Leishmania major strain (MHOM/Su73/5ASKH) was a kind gift from Dr. Satyajit Rath, Immunobiology Laboratory, National Institute of Immunology, India. L.major promastigotes were cultured at 23°C in modified DMEM (DMEM (1 L) supplemented with sodium bicarbonate (3.7 g), HEPES (5.96 g), hemin (5 mg), biotin (1 mg), adenine (13.36 mg), xanthine (7.6 mg), triethanolamine (0.5 mL), and tween 80 (40 mg)) supplemented with 10% FCS. It is known that long term culture of L.major promastigotes results in loss of their virulence (2). Hence, to maintain the virulence of these parasites, they were propagated in mice footpad. Towards this end, the stationary phase L.major promastigotes were resuspended in Hank's balanced salt solution and 2x106 promastigotes were injected into the footpad of female BALB/c mice. 6 weeks post-infection, the infected footpad was dissected and the lesion harvested. The obtained lesion was minced and resuspended in modified DMEM supplemented with 10% FCS and placed in 23°C incubator to allow differentiation of intracellular amastigotes to promastigotes. This cycle of harvesting promastigotes from footpad lesions was performed every 6 weeks to maintain the virulent phenotype of this parasite
1,723 Matching Annotations
- May 2019
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
-
Protocol for propagation and maintenance of Leishmania major promastigotes
-
population was determined by analyzing cells immunostained with an antibody against CD14 conjugated to FITC and the purity obtained was approximately 85% monocytes, the remaining being lymphocytes. The monocytes were further cultured in the presence of human AB serum for 7 days to allow differentiation to macrophages. At the end of 7 days post-isolation, greater than 95% of cells in culture are monocytes, with the majority of lymphocytes undergoing neglect induced death.
-
Peripheral blood (30 mL) was collected by venipuncture from healthy male volunteers after obtaining an informed consent and in accordance to the regulations of the Institutional Human Ethics Committee (National Institute of Immunology, New Delhi, India). The peripheral blood mononuclear cell (PBMC) population was isolated by density gradient centrifugation using Histopaque 1077, where, human whole blood was layered on Histopaque 1077 and centrifuged at 400 x g for 35 min at 25°C. The mononuclear cell population was isolated from the plasma-histopaque interface, and the monocytes were further purified by washing off the non-adherent cells after incubating the total PBMC for 1 h at 3 7°C. The homogeneity
-
Peripheral blood monocy.te isolation and macrophage differentiation
-
THP-1 acute monocytic leukemia cell line (TIB-202) was purchased from American type culture collection (ATCC) (Manassas, VA). These suspension cells were maintained in culture at 37°C in RPMI-1640 medium supplemented with 10% FCS. They were sub-cultured when the cell density reached ~1X106 per mL. To induce differentiation of these monocytic suspension cell cultures to adherent macrophage phenotype, they were subjected to treatment with PMA at a concentration of 10 ng/mL for 36 h. Forty eight hours prior to experimentation, the cells were transferred to phenol-red free RPMI-1640 medium supplemented with 10% dextran-coated charcoal stripped FCS. This was performed to remove all traces of exogenous estrogens as phenol red in culture medium is known to be a weak estrogen (1) and FCS contains multiple steroid hormones which are removed upon stripping with dextran-coated charcoal. MCF-7, a breast carcinoma cell line was obtained from ATCC (Manassas, VA). They were maintained in culture at 37°C in RPMI-1640 medium supplemented with 10% FCS and were routinely sub-cultured when the cells reached a confluency of around 80%
-
Cell lines and cell culture
-
Cell culture techniques
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
checks the stereochemical quality of protein structures. The output of the program consists of comprehensive listings of the stereochemical parameters. These files were analyzed to determine if the error in the various stereochemical parameters were within acceptable limits. If any parameter ofthe model was found to be outside the accepted range, they were corrected by adjustment of the concerned residue followed by refinement. The elbow angles of all the Fab structures were calculated using web based applet developed by Standfield et a/ (Stanfield et al., 2006). The buried surface areas (i.e. the area rendered inaccessible to a 1.4 A sphere) were determined using PISA web server (Krissinel and Henr:ck, 2007). CONTACT program of the CCP4 package (Elizabeth Potterton, 2003) was used to determine van der Waals contacts and hydrogen bonds between peptide and Fab. Vander Waals contacts were defined to be present between atoms if they were within 4 A of each other. Hydrogen bonds were assigned for donors and acceptor atoms when the distance between them is less than 3.5 A. In case of hydrogen bonds where the nitrogen atom is the donor, the N-H ... O angle should be greater than 120°. When an oxygen atom is the donor, a cut off value of 90° was used. All Fab-peptide complexes ofmAbs; BBE6.12H3 and 36-65 were compared in terms of various parameters such as elbow angle, peptide and CDR conformation, buried surface area, van der Waal contacts and hydrogen bonding. To compare conformations, RMSD in the position of the Ca as well as all atoms were calculated using SUPERPOSE program of CCP4 package (Krissinel and Henrick, 2004). The CDR conformations in the liganded and unliganded forms were also compared.
-
Deviations from ideal geometry of the various structures were analyzed using PROCHECK (R. A. Laskowski, 1993) from the CCP4 suite. PROCHECK
-
Validation, analysis and comparison of models
-
function of resolution. The displacement for an isotropic B-value is related to the displacement u by the equation B = 8;(u2). The isotropic B-value assumes equal movements in all the directions. However, the vibration of an atom need not be the same in all the directions, and in such a case motion is described by anisotropic displacement parameter. In this formulation the motion is described by an ellipsoid that can be rotated in any direction. The entire anisotropic displacement can be described in terms of six elements: UIJ, U22 and U33 specify the magnitude of movement in three axis and U 12, U t3 and U23 specify the rotation off the principal axis. Anisotropic displacement parameters can be converted to the isotropic equivalent by the formula Biso = 8;(Ull+l'22+U33). The B-values are restrained during refinement. Atoms that are bonded to each other influence each other's motion. B-values are restrained in such a manner that the average difference in the B-values of bonded atoms is kept to a target value. The B-values should vary smoothly along the protein chain and within the side chain. The usual target restraint for adjacent bonded main chain atom is 1.0 and for side chain the target value is 1.5 since one end of the side chain is free, ensuring the higher gradient. Similarly B-values can be graded for the one to three members of a bond angle. For main chain angles the target value is 1.5 and for the side chain angle the value is set to 2.0. Like rigid body refinement, it is done at the early stages of the refinement process. Refinement of the atomic B-factors is a bit tricky and is carried out in later stages of refinement.
-
The individual atoms were then refined by several cycles of conventional positional refinement, which uses the conjugate gradient minimization method. The proper weight term called Wa was calculated which was used for subsequent positional refinement (Brunger et al., 1987). In case of CNS this value was set to -1 and the program itself calculated these weights. The refinement was started using data in the range 50 A -4.0 A and higher resolution data were added in a stepwise fashion. After complete data had been added, the F0-Fc and 2F0-Fc electron density maps in addition to the composite omit map were calculated and displayed on an HP xw8400workstation (Hewlett-Packard Company, U.S.A.) using Coot (Emsley P, 2004 ). The electron density map was examined in the context of the model and the regions of the map where the electron density was not satisfactory or the model did not fit the density were identified. Using Coot, the residues were mutated to the sequence of the molecule of interest and wherever required, moved locally to correspond to the visible density. This was followed by refinement to check if the changes made could be accepted or not. Depending on the resolution to which X-ray data was available, anisotropic or individual B-factors were also refined. This process of model building and refinement was carried out iteratively until all the differences in sequence with the probe model had been accounted for and there was no ambiguity in the fit between the model and the electron density. Water molecules were included in the model using the 'water pick' program available in CNS only after a sufficient level of refinement had been achieved. This was followed by visual examination of the waters to avoid inclusion of spurious water molecules. The B-value is the measurement of the displacement of an atom from thermal motion, conformational disorder and static lattice disorder. This vibration will smear out the electron density and will also decrease the scattering power of the atom as a
-
sum runs over all the reflections in your data set, and k is a scale factor needed to put the Fe on the same scale as the Fobs· A model consists typically of five parameters for each atom: x,y,z, B, and Q. The triplet (x,y,z) specifies the position of each atom in an orthogonal coordinate system. B is the B-factor or temperature factor of each atom, and it is related to the thermal motion of the atom. B-factor also contains information about other types of "disorder" including errors that you are being made while constructing and refining model. Q is the occupancy and it is the fraction of time that the atom spends at position (x,y,z). Typically, Q=l. If one has data better than about 1.8 A, then occupancies between zero and one are sometimes used. Refinement procedures for antibodies involve two basic procedures, rigid body refinement followed by positional refinement. Rigid body refinement is used to refine the results obtained from MR in terms of orientation and position of the starting model in the unit cell. Positional refinement is used to refine the positions of individual atoms in space. Both conventional R-factor (Rcryst) and the free R-value (Rfree) (BrUnger, 1992) were used to monitor the progress of refinement. 10% of the reflections were set aside at random to monitor the Rfree during refinement. Rigid body refinement was carried out to further refine the positioning of the probe molecule in the target unit cell. The probe models that gave the highest correlation coefficients were thus subjected to rigid body refinement. Refinement was initially done using data in the range of 50 A -4 A; thereafter data up to the maximum available resolution were added in a step wise manner. The Fab molecule can be defined as an assembly of four domains, the VH, VL, CH and CL. Consequently, rigid body refinement where these domains were considered as discrete rigid units was carried out.
-
This section describes the detailed refinement strategies used for structure determination. The structures presented in the thesis were refined using CNS (Brunger, 2007; Brunger et al., 1998). The refinement of structures obtained after molecular replacement was done using Crystallography and NMR system (CNS) suite of programs (BrUnger et al., 1998) based on the refinement of crystal structures using Cartesian (BrUnger et al., 1987) or torsion-angle molecular dynamics (Rice and BrUnger, 1994). This task file automatically computes a cross-validated crA estimate, determines a weighting scheme between the X-ray refinement target function and the geometric energy function, refines a flat bulk solvent model (Jiang and Brunger, 1994) and an overall anisotropic B-value of the model by least squares minimization, and subsequently refines the atomic positions. Available target functions include the maximum-likelihood functions MLF, MLI and MLHL (Pannu et al., 1998). Refinement is an iterative process in which the atomic model is modified, structure factor amplitudes are calculated from the modified model, and the agreement between these calculated structure factor amplitudes (IFcl) and the experimental or observed ones (IF ~bsD is determined. The goal is to find the model that produces the best agreement between lfohsl and lfcl. Refinement is a problem of finding the minimum of a function that mathematically expresses the agreement between IFobsl and lfcl. This function is called a target function. A commonly used target function is the crystallographic residual: SUM {(IFobsl -k1Fcl)2}, where the
-
Structure refinement using the Crystallography and NMR system (CNS) suite
-
Phaser is a program for phasing macromolecular crystal structures by both molecular replacement and experimental phasing methods (A. J. McCoy, 2007). The novel algorithms in Phaser are based on maximum likelihood probability theory and multivariate statistics rather than the traditional least-squares and Patterson methods. For molecular replacement, the new algorithms have proved to be significantly better than traditional methods in discriminating correct solutions from noise. One of the design concepts of Phaser was that it be capable of a high degree of automation. Phaser has novel maximum likelihood phasing algorithms for the rotation functions and translation functions in MR, but also implements other non-likelihood algorithms that are critical to success in certain cases.
-
Automated molecular replacement program (Phaser)
-
simultaneously uses all symmetry operators, resulting in a single peak with an improved signal-to-noise ratio which directly gives the position of the model in the unit cell. In addition, the TF is coupled with a PF to remove false maxima which correspond to interpenetrating molecules. Both the TF and PF allow the incorporation of a second model already placed in the cell. The TF solution may be subjected to rigid-body refinement incorporated in MOLREP. Non crystallographic symmetry may be imposed on the model in order to restrain the refinement. Pseudo-translation is automatically detected from analysis of the Patterson map. A significant off-origin peak gives the pseudo-translation vector, which is used to modify structure factors in the TF calculation (Navaza et al., 1998). In MOLREP multiple copies of the macromolecule in the unit cell can be searched (Vagin, 2000).
-
MOLREP is an automated program for molecular replacement that utilizes a number of original approaches to rotational and translational search and data preparation. MOLREP can perform a variety of tasks that require rotational and/or positional search: standard MR, multi-copy search, fitting a model into electron density, heavy-atom search and model superposition. The arsenal of rotation (RF) and translation (TF) functions includes self-RF, cross-RF, locked cross-RF, phased RF, full-symmetry TF, phased TF, spherically averaged phased TF and packing function (PF).The program is general for all space groups. The output of the program is a PDB file with the atomic model ready for refinement and a text file with details of the calculations. The rotational search is performed using the RF of (Crowther, 1972), which utilizes the fast Fourier transform (FFT) technique. The default radius of the integration sphere is derived from the size of the search model and is usually two times larger than the radius of gyration. The RF solutions are refined prior to positional search using a rigid-body technique. The refinement is performed in space group PI and the outcome is evaluated by the correlation coefficient. It
-
Automated molecular replacement program (MOLREP)
-
include SORTING, that sorts, packs and assesses the quality of the experimentally measured diffraction data, and is run in the first step. The program TABLING calculates the continuous Fourier coefficients from the model placed in the artificial cell. The cross-rotation function is carried out by the program ROTING, which uses Crowther's algorithm (Crowther, 1972). TRAING is used to calculate the translation function. Finally FITING is used to refine the orientational and positional parameters of the molecule corresponding to the potential solutions, as a rigid body.
