love et al., 2014).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DeSeq2</div><div>suggested: (DESeq2, RRID:SCR_015687)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Membranes were blocked in 5% milk in PBS/0.1% Tween-20 and incubated with anti-HIF-1α (BD Biosciences), anti-β-Actin (Sigma) or SARS-CoV-2 nucleocapsid (EY-2A, a kind gift from Prof Alain Townsend) primary antibodies and appropriate HRP-conjugated secondary antibodies (DAKO).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Biosciences</div><div>suggested: (BD Biosciences, RRID:SCR_013311)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">P values were determined using the Mann-Whitney test (two group comparisons) or with the Kruskal–Wallis ANOVA (multi group comparisons) using PRISM version 8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PRISM</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.15.484379
  169. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.15.22272192
    1
    1. sciscore 18 Mar 2022

      SciScore for 10.1101/2022.03.15.22272192: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study plan was reviewed and approved by the Research Ethics Committee (IRB: EMRP108065).<br>Consent: This study complied with research ethics regulations and the principle of informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      This study had some limitations. First, this was a pilot study conducted at outpatient departments during the COVID-19 pandemic, even though the severity and rate of complications were not high. Second, the decrease in patient visits to the outpatient department due to the COVID-19 pandemic made it difficult to follow up with the patients. We intend to continue data collection and analysis to examine more interesting findings.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.15.22272192
  170. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.14.484288
    1
    1. sciscore 18 Mar 2022

      SciScore for 10.1101/2022.03.14.484288: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: The use of tissue specimens collected at Semmelweis University in this study was approved by the Hungarian Scientific Research Ethics Committee (ETT TUKEB IV/3961-2/2020/EKU).<br>IRB: The use of tissue specimens collected at Semmelweis University in this study was approved by the Hungarian Scientific Research Ethics Committee (ETT TUKEB IV/3961-2/2020/EKU).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spatial Transcriptomics Hematoxylin & Eosin Imaging: Hematoxylin & Eosin brightfield images were acquired with a Zeiss Axiolmager.Z2 VSlide Microscope using the Metasystems VSlide scanning system with Metafer 5 v3.14.179 and VSlide software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Metafer</div><div>suggested: (Metafer, RRID:SCR_016306)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The DE genes distinguishing SARS-CoV-2+ spots from SARS-CoV-2- spots were obtained as described in the Methods section “Differential Gene Expression” with an additional filter of average logFC +/-1.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene Expression”</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Validation by RNAScope: RNAScope and ST images were manually aligned with Adobe Photoshop 2022.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Adobe Photoshop</div><div>suggested: (Adobe Photoshop, RRID:SCR_014199)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The computational validation was performed as follows: the RNAScope signal was detected with an ad hoc Matlab (version R2021b) algorithm, which is specified in the next section “Automatic detection of RNAScope signal”; then both the binary ST and RNAScope signal images were aligned and binned into 200×200 μm2 blocks (Extended Data Figures 3-4).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Matlab</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      In terms of the general outlook on spatially resolved host-pathogen interactions, limitations of our proposed approach include the requirement of previous knowledge of the pathogen transcriptome of interest to develop targeted probes, the inability to detect different human RNA splice variants, the lack of capturing human non-coding RNA groups that may have important regulatory functions, and the inability to detect new viral variants since the viral RNA is not directly sequenced. However, probes targeting specific host RNAs of interest could be developed to overcome some of these shortcomings. In conclusion, the proposed method enables insights into highly localized host response to pathogen infection within the spatial context of the tissue microenvironment at the whole-transcriptome level in an unbiased and high-throughput manner. The method has the potential to be applied to other human pathogens with the development of targeted probes and thus examine the interplay between host and pathogen across the multitude of human infectious diseases. Overall, our approach opens the door to new possibilities of studying infectious disease at a large scale by exploring multiple transcriptomes in a single experiment.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.14.484288
  171. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.15.22272350
    1
    1. sciscore 18 Mar 2022

      SciScore for 10.1101/2022.03.15.22272350: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This trial was reviewed and approved by the Institutional Review Board of the Faculty of Medicine, Chulalongkorn University (1425/2021) and registered in the Thai Clinical Trial Registry (TCTR20211220004).<br>Consent: Participants meeting eligibility criteria were invited to participate in the study and provided written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The cellular immune responses were measured by human IFNγ-ELISpot assay (ELISpot) in a random subset of patients.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We chose the anti-RBD IgG (Abbott Diagnostics) cut-off value of 2,360 BAU/mL (16,503 AU/mL) as it corresponded to vaccine efficacy of 90% for wild-type8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was performed using JMP software V.13.2.1 (SAS Institute, Cary, North Carolina, USA) and dot-plot graphs were created using GraphPad Prism V.4.03 (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>JMP</div><div>suggested: (JMP, RRID:SCR_014242)</div></div><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(GraphPad Software, La Jolla, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      It should be noted that there were several limitations to this study. The findings are observational and based on a small sample size, so they should be interpreted with caution. The results may not be generalizable to other autoimmune rheumatic conditions, other immunosuppressive regimens such as B-cell depletion therapy, or initial mRNA vaccine series. The immunosuppressive load calculation was adapted from the prior study which was arbitrarily determined. In conclusion, this study demonstrated that the third BNT162b2 booster was well tolerated and significantly improved humoral and cellular immunogenicity in SLE and RA patients. The intensity of immunosuppressive therapy and the type of initial vaccine appear to affect the humoral immune response to the third booster. In poor humoral responders, a fourth BNT162b2 booster administered at a short interval may not provide additional protection against the omicron variant. Our finding that severe flares were observed in SLE patients after the fourth booster is also cause for caution and additional research on the appropriateness of a fourth booster and the timing of such booster in our population.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.15.22272350
  172. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.15.484274
    1
    1. sciscore 18 Mar 2022

      SciScore for 10.1101/2022.03.15.484274: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation for 1 hour with AlexaFluor 405-labeled spike protein antibodies (FAB105403V, 1:100), absorbance was measured at 405 nm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>spike protein antibodies (FAB105403V</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells grown on glass slides were infected and stained using anti-VE-Cadherin mouse monoclonal IgG1 antibody, conjugated to AlexaFluor 488 (F-8 sc-9989, 1:100), overlaid onto Fluoroshield mounting medium (ab104139).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-VE-Cadherin</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-9989, RRID:AB_2077957)</div></div><div style="margin-bottom:8px"><div>IgG1</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-9989, RRID:AB_2077957)</div></div><div style="margin-bottom:8px"><div>Fluoroshield mounting medium</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Proteins (10 μg) were loaded into an SDS-PAGE and stained using anti-VE-Cadherin mouse antibodies (F-8, sc-9989, 1:200) followed by anti-mouse secondary antibodies (sc-525405, 1:5000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.15.484274
  173. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.15.484421
    1
    1. sciscore 18 Mar 2022

