331 Matching Annotations
  1. May 2019
    1. Sonicated cells of E. coli having recombinant vector was centrifuged. Supernatant was dispensed into 0.2 % v/v xylan agar plate and incubated for 4 h. The plates were then flooded with Congo red solution (0.2 % w/v) for 30 min and destained with 1M NaCl solution till a clear zone of xylan hydrolysis was visible. The plates were gently shaken on a shaker to accelerate the process of staining/destaining
    2. Qualitative detection of xylanolytic activity by plate assay
    3. Preparation of electrocompetent cells (E. coli cells) A protocol was employed. The procedure was carried out in cold under sterile conditions as follows: •A single colony of E. coli DH10B/ DH5α/XL1blue was inoculated in 20 mL of LB medium and grown overnight at 30 °C. •500 mL LB medium was inoculated with 5mL of this overnight grown culture of the E. coli and incubated with vigorous shaking (250 rpm) at 30 °C until an A600of 0.5 - 0.8 was achieved. •The cells were chilled in ice for 10-15 min and transferred to prechilled Sorvall® centrifuge tubes and sedimented at 4,000 rpm for 20 min at 4 °C. •The supernatant was decanted and cells were resuspended in 500 mL of sterile ice-cold water, mixed well and centrifuged as described above. •The washing of the cells described above was repeated with 250 mL of sterile ice-cold water, following which cells were washed with 40 mL of ice-cold 10 % (v/v) glycerol and centrifuged at 4,000 rpm for 10 min. •The glycerol solution was decanted and the cell volume was recorded. The cells were resuspended in an equal volume of ice-cold 10 % glycerol. •Cells were then dispensed in 40 μL volumes and stored at -80 °C until required.
    4. Electrotransformation
    5. The metagenomic DNA extracted from above defined protocol was digested with Sau3A1 at conditions optimized to generate maximum fragment in the size range of 2-6 kb. Different concentration (0.05 to 1 unit) of enzyme was used to optimize the digestion of 1 μg of DNA. Reactions were carried out in a final volume of 30 μl each in an Eppendorf of 1.5 mL. Reaction mixture (1 μg DNA having 3 μL NEB buffer 3 and 0.3 μL of 10X BSA) were kept at 37 °C for 10 min and stopped by heat inactivation at 80 °C for 20 min. Different digested reactions were checked for the desired fragments using 0.8 % (w/v) agarose gel electrophoresis. After optimization of DNA fragments for the appropriate size, a large scale digestion was carried out and the fragments (2-8 kb) were purified from low melting agarose gel using gel extraction method according to the manufacturer’s protocol (Qiagen gel extraction kit, Germany)
    6. Insert DNA preparation
    7. Purity of the DNA extracted from various environmental samples was confirmed by subjecting the extracted DNA to restriction digestion. DNA was digested with Sau3AI (New England Biolabs). One μg of metagenomic DNA in 20 μL reaction mixture was treated with 0.5 U of Sau3AI and incubated at 37 °Cfor 10 min. The reaction was terminated at 80 °C for 20 min and the digested DNA was fractionated on 1.2 % (w/v) agarose gel.
    8. Restriction digestion
    9. The isolated DNA was diluted (1:100) with MQ. The concentration (mg mL-1) of the DNA [N] was determined spectrophotometrically by recording absorbance at 260 nm (A260) as: A260 = ε 260[N]where ε 260 is the extinction coefficient of DNA (50 for ds DNA) [N] = concentration (mg mL-1) of DNA The concentration of ds DNA [N] was calculated as [DNA] (mg mL-1) = A260/ε 260 [DNA] (μg mL-1) = A260 × 50 × dilution factor Purity of DNA was checked by measuring absorbance at 260 and 280 nm and calculating the A260/A280 ratio (Sambrook et al., 1989). A DNA sample was considered pure when A260/A280 ranged between 1.8-1.9. An A260/A280 < 1.7 indicated contamination of the DNA preparation with protein or aromatic substances such as phenol, while an A260/A230 < 2.0 indicated possible contamination of high molecular weight polyphenolic compounds like humic substances.
    10. Determination of DNA quantity and purity
    11. as well as commercial methods (MN kit, Germany; Mo-Bio kit, CA, USA; Zymo soil DNA kit, CA, USA) according to the manufacturer’s protocols and compared in terms of DNA yield and purity.