-
To carry out MR, the AMoRe package can be used. AMoRe constitutes a suite of programs written by Jorge Navaza (Navaza, 1993; Navaza, 1994). These
-
Automated molecular replacement package (AMoRe)
-
was subsequently used as a probe model to carry out molecular replacement for one of the Fab-peptide complex; remainmg three Fab-peptide complexes were solved by using Ppy-LH as search model. The structure of antigen bound 36-65 Fab (2A61) was used for molecular replacement of two Fab-peptide complexes of the same antibody. AMoRe (Navaza, 1994) and Phaser packages from CCP4 suite (Elizabeth Potterton, 2003) were used for structure determination of antigen free BBE6.12H3 Fab and its complexes with peptide, respectively. The solution for 36-65 complexes was determined by using MOLREP from CCP4 suite. Both for MOLREP and AMoRe, calculations for rotation/translation functions were carried out using structure factors from 8 to 4 A resolutions. The transformation matrices obtained from AMoRe for antigen free Fab was utilized to orient the models in the corresponding unit cell. However, both Phaser and MOLREP have a module which automatically does orientation. The packing function of Phaser also checks for possible clashes or voids between the symmetry related molecules. All the solutions were unambiguous. For outputs of AMoRe and MOLREP the crystal packing was examined using Coot (Emsley P, 2004) to ascertain the absence of steric clashes or large voids between symmetry related molecules. Calculations of the Matthews coefficient (Kantardjieff and Rupp, 2003) indicated presence of two molecules for antigen free Fab and a single Fab molecule for all Fab-peptide complexes within the asymmetric unit.
-
wavelength component in three dimensions inversely proportional to their values of h, k and /. The image of the object can be reconstructed by recombining the individual sine waves as occur in the objective lens of the microscope. Since it is not possible to focus the X-rays, only the intensities could be recorded with the loss of phases, well known as phase problem of crystallography. Macromolecular crystal structures are usually solved using one of the three techniques; multiple isomorphous replacement (MIR), multiple anomalous dispersion (MAD) or molecular replacement (MR). Of the three, MR is generally used in cases where a structural homolog is available. Since the structure of a number of antibodies is already known, MR is the method of choice for structure determination of antibody Fab. The molecular replacement method, involves orienting and positioning a model molecule in the experimental unit cell through rotations and translations. The rotation function developed by Rossman and Blow ( 1962), involves rotation of the Patterson function of one group or molecule with respect to the other in all possible ways and the ultimate superimposition of the two Patterson functions. The translation function deals with positioning the oriented molecule in the unit cell of the unknown structure. It utilizes the cross vectors between various symmetrically related molecules for positioning the probe in the target unit cell. The translation function is carried out by moving the oriented model in small increments along all three directions and calculating the correlation between observed and calculated intensities. From the solutions obtained, the one with the highest correlation and lowest R-factor was chosen for molecular replacement. The structure of the Fab of putative anti-NP germ line mAb Nl G9 was used for molecular replacement. The refined model of the native unliganded germline Fab
-
The goal of diffraction analysis is reconstruction of the detailed structure of the asymmetric unit from a diffraction pattern. The diffraction pattern breaks down the structure into discrete sine waves. Any shape can be presented in three dimensions as the sum of sine waves of varying amplitudes and phases. The individual reflections of a diffraction pattern represent such waves, which have
-
Structure determination using molecular replacement
-
Structure determination
-
merging data, and symmetry equivalent positions, space group-specific systematic absences, total percentage of data collected and the linear Rmerge for data reduction. Finally, truncate program was used to obtain structure factor or amplitudes from averaged intensities (output from SCALA, or SCALEPACK) and write a file containing mean amplitudes and the original intensities. If anomalous data is present then F(+), F(-), with the anomalous difference, plus I(+) and 1(-) are also written out. The amplitudes are put on an approximate absolute scale using the scale factor taken from a Wilson plot. For all the Fab-peptide complexes and unliganded Fab of BBE6.12H3 antibody, the diffraction data were collected and processed using MOSFLM and subsequently merged using SCALA. For all the Fab-peptide complexes of 36-65 Fab, the diffraction data were collected and processed using DENZO and subsequently merged using SCALEPACK. The cell dimensions and space groups were unambiguously determined for each crystal. The solvent content and Matthews's constant were calculated (Matthews, 1968). The merged and scaled intensities were used for structure determination.
-
parameters using the whole data set. It is also used for merging different data sets and carrying out statistical analysis of the measurements related by space group symmetry. SCALEPACK also provides the detailed analysis of the merged data, and symmetry equivalent positions, space group-specific systematic absences, total percentage of data collected and the linear Rmerge for data reduction. MOSFLM is a package of programs with an integrated graphical user interface for processing data collected on any detectors. The programs cover all aspects of data reduction starting from the crystallographic pattern recorded on an image to the final intensities of observed reflections. In MOSFLM this entire process of integration of diffraction images is subdivided into three steps. The first is the determination of the crystal parameters, in particular the crystal lattice (unit cell) and its orientation relative to a laboratory axial system (usually based on the X-ray beam direction and the rotation axis)_ This is usually referred to as autoindexing. Knowledge of these parameters then allows an initial estimate of the crystal mosaicity. The second step is the determination of accurate unit-cell parameters, using a procedure known as post-refinement. This requires the integration of one or more segments of data with a few images in each segment. The final step is the integration of the entire set of diffraction images, while simultaneously refining parameters associated with both the crystal and the detector. After integration of the data, next step is to scale and merge the data set. Scaling and merging are done with the program SCALA. This program scales together multiple observations of reflections, and merges multiple observations into an average intensity. The merging algorithm analyses the data for outliers, and gives detailed analyses. It generates a weighted mean of the observations of the same reflection, after rejecting the out:iers. SCALA also provides the detailed analysis of
-
therefore only partially recorded on any individual image. For each predicted reflection, the background-subtracted diffracted intensity must be estimated. Although straightforward in principle, defects and limitations in both the sample (the crystal) and the detector can make this difficult in practice. Complicating factors include crystal splitting, anisotropic and/or very weak diffraction, high mosaicity, diffuse scattering, the presence of ice rings or spots, unresolved or overloaded spots, noise arising from cosmic rays or zingers, backstop shadows, detector blemishes, radiation damage and spatial distortion. These experimental factors will be important in determining the final quality of a data set. The HKL2000 (Otwinowski, 1997) is GUI based suite of programs for the analysis of X-ray diffraction data collected from single crystals. The package consists of three programs: DENZO, XDISPLA YF and SCALEPACK. HKL is the program that converts the raw X-ray diffraction data, collected from an image plate and reduces it to a file containing the hkl indices, intensities of the spots on the image plate along with estimates of errors involved. DENZO initially performs peak searching. The autoindexing algorithm carries out complete search of all the possible indices of the reflections picked by peak search using a fast Fourier transformation (FFT) software module. After search for real space vectors is completed, the program finds the three best linearly independent vectors, with a minimal unit cell volume, that would index all of the observed peaks. After refining the initial cell dimensions and detector parameters, the determined values are applied to the rest of the frames and the parameters are refined for each frame. The diffraction maxima are also integrated by DENZO_ The program XDISPLA YF (W., 1993) enables visualization of the peak search and processing procedures. SCALEPACK finds the relative scale factors between frames and carries out precise refinement of crystal
-
The collection of macromolecular diffraction data has undergone dramatic advances during the last 20 years with the advent of two-dimensional area detectors such as image plates and CCDs, crystal cryocooling and the availability of intense, monochromatic and highly collimated X-ray beams from synchrotron sources. These technical developments have been accompanied by significant advances in the software used to process the resulting diffraction images. In particular, autoindexing procedures have improved the ease of data processing to the point that in many cases it can be carried out automatically without any user intervention. However, the procedure used to collect the diffraction images, the screenless rotation method, has remained essentially unchanged since it was first suggested for macromolecular crystals by Xuong et al. (Nguyen-huu-Xuong, 1968) and by Arndt and coworkers and popularized by the availability of the Arndt-Wonacott oscillation camera (Arndt, 1977; U. W. Arndt, 1973). In this procedure, each diffraction image is collected while rotating the crystal by a small angle (typically between 0.2 and 2°) about a fixed axis (often referred to as the cpaxis). The only development of the method has been the use of very small rotation angles per image (the so-called fine cp-slicing technique) to provide improved signal to noise for weakly diffracting samples. Since, virtually all macromolecular diffraction data are collected in this way (with the exception of data collected using the Laue technique). The starting point for data integration will therefore be a series of such diffraction images and the desired outcome is a data set consisting of the Miller indices (hk/) of all reflections recorded on these images together with an estimate of the diffracted intensities I(hkl) and their standard uncertainties al(hkl). This requires the prediction of which reflections occur on each image and also the precise position of each reflection on each image (note that typically most reflections will be present on several adjacent images and
-
X-ray intensity data processing
-
mounted on goniometer heads, which were in turn fixed on the oscillator dial of the image plate. However since our crystals suffered significant radiation damage at room temperature we decided to attempt cryo-crystallography and collected data at low temperature. Radiation damage to protein crystals is greatly reduced at lower than room temperatures (D. J. Haas, 1970; Low et al., 1966). Primary radiation damage is largely caused by interactions between the molecules in the crystal and the beam. This energy is dissipated in at least two ways; it produces thermal vibrations (heat) and it provides the necessary energy to break bonds between atoms in the molecules. Secondary damage to the crystals is caused by the diffusion of reactive radicals produced due to damage to the protein. This diffusion is aided by the presence of thermal energy. At cryo-temperature of around 1 OOK, thermal damage is limited and also the reactive products are immobilized and do not cause extensive secondary damage in areas of the crystal which are not exposed to the beam (Garman, 1999). For low temperature data collection, the crystals were initially soaked in a cryo-protectant, which was basically the mixture of the mother liquor and antifreeze. We added 30% glycerol to our mother liquor, in which the crystals were soaked from between 1 to 5 minutes to achieve cryo-protection. The crystals were then picked up using a 20Jl nylon loop, which was immediately flash frozen in a stream of nitrogen at 120k at a flow rate of 6 liters/min (Oxford cryo-systems). The crystals were centered in the beam using the two arcs and translations on the goniometer head and by viewing the crystal on the monitor of the attached CCD camera. The collimation, crystal to detector distance, oscillation angle and the exposure time per frame were optimized after a few trial frames in each case.
-
Data collection for macromolecular crystallography involves exposure of the crystal to X-rays and recording the intensities of the resultant diffraction patterns. Rapid advances in this field have made available sophisticated electronic detectors like the Image plate detector, high power X-ray generators and synchrotrons. Successful data set collection is followed by data processing to extract the hkl indices with corresponding intensities, along with an estimate of the errors involved. At the core of the Image Plate detector is an amorphous thin film made of Barium, Europium and Bromium. This material that is coated on to a motorized plate absorbs X-rays to form F-centers. These F-centers are the regions that store photon energy as excited electrons. After the exposure is complete the plate is read by a He-Ne (2eV) red laser. Absorption of photons induces excited electrons to return to ground state with the emission of blue light (4eV) which is quantitatively read by a photomultiplier. Exposing it to intense white radiation erases the plate. While the basic technology behind the image plates remains the same, improvements in electronics and computers has led to greater automation and faster data collection cycles. The X-ray intensity data for various Fab-peptide complexes of 36-65 were collected on the Mar345dtb, installed on a rotating anode X-ray source (RIGAKU, Japan) operating at 50kV and 1 OOmA (CuKa. radiation) with Osmic mirrors (RIGAKU, Japan). While the Mar225 image plate installed at BM14 (ESRF, Grenoble, France) was used to record three Fab-peptide complexes of BBE6.12H3. Data for antigen free BBE6.12 H3 Fab and its complex with Ppy peptide was recorded on Mar345dtb image plate (Mar research, Germany), installed on the home source. For data collection at room temperature, the crystals were mounted in 0.5 mm quartz capillary tube along with some mother liquor. The capillaries were then
-
X-ray intensity data collection
-
a buffered protein solution in the form of a droplet in contact with the precipitant through the vapor phase. The precipitant slowly causes dehydration to occur in the protein droplet increasing the effective concentration of the protein. The hanging drop crystallization experiment is set up in 24 well tissue culture plates, with the drop of protein solution containing 50% of the precipitant in the mother liquor suspended over the precipitant solution from a siliconized cover slip. This setup is sealed with silicon grease to facilitate controlled vapor diffusion between the well and the drop. For setting up hanging drop crystallization, a pure preparation of Fab molecules in the crystallization buffer (50 mM Na-cacodylate pH 6.7, 0.05% sodium azide or 50mM Tris-Cl pH 7.1, 0.05% sodium azide) was concentrated to a final concentration of 10 mg/ml. For the antibody-peptide complexes, 50-fold molar excess of the peptide was added to the Fab solution. Hanging drops of 8 Jll volume containing 4 111 of the Fab so:ution and 4 111 of varying concentrations of the precipitant were set up in 24-well tissue culture plates (Nunc, Denmark). Initially, a variety of precipitants were used in the crystallization experiments. Conditions which gave indications of crystal formation were then further explored to improve the quality of the crystals. The crystallization plates were maintained at room temperature in insulated conditions so as to prevent rapid changes in temperature. For crystallization of BBE6.12H3Fab-peptide complexes, the crystallization plates were also maintained at 8°C in vibration free incubator (RUMED, Rubarth Apparate, GmbH, Germany). The plates were checked for the presence of crystals every two weeks.