      SciScore for 10.1101/2022.03.15.484421: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Based on this knowledge, the neutralising antibodies which bind to the distinct epitope sites of the spike RBD were selected - the S23029 (PDB ID: 6NB7) and the CC12.130 (PDB ID: 6XC2) binding the receptor binding site region, the REGN1098731 (PDB ID: 6XDG) and S30932 (PDB ID: 6WPS) attaching at the proteoglycan site44 and the ones binding the CR302228 site (PDB ID: 6ZLR).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S30932</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Molecular dynamics (MD) Simulation studies: All molecular dynamics simulations were performed with GROMACS version 2021.447.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GROMACS</div><div>suggested: (GROMACS, RRID:SCR_014565)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The initial structures for the Delta and Omicron mutant were obtained by docking the antibody into a representative structure of the RBD, obtained from a MD simulation, with ClusPro 2.0 as discussed above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ClusPro</div><div>suggested: (ClusPro, RRID:SCR_018248)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.15.484421
  174. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.15.484018
    1
    1. sciscore 18 Mar 2022

      SciScore for 10.1101/2022.03.15.484018: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Experimental procedure involving live animals were carried out in agreement with the protocol (#HA20M310) approved by the Institutional Animal Care and Use Committee (IACUC) at The Johns Hopkins University School of Medicine.<br>Euthanasia Agents: Animals were randomly assigned to be euthanized by isoflurane overdose at end points (day 4 and day 7) following SCV2 infection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animals: In vivo experiments involving BCG vaccination and SCV2 infection were carried out using male golden Syrian hamsters (Mesocricetus auratus).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Individual seed-stock vial was randomly picked from frozen stock and was subsequently propagated in 7H9 medium before immunization.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Protein expression was scored by a board-certified pulmonary pathologist blinded to cohort status or treatment group.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following antibodies were used for cell surface staining: anti-CD3 (Bio-Rad, #MCA1477PB, CD3-12), anti-CD4 (BioLegend, #100451, GK1.5), anti-CD11b (Novus, #NB110-89474PECY7, Poly), and anti-RT1D (BioLegend, #110211, 14-4-4S).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD4</div><div>suggested: (BioLegend Cat# 100451, RRID:AB_2564591)</div></div><div style="margin-bottom:8px"><div>anti-CD11b</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-RT1D</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibody for CD3 (1:200 dilution; Cat# RM-9107-S1, Thermo Fisher Scientific) was incubated for 30m at 4 °C and detection was achieved using UltraView DAB detection kit (Roche).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD3</div><div>suggested: (Thermo Fisher Scientific Cat# RM-9107-S1, RRID:AB_149924)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero C1008 [Vero 76, clone E6, Vero E6] (ATCC CRL-1586) cells were used for viral growth and determination of virus stock titers.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero C1008</div><div>suggested: ECACC Cat# 85020206, RRID:CVCL_0574)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 cells were grown in MEM with 10% fetal bovine serum (FBS), L-glutamine, and penicillin-streptomycin at 37°C with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were passed through a 70 μm filter and washed twice using ice-cold PBS followed by RBC lysis using ACK lysis buffer (Thermo Fisher Scientific: A1049201) at room temperature for 5 minutes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo Fisher Scientific</div><div>suggested: (Thermo Fisher Scientific, RRID:SCR_008452)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following antibodies were used for cell surface staining: anti-CD3 (Bio-Rad, #MCA1477PB, CD3-12), anti-CD4 (BioLegend, #100451, GK1.5), anti-CD11b (Novus, #NB110-89474PECY7, Poly), and anti-RT1D (BioLegend, #110211, 14-4-4S).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Poly</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed three times using FACS buffer and acquired using BD LSRII with FACSDiva Software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FACSDiva</div><div>suggested: (BD FACSDiva Software, RRID:SCR_001456)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analyses was carried out using FlowJo (v10) (TreesStar).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differentially expresses genes (DEGs) and pathway analysis: The FindMarker function in Seurat package was performed to identify differentially expressed genes between BCG-WT + SCV2 and SCV2 groups in a particular cell cluster.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Seurat</div><div>suggested: (SEURAT, RRID:SCR_007322)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GO term enrichment analysis of the DEGs was performed using Metascape (www.metascape.org) (63).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Metascape</div><div>suggested: (Metascape, RRID:SCR_016620)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Despite being a well-defined animal model of COVID-19 with human-like pathology, one key limitation of using golden Syrian hamsters is the limited immunological resources such as well-characterized and validated antibodies (anti-CD8 Abs for example) and the relative paucity of immunologic data on hamster immune responses for correlation with our scRNAseq data. Along these lines, it was surprising that no CD8+ T cells were observed across the hamster groups even though they have been well-described in human scRNAseq studies of BAL samples in SCV2 (57, 58). While BCG vaccination is routinely used in most countries as a TB prevention, the vaccine is generally given intradermally, and recent human studies showing protection by BCG against COVID-19 disease also used intradermal BCG (13). Like other animal studies using BCG in animal models of SCV2 (28) we used the intravenous route based on literature that IV BCG is far more potent against tuberculosis in non-human primates, and evidence that IV BCG reprograms bone marrow hematopoietic stem cells towards a more protective state against bacterial challenge (22). Nevertheless, SCV2 animal studies using percutaneous BCG have shown significant immunologic benefits at the level of flow cytometry (29), and we anticipate that many of the scRNAseq shifts which we observed in IV BCG vaccinated hamsters would be present following intradermal BCG albeit potentially at a lower level. In summary, our study reveals that BCG vaccination reduces ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.15.484018
  175. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.14.22272316
    1
    1. sciscore 17 Mar 2022