    12. The soil DNA from Pantnagar and Lonar soil samples were also extracted by various manual (Desai and Madamwar, 2007; Agarwal et al., 2001; Yamamoto et al., 1998
    13. Alternatively metagenomic DNA was extracted from the alkaline soil samples by using different commercial kits (UltraClean™, PowerSoil™ [Mo Bio Laboratories Inc., Carlsbad, CA, USA], Nucleospin kit [Macherey-Nagal, Germany] and Zymo soil DNA isolation kit [CA, USA]). The DNA was finally suspended in 100 μL of sterile Milli Q water for further analysis.
    14. Commercial kits
    15. Comparison of yield and purity of crude DNA
    16. Soil (1 gm) was suspended with 0.4 gm (w/w) polyactivated charcoal (Datta and Madamwar, 2006) and 20 μL proteinase K (10 mg mL-1) in 2 mL of modified extraction buffer [N,N,N,N cetyltrimethylammonium bromide (CTAB) 1% w/v, polyvinylpolypyrrolidone (PVPP) 2% w/v, 1.5 M NaCl, 100mM EDTA, 0.1 M TE buffer (pH 8.0), 0.1M sodium phosphate buffer (pH 8.0) and 100 μL RNaseA] [Zhou et al., 1996] in 20 mL centrifuge tubes to homogenize the sample and incubated at 37 °C for 15 min in an incubator shaker at 200 rpm. Subsequently, 200 μL of 10% SDS was added to the homogenate and kept at 60 °C for 2 h with intermittent shaking. DNA was precipitated by adding 0.5 V PEG 8000 (30 % in 1.6 M NaCl) and left at room temperature for an hour (Yeates et al., 1998). The precipitated DNA was collected by centrifugation at 8000 x g at 4 °C. The supernatant was discarded and pellet was dissolved in 1 mL of TE buffer (pH 8.0) and then100 μL of 5 M potassium acetate (pH 4.5) was added and incubated at 4 °C for 15 min. The supernatant was collected after centrifugation at 8000 x g and treated with equal volumes of phenol: chloroform (1:1) followed by chloroform: isoamylalcohol (24:1) at 8000 x g for 15 min
    17. PROTOCOL FOR OPTIMIZATION OF HUMIC ACID-FREE DNA FROM ALKALINE SOILS
    18. Various strains of Escherchia coli (DH5α, XL1Blue, DH10B) were used as hosts for the propagation of recombinant vectors. In addition, Bacillus subtilis was used as a host for the expression of xylanase gene from the recombinant vector pWHMxyl. Different vectors used in this investigation are listed in
    19. BACTERIAL STRAINS
    20. Soil, sediment, effluent, and water samples have been collected from various hot and alkaline regions of India and Japan in sterile polyethylene bags/bottles. The samples were transported to the laboratory and preserved at 4 °C. Temperature and pH of the samples was recorded.
    21. COLLECTION OF SAMPLES
    1. or DNA isolationJrom P. Jalciparum, genomic DNA kit from Qiagen (Germany) was used. Isolation was done following manufacturer's instructions. Briefly, infected erythrocytes (5 ml at 10% parasitemia) were centrifuged at 3,000 g for 2 min. The cells were washed once in cold PBS and resuspended in 1 ml. Following which, 10 ilL of 5% saponin (final concentration 0.05%) was added and' mixed gently. After lysis, the mix was immediately centrifuged at 6,000 g for' 5min. Further steps were, carried out according to the manufacturer's instructions to isolate genomic DNA. DNA was quantified by measuring absorbance at 260 nm I using a UV -spectrophotometer
    2. Genomic DNA Isolation from Parasite Culture
    1. ~PL mutants were generated using QuickChange site-directed mutagenesis kit (Stratagene). Mutagenesis reactions were performed in accordance with the manufacturer's protocol using pAC28 (wild type ~PL gene fragment cloned in pET28c, section 2.3.3.1) as template. The details of oligonucleotides used for generating the mutant clones are given in table 3.1. Translationally silent restriction sites were engineered in the oligonucleotides whenever possible, in order to facilitate preliminary screening of mutant clones. Mutant clones were screened by restriction endonuclease analysis and confirmed by automated DNA sequencing
    2. Site directed mutagenesis to generate RGPL mutant clones
    1. Bilateral oophorectomy, the surgical removal of both the ovaries, was performed in mice to simulate a condition of estrogen depletion. All procedures in mice were performed after obtaining approval from the Institutional Animal Ethics Committee (National Institute of Immunology, New Delhi). Female BALB/c mice were used in the study
    2. Assay for cell viability by propidium iodide dye exclusion method