-
One of the most widely utilized methodologies of crystallization is hanging drop vapor diffusion technique (Wlodawer and Hodgson, 1975). The setup involves
-
Crystallization
-
Crystallization and data collection
-
Fab purification from the digestion mixture was carried out by ion-exchange chromatography using SPW-DEAE (60xl50 mm) column on a Waters3000 preparative HPLC (Waters, USA). In:tially, a blank run was carried out thereafter the column was allowed tore-equilibrate with the wash buffer (10 mM Tris-Cl, pH 8.0). A salt gradient of 0 to 0.2 M NaCI over a period of 120 minutes was used to elute the Fab. An aliquot from all the collected fractions were precipitated by using chilled acetone and were analyzed on a SDS-PAGE gel to ascertain which fraction corresponds to Fab. Fab, which has low or zero net negative charge at pH 8.0, was eluted out as the first major peak early in the gradient. The Fe portion and any undigested IgG which have a higher net negative charge at pH 8.0 would elute out later in the gradient. The Fab fractions collected from various HPLC runs for both the antibodies were pooled, concentrated and dialyzed against their respective crystallization buffer (50 mM Na-cacodylate pH 6.7, 0.05% sodium azide and SOmM Tris-Cl pH 7.1, 0.05% sodium azide).
-
Purification of Fab fragment
-
band has completely disappeared and only the 25 kDa doublet is clearly visible. Optimal w/w ratios of protein/enzyme and time of incubation were ascertained and preparative digestions were carried out using 20-50 mgs of IgG. The digestion mixture was then dialyzed against 10 mM Tris-Cl, pH 8.0 for Fab purification.
-
The concentration of the purified IgG was estimated usmg micro bicinchoninic acid (BCA) method of protein estimation (Micro BCA Protein Assay Kit , Pierce). To ascertain the optimal ratio of IgG to papain and time of incubation for proteolytic fragmentation of the antibody, an initial analytical digestion was carried out. 1 mg/ml solution of papain (Sigma, St. Louis, USA) was first pre-activated using rJ-mercaptoethanol (2.0m\1) for one hour. The reaction mixtures for digestion constituted 400 J.lg of IgG, rJ-mercaptoethanol (2.0mM) and EDTA (2.0mM) appropriate volumes of the activated papain solution were added so as to obtain various ratios of lgG:papain. The digestion reaction was monitored for 10 hours and 20 Ill aliquots were collected every hour. The proteolysis reaction was stopped with addition of 75 mM iodoacetamide and all the aliquots were analyzed on reducing SDS-PAGE. Initially the lgG appears as two bands, one at 50 kDa and the other at 25 kDa, corresponding to the heavy and light chains, respectively. The intensity of the 50 kDa band decreases and instead, a doublet starts appearing at 25 kDa as the reaction proceeds. The Fe portion may or may not be visible as a band just above the 25 kDa doublet. The digestion is deemed complete when the 50 kDa
-
Generation of Fab fragment
-
solution was injected into the HPLC. A salt gradient of 0 to 0.2 M NaCl over a period of 120 minutes was run and fractions for each peak, as detected by measurement of UV absorbance at 220nm, were collected. An aliquot of each fraction was subjected to acetone precipitation and the obtained precipitate was analyzed on SDS-PAGE to ascertain which fraction corresponds to IgG. The IgG fractions from different runs were pooled and concentrated to -1 mg/ml which was then dialyzed against the digestion buffer (0.15 M NaCl, O.lM Tris-Cl, pH 7.1).
-
The collected ascitic fluid was centrifuged to remove cell debris and fat. Mouse monoclonal ascites, was filtered through glass wool to remove lipid like material left over after centrifugation. The supernatant was then subjected to (Nr4)zS04 fractionation. Saturated (Nlit)zS04 solution (SAS) at pH 7.0 was gradually added to the ascites in an ice bath with continuous stirring till a concentration of 40% (v/v) was achieved. The mixture thus, obtained was centrifuged to get the protein pellet and the pellet was re-suspended in buffer (0.01 M Tris-Cl, pH 8.5). The crude antibody solution obtained from ammonium sulfate fractionation was dialyzed against the wash buffer (0.0 1 \1 Tris-Cl, pH 8.5) and then subjected to ion-exchange chromatography using 5PW-DEAE (60x150 mm) column on a Waters3000 preparative HPLC (Waters, L:SA), to purify IgG. All solutions used during chromatography were filtered (0.451-lm) and then degassed. Following equilibration of the column with wash buffer, a 2 ml aliquot of the crude antibody
-
Antibody purification
-
secrete antibody which gets collected in the peritoneal fluid. Ascites is thus a good source of monoclonal antibody. The hybridoma cells, from two different hybridoma, which were secreting IgGs, 36-65 and BBE6.12H3, were injected into the peritoneal cavity of male Balb/c mice irradiated with a dose of 400 RAD and primed with Freund's incomplete adjuvant 72 hours prior to injecting the hybridoma cells suspended in 500 111 of Dulbecco's phosphate buffered saline (DPBS). Approximately 5 x 105 to 5 x 106 hybridoma cells were injected into each mouse. Ascitic fluid could be tapped from the peritoneal cavity of mice after approximately 4-5 days.
-
Ascites is the intra-peritoneal fluid collected from mice that have developed peritoneal tumor. Hybridoma cells, when injected into the peritoneal cavity of mice,
-
Generation of ascites from mice
-
conditions used for purificatior and crystallization. Therefore, in any attempt at crystallization, the homogeneity of the preparation and its stability in solution is of paramount importance. lgG molecules possess a net negative charge, at pH 8.5. At this pH, IgG molecules, can therefore, bind to positively charged chemical moieties, an association that can be reversed using low concentrations of sodium chloride. Hence, it is possible to purify IgG using anion-exchange chromatography with a salt gradient. Since this method does not involve harsh conditions it represents an ideal way to purify IgG to be ultimately used for crystallization experiments. Ammonium sulphate fractionation prior to chromatography improves the resolution of peaks during IgG purification. The mouse IgG molecules are known to precipitate in the range of 33% to 40% (v/v) saturated ammonium sulphate. lgG molecules have three major domains, each of which are mobile with respect to the other. Consequently, the molecule is highly flexible and not easy to crystallize. Although entire immur.oglobulin molecules have also been crystallized (Harris et a!., 1998), the proteolytic fragments of IgG molecules have been observed to be more amenable to crystallization. Papain, a non-specific proteolytic enzyme obtained from papaya, cleaves antibodies at the hinge region to release one Fe and two Fab domains. Proteolysis by papain, if carried out carefully, followed by purification can yield a homogenous preparation of Fab. This pure preparation of Fab can be used for crystallization experiments.
-
A prerequisite for collection of X-ray diffraction data for structure determination is availability of well-ordered single crystals. Protein crystallization is considered to be an art and there are no universally applicable methods for obtaining crystals suitable for X-ray diffraction studies. However, it is unlikely that good crystals will not be obtained if attention is paid to the purity and stability of the molecule of interest. A high degree of purity is essential for successful crystallization of most proteins. Also, the molecule must be stable under the
-
Preparation of Fab fragment
-
The peptides were purified using reverse-phase HPLC. Binding occurs through hydrophobic interactions between peptide and the column support. Decreasing the ionic nature or increasing the hydrophobicity of eluant such that it competes with peptide for hydrophobic groups on the column accomplishes elution. Crude peptides were purified on a Waters Xbridge™ BEH 130 reverse-phase C 18 column ( 19x250mm, 1 O~m, spherical) on a semi-preparative HPLC system (Waters, USA) using a linear gradient of 0.1% trifluoroacetic acid (Sigma) and acetonitrile (Merck). The absorption was monitored at 214nm. After purification, the peptides were lyophilized. The purity of the peptide was checked by determination of molecular mass using single quadruple mass analyzer (Fisons Instruments, UK). Circular dichroism studies were performed on the peptides to determine secondary structural state, if any, in solution. 50 )lM peptide concentrations in water were used and data was accumulated for 1 0 scans at a temperature of 10° C using a JASCO 710 spectropolarimeter. 1.0 nm bandwidth and O.lnm resolutions were used, with the sample being placed in a 2mm path length cuvette.
-
Peptide purification
-
All the peptides used in this study were synthesized by solid phase method on an automated peptide synthesizer (Applied Biosystems, Model 431A), using F-moc (9-fluorenylmethyloxycarbonyl) chemistry on a p-hydroxymethyl phenoxymethyl polystyrene resin (Nova Biochem). For the peptide synthesis, 0.1 mmol of the resin was used and deprotected using 20% piperidine in N-methyl-pyrrolidone (NMP). Subsequently 0.5nmol of the first amino acid was added and coupling was performed usmg DCC-HoBt (dicyclohexylcarbodiimide-hydroxybezotriazole) ester formation method. All other amino acids were coupled by DCC ester coupling. Amino acids and solutions required for peptide synthesis were procured from Nova Biochem and Applied Biosystems, respectively. After completion of synthesis, deprotection was carried out in 20% piperidine/DMF. Finally, the resin was shrunk using ether and dried under vacuum for a minimum of four hours. The cleavage was performed in dark using 94% TF A, 5% anisole, EDT and water accompanied by continuous stirring for two hours. The resin was then filtered and washed with DCM and the solution was evaporated on a rotary evaporator (Buchi, Switzerland) till only a small quantity of DCM/cleavage mixture is left. Cold anhydrous diethyl ether was added to the filtrate to aid in the separation of scavengers from the mixture. The peptides were then extracted with water using a separating funnel. Extraction was followed by evaporation of residual diethyl ether on the rotary evaporator. Total aqueous layer was then frozen as a thin film and lyophilized.
-
Procedure for peptide synthesis
-
the peptide and the resin is cleaved using trifluoroacetic acid (TF A) to release the polypeptide.
-
Solid phase peptide synthesis was introduced by Merrifield in 1963, and includes successive assembly of amino acid residues to build the peptide chain on an insoluble polymeric support. The C-terminal residue, with protected a-amino and side chain functional groups, is chemically attached to the insoluble resin via a flexible linker. Subsequently, in the coupling step, the a-amino group is deprotected and the next protected amino acid is reacted with the resin-bound first amino acid. This cycle of deprotection and coupling is repeated till the complete peptide chain is synthesized. After the synthesis of the desired peptide, the anchoring bond between
-
Peptide synthesis
-
The crystallographic analysis of the anti-( 4-hydroxy-3-nitrophenyl)-acetyl (anti-NP) and the anti-p-azophenylarsonate (anti-Ars) germline mAbs, BBE6.12H3 and 36-65 bound to various peptides derived from the screening of a random phage library would yield valuable information regarding their promiscuous binding abilities, associated with a primary immune response. The primary requirement for the crystallographic analysis was the preparation of adequate quantities of pure Fab (fragment antigen binding). Purified Fab fragment of both the mAbs was used for subsequent crystallization experiments with various peptide ligands. The X-ray intensity data for the crystals obtained were collected followed by structure determination, iterative steps of crystallographic refinement and model building. The refined models were structurally validated and then subjected to rigorous analysis. This chapter provides a brief background of the methods utilized and details of the experimental protocols followed.
-
Introduction
Tags
- Method-4
- Method-2-detail
- Method-5-Method-2-detail
- Method-4-Method-3
- Method-3-Method-4-detail
- Method-3-detail
- Method-5-Method-2
- Method-2
- Method-3-Method-3
- Method-2-Method-1
- Method-4-Method-1-detail
- Method-6
- Method-2-Method-2-detail
- Method-4-Method-2
- Method-2-Method-2
- Method-3-Method-3-detail
- Method-5-Method-3
- Method-3-Method-1
- Method-5-Method-1-detail
- Method-4-Method-2-detail
- Method-3
- Method-3-Method-2
- Method-3-Method-4
- Method-5-Method-1
- Method-7
- Method-2-Method-1-detail
- Method-4-Method-1
- Method-6-detail
- Method-4-Method-3-detail
- Method-5-Method-3-detail
- Method-5
- Method-5-Method-4-detail
- Method-1
- Method-7-detail
- Method-5-Method-4
- Method-1-detail
- Method-3-Method-2-detail
- Method-3-Method-1-detail
Annotators
URL
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
I 0.0 J.Ll 16.0 J.LI I 0.0 J.Ll 4.0J.Ll 4.0J.Ll 0.5 J..ll 55.5 J.LI I 00 J.L
-
lOX PCR buffer 1.25 J.LM dNTP mix Template DNA (I 0 J.Lg/ml) Primer #I (25 nmoles/ml) Primer #2 (25 nmoles/ml) Taq DNA polymerase (5 U/J.Ll) Sterile water Total volume
-
METHODS
-
The aggregation of the phospholipid vesicles, induced by ribotoxins, was assayed by titrating 40 nmoles of freshly prepared lipid vesicles with various molar concentrations of restrictocin and its mutants. The samples of I ml volume were prepared in 30 mM Tris-HCl buffer, pH 7.0, containing O.IM NaCl and incubated at 37 °C for I h. The change in absorbance due to an increase in turbidity of the lipid suspension was measured at 400 nm in Lambda Bio 20 spectrophotometer (Perkin Elmer) in the cells of I em optical path length. Appropriate control proteins, not interacting with the membranes and the vesicles without proteins were included in all the experiments. The change in absorbance of the lipid suspension was plotted against the toxin concentration.