      SciScore for 10.1101/2022.03.14.22272316: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All study materials (i.e. participant information, informed consent form, and a standardised questionnaire) were included in the letter.<br>IRB: The study was conducted according to the Declaration of Helsinki, and ethical approval was obtained from the respective ethical review boards of the study centres in Freiburg (21/1484) and Ulm (337/21).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The identified symptom clusters were visualised by means of a co-occurrence network using Gephi 0.9.2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gephi</div><div>suggested: (Gephi, RRID:SCR_004293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical procedures were performed with the SAS statistical software package (release 9.4 SAS Institute Inc.) or R version 4.1.2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Limitations include the self-reported nature of symptoms and sequelae without medical validation. Also, reporting bias has to be considered when reporting symptoms from the past, especially in subjects with neurocognitive sequelae. Furthermore, we had a limited response with some overrepresentation of older persons and female sex (appendix, table S4). Our study regions were located around medium sized university cities, with respondents having higher education than the general population, which may limit generalizability. As we only have a before-after comparison within infected subjects, we cannot differentiate between the impact of the pandemic itself and its consequences such as non-pharmaceutical and public health interventions on symptoms and symptom reporting from direct consequences of the virus infection. Finally, we used only one specific method for symptom clustering and cannot exclude that other methods would define different and presumably larger clusters.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.14.22272316
  176. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.13.484191
    1
    1. sciscore 17 Mar 2022

      SciScore for 10.1101/2022.03.13.484191: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1.0 [35] and Ligplot+ v.2.2 [36] were used to assess binding affinity energy and different types of interactions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ligplot+</div><div>suggested: (LigPlot+, RRID:SCR_018249)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.4.1 (The PyMOL Molecular Graphics System, Version 2.0 Schrödinger, LLC) and VMD v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.13.484191
  177. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.09.22272170
    1
    1. sciscore 17 Mar 2022

      SciScore for 10.1101/2022.03.09.22272170: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Limitations: This study utilised Omicron data publicly available from mid-January 2022 up to late February 2022. Given that the emergence of this variant occurred in November 2021, further data may allow us to refine our findings. For example, there is limited data on the duration of immunity resulting from Omicron infection, and the long-term waning effects of booster vaccinations. In the absence of further data, we assumed protection against symptomatic disease to be a proxy for vaccine effectiveness against infection. We have used UK data sources given their rapid availability, and the scale and earlier occurrence of Omicron outbreaks in the UK compared to Australia. Use of UK data is appropriate given the similar population demographics, healthcare systems, and vaccination rates in both countries. We have assumed that the behaviour of the population does not change over the course of the modelled epidemic, and that limited mandated physical distancing measures and self-adopted social distancing remains constant. This level of NPI measures is implicitly modelled using data from Omicron outbreaks in two Australian states to derive our effective reproduction number, and thus the probability of transmission between infectious/susceptible pairs of individuals. However, this assumes population behaviour remains constant over the course of an outbreak, which may not be the case. Awareness of increasing case numbers may cause individuals to reduce movement and contacts and lead t...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.09.22272170
  178. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.14.22272359
    1
    1. sciscore 17 Mar 2022

      SciScore for 10.1101/2022.03.14.22272359: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data would be collected at the step of 55°C extension. 2.4 Quantification of biomarkers: 2.4.1 Detection of pMMoV viral concentration: The TaqMan probe (pMMoV Probe) and the primer pair (pMMoV Forward and pMMoV Reverse, Table 2) were designed and used to target the pMMoV RNA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMMoV</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.3 Detection of SARS-CoV-2 concentration: 2.3.1 RNA extraction from wastewater samples: Fifty mL of wastewater from each catchment was filtered through a 0.22-micron filter (Millipore cat# SCGPOO525).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: (Active Motif Cat# 91351, RRID:AB_2847848)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The specificity of primers and probe were tested by BLAST analysis (NCBI) to prevent known nonspecific binding targets that could be obtained in a human specimen.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.14.22272359
  179. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.11.484006
    1
    1. sciscore 17 Mar 2022

      SciScore for 10.1101/2022.03.11.484006: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero cells (ATCC) were seeded in 96-well clear CellBind plates (Sigma Aldrich) 24 hours prior to the experiment at a density of 40,000 cells/well in a 100 μL volume of complete DMEM supplemented with 10% inactive FBS and 1% of penicillin/streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, plasmids expressing a lentiviral backbone encoding the luciferase reporter gene (BEI NR52516), the HIV structural and regulatory proteins Tat (BEI NR52518), Gag-pol (BEI NR52517) and Rev (BEI NR52519), and the full-length SARS-CoV-2 S protein were co-transfected into human kidney HEK293T cells (ATCC, CRL-3216) using the BioT transfection reagent (Bioland Scientific) following the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization was determined in a single-cycle neutralization assay using HeLa cells expressing ACE2 (HeLa-ACE2), kindly provided by D.R. Burton; The Scripps Research Institute, and Vero E6 cells constitutively expressing the transmembrane protease, serine 2 (Vero-TMPRSS2), obtained from the Centre For AIDS Reagents (National Institute for Biological Standards and Control) [51, 52].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: CLS Cat# 300194/p772_HeLa, RRID:CVCL_0030)</div></div><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HeLa-ACE2 and Vero-TMPRSS2 cells were prepared following the above-mentioned protocol, where 10,000 cells/well of pre-seeded cells were co-cultured with the same serial dilutions of the sample compounds at 37°C for 2 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa-ACE2</div><div>suggested: JCRB Cat# JCRB1845, RRID:CVCL_B3LW)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Authentic SARS-CoV-2 Neutralization and Titer Assay: Authentic SARS-CoV-2 experiments were conducted using Vero’76 (ATCC, CRL-1587) or Calu-3 (ATCC, HTB-55) cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero’76</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: ATCC Cat# HTB-55, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The assay was performed using Vero-TMPRSS2 cells following the above protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Similarly, the wild-type S plasmid was substituted with plasmids codifying for the B.1.117 or B.1.351 SARS-CoV-2 S proteins (kindly provided by David Ho, Columbia University) or B.1.1.529 (synthesized and cloned by GeneArt, LifeTechnologies into pcDNA3.4 expression vector) to generate the corresponding SARS-CoV-2 pseudoviral particle (PsV) variants.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.4</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data was plotted using Prism 9 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.11.484006
  180. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.10.22272213
    1
    1. sciscore 17 Mar 2022