    3. THP-1 acute monocytic leukemia cell line (TIB-202) was purchased from American type culture collection (ATCC) (Manassas, VA). These suspension cells were maintained in culture at 37°C in RPMI-1640 medium supplemented with 10% FCS. They were sub-cultured when the cell density reached ~1X106 per mL. To induce differentiation of these monocytic suspension cell cultures to adherent macrophage phenotype, they were subjected to treatment with PMA at a concentration of 10 ng/mL for 36 h. Forty eight hours prior to experimentation, the cells were transferred to phenol-red free RPMI-1640 medium supplemented with 10% dextran-coated charcoal stripped FCS. This was performed to remove all traces of exogenous estrogens as phenol red in culture medium is known to be a weak estrogen (1) and FCS contains multiple steroid hormones which are removed upon stripping with dextran-coated charcoal. MCF-7, a breast carcinoma cell line was obtained from ATCC (Manassas, VA). They were maintained in culture at 37°C in RPMI-1640 medium supplemented with 10% FCS and were routinely sub-cultured when the cells reached a confluency of around 80%
    4. Cell lines and cell culture
    5. Cell culture techniques
    1. was subsequently used as a probe model to carry out molecular replacement for one of the Fab-peptide complex; remainmg three Fab-peptide complexes were solved by using Ppy-LH as search model. The structure of antigen bound 36-65 Fab (2A61) was used for molecular replacement of two Fab-peptide complexes of the same antibody. AMoRe (Navaza, 1994) and Phaser packages from CCP4 suite (Elizabeth Potterton, 2003) were used for structure determination of antigen free BBE6.12H3 Fab and its complexes with peptide, respectively. The solution for 36-65 complexes was determined by using MOLREP from CCP4 suite. Both for MOLREP and AMoRe, calculations for rotation/translation functions were carried out using structure factors from 8 to 4 A resolutions. The transformation matrices obtained from AMoRe for antigen free Fab was utilized to orient the models in the corresponding unit cell. However, both Phaser and MOLREP have a module which automatically does orientation. The packing function of Phaser also checks for possible clashes or voids between the symmetry related molecules. All the solutions were unambiguous. For outputs of AMoRe and MOLREP the crystal packing was examined using Coot (Emsley P, 2004) to ascertain the absence of steric clashes or large voids between symmetry related molecules. Calculations of the Matthews coefficient (Kantardjieff and Rupp, 2003) indicated presence of two molecules for antigen free Fab and a single Fab molecule for all Fab-peptide complexes within the asymmetric unit.
    2. wavelength component in three dimensions inversely proportional to their values of h, k and /. The image of the object can be reconstructed by recombining the individual sine waves as occur in the objective lens of the microscope. Since it is not possible to focus the X-rays, only the intensities could be recorded with the loss of phases, well known as phase problem of crystallography. Macromolecular crystal structures are usually solved using one of the three techniques; multiple isomorphous replacement (MIR), multiple anomalous dispersion (MAD) or molecular replacement (MR). Of the three, MR is generally used in cases where a structural homolog is available. Since the structure of a number of antibodies is already known, MR is the method of choice for structure determination of antibody Fab. The molecular replacement method, involves orienting and positioning a model molecule in the experimental unit cell through rotations and translations. The rotation function developed by Rossman and Blow ( 1962), involves rotation of the Patterson function of one group or molecule with respect to the other in all possible ways and the ultimate superimposition of the two Patterson functions. The translation function deals with positioning the oriented molecule in the unit cell of the unknown structure. It utilizes the cross vectors between various symmetrically related molecules for positioning the probe in the target unit cell. The translation function is carried out by moving the oriented model in small increments along all three directions and calculating the correlation between observed and calculated intensities. From the solutions obtained, the one with the highest correlation and lowest R-factor was chosen for molecular replacement. The structure of the Fab of putative anti-NP germ line mAb Nl G9 was used for molecular replacement. The refined model of the native unliganded germline Fab
    3. The goal of diffraction analysis is reconstruction of the detailed structure of the asymmetric unit from a diffraction pattern. The diffraction pattern breaks down the structure into discrete sine waves. Any shape can be presented in three dimensions as the sum of sine waves of varying amplitudes and phases. The individual reflections of a diffraction pattern represent such waves, which have