-
Aggregation of Lipid Vesicles
-
The organic solution of phospholipid was made in a 1:1 mixture of chloroform and methanol at a concentration of 5 mg/ml. To get a thin and uniform lipid film, lipid was dried down onto the walls of a round bottom flask by rotating for 30 min. in a rotary evaporator fitted with a coo!;ng coil and a thermostatically controlled water bath. The temperature of the water bath was maintained 10 °C above the phase transition temperature of the respective phospholipid. The film was stored under vacuum for 1 2 h to remove the traces of the solvent after flushing with nitrogen. Subsequently, lipid film was dispersed in 30 mM Tris-HCI buffer containing O.IM NaCl, pH 7.0 at a concentration of 1 mg/ml of lipid using glass beads of 0.5 mm-3 mm in diameter. Multilamellar vesicles (ML Vs) were obtained by manual swirling for 2 h at room temperature (Bangham et al., 1965). Nitrogen was flushed into the flask and the vesicle suspension was left overnight at 4 °C. The .following day, maintaining the temperature 10 °C abcve the phase transition temperature of the corresponding phospholipid, MLVs were sonicated in a water bath sonifier (Branson 321 0) for 45 min. to get the small unilamellar vesicles (SUVs) (Huang C, 1969).
-
Preparation of Lipid Vesicles
-
Tryptic hydrolysis of restrictocin and the chimeric toxins was carried out at neutral pH in 25 mM HEPES, pH 7.4 containing 1 mM CaCh, 0.5 mM EDT A. For acidic pH, the buffer containing 200 mM sodium acetate, pH 5.2 and 1 mM CaCh was used. Trypsin diluted in 50 mM PBS, pH 7.4 was added to the protein and the samples were incubated at 37 °C for specified time periods. The reaction was terminated by the addition of SDS-PAGE sample buffer. The digestion products were analyzed on a 12.5% SDS-PAGE using Tris-Giycine buffer system and restrictocin containing fragments were detected by western blotting with anti-restrictocin antibodies.
-
Trypsin Treatment
-
in IOmM Tris/HCI (pH 7.4)/ lmM EDTN 0.5% SDS. The radioactivity associated with the cells was counted in a y-counter (LKB).
-
Competition binding analysis was performed to compare the affinity of the chimeric toxins with native antibody. Anti-transferrin receptor antibody (HB21) was iodinated using iodogen method as described by Harlow and Lane, (1988). Adherent cell lines, namely, A431 and A549 were plated at 4Xl05 cells per well in a 24 well plate and used 16 h later for the assay. 500 J.Ll medium, same as described in cytotoxicity assay, was used to dispense the cells. HUT102 cells were also plated at the same density in microfuge tubes and used immediately. After 2 washes with binding buffer (0.1% BSA in DMEM), various dilutions of toxin, along with 3 ng of labeled antibody in binding buffer, were added to the cells. The cells were incubated at 25 °C for 2 h with mild shaking, washed three times with binding buffer and lysed
-
Binding Studies
-
The kinetics of intoxication by different restrictocin containing chimeric toxins was investigated by assaying the cytotoxic activity at various time points. HUTI02, K562 and A431 cell lines were seeded at a density of IX104 cells per well in 200 J.ll medium in a similar manner as described in cytotoxicity assay. The various concentrations of chimeric toxins were added and the cells were incubated at 37 °C in the presence of 5% C02 for different time points. At the end of each incubation period cells were pulsed with eH] leucine and the protein synthesis was measured as described above. The results were expressed as percentage of control where no toxin was added to the cells.
-
Kinetics of Protein Synthesis Inhibition
-
with appropriate antibiotics. Serial dilutions of the toxin, made in 0.2% HSA were added to the cells and incubated for indicated time periods. After incubation, the adherent cells were labeled with 0.25 J!Ci eH] leucine per well and the suspension cells with 0.75 J!Ci eH] leucine per well for 3 hat 37 °C. The cells were harvested on to filtermats using an automatic cell harvester, and the incorporation of the eH] leucine in the newly synthesized proteins was estimated using LKB ~-plate counter. Activity was expressed as percentage of control where no toxin was added to the cells. To check the specificity of chimeric toxins for TFR, 10 J.Lg of anti-TFR antibody (HB21) was added to each well prior to the addition of the fusion protein in the competition experiments.
-
Cytotoxic activity of restrictocin, its mutants and chimeric toxins was checked on a variety of cell lines. The cellular protein synthesis was assayed in the absence and presence of various concentrations of toxin by measuring eH] leucine incorporation in the newly synthesized proteins. Adherent cell lines namely A431, A549, HeLa, L929 and MCF7 were plated in RPMI 1640 containing 10% FCS at a density of 5x I a:~ cells per well in 96 well culture plates and allowed to adhere for 12 h at 37 °C in the presence of 5% C02• Next day, the medium was replaced with 200 J.LI of leucine free RPMI medium containing 10% serum. The leucine free RPMI containing 1 0% FCS was used for seeding partially adherent cell lines, COL0205 and J774A.1. Cells were allowed to adhere for 12 h and the toxin was added in the same medium. The suspension cell lines, HUT102 and K562 were plated at a density of 5X 103 _cells/well in 80% leucine free RPMI containing 18% complete RPMI and 2% serum immediately before use. The medium used at various stages was supplemented
-
Assay of Cytotoxicity of Chimeric Toxins
-
Cell-free protein synthesis inhibitory activity of restrictocin was assayed as described by Harlow and Lane ( 1988). The frozen rabbit reticulocyte lysate was thawed on ice in the presence of 30 J..LI of haemin solution per 0.5 ml vial. The toxin was diluted in 0.2% RNase free BSA and several concentrations were incubated with 10 J..LI lysate, I mM ATP, 0.2 mM GTP, 75 mM KCI, 2 mM magnesium acetate, 3 mM glucose, 10 mM Tris-HCI, pH 7.6, 4 J..LM amino acid mixture without leucine, 0.16 J..LCi eH] leucine, 1.33 mg/ml creatine phosphokinase, and 2.66 mg/ml creatine phosphate in a reaction volume of 30 J.LI. The reaction was carried out at 30 °C for one hour and terminated by adding 0.25 ml of I N NaOH containing 0.2% H202• The reaction mixture was further incubated for I 0 min. at 37 °C, BSA added to a final concentration of 65 J..Lg/ml, and the proteins were precipitated with 15% trichloroacetic acid. The mixture was left on ice for 30 min. for complete precipitation and harvested onto 26 mm glass fibre filters. The filter discs were placed in a manifold harvester (millipore) and rinsed with chilled 5% TCA, before the addition of reaction contents. The filters were thoroughly washed with chilled acetone and dried at 37 °C, for one hour. The dried filters were immersed in organic scintillation fluid, and counted using a liquid scintillation counter (Packard).
-
Assay for Inhibition of in Vitro Protein Synthesis
-
The specific ribonucleolytic activity of restrictocin and its mutants was followed by detecting the release of the characteristic 400 nucleotide long a-fragment from 28S rRNA of eukaryotic ribosomes. All the reagents, water and glassware used during the experiment were treated with O.I% DEPC to get rid of contaminating ribonucJeases. Rabbit reticulocyte lysate (30 J.Ll) was incubated with different concentrations of the toxin in 40 mM Tris-HCl (pH 7.5) containing 10 mM EDTA at 37 °C for 30 min. in a 50 J.Ll reaction volume. The control reaction did not contain an)' toxin. The reaction was stopped by adding 2 J.Ll of I 0% SDS and incubated at ambient temperature for 5 min. Total RNA was extracted using Trizol reagent. 200 J.LI of the reagent was added to the reaction mixture, mixed well and incubated at room temperature for 5 min. Subsequently, 50 J.LI chloroform was added to each tube, mixed thoroughly and incubated at ambient temperature for 2 min. followed by centrifugation at I2,000 rpm, at 4 °C, for I5 min. in a microfuge (Plastocraft). The aqueous phase was mixed with 125 J.Ll isopropanol to precipitate the RNA, allowed to stand at ambient temperature for I 0 min. and centrifuged at 12,000 rpm at 4 °C for I5 min. The RNA pellet was washed with 75% ethanol, dried in air, dissolved in 10 J.Ll of 0.5% SDS solution and electrophoresed on a 2% agarose gel after heating at 65°C for 2 min. The RNA was visualized by ethidium bromide staining and photographed using Polaroid camera. The photographs were scanned, printed using a laser printer to present as figures in this thesis.
-
Specific Ribonucleolytic Activity Assay
-
1.2% acetylphenylhydrazine (APH) solution to render it anemic. The APH solution wa5 prepared in sterile water and pH was neutralized to 7.0 with 1 M HEPES buffer (pH 7.5). The rabbit was allowed to recover for 5 days, after which it was bled. The blood was collected in a sterile tube, containing an equal volume of prechilled salt solution and the mixture was filtered through a cheese cJoth. Filtrate was centrifuged at 2000 g for 10 min. at 4 °C. Supernatant was discarded, the pellet was washed twice with salt solution without heparin and finally, resuspended in equal volume of chilled sterile water. It was kept on ice for a minute and centrifuged at 20,000 g for 20 min. at 4 °C. The supernatant, containing the lysate, was immediately stored in liquid Nitrogen in 0.5 ml aliquots.
-
The rabbit reticulocyte lysate was prepared as described by Sambrook et al ( 1989). A young male NZW rabbit weighing 2-2.5 Kg was subcutaneously injected for five consecutive days respectively with 2 ml, 1.6 ml, 1.2 ml, 1.6 ml and 2.0 ml of
-
Preparation of rabbit reticulocyte lysate
-
Circular Dichroic spectra of various proteins were recorded at room temperature, using a JASCO J7i0 spectropolarimeter fitted with a thermostated cell holder. I 50 J..Lg protein was dissolved in 3 ml of I 0 mM sodium phosphate buffer (pH 7.0), and the samples were scanned in the far-UV range (200-250 nm). A cell with a 1 em optical path was used to acquire the spectra at a scan speed of 50 nrn/min. with a. sensitivity of 50 mdeg and a response time of I sec. The sample compartment was purged with nitrogen, and spectra were averaged over I 0 accumulations. The CD spectra were normalized to mean residue ellipticity curves using Jasco software. Yang's reference parameters were used to perform secondary structure analyses from CD measurements using Jasco Secondary Structure Estimation Programme (Yang et al., 1986).
-
Structural Characterization of Proteins by CD Spectroscopy
-
The proteins were resolved on SDS-polyacrylamide gels and transferred onto a nitrocellulose membrane, in the transfer buffer, at a constant current of 300 rnA for 2 h. The membrane was incubated in blocking buffer for 45 min. at room temperature with continous shaking. The membrane was further incubated in anti-restrictocin antibody diluted in PBS, pH 7.4, containing 0.1% Tween 20 (PBST), for 45 min .. The membrane was washed thrice with PBST, followed by incubation in anti-rabbit IgG-HRP conjugate diluted in PBST for 30 min. with shaking. After repeated washings with PBS, colour was developed by incubating the membrane with the chromogenic substrate 0.5 mg/ml of DAB.4HCI (diaminobenzidine tetrahydrochloride dihydrate) and 1 f..ll/ml of H202 in PBS.
-
Western Blotting
-
M Tris-HCI pH 8.8, containing 4% stacking gels in O.I25 M Tris-HCI pH 6.8. The gels were run in SDS-PAGE running buffer at a constant current of 40 rnA Proteins were visualized by staining the gels with Coomassie brilliant blue.
-
The purified proteins were analysed by SDS-PAGE as described by Laemmli ( 1970). Restrictocin and its mutants were analysed on 12.5% resolving gels in 0.375
-
SDS-PAGE
-
Heterologus expression of various proteins was done in BL21 (A.DE3) strain of E. coli. Bacterial cells were transformed with the desired construct and grown in Super broth (pH 7.2) containing 100 J.lg/ml ampicillin, at 37 °C with continous shaking in a gyratory shaker at 225 rpm. The cultures were induced, at ~oo of 2.0, with I mM IPTG, and harvested two hours later by centrifugation at 4000 g, at 4 °C, for 20 min .. The recombinant proteins were purified from the inclusion bodies using the procedure described by Buchner et al ( 1992). The total cell pellet from a liter of culture was homogenized in 180 ml of inclusion bodies washing buffer containing 8 ml of freshly prepared lysozyme solution (5 mg/ml). The suspension was incubated at room temperature for 1 hr with intermittent shaking. Added 20 ml each of 5M NaCI and 25% Triton X-100 were added to the suspension and incubated at room temperature for 30 min. with vigorous shaking. The suspension was centrifuged at 13,000 g at 4 °C, for 50 min. and the pellet was resuspended, in the washing buffer containing 1% Triton X-1 00, using a polytron homogenizer and centrifuged at 13,000 g for 50 min. The pellet was washed four times with washing buffer without Triton . X-100. The pellet containing inclusion bodies was solubilized in 6 M guanidine hydrochloride by incubating for 2 hours at room temperature. The solubilized protein was centrifuged at 50,000 g, at 4 °C, for 30 min. and the protein concem.ration was adjusted to 10 mg/ml in the supernatant with 6 M guanidine hydrochloride. The denatured protein thus obtained was reduced by adding 65 mM dithioerythritol and incubated at room temperature for 2 h. To renature, the protein was diluted 1 00-fold in the refolding buffer and incubated at 10 °C for 48 h without stirring or shaking. Renatured material, after dialysis in 20 mM MES buffer, pH 5.0 containing 100 mM urea, was loaded on a S-Sepharose column, and the protein bound to the column was eluted with a 0-1 M NaCI gradient in 20 mM MES on an FPLC system (Pharmacia). The fractions containing the desired protein were pooled and concentrated, and the protein was further purified to homogeneity by gel filtration chromatography on a TSK 3000 column (LKB) in PBS, pH 7.4.