      SciScore for 10.1101/2022.03.10.22272213: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Sampling strategies included random sampling (ranging from 5-100% of cases at different periods) and targeted sampling (outbreaks and targeted populations such as travellers)25.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Consensus sequences were generated using the Connor Laboratory pipeline (https://github.com/connor-lab/ncov2019-artic-nf) with consensus bases called at a frequency of 0.75 with a subsampling read count strategy.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Connor Laboratory</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Consensus sequences were aligned and trimmed to Wuhan-Hu-1 reference sequence (Accession MN908947, Version MN908947.3) using MAFFT (v7.471) 27 prior to phylogenetic tree production.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenetic analyses: A multiple sequence alignment of the full SARS-CoV-2 genome was used to construct maximum-likelihood (M-L) phylogenetic trees with IQ-TREE (v.2.1.3) 28.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IQ-TREE</div><div>suggested: (IQ-TREE, RRID:SCR_017254)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      One limitation of our study is that we do not have exposure, contact or location information to explore this application. Sequences belonging to a P.1 sublineage (P.1.14) form a single, large cluster (illustrated as the red cluster in the delta wave dataset in Figure 2), coinciding with a high number of low-diversity P.1 cases present in BC from April 2021 onwards 22, where almost all P.1 samples were within 0-1 SNPs of another P.1 sequence. This phenomenon is also expected with the recent Omicron variant, where rapid spread has led to high numbers of low diversity cases 23. Increasing the probability threshold to 0.9 (or conducting phylogenetic clustering with a smaller maximum clade divergence threshold) breaks up the cluster into smaller groups of identical or near-identical sequences, but this does not reflect genuine underlying clustering (Supplementary figure S2). In such circumstances, we recommend including additional metadata to refine clusters into genetically related groups with shared demography and epidemiology. Alternatively, our approach could be used as a surveillance tool focusing on a particular individuals or settings of interest, identifying sequences that are linked to the focal individuals or exposure sites, moving outwards to a desired number of “rings”. While COVID-19 remains at pandemic levels with high case numbers in many regions globally, it is anticipated that there will be a shift to endemicity characterized by persistent, lower levels of the dis...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.10.22272213
  181. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.14.22272368
    1
    1. sciscore 17 Mar 2022

      SciScore for 10.1101/2022.03.14.22272368: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Data use in this project was authorized under Section 45 of Ontario’s Personal Health Information Protection Act, which does not require review by a Research Ethics Board. Outcomes: Our primary outcome of interest was COVID-19-related death, defined as death within 30 days following, or 7 days prior to a positive SARS-CoV-2 test.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 test result and date were determined based on records in Ontario Laboratory databases, and the COVID-19 surveillance system (Case and Contact Management System (CCM)).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ontario Laboratory</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Limitations include the potential for misclassification biases due to lack of data on the cause of death. Based on the Ontario COIVD-19 surveillance data, 92% of recorded all-cause death among individuals diagnosed with COVID-19 occurred within 30 days following or 7 days prior to a positive test (Appendix-Figure-2). Other settings have adopted similar definition of COVID-19-related death to capture the immediate impact of COVID-19 on death(44). Individuals who do not have a health card number were not captured; and if they were more likely to be socially and structurally vulnerable, our estimates might have under-estimated the inequalities. We were restricted to area-level SDOH measures in the absence of individual-level SDOH measures, leading to the potential for residual confounders by SDOH. However, our findings were similar in pattern to that of other studies using individual-level SDOH measures(3, 15), suggesting a lower risk of ecological fallacy. Almost all areas with the highest quintile proportion racialized groups were urban areas. Therefore, our estimated associations between racialized groups and COVID-19-related mortality are subject to residual confounding by individual’s residence in rural vs urban areas. However, stratified analysis by rural/urban revealed that structural inequalities in COVID-19-related mortality by racialized groups were present in both settings (Appendix-Table-5). We did not examine the potential modifying effect by age or region, nor the ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.14.22272368
  182. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.15.22272371
    1
    1. sciscore 17 Mar 2022

      SciScore for 10.1101/2022.03.15.22272371: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Patients and samples: Serum and nasopharyngeal swab samples were collected from individuals with written informed consent approved by the Ethics Committee of the Colombian National Health Institute (CEMIN)-04-2021.<br>IRB: Patients and samples: Serum and nasopharyngeal swab samples were collected from individuals with written informed consent approved by the Ethics Committee of the Colombian National Health Institute (CEMIN)-04-2021.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Serum samples were collected from immunologically naïve individuals between 9 and 13 weeks after receiving the complete regimens of BNT162b2 (n = 31; 3 males and 28 females, age range, 23–62 years), CoronaVac (n = 30; 9 males and 21 females; age range 18–58 years), ChAdOx1 (n = 20; 10 males and 10 females; age range 50 –81 years) or Ad26.COV2.S (n = 26; 9 males and 17; age range 21 –61 years).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The absence of total (IgG/IgM) anti-S antibodies before vaccination was verified using the SARS-CoV-2 Total assay (COV2T, Siemens Healthcare Diagnostics Inc., NY, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The absence of IgG anti-nucleoprotein antibodies during clinical follow-up of individual vaccinated with BNT162b2, ChAdOx1, Ad26.COV2.S was verified using the qualitative ELISA ID Screen SARS-CoV-2-N IgG Indirect (ID Vet, Montpellier, France), following the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-nucleoprotein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, the concentration of anti-spike IgG antibodies was tested using the SARS-CoV-2 IgG assay (sCOVG, Siemens Healthcare Diagnostics Inc., NY, USA) on the ADVIA Centaur XPT platform (Siemens).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-spike IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Microneutralization and binding antibody assays: Microneutralization assays with infectious viruses were performed in Vero E6 monolayers as described (4), by incubating 120 mean tissue culture infectious doses (TCID50) of SARS-CoV-2 isolates belonging to the lineages B.1.111, P.1 (Gamma), B.1.621 (Mu), and AY.25.1 (Delta), with two-fold serial dilutions (1:4 to 1:2560) of sera from vaccinated volunteers.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was performed using GraphPad PRISM 6.0.1 (GraphPad Software, San Diego CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad PRISM</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.15.22272371
  183. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.11.483867
    1
    1. sciscore 17 Mar 2022