    4. Structure determination using molecular replacement
    5. a buffered protein solution in the form of a droplet in contact with the precipitant through the vapor phase. The precipitant slowly causes dehydration to occur in the protein droplet increasing the effective concentration of the protein. The hanging drop crystallization experiment is set up in 24 well tissue culture plates, with the drop of protein solution containing 50% of the precipitant in the mother liquor suspended over the precipitant solution from a siliconized cover slip. This setup is sealed with silicon grease to facilitate controlled vapor diffusion between the well and the drop. For setting up hanging drop crystallization, a pure preparation of Fab molecules in the crystallization buffer (50 mM Na-cacodylate pH 6.7, 0.05% sodium azide or 50mM Tris-Cl pH 7.1, 0.05% sodium azide) was concentrated to a final concentration of 10 mg/ml. For the antibody-peptide complexes, 50-fold molar excess of the peptide was added to the Fab solution. Hanging drops of 8 Jll volume containing 4 111 of the Fab so:ution and 4 111 of varying concentrations of the precipitant were set up in 24-well tissue culture plates (Nunc, Denmark). Initially, a variety of precipitants were used in the crystallization experiments. Conditions which gave indications of crystal formation were then further explored to improve the quality of the crystals. The crystallization plates were maintained at room temperature in insulated conditions so as to prevent rapid changes in temperature. For crystallization of BBE6.12H3Fab-peptide complexes, the crystallization plates were also maintained at 8°C in vibration free incubator (RUMED, Rubarth Apparate, GmbH, Germany). The plates were checked for the presence of crystals every two weeks.
    6. One of the most widely utilized methodologies of crystallization is hanging drop vapor diffusion technique (Wlodawer and Hodgson, 1975). The setup involves
    7. Crystallization
    8. secrete antibody which gets collected in the peritoneal fluid. Ascites is thus a good source of monoclonal antibody. The hybridoma cells, from two different hybridoma, which were secreting IgGs, 36-65 and BBE6.12H3, were injected into the peritoneal cavity of male Balb/c mice irradiated with a dose of 400 RAD and primed with Freund's incomplete adjuvant 72 hours prior to injecting the hybridoma cells suspended in 500 111 of Dulbecco's phosphate buffered saline (DPBS). Approximately 5 x 105 to 5 x 106 hybridoma cells were injected into each mouse. Ascitic fluid could be tapped from the peritoneal cavity of mice after approximately 4-5 days.
    9. Ascites is the intra-peritoneal fluid collected from mice that have developed peritoneal tumor. Hybridoma cells, when injected into the peritoneal cavity of mice,
    10. Generation of ascites from mice
    11. All the peptides used in this study were synthesized by solid phase method on an automated peptide synthesizer (Applied Biosystems, Model 431A), using F-moc (9-fluorenylmethyloxycarbonyl) chemistry on a p-hydroxymethyl phenoxymethyl polystyrene resin (Nova Biochem). For the peptide synthesis, 0.1 mmol of the resin was used and deprotected using 20% piperidine in N-methyl-pyrrolidone (NMP). Subsequently 0.5nmol of the first amino acid was added and coupling was performed usmg DCC-HoBt (dicyclohexylcarbodiimide-hydroxybezotriazole) ester formation method. All other amino acids were coupled by DCC ester coupling. Amino acids and solutions required for peptide synthesis were procured from Nova Biochem and Applied Biosystems, respectively. After completion of synthesis, deprotection was carried out in 20% piperidine/DMF. Finally, the resin was shrunk using ether and dried under vacuum for a minimum of four hours. The cleavage was performed in dark using 94% TF A, 5% anisole, EDT and water accompanied by continuous stirring for two hours. The resin was then filtered and washed with DCM and the solution was evaporated on a rotary evaporator (Buchi, Switzerland) till only a small quantity of DCM/cleavage mixture is left. Cold anhydrous diethyl ether was added to the filtrate to aid in the separation of scavengers from the mixture. The peptides were then extracted with water using a separating funnel. Extraction was followed by evaporation of residual diethyl ether on the rotary evaporator. Total aqueous layer was then frozen as a thin film and lyophilized.