-
Isolation and Purification of Proteins from the Inclusion Bodies
-
Sequencing of cloned inserts was done by Sanger's dideoxy chain termination method (Sanger et al., J 977) using Sequenase version 2.0 kit from USB. 5 J.ll of J mg/ml suspension of plasmid DNA was incubated in denaturation buffer at 37 °C for 30 min. in a reaction volume of 50 J.ll, and then the precipitation was carried out in the presence of 5.5 J.ll of 3M sodium acetate and 4 volumes of chilled ethanol at -70 °C for 30 min. The pellet, obtained by centrifugation at 10,000 g, for 20 min., at 4 °C, was washed with 70% ethanol and resuspended in 7 J.ll of sterile water. J pmole of sequencing primer in J J.ll water and 2J.ll of 5X sequenase reaction buffer were added to denatured DNA and the reaction mix was incubated at 65 °C for 5 min. for primer annealing. The reaction mixture was cooled slowly to about 35 °C, by putting the heat block at room temperature. For labeling, J J.ll of 0. J M DTT, J J.ll radioactivity containinig J 0 J.lCi of 35S dATP, 2 Jlllabeling mix diluted 5-fold in steriJe water and 2 Jll sequenase enzyme diluted 8-fold in sequenase dilution buffer were added to the· primer annealed DNA. Incubated the reaction mixture at room temperature for 2-5 min. and added 3.5 J.ll to each of the 4 different tubes containing 2.5 J.ll dideoxy nucleotides ddATP, ddTTP, ddCTP, and ddGTP separately. The mixture was incubated at 37 °C for 5 min. and finally, the reaction was stopped by adding 4 J.ll of estop solution to each tube. Reaction products were separated on a 6% polyacrylamide sequencing gel made in TBE buffer containing 7.5 M urea. The samples were heated at 75 °C for 2 min. and immediately loaded on the gel. The gel was run at a constant power of 60 watts maintaining the temperature of gel between 50-55 °C, dried and exposed to an X-ray film.
-
DNA Sequencing
-
resuspended in 0.2 ml TE, and extracted successively with phenol, phenol-chloroform, and chloroform. In the aqueous phase, 0.25 volume of J 0 M ammonium acetate and two volumes of chilled ethanol were added and the mixture was incubated at room temperature for 5 min. to precipitate the plasmid DNA. The pure plasmid DNA was recovered by centrifugation at J 2,000 g for J 0 min. at 4 °C, washed with 70 %ethanol, dried and resuspended in TE buffer (pH 8.0). The amount and the purity of the DNA was done spectrophotometrically by recording the absorbance at 260 nm.
-
Plasmid DNA was prepared by alkaline lysis method of Ish-Horowicz ( 1981 ). 5 ml cultures were grown as described for small scale plasmid preparation. 0.5 ml from the growing culture was inoculated into 250 ml of LB containing ampicillin. The culture was grown for 12 h at 37 °C with vigorous shaking, centrifuged at 3000 g, at 4 °C, for 15 min. and the bacterial pellet was resuspended gently in 1 0 ml TEG buffer. The mixture was incubated at room temperature for 10 min., followed by addition of 20 ml of freshly prepared alkaline-SDS solution. The contents were mixed by inversion and the mixture was kept on ice for 10 min., followed by the addition of 15 ml of chilled potassium acetate solution. The contents were mixed by inverting the tube, and incubated on ice for 10 min. The lysed cell suspension was centrifuged at 5000 g, at 4 °C, for 20 min. The supernatant was taken, and nucleic acids we~,-.. precipitated by adding 0.6 volume of chilled isopropanol. The mixture was incubated on ice for 10 min. followed by centrifugation at 5000 gat 4 °C, for 10 min .. The pellet was washed with 70% ethanol, dried and resuspended in TE buffer. The plasmid DNA was purified further to remove the contaminating proteins and RNA following the PEG purification protocol as described by Sambrook et al ( 1989). Equal volume of chilled 5 M lithium chloride solution was added to DNA . suspension, mixed well and incubated on ice for 10 min. The precipitate was removed by centrifugation at 10,000 g at 4 °C, for 10 min. DNA was precipitated from the supernatant by adding equal volume of isopropanoL The mixture was centrifuged at 10,000 g for 10 min. at 4 °C and the pellet was washed with 70% ethanol. The DNA thus obtained was incubated in TE buffer containing 20 J.tg/ml of DNase free RNase A for 30 min. at room temperature. Afterwards, equal volume of 1.6 M NaCl containing 13% (w/v) PEG 8000 was added to DNA solution. The contents were. thoroughly mixed and centrifuged at 10,000 g, at 4 °C, for 10 min .. The pellet was
-
Large Scale Plasmid DNA Preparation
-
of the plasmid DNA with 0.5 volume of cold isopropanol. The mixture was kept on ice for 10 min. and centrifuged at 12,000 rpm at 4°C for 15 min. DNA pellet thus obtained was washed with 80% ethanol, dried and dissolved in 50 J.!l TE buffer (pH 8.0). Minipreps were screened by restriction digestion. 5 J.tl of plasmid DNA was incubated with 5 units of appropriate enzyme(s) and 150 units of RNaseT1 for 2 h and the products were analyzed on an agarose gel to identify the positive clones.
-
5 ml LB containing 100 J.tg/ml of ampicillin was inoculated with single. bacterial colony picked from the culture plates. The culture was grown for 12 h at 37 °C with vigorous shaking. Cells were harvested from 3 ml of culture by centrifugation at 3000 rpm in a microfuge (Plastocraft) at 4 °C for 15 min. Added 200 J.tl of TEG buffer was added to the cells, and tt.ey were gently resusupended to get a uniform suspension and kept on ice for 5 min. 400 J.tl of freshly prepared alkaline-SDS solution was added to the cell suspension and mixed well by inverting the tubes followed by an incubation on ice for 10 min. Subsequently, 300 J.ll of chilled potassium acetate solution was added and mixed thoroughly by vortexing. The mixture was centrifuged at I 0.000 rpm at 4 °C for 15 min.. The supernatant was collected and phenol-chloroform extraction was performed followed by precipitation
-
Mini Plas~id Preparation and Screening
-
A control reaction was done with the control annealed DNA lacking the oligonucleotide. The constituents were mixed and incubated on ice for 2 min. afterwards, at room temperature, for 5 min. The reaction was further carried out at 37 °C for 2 h followed by heating at 70 °C for 10 min. 12.5 J.tl of the reaction products were analyzed on an agarose gel along with annealed samples to check the complementary strand synthesis. The samples were diluted I 0-times with water and 5 J.ll of the diluted sample was used to transform 50 J.ll of E. coli host strain, DH5a cells. The suspension was pl~!ed on 2 LB agar plates containing ampicillin. Single colonies were picked, grown in liquid culture and miniprep screening of DNA was done to select the positive clones.
-
Annealed DNA 10.0 J.ll I OX synthesis buffer 2.5 J.ll 1 OX ligation buffer 1.0 J.ll dNTP mix (100 mM) 1.0 J.ll ATP (100 mM) 0.25 J.ll ~ T7 DNA polymerase (5 U/J.tl) 0.5 J.ll T4 DNA ligase (400 U/J.tl) 0.5 J.ll H20 9.25 J.ll Total 25.0 J.l
-
Titration of uracil containing template: The crude preparation of the phagemid DNA (1 ml aliquot), was used to titrate the uridine incorporation in the template. The strains CJ236 (ung-duf) and DH5aF'(ung+ dut+) of E. coli were transformed with the diluted template DNA The CJ236 cells, plated in the presence of ampicillin and chloramphenicol while DH5aF' cells, plated in the presence of ampicillin alone, were grown overnight on LB agar plates. The good incorporation of uridine gave no colonies or very few colonies in DH5aF' cells whereas with CJ236 several colonies were obtained. A ratio of 103-104 between the number of colonies in CJ236 to that in DH5aF' cells was considered ideal for an efficient incorporation of uridine. Phosphorylation of the mutagenic oligonucleotide: The components of a standard reaction to carry out the phosphorylation are described below Oligonucleotide (180 nmoVml) 1.0 J.ll 1 OX Kinase buffer 2.5 J.ll 10mMATP 1.0 J.ll 10 mM spermidine 0.25 J.ll 100mMDTT 1.25 J.ll T4 polynucleotide Kinase 0.5 J.ll H20 18.5 J.ll Total 25.0 J.LI The constituents were . mixed thoroughly, incubated at 37 °C for 30 min. and subsequently, the enzyme was denatured by heat inactivation at 70 °C for 10 min. Annealing of the mutagenic oligonucleotide: 750 ng (approximately) of the uracil containing single stranded template and 1 J.L) of the phosphorylated· oligonucleotide were taken in IX annealing buffer making up the total reaction volume 20 J.LI. A control reaction, was also carried out simultaneously, lacking the oligonucleotide. The contents were mixed by vortexing and incubated at 95 °C for 10 min. in a water bath. The reaction mixtures were further incubated at 80 °C for I 0 min. in a heat block and the heat block was transferred to ambient temperature, cooled slowly to about 30 °C over a period of 30-60 min. Complementary DNA strand synthesis: The oligonucleotide annealed uracil containing template was used for complementary strand synthesis in the following reaction.
-
Site-directed mutagenesis was done according to the method employed by Kunkel et al., 1987. Preparation of Uracil containing phagemid: E. coli strain CJ236 was transformed with the required template DNA and grown on LB plates containing the antibiotics, ampicillin 100 Jlg/ml and chloramphenicol 30 Jlg/ml (stock solution made in alcohol). Further, the plates were incubated at 37 °C for 12 h and a single colony was picked from the center of the plate, inoculated in 5 ml LB containing ampicillin and chloramphenicol. The liquid culture was grown at 37 °C overnight with vigorous. shaking. About 500 Jll of the culture was diluted 40-times with LB containing ampici11in and chloramphenicol and grown at 37 °C with vigorous shaking (200 rpm) upto an OD600 of 0.25-0.3. The speed of shaker was reduced to 100 rpm and the culture was left for 30 min. for the F pilus to grow. Afterwards, it was infected with VCS Ml3 helper phage at an MOl of 1:20. The cells were grown for 30 min. in a stationary culture to allow the phages to infect, followed by slow shaking ( 100 rpm) for one hour. Subsequently, the culture was diluted 10-times with 2X YT medium containing ampicillin and chloramphenicol and grown in the presence of 0.25 Jlg/ml uridine and 50 Jlg/ml kanamycin at 37 °C overnight with vigorous shaking. The following day, the culture was chilled on ice for 10 min. and centrifuged at 12,000 rpm for 10 min. at 4 °C in a Sorvall RC5C centrifuge using a GSA rotor. The pellet was discarded and the supernatant was centrifuged again in fresh GSA bottles. A small aliquot of about 1 ml from the supernatant was saved for titration and the . precipitation of the single stranded phagemid was carried out using 0.15 volume of 16.67% PEG in 3.3 M NaCl followed by incubation on ice for 4 h. J'he mixture was centrifuged at 12,000 rpm at 4 °C for 30 min. using a GSA rotor and the pellet was resuspended in 3 ml TE buffer. The suspension was centrifuged at 15,000 rpm at 4 °C for 10 min. using a SS34 rotor. The supernatant was ultracentrifugated at 100,000 g at 4 °C for 2.5 h. The pellet was resuspended in 500 Jll TE buffer followed by phenol-chloroform extraction and precipitation of the single stranded DNA with ethanol for 30 min. at -70 °C. The DNA pellet was washed with 70% ethanol, dried and dissolved in 200 Jll TE buffer. The uracil containing template was quantitated by analysing on an agarose gel.
-
Site-directed Mutagenesis
-
Transformation of the bacterial host with an appropriate plasmid was performed using the method of Mandel and Higa ( 1970). A vial of competent bacterial cells was thawed on ice. The plasmid DNA was added at a concentration 1 ng/25 Jll of competent cells and the mixture was allowed to stand on ice for 30 min. The cells were given a heat shock by incubating the mixture at 42 °C for 90 sec, followed by a 2 min. incubation on ice. The mixture was diluted 10-fold with LB and incubated at 37 °C for 1 h. Afterwards the cells were plated on the LB-agar containing the antibiotic whose resistance marker was present in the plasmid.
-
Transformation of Bacterial Host
-
The pure PCR amplified product, and the vector were digested with required· restriction enzymes in the reaction buffer as per supplier's recommendation. Ten units of enzyme were used to digest I Jlg of DNA and the samples were incubated for three hours at appropriate temperature. The vector was dephosphorylated with calf intestinal phosphatase (0.2 units/Jlg of DNA) for 30 min. at 37 °C. After digestion, relevant fragments were gel purified in 15% PEG-8000-T AE solution as described by Zhen and Swank (1993). Ligation of the vector and insert DNA was performed in a reaction volume of 20 Jll using 400 units oi T4 DNA ligase in the recommended ligation buffer at 16 °C for 12 h. A control ligation reaction without the insert was also done keeping the other components same. The concentration of insert was eight to ten times more than the vector. The ligated sample and control mix was later used for transformation.
-
DNA Digestion and Ligation
-
The reaction was started by an initial hot start at 94 °C for 5 min., followed by a three-step amplification cycle. The amplification cycle consisted of a 1 min. denaturation at 94 °C, followed by a 2 min. annealing at 48 °C and an extension at 72 °C for 2 min. The cycle was repeated 30 times and the reaction mixture was incubated at 72 °C for additional 7 min. to allow for primer extension. The PCR amplified product was separated from the primers on a 1% agarose gel. A well was carved ahead of the required fragment and filled with 15% PEG-T AE solution (Zhen and Swank, 1993). The DNA was electro-eluted in 15% PEG-TAE solution, and purified further by phenoVchloroform extraction and ethanol precipitation.
-
A standard PCR was set up as described below.