      SciScore for 10.1101/2022.03.11.483867: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The protein band was detected with HRP-conjugated anti-Hisx6 antibody (Proteintech, #HRP-66005).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Hisx6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mixture was diluted 50 times with HBSS and incubated at 37 °C for 1 h, 100 μL of which was subsequently added to 1.5 × 105 ACE2-expressing 293T cells and incubated at 37 °C for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus stocks were prepared in Vero E6 (ATCC) and titers were determined by plaque assays on Vero-E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralizing assays were performed in 293T-ACE2 cells (15,000 cells per well) in a white opaque 96-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nanobody expression and purification: Plasmid pBAD-H11D4, pBAD-MR17K99Y, or pBAD-SR was transformed into E. coli BL21(DE3) for wildtype protein expression.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBAD-SR</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmid pBAD-H11D4 (27TAG), pBAD-H11D4 (30TAG), pBAD-H11D4 (100TAG), pBAD-H11D4 (112TAG), pBAD-H11D4 (115TAG), pBAD-H11D4 (116TAG), pBAD-MR17K99Y (99TAG), pBAD-MR17K99Y (101TAG), pBAD-SR4 (37TAG), pBAD-SR4(54TAG), or pBAD-SR4 (57TAG) was co-transformed respectively with plasmid pEVOL-FSYRS into E. coli BL21(DE3) for FSY incorporated protein expression.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBAD-H11D4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pBAD-MR17K99Y</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pBAD-SR4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pEVOL-FSYRS</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were transfected with 25 μg pcDNA-ACE2-34TAG and 25 μg pMP-FSYRS plasmids according to manufacturer’s protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA-ACE2-34TAG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pMP-FSYRS</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      A potential caveat is that the cross-linking rate can be negatively impacted when the binding affinity between protein drug and target decreases drastically due to target mutation, such as mNb6(108FFY) and Beta RBD. In rare cases, mutation can even occur at the cross-linking residue, which would abolish cross-linking at that site. However, as we demonstrated here and previously,19 44 PERx is a general strategy that can be applied on diverse nanobodies and each nanobody can have FFY incorporated at multiple sites to target different natural residues on Spike RBD to achieve crosslink (Figure 3). Therefore, other nanobodies able to bind mutated Spike RBD could be similarly engineered, and diverse covalent nanobodies could be used in combination to ensure the cross-linking and inhibition of future potential variants. When in use, the irreversible cross-linking ability together with multi-targeting of these covalent nanobodies should achieve complete viral inhibition and mechanistically prevent drug resistance. Nonetheless, animal tests and clinical trial are warranted to confirm these potential benefits of covalent protein drugs. Fast reaction kinetics would be critical for effective inhibition of viral infection, as it enables covalent crosslinks to promptly form between the protein drug and the target within a shorter contact time, and to reach higher extent for more effective neutralization. By introducing electron withdrawing fluorine substitution we designed and genetically ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.11.483867
  184. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.14.22270915
    1
    1. sciscore 17 Mar 2022

      SciScore for 10.1101/2022.03.14.22270915: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Inclusion criteria were as follows: 1) adult patients ≥18 years old, of any gender, 2) positive polymerase-chain-reaction (PCR) test for SARS-CoV-2 RNA in nasopharyngeal swab, 3) pulmonary infiltrates suggestive of COVID-19, 4) SRF as defined by PaO2/FiO2<100 mmHg, 4) written informed consent from the patients or legal representatives for the current compassionate therapeutic protocol.<br>IRB: The study protocol design was approved by the local scientific and ethics committees and institutional review board of the University Hospital of Alexandroupolis (Ref. No. 87/08-04-2020).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">For that purpose, all scale variables were turned into binary ones with the use of Optimal Scaling along with ridge regression, random initial configuration and bootstrapping.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was performed using SPSS 26.0 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT05279391</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Combination of Inhaled DNase, Baricitinib and Tocilizumab in…</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.14.22270915
  185. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.14.22272130
    1
    1. sciscore 17 Mar 2022

      SciScore for 10.1101/2022.03.14.22272130: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants had signed an informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RV GLS more than -20% was considered as pathological [6] Statistical analysis: Statistical analyses were performed using SPSS (Statistical Program for Social Sciences) version 20.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div><div style="margin-bottom:8px"><div>Statistical Program</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Study limitations: Our study has some limitations. First, three dimension echocardiography as well as circonferencial and radial strain were not performed. Second, echocardiography was not performed during acute phase of COVID-19 infection. Moreover, cardiac magnetic resonance imaging and cardiac computed tomography imaging were not performed.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.14.22272130
  186. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.14.22272351
    1
    1. sciscore 17 Mar 2022

      SciScore for 10.1101/2022.03.14.22272351: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.14.22272351
  187. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.14.22272283
    1
    1. sciscore 17 Mar 2022

      SciScore for 10.1101/2022.03.14.22272283: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">To comply with CPRD’s data minimisation policy, we randomly sampled non-migrants from the reduced initial cohort at a ratio of 1:4 migrants to non-migrants and then linked this cohort to IMD data.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To account for migrants’ younger age at cohort entry, later cohort entry, shorter time between entering the CPRD GOLD database and entering the cohort, and shorter follow-up time, we conducted two pre-pandemic and one ITS sensitivity analyses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GOLD</div><div>suggested: (GOLD, RRID:SCR_000188)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Limitations of our study include the under-recording of migration-related indicators in EHRs, which could result in migrants being misclassified as non-migrants (20) and a selection bias towards migrants who are more engaged with primary care. These biases would likely result in an underestimation of differences between groups. As we reported previously, the migration code list used in this study is less representative of migrants aged over 50 (20). As a result, findings concerning older migrants should be interpreted with caution. Another limitation is the lack of power in the 18-category ethnicity ITS analysis; these findings should also be interpreted with caution. Our study could also have been affected by changes in size and composition of the migrant population during the study period due to the pandemic itself and/or other factors e.g. the UK’s exit from the EU. We found pronounced widening of differences between migrants’ and non-migrants’ consultation rates in both White British and White non-British groups, who may represent EU migrants. The lack of timely de-registration of migrants who leave GP practices and/or emigrate from the UK could contribute to a greater amount of false follow-up time (i.e. a numerator-denominator bias) and, thus, an underestimation of consultation rates. Finally, we provide quantitative evidence on migrants’ primary care utilisation, which is useful for service planning; however, we did not assess clinical need and, therefore, cannot make ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.14.22272283
  188. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.12.484088
    1
    1. sciscore 17 Mar 2022