    12. Procedure for peptide synthesis
    13. The crystallographic analysis of the anti-( 4-hydroxy-3-nitrophenyl)-acetyl (anti-NP) and the anti-p-azophenylarsonate (anti-Ars) germline mAbs, BBE6.12H3 and 36-65 bound to various peptides derived from the screening of a random phage library would yield valuable information regarding their promiscuous binding abilities, associated with a primary immune response. The primary requirement for the crystallographic analysis was the preparation of adequate quantities of pure Fab (fragment antigen binding). Purified Fab fragment of both the mAbs was used for subsequent crystallization experiments with various peptide ligands. The X-ray intensity data for the crystals obtained were collected followed by structure determination, iterative steps of crystallographic refinement and model building. The refined models were structurally validated and then subjected to rigorous analysis. This chapter provides a brief background of the methods utilized and details of the experimental protocols followed.
    14. Introduction
    1. For purification, the His6-bZP3 fusion protein was expressed in SG 13009[pREP4] and BL2I (DE3) strains transformed with the pQE-bZP3 plasmid. Expression was scaled up to a 2000 ml (250 ml X 8) batch flask culture. Cells were pelleted down at 4,000 g for 20 min at 4oc and stored at -7ooc till used. The cell pellet (I g/5 ml) was solubilized in buffer A (6 M Guanidine hydrochloride, O.I M NaH2P04, O.OI M Tris, pH 8.0). The suspension was centrifuged at I 0,000 g for I5 min at 4°C and the supernatant containing the r-fusion protein was mixed with gentle end to end shaking for 1 hat RT with the Ni-NT A resin (Qiagen GmbH). The resin was loaded on a column and washed with I_O volumes of buffer A. The column was subsequently washed with 5 volumes each of buffers B and C which contained 8 M Urea, 0.1 M NaH2P04 and 0.01 M Tris and had successively reducing pH values of 8 and 6.3. The recombinant fusion protein was eluted with buffers D and E in which the pH was further reduced to 5.9 and 4.5 respectively. The eluted protein was concentrated in an Amicon concentrator using a YM5 membrane and then dialyzed against I 00 mM phosphate buffer pH 7.4 having 4 M urea. The purified protein was quantitated with bicinchoninic acid. Twenty milligrams of r-bZP3 was conjugated to 13 mg of diphtheria toxoid (DT; Serum Institute, Pune, India) or 19 mg of tetanus toxoid (TT) using a modification of the "one step" glutaraldehyde coupling procedure (Avrameas, 1969). Conjugation was done in I 00 mM phosphate buffer, pH 7.4 with 4 M urea using O.I% glutaraldehyde, 0/N at RT with gentle end to end mixing. Unreacted sites were blocked with 100 mM lysine for 3 h at RT. The conjugate was dialyzed against 10 mM PBS having 0.3 M urea.
    2. Purification and Conjugation
    3. (gp67) signal sequence in the pAcSecG2T vector. bZP3 was amplified using the VI transfer vector as a template in a PeR reaction using forward primer eGGGATCCeAAeeeTTeTGGeTeTTG incorporating a BamH I site and reverse primer GeGAATTCeAGAAGeAGAeeTGGAeeA incorporating an EcoR I site. Amplified DNA was digested and ligated with the digested pAcSecG2T vector. A dinucleotide deletion at nt position 239-240 resulted in premature termination of the protein after aa residue 76 and was used for expression of the V3 protein. DNAs from the transfer vector clones were purified using the Plasmid Midi kit DNA purification system.