-
Polymerase Chain Reaction
-
Competent cells of the different strains of E. coli were prepared as described by Cohen et al. ( 1972). An LB-agar plate was streaked with the desired strain, and a single colony was inoculated into 5 ml of LB medium. The culture was grown at 37 °C with continuous shaking at 200 rpm for 6 hours. A small inoculum from this culture was used to start a I 00 ml culture in the same medium. At an OD600 of 0.3-0.4, when the culture reached early Jog phase, it was chilled on ice for 30 min .. and centrifuged at 2000 g for 15 min. at 4 °C. The pellet was gently resuspended in 50 ml of chilled 50 mM calcium chloride and incubated on ice for 60 min. The cell suspension was centrifuged at 2000 g for 15 min. at 4 °C, and the pellet was gently resuspended in 5 ml of chilled 50 mM calcium chloride containing 20% glycerol. The competent cell suspension was immediately aliquoted in prechilled vials and stored at -70 °C.
-
Preparation of Competent Bacterial Cells
-
Compositions of the different solutions used in this study are described in appendix.
Tags
- Method-11-detail
- Method-4
- Method-11
- Method-2-detail
- Method-18-detail
- Method-3-detail
- Method-10-detail
- Method-21
- Method-15-detail
- Method-22-detail
- Method-10
- Method-13
- Method-12
- Method-16-detail
- Method-2
- Method-20
- Method-17-detail
- Method-17
- Method-5-detail
- Method-6
- Method-8-detail
- Method-4-detail
- Method-12-detail
- Method-18
- Method-3
- Method-9
- Method-19
- Method-7
- Method-22
- Method-20-detail
- Method-6-detail
- Method-5
- Method-16
- Method-19-detail
- Method-1
- Method-14-detail
- Method-21-detail
- Method-15
- Method-7-detail
- Method-13-detail
- Method-9-detail
- Method-1-detail
- Method-14
- Method-8
Annotators
URL
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
r-bZP3 was arsanilated using a modification of the procedure of Nisnoff (1967). Briefly, arsanilic acid (100 mg) was dissolved in 5 ml of I M HCI. A IO ml stock of NaN02 (10 mg/ml) was also prepared fresh and added dropwise to the arsanilic acid solution while vortexing. Activation of arsanilic acid was checked on starch-KI paper. The ice cold activated arsanilic acid solution was added dropwise to the protein solution (5 mg of r-bZP3 in 100 mM PB, pH 7.4) stirring constantly in an ice water bath, while pH was maintained between 9.0 and 9.5 with 10 N NaOH. The protein solution was dialyzed extensively against I 00 mM PB having 4 M urea. Arsanilation of r-bZP3 was checked by ELISA using ars-r-bZP3 for coating ( 1 flg/well) and using a 1:100 dilution of murine anti-ars MAb, R 16.7 (Durdik et al., 1 989). Bound Ab was revealed using anti-mouse HRPO conjugate (I :5000). Three monkeys previously immunized with r-bZP3-DT conjugate (MRA-375, MRA-640 and MRA-672) and 2 naive monkeys (MRA-446 and MRA-670) were immunized at 2 intramuscular sites with 250 flg of ars-bZP3 conjugate using Squalene:Arlacel A ( 4: 1) as an adjuvant. Boosters were administered at intervals of 20 days and bleeds were collected I 0 days post immunization. Bleeds were analyzed by ELISA using r-bZP3 and ars-BSA for coating to determine anti-bZP3 and anti-ars Ab titres as described earlier.
-
Arsanilation of r-bZP3
-
administered as and when required. Animals were put on continuous mating with males of proven fertility after administration of the three primary injections and monitored for menstrual cyclicity and conception. Ab titres were determined as described above except that anti-monkey HRPO conjugate was used as the revealing Ab.
-
Female bonnet monkeys (Macaca radiata) reared at the Primate Facility (Nil, New Delhi) were selected and serum progesterone levels were estimated for atleast three months in samples which were collected biweekly. Animals showing atleast two consecutive normal ovulatory peaks (serum progesterone levels >2 ng/ml) (Bamezai, 1986) were selected for fertility trials. Five animals (MRA 375, 515, 640, 672, 770) immunized with 250 Jlg equivalent of r-bZP3, expressed in SG I3009[pREP4] cells, conjugated to DT, was emulsified with Squalene and Arlacel A, adjuvants permitted for human use, in a ratio of 4: I and administered intramuscularly at two sites. In addition, the primary dose also contained I mg/animal of SPLPS as an additional adjuvant. Animals were boosted at intervals of 4-6 weeks depending on the Ab titers with 250 Jlg of r-bZP3-DT using Squalene and Arlacel A as adjuvants. A second group of 3 monkeys (MRA 384, 502, 661) were immunized using a slightly different protocol. The primary immunization consisted of 125 J.lg of r-bZP3-DT and 125 J.lg of r-bZP3-TT (expressed in BL2I(DE3) cells) using the same adjuvants and immunization protocols mentioned above except that boosters were administered alternately with 250 Jlg of r-bZP3-DT or -TT conjugates using Squalene and Arlacel A as adjuvants. Following completion of the primary immunization and 2 boosters at monthly intervals, bleeds (1-2 ml) were collected biweekly from the antecubital vein for estimation of progesterone levels and Ab titres. Boosters were
-
Immunization of Female Bonnet Monkeys
-
Progesterone levels were estimated from sera of bonnet monkeys which were bled biweekly using a radioimmunoassay employing reagents and protocol as prescribed by the W.H.O. Matched Assay Reagent Programme (Sufi et al., 1983). Each sample was run in duplicates. Progesterone was extracted from serum (0.1 ml) by the addition of 2 ml of ice-cold ether in each tube and vortexing for 2 min. The tube was immersed in liquid nitrogen in order to flash freeze the serum phase and the unfrozen ether phase which contained the extracted steroid hormone was decanted into another tube. The ether was allowed to evaporate 0/N and 0.5 ml of steroid assay buffer (0.1 M PBS, pH 7 .3, 0. 1% thiomersal and 0.1% gelatin) was added to the tubes and the tubes were incubated at 40°C for 30 min. Steroid sticking to the walls of the tubes was recovered by vigorous vortexing. 100 J..LI of anti-progesterone Ab (at a dilution giving -50% binding of tritiated p.rogesterone in the absence of unlabelled competing progesterone) was then added to the tubes followed by addition of 0.1 ml of 3H-progesterone ( -10,000 cpm/tube). The mixture was incubated for atleast 16 hrs at 4oc. Unbound progesterone
-
was separated by addition of 0.2 ml of ice cold assay buffer containing 0.625% activated charcoal and 0.0625% dextran and incubated for 30 min at 4oc. This was followed by centrifugation at 2500 rpm for I 5 min at 4°C. The supernatant was carefully decanted into scintillation vials and 4 ml of scintillation fluid (0.4% 2,5 diphenoxazole; 0.01% POPOP [1-4 bis(5-phenyl-2-oxazolyl)benzene] in sulfur free toluene) was added and counted in a liquid scintillation beta counter (Beckman Instruments, California, USA). The amount of progesterone per ml of serum was calculated from a standard curve with known amounts of progesterone in each assay.
-
Progesterone Radioimmunoassays
-
Human oocytes were washed twice with PBS containing 0.1 % BSA and then incubated with 1 :50 dilution of immune or pre-immune serum samples at RT for 30 min. Following washing with PBS (3 changes of 5 min each), the oocytes were treated with goat anti-rabbit Ig-FITC conjugate for 30 min at RT. After washing with PBS, the treated oocytes were mounted in Glyceroi:PBS (9: 1) and examined under fluorescent microscope.
-
Indirect Immunofluorescence on Human Oocytes
-
In addition, cryosections of an ovary from a normal cycling female (10 years) were also processed. Sections passing through a follicle were selected, washed in PBS and blocked for 30 min in 5% normal goat serum. The sections were incubated at 37°C with 1 :250 dilution of rabbit pre-immune and immune sera for 1 h, washed with PBS and incubated for 1 h with 1 :2000 dilution of goat anti-rabbit lg-FITC conjugate. Slides were washed with PBS and mounted in Glyceroi:PBS (9: 1) and examined under fluorescent microscope.
-
A 3 year old monkey was treated daily for 3 days with an intramuscular injection of 25 IU of PergonaJ® (Laboratoires Serono S.A., Aubonne, Switzerland). The monkey was ovarectomized on day 6, and the ovary was snap frozen in liquid nitrogen and sections of 5 J..Lm thickness were cut in a cryostat at -20°C and fixed for 20 min in chilled methanol.
-
Immunofluorescence on Bonnet Monkey Ovarian Sections
-
Porcine ZP3a. and ZP3P prepared as described previously (Yurewicz et al., 1987) and purified r-bZP3 were tested for their reactivity with rabbit anti-r-bZP3 Ab in the immunoblot by the same procedure as described above except that goat anti-rabbit Ig-HRPO conjugate was used.
-
Reactivity with Porcine ZP3
-
Microtitration plates were coated with r-bZP3 at a concentration of 200 ng/well in 50 mM PBS, pH 7.4 for I hr at 37°C and then at 4oc overnight. Plates were subsequently washed once with PBS and blocked with 1% BSA for I hr at 370C in PBS to reduce non-specific binding. Blocking was followed by three washes of 5 min each with PBS containing 0.05% Tween-20 (PBST). Plates were incubated with varying dilutions of preimmune and immune sera for 1 h and bound Ab was revealed with the anti rabbit-HRPO conjugate used at an optimized dilution of 1:5000 in PBS. After washing to remove unbound anti-rabbit-HRPO conjugate, the enzyme activity was estimated with 0.1% orthophenylenediamine (OPD) in 50 mM citrate phosphate buffer, pH 5.0 having 0.06% of hydrogen peroxide as the substrate. The reaction was stopped by adding 50 J..fllwell of 5 N H2S04 and the absorbance read at 490 nm in a microplate reader (Molecular Devices Corporation, California, USA). The Ab titer was calculated by regression analysis and is represented by Ab units (AU) as the reciprocal of the dilution of the Ab giving an A490 of I .0
-
Titration of Rabbit Anti-bZP3 Sera
-
administered at two sites. In addition, the primary dose also contained 500 J..Lg of SPLPS as an additional adjuvant. This was followed by 2 booster at 4 weekly intervals with an equal amount of r-bZP3-DT conjugate.
-
Female New Zealand White rabbit (Small Animal Facility, National Institute of Immunology, New Delhi, India), 6 months of age was immunized intramuscularly with r-bZP3-DT conjugate equivalent to 125 Jlg of r-bZP3 (expressed in SG13009[pREP4] cells) in 0.9% saline emulsified with Squalene and Arlacel "A" in a ratio of 4: I and
-
Immunization of Rabbit
-
For purification, the His6-bZP3 fusion protein was expressed in SG 13009[pREP4] and BL2I (DE3) strains transformed with the pQE-bZP3 plasmid. Expression was scaled up to a 2000 ml (250 ml X 8) batch flask culture. Cells were pelleted down at 4,000 g for 20 min at 4oc and stored at -7ooc till used. The cell pellet (I g/5 ml) was solubilized in buffer A (6 M Guanidine hydrochloride, O.I M NaH2P04, O.OI M Tris, pH 8.0). The suspension was centrifuged at I 0,000 g for I5 min at 4°C and the supernatant containing the r-fusion protein was mixed with gentle end to end shaking for 1 hat RT with the Ni-NT A resin (Qiagen GmbH). The resin was loaded on a column and washed with I_O volumes of buffer A. The column was subsequently washed with 5 volumes each of buffers B and C which contained 8 M Urea, 0.1 M NaH2P04 and 0.01 M Tris and had successively reducing pH values of 8 and 6.3. The recombinant fusion protein was eluted with buffers D and E in which the pH was further reduced to 5.9 and 4.5 respectively. The eluted protein was concentrated in an Amicon concentrator using a YM5 membrane and then dialyzed against I 00 mM phosphate buffer pH 7.4 having 4 M urea. The purified protein was quantitated with bicinchoninic acid. Twenty milligrams of r-bZP3 was conjugated to 13 mg of diphtheria toxoid (DT; Serum Institute, Pune, India) or 19 mg of tetanus toxoid (TT) using a modification of the "one step" glutaraldehyde coupling procedure (Avrameas, 1969). Conjugation was done in I 00 mM phosphate buffer, pH 7.4 with 4 M urea using O.I% glutaraldehyde, 0/N at RT with gentle end to end mixing. Unreacted sites were blocked with 100 mM lysine for 3 h at RT. The conjugate was dialyzed against 10 mM PBS having 0.3 M urea.
-
Purification and Conjugation
-
IMMUNOGENICITY AND IN VIVO CONTRACEPTIVE EFFICACY
-
Sf9 cells infected with AcNPV, VI, V2, V3, or V4 were harvested 72 h pi, washed twice with 10 mM PBS, air dried on a slide and fixed in chilled methanol for 15 min. Cells were incubated with MA-451 culture supernatant and N-terminal anti-peptide serum ( 1 :500) at 37°C for 1 h, washed with PBS and further incubated at 37oc for 1 h with I :50 dilution of anti-mouse FITC or I :2000 anti-rabbit FITC. Slides were washed extensively, mounted in 90% glycerol in PBS (50 mM, pH 7.4) and examined under Optiphot fluorescent microscope (Nikon, Tokyo, Japan).