      SciScore for 10.1101/2022.03.12.484088: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: In all studies, written informed consent was obtained from each participant.<br>IRB: Blood samples were obtained after written informed consent from adults with PCR-confirmed SARS-CoV-2 infection who were enrolled in a prospective cohort study at the Africa Health Research Institute approved by the Biomedical Research Ethics Committee at the University of KwaZulu–Natal (reference BREC/00001275/2020).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For RBD expression experiments, 45 OD units of yeast were labeled in 1:100 diluted chicken-anti-Myc-FITC antibody (Immunology Consultants CMYC45F) to detect the RBD’s C-terminal Myc tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Myc tag .</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These measurements were used in downstream steps to computationally filter library variants that were highly deleterious for RBD expression or ACE2 binding and would likely represent spurious antibody-escape mutations (see below for details).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the plasma incubations, the libraries were secondarily labeled for 1 hour with 1:100 fluorescein isothiocyanate-conjugated anti-MYC antibody (Immunology Consultants Lab, CYMC-45F) to label for RBD expression and 1:200 Alexa Fluor-647-conjugated goat anti-human-IgA+IgG+IgM (Jackson ImmunoResearch 109-605-064) to label for bound plasma antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-MYC</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human-IgA+IgG+IgM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, version 0.8.10) to process Illumina sequences into counts of each barcoded RBD variant in each pre-selection and antibody-escape population.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-escape population .</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">S4B), and are the counts of variant v in the RBD library after and before enriching for antibody-escape variants with a pseudocount of 0.5 added to all counts, and and are the total counts of all variants after and before the antibody-escape enrichment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-escape enrichment .</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody binding was detected with TMB/E HRP substrate (Millipore Sigma, ES001) and 1 N HCl was used to stop the reaction.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ES001</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The multidimensional scaling in Fig 4 and 5 that projects the antibody-escape maps into two dimensions was performed using the Python scikit-learn package, version 1.0.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-escape</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate spike-pseudotyped lentiviral particles (58), 6 × 105 HEK-293T (ATCC CRL-3216) cells per well were seeded in 6-well plates in 2 mL D10 growth media (Dulbecco’s Modified Eagle Medium with 10% heat-inactivated fetal bovine serum, 2 mM l-glutamine, 100 U/mL penicillin, and 100 µg/mL streptomycin).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: ATCC Cat# CRL-3216, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">100 µL of serially diluted spike-pseudotyped lentiviral particles were added to 1.25 × 104 293T-ACE2 cells (BEI Resources NR-52511), grown overnight in 50 µL of D10 growth media in a 96-well black-walled poly-L-lysine coated plate (Greiner Bio-One, 655936)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Note that these assays were performed in 293T cells over-expressing human ACE2, which emphasize contributions of ACE2-competitive antibodies to viral neutralization (3,34,60).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For experiments involving D614G spike, we used spike-pseudotyped lentiviral particles that were generated essentially as described in (58), using a codon-optimized SARS-CoV-2 spike from Wuhan-Hu-1 strain that contains a 21-amino-acid deletion at the end of the cytoplasmic tail (59) and the D614G mutation that is now predominant in human SARS-CoV-2 (25).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Wuhan-Hu-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Depletion of RBD-binding antibodies from polyclonal sera: Magnetic beads conjugated to the SARS-CoV-2 Wuhan-Hu-1 RBD (ACROBiosystems, MBS-K002) or Delta RBD (ACROBiosystems, MBS-K037) were prepared according to the manufacturer’s protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 Wuhan-Hu-1 RBD</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">AWY101 yeast containing an empty vector pETcon plasmid were grown overnight, shaking, at 30°C in SG-CAA media.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pETcon</div><div>suggested: RRID:Addgene_41522)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PacBio HiFi circular consensus sequences (CCSs) were generated on-instrument (Sequel IIe control software version 10.1.0.119549) and demultiplexed with lima using SMRTLink version 10.1.0.119588.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SMRTLink</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The multidimensional scaling in Fig 4 and 5 that projects the antibody-escape maps into two dimensions was performed using the Python scikit-learn package, version 1.0.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div><div style="margin-bottom:8px"><div>scikit-learn</div><div>suggested: (scikit-learn, RRID:SCR_002577)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Our study has several limitations. First, each cohort in this study consists of a relatively small sample size. Due to patterns of SARS-CoV-2 viral circulation and competition among variants (e.g., early 2020, Beta, and Delta viruses circulated during different time periods and in different geographic regions), as well as the introduction of SARS-CoV-2 vaccination in 2021, the cohorts differ with regards to geographic location, age, and time of sample collection. Second, the antibody-escape mapping experiments were performed in a yeast-displayed deep mutational scanning system which only measures antibody binding to the RBD. There is not always a direct relationship between antibody binding and neutralization, as some epitopes are more immunodominant with regards to neutralization than others, and the relative contributions to neutralization of antibodies targeting different spike epitopes may depend on cell type and ACE2 expression level used in the experimental assays (3,34,35). Despite these caveats, our results have important implications for future viral evolution and vaccine design. Due to the rapid antigenic evolution of SARS-CoV-2, public health experts must decide if and when to update SARS-CoV-2 vaccines (51,52). But because each variant elicits an antibody response with its own susceptibilities to erosion by mutation, the impacts of mutations in future variants may depend on prior exposure history. This knowledge will help to understand which vulnerabilities may ex...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.12.484088
  189. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.13.484172
    1
    1. sciscore 17 Mar 2022