    4. Constructs were designed to express bZP3 in insect cells under the late polyhedrin promoter. The full length bZP3 I-424 aa residues (construct VI encoding a 47 kDa polypeptide) including the native eukaryotic N-terminal signal sequence (aa 1-22) and the C-terminal region after the furin cleavage site which includes the transmembrane-like domain (aa 349-424) was digested from pBluescript-bZP3 clone 401 using Kpn I and Sac I restriction enzymes and subcloned in the pBacPAK8 vector. A second construct V2 was designed containing a truncated version of the gene (aa 1-348), excluding the C-terminal transmembrane domain giving a protein with a calculated mass of 39.8 kDa. The insert was amplified by PCR using the forward primer TGCAGGTACCATGGAGCTGAGGC incorporating a Kpn I site (restriction site shown in bold) and the reverse primer CCGAGCTCAGAAGCAGACCTGGACCA incorporating a Sac I site using 10 ng of 401 template DNA. The amplified fragment was digested with Kpn I and Sac I, and ligated with a similarly restricted pBacPAK8 vector. Two more constructs were designed to express bZP3 aa 23-76 (V3 encoding a polypeptide 36.6 kDa) and aa 23-348 (V4, encoding a polypeptide 67.3 kDa) inframe as GST fusion proteins with a replacement of the native signal sequence with an insect
    5. Plasmid Construction
    6. vector, under the phage T7 promoter, in BL21 (DE3) cells, and under the T5 phage promoter, in the pQE30 vector for expression in SG13009[pREP4] and M15[pREP4] cell strains. For cloning in pRSET B, the full length bZP3 initially subcloned in the pBacPAK8 vector at the Kpn I and Sac I sites was released after digestion with Kpn I and EcoR I and cloned in a similarly restricted pRSETB vector inframe with an N-terminal His6 tag. For cloning in the pQE30 vector, the pBacPAK8 carrying the full length bZP3 was initially digested with Not I, filled in with Klenow and then digested with Kpn I. The purified bZP3 fragment was then cloned in the vector digested with Kpn I and Sma I in frame with an N-terminal His6 tag. Though transformants positive for the bZP3 insert in the right reading frame were recovered, no expression could be detected by SDS-PAGE or immunoblots in either case. An alternate strategy was then devised in which an internal fragment of the gene, excluding the signal sequence and the transmembrane-like domain, following the putative furin cleavage site, was amplified by PCR using the forward primer 5'-CGGGATCCCAACCCTTCTGGCTCTTG-3' incorporating a BamH I site and the reverse primer 5'-CCGAGCTCAGAAGCAGACCTGGACCA-3' incorporating a Sac I site. The PCR was done in a 50 J!l volume using 50 pM of each primer and Vent polymerase for extension. The pBluescript-bZP3 (1 0 ng) having a full length bZP3 insert was used as the template and was initially denatured at 95°C for 10 min. Amplification was carried out for 35 cycles of denaturation at 95°C for 2 min, primer annealing at 600C for 2 min and extension at 72°C for 3 min followed by a final extension at 72oc .for 15 min. The amplified bZP3 fragment was digested with BamH I and Sac I and cloned in frame downstream of a His6 tag under the T5 promoter-lac operator control in the pQE30 vector. The authenticity of the construct was confirmed by N-terminal sequencing using an upstream sequencing primer GGCGT ATCACGAGGCCCTTTCG.
    7. Our initial attempts to express the full length gene in E. coli as a His6 fusion protein failed. Attempts were initially made to express the His6-bZP3 protein in the pRSET B
    8. PCR Amplification and Cloning in pQE30 Vector
    9. The bZP3 sequence was analyzed using PCgene and Lasergene DNA and protein analysis softwares. The alignment of the bZP3 aa sequence with the homologous sequences from other species was carried out using the Cluster V Multiple Alignment Programme (Higgins and Sharp, 1989).
    10. Analysis of Sequence
    11. Double stranded plasmid pBluescript-bZP3 DNA was sequenced using Sanger's dideoxy chain termination method (Sanger et al., 1977) using the Sequenase version 2.0 kit according to the protocols recommended by the manufacturer. Purified plasmid DNA (5 J..Lg) and 2 pM of the sequencing primer was used in the sequencing reaction. Table 2 gives a list of the primers used for sequencing of the bZP3 eDNA clones. bZP3 sequence was confirmed by sequencing three independent clones 401, 403 and 404.
    12. Sequencing of bZP3
    13. centrifuged at 10,000 rpm for 10 min, washed with 70% ethanol and dried. DNA was resuspended in 500 J..Ll of TE containing 20 J..Lg/ml RNAase, incubated at RT for 30 min and analyzed by agarose gel electrophoresis. DNA for transfection was prepared using the Plasmid midi kit DNA purification system using protocols described in the manual.