-
Immunocytochemical Localization of Recombinant Proteins in Infected Cells
-
Cells and supernatant collected 72 h pi were analyzed on a 0.1% SDS-I 0% PAGE and Western blot using polyclonal Abs generated in rabbit against peptide-DT conjugates using (i) 23-45 aa residue N-terminal peptide with an extra lysine at the N-terminus (KQPFWLLQGGASRAETSVQPVLVE), (ii) 300-322 aa residue C-terminal peptide (CSFSKSSNSWFPVEGPADICQCC) corresponding to the bZP3 sequence (iii) MA-451 and (iv) goat anti-GST Ab. The C-terminal anti-peptide Ab was used for determining whether or not the full length bZP3 was being expressed by the cells infected with the different viruses. Anti-mouse (I :500), anti-rabbit ( 1 :500) or anti-goat ( 1 :500) Abs conjugated to HRPO were used for revealing bound Ab.
-
Analysis ofr-bZP3 in VI, V2, V3 and V4 Infected Cells and Supernatant
-
Cells ( 1.5X to6) infected with AcNPV, V 1, V2, V3 or V 4 were grown for 72 h pi followed by starvation for methionine (Met) in Met-free medium for I h. 25 J.1Ci of 35s Met was added and cells were pulsed for 2 h. Cells were harvested and proteins resolved on a 0.1% SDS-I 0% PAGE as described above. The gel was dried and exposed to X-ray film. The signal was quantitated and analyzed using the molecular imager (GS 250, BioRad, USA). The intensity of the polyhedrin band was compared with that of the r-bZP3 proteins expressed by virus constructs V 1, V2, V3 and V 4.
-
Radiolabeling of Recombinant Proteins in Infected S/9 Cells
-
Expression conditions for bZP3 under the polyhedrin promoter were standardized using the Northern blot and Western blot analysis of cells infected with the VI virus. Sf9 cells, seeded at a density of 1.5 million in a 35 mm petridish were allowed to attach for I h at 27oc. The medium was removed and the cells were infected with AcNPV (Autographa californica nuclear polyhedrosis virus) or VI at -10 MOl for 1 h. The infected cells were harvested at different time points from 0-84 h pi. The cells (-2X I o6) were washed with chilled PBS and resuspended in I ml of denaturing solution ( 4 M GITC, 25 mM sodium citrate, pH 7, 0.5% sarcosyl, and 0.1 M BME) followed by addition of 50 Jll of 2 M sodium acetate (pH 4) and 500 Jll water saturated phenol and 1 00 Jll chloroform:isoamyl alcohol ( 49: 1 ). The suspension was mixed thoroughly after the addition of each reagent, vortexed for 1 0 sec and cooled on ice for 15 min. The aqueous and the phenol phases were separated by centrifugation at 12,000 rpm for 20 min in a refrigerated microfuge. The aqueous phase was transferred to a fresh tube and 500 Jll isopropanol was added. RNA was precipitated at -20°C for 1 h, and pelleted at 12,000 rpm for 20 min at 40C. The RNA pellet was dissolved in 300 Jll denaturing solution followed by addition of 300 Jll of isopropanol. RNA was reprecipitated at -2ooc for 1 h, washed with 75% ethanol and the pellet collected by centrifugation at 12,000 rpm in a refrigerated microfuge. RNA was dissolved in 25 Jll of 0.5% SDS by heating at 65°C for 10 min and stored at -700C. RNA was quantitated and 5 Jlg of RNA corresponding to each time point was resolved on a 1.2% agarose formaldehyde gel, transferred to a nylon membrane and probed with 32p labeled bZP3 probe. Cells harvested at different time points from -2X 106 cells 12-84 h pi were pelleted down, washed with 10 mM PBS, pH 7.4, and lysed in reducing buffer and resolved on a 0.1% SDS-10% PAGE as described earlier. The supernatant was concentrated to lOX for loading on the gel.
-
Expression 'Of bZP3 in BEVS
-
For analysis of viral DNA by dot blot, I X I o5 cells were seeded in each we11 of the 9~ well plate and infected in duplicate with 50 J.Ll of the plaque pick for I h, followed b: addition of 50 J.Ll of CM to each well. Infected cells were incubated for 5 days, afte which the culture supernatant was saved and ce11s were processed for dot blot analysi~ Ce11s were lysed with 200 J.LI of 0.5 M NaOH. The alkali was neutralized by addition o 50 J.LI of 4 M ammonium acetate. The nylon membrane was wetted in warm water an( washed in dot blot solution (1 M ammonium acetate, 0.02 N NaOH) and the cell lysatt was blotted on to the membrane using a dot blot apparatus (Bio-Rad), dried, UV eros: linked and processed for prehybridization and hybridization. For the isolation of total genomic DNA, cells infected in a 35 mm culture dish wen harvested 72 h post infection (pi) and treated with 400 J.LI of DNA extraction buffer(]( mM Tris HCI, pH 8, 0.6% SDS, 10 mM EDTA)·and 50 J.Ll of 20 mg/ml proteinase K a 37°C for 12-I6 h. The DNA was extracted twice with phenol:chloroform:isoamy alcohol (25:24: 1) and once with chloroform. For each extraction, the suspension wa! mixed by inverting the eppendorf and separated by centrifugation at 2,000 rpm for 3 mir in a microfuge. DNA was precipitated with I ml of 95% ethanol at -20°C for 4 h anc pelleted at 4,500 rpm for 20 min. The pellet was washed with 70% ethanol, dried anc resuspended in 50 J.LI of TE. DNA was digested with Hind III, resolved on a 0.8% agarose gel and processed for Southern blotting. Positive clones were amplified b) infecting cells at a multiplicity of infection (MOl) of ~1 for 10 days and the amplifiec virus. was titrated using a plaque assay. Sf9 cells were infected at -I 0 MOl fo1 expression of the r-proteins.
-
Screening of the Recombinant Viruses
-
The staining solution was aspirated and the plates left at 27°C 0/N. Plaques whicl appeared as clear zones, were identified, marked and verified under the microscope Plaques were picked up using a sterile 200 J.Ll tip and viruses were allowed to diffuse ou 0/N in 200 J.LI of CM to make the plaque pick stock virus.
-
Sf9 cells ( 1.8x 1 o6) seeded in a 35 mm culture dish were infected in duplicate with 100 J!l of the serial dilutions (1 oO to w-2) of the transfection supernatant for I h. The viral inoculum was aspirated and 1.5 ml of the cooled agarose overlay (1.5% LMP agarose, 0.5X CM) was added to each dish and allowed to set. 1 ml of CM was added to each dish and the plates were incubated at 270C for 5 days. Medium was removed and cells were stained with 2 ml of staining solution (0.03 % neutral red in 10 mM PBS) for 1 h.
-
Plaque Assay for Isolating Viruses
-
Lipofectin-mediated transfection and in vivo homologous recombination was used to introduce foreign DNA into the AcNPV genome at the polyhedrin locus for making the V 1, V2, V3 and V 4 recombinant virus constructs using the BacPAK™ baculovirus expression system or the Baculogold™ transfection kit (Pharmingen) according to the manufacturer's instructions.
-
Construction of Recombinant Viruses
-
AcNPV and recombinant baculoviruses were isolated, grown and assayed in confluent mono layers of Spodoptera frugiperda (Sf9) cell line maintained in TNMFH which is Grace's insect cell culture medium supplemented with 3.33 giL Lactalbumin hydrolysate, 3.33 giL Yeast autolysate. Complete medium (CM) was prepared by supplementing TNMFH with 10% heat inactivated FCS and 1 OOX antibiotic-antimycotic.
-
Cell Culture Techniques
-
650C in 0.2X SSC, 0.1 % SDS for I 0 min. The membrane was wrapped in Saran wrap and exposed to an X-ray film. The colonies that were positive by colony hybridization were inoculated in a 3 ml culture and used for preparing DNA for analysis by restriction digestion and Southern blotting. The digested DNA was resolved on a 0.8% agarose gel as described above. The gel was soaked in 4 volumes of denaturing solution (1.5 M NaCI and 0.5 M NaOH) for 1 h at RT with shaking followed by neutralization (1 M Tris HCI, pH 8 and 1.5 M NaCI) for 1 hat RT. The DNA was transferred to a Nylon membrane, UV crosslinked and hybridized with the full length 32p labeled· bZP3 probe as described above.
-
The ligation mixture was used for transformation of DH5a cells as described earlier. Transformed bacterial colonies growing on LB Amp plates were screened by colony hybridization. Briefly, colonies were grown for 6-8 h on a Nylon membrane placed on a LB Amp plate. The colonies were lysed by placing the membrane on a Whatman® 3MM paper soaked in I 0% SDS for 3 min, followed by treatment with denaturing solution (0.5 N NaOH, I.5 M Nael) for 5 min and neutralization solution (0.5 M Tris Hel pH 8, 1.5 . M Nael) for 5 min in the same manner. The membrane was dried, UV cross linked (Ultraviolet crosslinker, Amersham) and processed for prehybridization and hybridization. Stocks of 20X sse (174 giL NaCI, 88.2 giL sodium citrate, pH 7.0) and 50X Denhardt's (I% ficoll, I% PVP, I% BSA) were prepared. The membrane was prehybridized for 4-6 h in the prehybridization solution (5X SSe, 5X Denhardt's, 0.5% SDS, I 0 J..Lg/ml sheared and denatured salmon sperm DNA). The bZP3 DNA was labelled using the Multiprime DNA labeling system using 50 ng of purified bZP3 DNA. For hybridization with the probe, I o6 cpm/ml of the denatured 32p labeled bZP3 probe was added to the prehybridization solution and incubation was further carried out for I4-I6 h. For removing the non specifically bound probe, the membrane was washed successively at RT in 2X sse for 10 min, at 55°e in 0.2X sse, 0.1% SDS for 10 min and finally at
-
Screening of the Recombinant Transfer Vector
-
(gp67) signal sequence in the pAcSecG2T vector. bZP3 was amplified using the VI transfer vector as a template in a PeR reaction using forward primer eGGGATCCeAAeeeTTeTGGeTeTTG incorporating a BamH I site and reverse primer GeGAATTCeAGAAGeAGAeeTGGAeeA incorporating an EcoR I site. Amplified DNA was digested and ligated with the digested pAcSecG2T vector. A dinucleotide deletion at nt position 239-240 resulted in premature termination of the protein after aa residue 76 and was used for expression of the V3 protein. DNAs from the transfer vector clones were purified using the Plasmid Midi kit DNA purification system.
-
Constructs were designed to express bZP3 in insect cells under the late polyhedrin promoter. The full length bZP3 I-424 aa residues (construct VI encoding a 47 kDa polypeptide) including the native eukaryotic N-terminal signal sequence (aa 1-22) and the C-terminal region after the furin cleavage site which includes the transmembrane-like domain (aa 349-424) was digested from pBluescript-bZP3 clone 401 using Kpn I and Sac I restriction enzymes and subcloned in the pBacPAK8 vector. A second construct V2 was designed containing a truncated version of the gene (aa 1-348), excluding the C-terminal transmembrane domain giving a protein with a calculated mass of 39.8 kDa. The insert was amplified by PCR using the forward primer TGCAGGTACCATGGAGCTGAGGC incorporating a Kpn I site (restriction site shown in bold) and the reverse primer CCGAGCTCAGAAGCAGACCTGGACCA incorporating a Sac I site using 10 ng of 401 template DNA. The amplified fragment was digested with Kpn I and Sac I, and ligated with a similarly restricted pBacPAK8 vector. Two more constructs were designed to express bZP3 aa 23-76 (V3 encoding a polypeptide 36.6 kDa) and aa 23-348 (V4, encoding a polypeptide 67.3 kDa) inframe as GST fusion proteins with a replacement of the native signal sequence with an insect
-
Plasmid Construction
-
EXPRESSION IN BACULOVIRUS
-
Peptide antisera were generated in the laboratory against peptides PI, 23-45 aa residues with an extra lysine at the N-terminus (KQPFWLLQGGASRAETSVQPVL VE), P2, 300-322 aa residues (CSFSKSSNSWFPVEGPADICQCC) and P3, 324-347 aa residues (KGDCGTPSHSRRQPHVVSQWSRSA) corresponding to bZP3 precursor protein in rabbits and were used to determine their reactivity with the r-bZP3 protein expressed in E. coli in an enzyme linked immunosorbent assay (ELISA). Microtitration plates were coated with 200 ng of r-bZP3 or I J.tg/well of the peptide. HRPO conjugated goat anti-rabbit Ig at I :5000 dilution was used as revealing Ab.
-
Reactivity with Anti-peptide Sera
-
E. coli strains deficient in specific proteases were used to study their influence on the expression of r-bZP3. BL21 (DE3) and BL21 (pLysS) deficient in ompT and ion proteases and DF5 carrying a targeted mutation of the ptr gene, were transformed with the pQE-bZP3 plasmid. Colonies obtained were grown 0/N and subcultured next morning and grown till A6oo=0.7. Cultures were then induced with 0.5 mM IPTG for 3 h. Harvested cells were checked by SDS-P AGE and immunoblotting.
-
Expression of r-bZP3 in Different E. coli Strains
-
Conditions for expression of r-bZP3 in SG 13009[pREP4] cells transformed with the pQE-bZP3 plasmid were standardized. Cells were grown till A6oo=0.7 and induced with different concentrations of IPTG (0.5, 1, 2, or 4 mM) for a constant time period (3h) or induced with a 0.5 mM IPTG for different time periods (0, 1, 2, 3 or 5 h). Cells were harvested and analyzed by SDS-PAGE and immunoblot as described above.