      SciScore for 10.1101/2022.03.13.484172: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Biosafety: All in vitro and in vivo experiments with infectious natural isolate or rSARS-CoV-2 were conducted under appropriate biosafety level 3 (BSL3) and animal BSL3 (ABSL3) laboratories, respectively, at Texas Biomedical Research Institute.<br>IACUC: Biosafety (IBC) and Animal Care and Use Committees (IACUC)<br>Euthanasia Agents: Animal infection was performed by intranasally inoculation after being anesthetized following gaseous sedation in an isoflurane chamber.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Five-week-old female K18 hACE2 transgenic mice were purchased from The Jackson Laboratory and five-week-old female golden Syrian hamsters were purchased from Charles River Laboratories.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Multiplex cytokines and chemokines assay: Multiple cytokines and chemokines (IFN-α, IFN-γ, IL-6, IL-10, IL-17A, MCP-1, RANTES, and TNF-α) were measured using a custom 8-plex panel mouse ProcartaPlex assay (ThermoFisher Scientific, catalog# PPX-08-MXGZGFX), following the manufacturer’s instructions.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells, peptides, proteins, antibodies and viruses: African green monkey kidney epithelial cells (Vero E6, CRL-1586) were obtained from the American Type Culture Collection (ATCC, Bethesda, MD) and a Vero E6 cell line expressing hACE2 and TMPRSS2 (Vero AT) was obtained from BEI Resources (NR-54970).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cross-reactive mouse monoclonal antibody against SARS-CoV N protein, 1C7C7, was kindly provided by Dr. Thomas Moran at the Icahn School of Medicine at Mount Sinai.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV N protein , 1C7C7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 2 h incubation, plates were washed 3 time with PBST, then incubated with HRP-conjugated goat anti-mouse secondary antibody (ThermoFisher Scientific, catalog# 31430) at 25°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Thermo Fisher Scientific Cat# 31430, RRID:AB_228307)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation at 37°C for 1 h with constant rotation, mixtures were transferred to confluent monolayers (4×105 cells/well, quadruplicates) of Vero E6 cells (Vero AT cells for o), as previously described 42.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Vero AT</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Multiplex cytokines and chemokines assay: Multiple cytokines and chemokines (IFN-α, IFN-γ, IL-6, IL-10, IL-17A, MCP-1, RANTES, and TNF-α) were measured using a custom 8-plex panel mouse ProcartaPlex assay (ThermoFisher Scientific, catalog# PPX-08-MXGZGFX), following the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MCP-1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Raw reads were quality filtered using Trimmomatic v0.39 37 and mapped to a SARS-CoV-2 USA-WA1/2020 strain reference genome (Genbank Accession No. MN985325) with Bowtie2 v2.4.1 38.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Trimmomatic</div><div>suggested: (Trimmomatic, RRID:SCR_011848)</div></div><div style="margin-bottom:8px"><div>Bowtie2</div><div>suggested: (Bowtie 2, RRID:SCR_016368)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We genotyped each sample for low frequency variants with LoFreq* v2.1.3.1 40 and filtered sites with less than 100x read depth or minor allele frequencies less than 1%.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>LoFreq*</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Finally, we used SnpEff v4.3t 41 to identify the impact of potential variants on the protein coding regions in the SARS-CoV-2 reference genome.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SnpEff</div><div>suggested: (SnpEff, RRID:SCR_005191)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed using FlowJo v10 (Tree Star)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Evaluation of lung pathological lesions: Macroscopic pathology scoring was evaluated using ImageJ software to determine the percentage of the total surface area of the lung (dorsal and ventral view) affected by consolidation, congestion, and atelectasis, as previously described 43.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.13.484172
  190. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.14.22272134
    1
    1. sciscore 17 Mar 2022

      SciScore for 10.1101/2022.03.14.22272134: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.14.22272134
  191. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.13.484037
    1
    1. sciscore 17 Mar 2022

      SciScore for 10.1101/2022.03.13.484037: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirions were generated by co-transfection of HEK293T cells with MLV-gag/pol (Addgene #14887) and MLV-Luciferase (Addgene #170575) plasmids and SARS-CoV-2 spike WT or variants with an 18-AA truncation at the C-terminus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation, 10,000 Hela-hACE2 cells were added to the mixture with 20 µg/ml Dextran (Sigma, 93556-1G) to enhance infectivity.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Hela-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mixture was incubated for 1 h at 37 °C, 5% CO2 before adding to a 24-well plate coated in a subconfluent Vero E6 cell monolayer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression and purification of IgGs and Fabs: The heavy and light chains were cloned into phCMV3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>phCMV3</div><div>suggested: RRID:Addgene_173431)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the RBD (residues 333-529) of the SARS-CoV-2 spike (S) protein (GenBank: QHD43416.1) was cloned into a customized pFastBac vector (38), and fused with an N-terminal gp67 signal peptide and C-terminal His6 tag (9).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pFastBac</div><div>suggested: RRID:Addgene_1925)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Iterative model building and refinement were carried out in COOT (42) and PHENIX (43), respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div><div style="margin-bottom:8px"><div>PHENIX</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fifty percent maximal inhibitory concentrations (IC50), the concentrations required to inhibit infection by 50% compared to the controls, were calculated using the dose-response-inhibition model with 5-parameter Hill slope equation in GraphPad Prism 7 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.13.484037
  192. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.13.484129
    1
    1. sciscore 17 Mar 2022

      SciScore for 10.1101/2022.03.13.484129: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.13.484129
  193. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.13.484123
    1
    1. sciscore 17 Mar 2022

      SciScore for 10.1101/2022.03.13.484123: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.13.484123
  194. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.13.22272281
    1
    1. sciscore 17 Mar 2022

      SciScore for 10.1101/2022.03.13.22272281: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study cohorts: This study was approved by the Institutional Review Boards (IRB) at the NYU Grossman School of Medicine (IRB i20-00601) and University of Rochester Medical Center (IRB STUDY00004889).<br>Consent: All participants provided informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, goat anti-human PE-conjugated IgG and IgA secondary antibodies (Southern Biotech, Cal No:2040-09, 2050-09) were used as the detection reagent.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human PE-conjugated IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA</div><div>suggested: (SouthernBiotech Cat# 2050-09, RRID:AB_2795707)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis and statistical methods: Spearman’s correlations were used to calculate the correlation matrix of the IgA and IgG antibodies concentrations against SARS-CoV-2 (SARS2) full spike, S1, S2, and RBD in both milk and blood.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spearman’s correlations of IgA and IgG antibody levels between milk and blood were also calculated.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The longitudinal anti-S, S1, S2, RBD, and anti-N SARS-CoV-2 specific IgA and IgG antibody responses elicited by COVID-19 mRNA vaccination in milk and fingerstick blood samples were examined using the generalized linear mixed-effects models.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-N SARS-CoV-2 specific IgA and IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Similarly, the longitudinal milk and blood HCoV-reactive IgA and IgG antibody levels against spike proteins of SARS-CoV-2, SARS-CoV-1, OC43, HUK1, 229E, and NL63 were also estimated through generalized linear mixed-effects models.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-1, OC43</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HUK1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The calculation of IgG antibody concentrations against each HCoV virus strain was performed using the Bio-Plex Manager™ 6.2 software (Bio-Rad Co.,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bio-Plex</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Manager™</div><div>suggested: (?Manager, RRID:SCR_016865)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis software SAS V9.4 (SAS Institute Inc., Cary, NC) was used for fitting the generalized linear mixed-effects models and corresponding pairwise comparisons.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      The limitation of low antibody concentration of the fingerstick samples would be a technical challenge to measure the neutralizing antibodies against the OC43, HKU1 in in vitro assays. However, our previous work (20) demonstrated that milk neutralizing anti-SARS-CoV-2 antibodies could be induced by COVID-19 mRNA vaccination and SARS-CoV-2 infection.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.13.22272281
  195. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.14.22272273
    1
    1. sciscore 17 Mar 2022

      SciScore for 10.1101/2022.03.14.22272273: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Interviews: Respondents who consented to interview were randomly selected to take part, stratified by status (case or contact) and index of multiple deprivation (IMD) quintile, based on home postcode.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis: Survey: Analysis used Stata v15.1 (Stata Statistical Software 2017; StataCorp LLC, College Station, TX).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Limitations: Our study is based on a distinct sample of people, who were some of the first COVID-19 cases and their contacts in England, during the first phase of the pandemic response. While this enabled us to gather unique insights into experiences of self-isolation during the early stages of a global pandemic, the sample population is not representative of the wider population. During the early phases of the pandemic response, testing and contact tracing focused on returning holiday makers and travellers and their contacts; consequently, the sample population is primarily White British, of a similar age and from more affluent areas. We attempted to mitigate this by recruiting some interview participants from areas of lower IMD to ensure their experiences were included in the study. However, as the majority of our sample population were from more affluent areas, they may have experienced different barriers to adherence, compared with people for whom access to practical and social support may be more challenging. The low response rate will have introduced response bias, and the delay between respondents being asked to isolate and inviting them to take part in the study (up to 6 months) will have resulted in recall bias as participants may not have been able to accurately recall their behaviours during the early stages of the pandemic. Recall may have been particularly challenging during the early stages of the pandemic, where there was so much uncertainty and rapidly changin...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.14.22272273
  196. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.13.22272267
    1
    1. sciscore 17 Mar 2022

      SciScore for 10.1101/2022.03.13.22272267: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.13.22272267
  197. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.10.22272193
    1
    1. sciscore 16 Mar 2022

      SciScore for 10.1101/2022.03.10.22272193: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical Approval: This study was approved by the Institutional Review Boards (IRB) of Doctors Hospital & Medical Center, Lahore, Pakistan.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">The scans were interpreted by in-house qualified radiologists who were blinded to the clinical data.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analysis was carried out on Stata (Version 16, StataCorp LP, College Station, TX, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.10.22272193
  198. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.10.22271304
    1
    1. sciscore 16 Mar 2022

      SciScore for 10.1101/2022.03.10.22271304: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Patients: Before starting this study, we obtained ethical approval from the Ethical Review Committee of Medical Ethical Committee of Rumah Sakit Universitas Indonesia (RSUI) and followed the principles of the Medical Research Involving Human Subject Act (ETHICAL APPROVAL Nomor: 0042/SKPE/KKO/2021/00).<br>Field Sample Permit: All sampling methods were carried out in accordance with committee guidelines and regulations, and this study was carried out in accordance with the guidelines provided by the Strengthening the Reporting of Observational Studies in Epidemiology (STROBE) statement [21].<br>Consent: After a briefing on the procedure, only participants who provided written consent were included in the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were conducted using GraphPad PRISM 9.0 (GraphPad Software, San Diego, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad PRISM</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

      Our study has intrinsic limitations. First, as an observational study, it was difficult to exclude all potential confounders. Therefore, the involvement of some variables may be underestimated in predicting the result. Second, the number of subjects involved was small, and we could not be sure if the altered microbial composition in the periodontal niche had already occurred in our COVID-19 patients when GCF samples were collected. Periodontitis is a common infectious disease that is triggered by oral bacteria. It is important to analyze certain quantities of specific pathogens in the oral microbiota of patients to initiate inflammation. In this study, we used the relative abundance of each targeted species as a proportion rather than the actual levels. Finally, although GCF reflects the serum immune response [11], the results of this study cannot be linked directly to suggest that the level of inflammation determinants in GCF may correspond to the systemic inflammation mechanism of COVID-19. Based on the results of this preliminary study, we are planning a forthcoming study in searching the oral microbiome and trying to correlate the viral load and the functional inference of oral bacterial composition, and how it relates to the host response. However, with these limitations, the current approach hints at the importance of the oral ecosystem in modulating clinical symptoms related to COVID-19 cases [60-63].

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.10.22271304
  199. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2022.03.12.484092
    1
    1. sciscore 16 Mar 2022

      SciScore for 10.1101/2022.03.12.484092: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: All studies on infectious SARS-CoV-2 were performed in Biosafety level 3 facility at Indian Veterinary Research Institute (IVRI), Izatnagar Bareilly, after obtaining necessary approvals from Biosafety Committees.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For this purpose, Vero cells were seeded in a 96-well cell culture plate and were incubated at 37 ºC and 5% CO2 tension overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The PCR product was digested with NheI and SalI enzymes and subsequently ligated into the pET28c vector using DNA ligase.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET28c</div><div>suggested: RRID:Addgene_161936)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For molecular docking study, the atomic structure of SARS-CoV-2 NTD (PDB ID: 6M3M)25 was retrieved from RCSB-PDB and three-dimensional structure of GMP was extracted from the PubChem database.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PubChem</div><div>suggested: (PubChem, RRID:SCR_004284)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virtual screening and molecular docking of compound libraries: For structure-based virtual screening of small molecules against NTD, PyRx 0.840, and AutoDock tools/Vina37,38 platforms were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AutoDock</div><div>suggested: (AutoDock, RRID:SCR_012746)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell viability was calculated as a percentage against the untreated control, and the data were plotted using GraphPad prism to calculate the 50% cytotoxic concentration (CC50) of identified compounds.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2022.03.12.484092
  200. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.11.22272214
    1
    1. sciscore 16 Mar 2022

      SciScore for 10.1101/2022.03.11.22272214: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The study was approved by the Institutional Ethics Committees (IECs), AIIMS, Raipur [1379/IEC-AIIMSRPR/2020] & ICMR-NIMR, Delhi [PHB/NIMR/EC/2020/145].</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: The study data was fed in Microsoft Excel 365 and cross checked by two independent researchers.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The statistical and association analysis was performed using the SPSS version 23 (IBM).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.11.22272214
  201. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2022.03.11.22271527
    1
    1. sciscore 16 Mar 2022

      SciScore for 10.1101/2022.03.11.22271527: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">The dataset containing reinfections has been blinded to protect individuals medical history and is compliant with General Data Protection Regulation (GDPR) data processing.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:

      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2022.03.11.22271527