-
Standardization of Expression Conditions
-
A I 00 ml culture was grown and induced according to the procedure mentioned above. The culture was divided into 2 aliquots and cells were pelleted down. For cytosolic localization, one pellet was resuspended in 5 ml of sonication buffer (50 mM Na-phosphate, pH 7.8, 300 mM NaCI). The sample was frozen and then thawed in ice-water and cells lysed by brief sonication. The sample was centrifuged at I 0,000 g for 20 min. The soup and the pellet represent the soluble and insoluble components of the cell pellet. In order to check for periplasmic localization, the 2nd aliquot of cells was resuspended in I 0 ml of hypertonic solution (30 mM Tris, pH 8, 20% sucrose, 1 mM EDT A) and incubated at RT for 10 min with shaking. Cells were centrifuged at 8,000 g for 10 min. The pellet was subjected to osmotic shock in 5 mM MgS04. Cells were stirred for 10 min in an ice water bath, centrifuged at 8000 g at 4°C for I 0 min. The soup collected represented the periplasmic fraction. The fractions were analyzed by 0.1% SDS-1 0% PAGE and Western blotting as described above.
-
Intracellular Localization
-
The cell pellet obtained from l ml culture was solubilized by boiling for 5 min in 100 J..Ll of 2X sample buffer (0.0625 M Tris, pH 6.8, 2% SDS, 10% glycerol, 5% BME and 0.001% bromophenol blue) and the proteins were resolved on a 0.1% SDS-10% PAGE (Laemmeli, 1970). The gel was stained with Coomassie brilliant blue for staining total cellular proteins. For immunoblotting, the proteins were electrophoretically transferred to 0.45 J..Lm nitrocellulose membrane overnight at a constant voltage of 15 V in Tris glycine buffer with 20% methanol (Towbin et al., 1979). Nonspecific sites on the membrane were blocked by incubation with 5% BSA in 50 mM phosphate buffered saline (PBS), pH 7 .4, for 1 h followed by 3 washes (15 min each) with PBS containing 0.1% Tween-20 (PBST). For detection of bZP3, a murine monoclonal antibody (MAb), MA-451, generated against the pZP3P and recognizing a cross reactive epitope (166-171 aa residues) within the bonnet sequence was used (Afzalpurkar and Gupta, 1997). The membrane was incubated for 1 h with a 1 :5 dilution of MA-451 culture supernatant, followed by 3 washes in PBST. Horseradish-peroxidase (HRPO) conjugated goat anti-mouse immunoglobulin (lg) was used to reveal bound Ab. Colour was developed with 0.6% (w/v) 4-chloronaphthol in 50 mM PBS, pH 7.4, containing 25% methanol and 0.06% H202. The reaction was stopped by washing the membrane with PBS.
-
SDS-PAGE and Immunoblot
-
The pQE-bZP3 plasmid was transformed in Ml5[pREP4] and SG13009[pREP4] bacterial strains provided with the kit. The transformed colonies were analyzed for expression. A single transformed colony was inoculated and grown overnight at 37oc in 1 ml of LB containing 100 J..Lg/ml of ampicillin and 25 J..Lg/ml of kanamycin. Cells were subcultured 1:10, next morning and grown until cell density reached an A600 of approximately 0.6-0.7. The cells were further grown in the presence of isopropyl P-D thiogalactopyranoside (IPTG) to induce expression of the fusion protein under the T -5 promoter. The cells were collected by centrifugation at 13,000 g for 60 sec and the resulting pellet was stored at -700C until used.
-
Expression in MJS[pREP4] and SG13009[pREP4] E. coli Strains
-
vector, under the phage T7 promoter, in BL21 (DE3) cells, and under the T5 phage promoter, in the pQE30 vector for expression in SG13009[pREP4] and M15[pREP4] cell strains. For cloning in pRSET B, the full length bZP3 initially subcloned in the pBacPAK8 vector at the Kpn I and Sac I sites was released after digestion with Kpn I and EcoR I and cloned in a similarly restricted pRSETB vector inframe with an N-terminal His6 tag. For cloning in the pQE30 vector, the pBacPAK8 carrying the full length bZP3 was initially digested with Not I, filled in with Klenow and then digested with Kpn I. The purified bZP3 fragment was then cloned in the vector digested with Kpn I and Sma I in frame with an N-terminal His6 tag. Though transformants positive for the bZP3 insert in the right reading frame were recovered, no expression could be detected by SDS-PAGE or immunoblots in either case. An alternate strategy was then devised in which an internal fragment of the gene, excluding the signal sequence and the transmembrane-like domain, following the putative furin cleavage site, was amplified by PCR using the forward primer 5'-CGGGATCCCAACCCTTCTGGCTCTTG-3' incorporating a BamH I site and the reverse primer 5'-CCGAGCTCAGAAGCAGACCTGGACCA-3' incorporating a Sac I site. The PCR was done in a 50 J!l volume using 50 pM of each primer and Vent polymerase for extension. The pBluescript-bZP3 (1 0 ng) having a full length bZP3 insert was used as the template and was initially denatured at 95°C for 10 min. Amplification was carried out for 35 cycles of denaturation at 95°C for 2 min, primer annealing at 600C for 2 min and extension at 72°C for 3 min followed by a final extension at 72oc .for 15 min. The amplified bZP3 fragment was digested with BamH I and Sac I and cloned in frame downstream of a His6 tag under the T5 promoter-lac operator control in the pQE30 vector. The authenticity of the construct was confirmed by N-terminal sequencing using an upstream sequencing primer GGCGT ATCACGAGGCCCTTTCG.
-
Our initial attempts to express the full length gene in E. coli as a His6 fusion protein failed. Attempts were initially made to express the His6-bZP3 protein in the pRSET B
-
PCR Amplification and Cloning in pQE30 Vector
-
CLONING AND EXPRESSION IN E. coli
-
The bZP3 sequence was analyzed using PCgene and Lasergene DNA and protein analysis softwares. The alignment of the bZP3 aa sequence with the homologous sequences from other species was carried out using the Cluster V Multiple Alignment Programme (Higgins and Sharp, 1989).
-
Analysis of Sequence
-
Double stranded plasmid pBluescript-bZP3 DNA was sequenced using Sanger's dideoxy chain termination method (Sanger et al., 1977) using the Sequenase version 2.0 kit according to the protocols recommended by the manufacturer. Purified plasmid DNA (5 J..Lg) and 2 pM of the sequencing primer was used in the sequencing reaction. Table 2 gives a list of the primers used for sequencing of the bZP3 eDNA clones. bZP3 sequence was confirmed by sequencing three independent clones 401, 403 and 404.
-
Sequencing of bZP3
-
centrifuged at 10,000 rpm for 10 min, washed with 70% ethanol and dried. DNA was resuspended in 500 J..Ll of TE containing 20 J..Lg/ml RNAase, incubated at RT for 30 min and analyzed by agarose gel electrophoresis. DNA for transfection was prepared using the Plasmid midi kit DNA purification system using protocols described in the manual.
-
A 1000 ml culture of cells harboring the plasmid were grown 0/N in LB Amp· Next morning the culture was chilled and cells pelleted at 4,500 rpm in a Sorvall SS34 rotor for 20 min. The supernatant was discarded and cells were washed with 100 ml of STE buffer (0.1 M NaCI, 10 mM Tris HCl and 1 mM EDT A, pH 8.0). The pellet obtained after centrifugation was resuspended in I 0 ml of GTE solution containing I mg/ml lysozyme and the mixture was incubated at RT for 20 min at 4oc. Alkaline SDS (20 ml) was added and the mixture was incubated at RT for 10 min after mixing gently by inverting the tube. Ice cold potassium acetate solution ( 15 ml) was added and the tube was chilled on ice for 15 min and then centrifuged at 18,000 rpm at 40C in a SS34 rotor. The supernatant was carefully transferred to a fresh tube, DNA was precipitated by adding 0.6 volume isopropanol and incubating at RT for 10 min and then recovered by centrifugation at 5000 rpm at RT for 30 min. DNA was rinsed with 70% ethanol, dried and dissolved in 3 ml of TE. To the nucleic acid solution 3 ml of chilled LiCI (5 M) was added, mixed and the precipitate removed after spinning at 10,000 rpm for 10 min at 40 C. DNA was precipitated from the supernatant using an equal volume of isopropanol,
-
Large Scale Plasmid DNA Isolation
-
mixed by inverting tubes. Following an incubation on ice for 5 min, 150 J.tl of ice cold potassium acetate solution (prepared by mixing 60 ml of 5 M potassium acetate, II.5 ml of glacial acetic acid and 28.5 ml of water) was added. The mixture was incubated on ice for 5 min and centrifuged at I2,000 g for 5 min at 4°C. The supernatant was decanted into a fresh tube and extracted once with an equal volume of phenol equilibrated with 10 mM Tris, pH 8 and 1 mM EDT A (TE) followed by extraction with chloroform:isoamyl alcohol (24: 1 ). DNA was precipitated by adding 2 volumes of chilled ethanol, contents mixed and tube incubated on ice for 30 min. The pellet collected after centrifugation at 12,000 g for 15 min was washed once with 70% alcohol, dried and resuspended in 50 J!l TE. To remove RNA contamination contents of the tube were treated with 20 J.tg/ml RNAase for I5 min at RT. DNA was checked and analyzed after restriction digestion by agarose gel electrophoresis.
-
Colonies obtained after transformation were inoculated in 5 ml LB and grown 0/N in the presence of 100 Jlg/ml ampicillin (LB Amp). Next morning 1.5 ml of the culture was centrifuged for I min at I 0,000 rpm in a microfuge. The supernatant was discarded and the pellet was resuspended in 100 Jll of chilled GTE (50 mM Glucose, 25 mM Tris HCI and 10 mM EDT A). After an incubation at room temperature (RT) for 5 min, 200 Jll of freshly prepared alkaline SDS (0.2 N NaOH, 1% SDS) was added and the contents
-
Small Scale Plasmid DNA Isolation
-
E. coli DH5a cells were grown overnight (0/N) in LB at 37oc and subcultured in 100 ml of fresh LB. The culture was maintained at 37°C with shaking till absorbance at 600 nm (A6oO) reached 0.3. The culture was chilled and centrifuged at 4,500 rpm iil a Sorvall SS34 rotor for .15 min. Cells were resuspended in 50 ml of freshly prepared sterile ice cold CaCl2 (100 mM) solution and incubated on ice for 1 h. Cells were pelleted at 2,500 rpm and very gently resuspended in I 0 ml of chilled 100 mM CaCl2 having 15% glycerol. 200 Jll of competent cells were aliquoted into sterile, chilled 1.5 rn1 tubes and stored at -7ooc. The ligation mix was added to competent cells thawed on ice, tubes were gently mixed and incubated on ice for 1 h. Cells were subjected to a heat shock at 42oc for 90 sec and then revived in 1 ml of LB at 37°C for 1 h with gentle shaking. Aliquots were plated on LB plates containing the appropriate antibiotics and incubated at 37oc 0/N.
-
Preparation of Competent Cells and Transformation
-
All bacterial cultures were grown in Luria Bertani (LB) medium (NaCl 1%, Yeast extract 0.5%, and tryptone I%, pH 7.0) at 37oc with shaking. The medium was sterilized by autoclaving at 15 lbs/inch2 for 20 min. Solid growth medium was prepared by adding 1.5% agar to LB prior to autoclaving. Antibiotics were added after cooling the medium to 50°C.
-
Media Composition and Bacterial Culture
-
ligation reactions were carried out usmg conditions and buffers specified by the manufacturer.
-
The PCR amplified eDNA fragment corresponding to bZP3 was resolved on a 0.8% agarose gel run using IX TAE buffer (0.04 M Tris-acetate, O.OOI M EDTA) and purified using the Geneclean® II kit. The PCR amplified bZP3 was digested with Kpn I and Sac I and ligated into the pBluescriptll SK(+) vector at the same sites. The digestion and
-
Agarose Gel Electrophoresis, Digestion and Ligation
Tags
- Method-1-Method-4
- Method-3-Method-7
- Method-4
- Method-4-Method-4-detail
- Method-3-Method-7-detail
- Method-2-Method-6-detail
- Method-4-Method-3
- Method-3-Method-5
- Method-3-Method-9-detail
- Method-3-Method-4-detail
- Method-2-Method-4
- Method-1-Method-5
- Method-1-Method-7-detail
- Method-3-Method-detail
- Method-4-Method-7-detail
- Method-2-Method-6
- Method-2
- Method-4-Method-4
- Method-3-Method-3
- Method-3-Method-6
- Method-2-Method-1
- Method-4-Method-1-detail
- Method-4-Method-8-detail
- Method-2-Method-2-detail
- Method-1-Method-6
- Method-4-Method-2
- Method-2-Method-2
- Method-1-Method-7
- Method-3-Method-3-detail
- Method-1-Method-3
- Method-3-Method-10-detail
- Method-3-Method-1
- Method-2-Method-3-detail
- Method-1-Method-2
- Method-2-Method-8
- Method-4-Method-8
- Method-4-Method-9
- Method-4-Method-6
- Method-3-Method-9
- Method-3-Method-10
- Method-4-Method-2-detail
- Method-3
- Method-3-Method-2
- Method-4-Method-5-detail
- Method-1-Method-2-detail
- Method-1-Method-6-detail
- Method-3-Method-4
- Method-4-Method-9-detail
- Method-3-Method-5-detail
- Method-2-Method-5
- Method-1-Method-8
- Method-4-Method-5
- Method-4-Method-1
- Method-4-Method-3-detail
- Method-2-Method-8-detail
- Method-1-Method-3-detail
- Method-1-Method-5-detail
- Method-4-Method-7
- Method-4-Method-6-detail
- Method-2-Method-5-detail
- Method-2-Method-3
- Method-1-Method-4-detail
- Method-3-Method-8
- Method-2-Method-1-detail
- Method-3-Method-2-detail
- Method-3-Method-6-detail
- Method-3-Method-1-detail
- Method-1-Method-8-detail
Annotators
URL
-