    14. A 1000 ml culture of cells harboring the plasmid were grown 0/N in LB Amp· Next morning the culture was chilled and cells pelleted at 4,500 rpm in a Sorvall SS34 rotor for 20 min. The supernatant was discarded and cells were washed with 100 ml of STE buffer (0.1 M NaCI, 10 mM Tris HCl and 1 mM EDT A, pH 8.0). The pellet obtained after centrifugation was resuspended in I 0 ml of GTE solution containing I mg/ml lysozyme and the mixture was incubated at RT for 20 min at 4oc. Alkaline SDS (20 ml) was added and the mixture was incubated at RT for 10 min after mixing gently by inverting the tube. Ice cold potassium acetate solution ( 15 ml) was added and the tube was chilled on ice for 15 min and then centrifuged at 18,000 rpm at 40C in a SS34 rotor. The supernatant was carefully transferred to a fresh tube, DNA was precipitated by adding 0.6 volume isopropanol and incubating at RT for 10 min and then recovered by centrifugation at 5000 rpm at RT for 30 min. DNA was rinsed with 70% ethanol, dried and dissolved in 3 ml of TE. To the nucleic acid solution 3 ml of chilled LiCI (5 M) was added, mixed and the precipitate removed after spinning at 10,000 rpm for 10 min at 40 C. DNA was precipitated from the supernatant using an equal volume of isopropanol,
    15. Large Scale Plasmid DNA Isolation
    16. mixed by inverting tubes. Following an incubation on ice for 5 min, 150 J.tl of ice cold potassium acetate solution (prepared by mixing 60 ml of 5 M potassium acetate, II.5 ml of glacial acetic acid and 28.5 ml of water) was added. The mixture was incubated on ice for 5 min and centrifuged at I2,000 g for 5 min at 4°C. The supernatant was decanted into a fresh tube and extracted once with an equal volume of phenol equilibrated with 10 mM Tris, pH 8 and 1 mM EDT A (TE) followed by extraction with chloroform:isoamyl alcohol (24: 1 ). DNA was precipitated by adding 2 volumes of chilled ethanol, contents mixed and tube incubated on ice for 30 min. The pellet collected after centrifugation at 12,000 g for 15 min was washed once with 70% alcohol, dried and resuspended in 50 J!l TE. To remove RNA contamination contents of the tube were treated with 20 J.tg/ml RNAase for I5 min at RT. DNA was checked and analyzed after restriction digestion by agarose gel electrophoresis.
    17. Colonies obtained after transformation were inoculated in 5 ml LB and grown 0/N in the presence of 100 Jlg/ml ampicillin (LB Amp). Next morning 1.5 ml of the culture was centrifuged for I min at I 0,000 rpm in a microfuge. The supernatant was discarded and the pellet was resuspended in 100 Jll of chilled GTE (50 mM Glucose, 25 mM Tris HCI and 10 mM EDT A). After an incubation at room temperature (RT) for 5 min, 200 Jll of freshly prepared alkaline SDS (0.2 N NaOH, 1% SDS) was added and the contents
    18. Small Scale Plasmid DNA Isolation
    19. E. coli DH5a cells were grown overnight (0/N) in LB at 37oc and subcultured in 100 ml of fresh LB. The culture was maintained at 37°C with shaking till absorbance at 600 nm (A6oO) reached 0.3. The culture was chilled and centrifuged at 4,500 rpm iil a Sorvall SS34 rotor for .15 min. Cells were resuspended in 50 ml of freshly prepared sterile ice cold CaCl2 (100 mM) solution and incubated on ice for 1 h. Cells were pelleted at 2,500 rpm and very gently resuspended in I 0 ml of chilled 100 mM CaCl2 having 15% glycerol. 200 Jll of competent cells were aliquoted into sterile, chilled 1.5 rn1 tubes and stored at -7ooc. The ligation mix was added to competent cells thawed on ice, tubes were gently mixed and incubated on ice for 1 h. Cells were subjected to a heat shock at 42oc for 90 sec and then revived in 1 ml of LB at 37°C for 1 h with gentle shaking. Aliquots were plated on LB plates containing the appropriate antibiotics and incubated at 37oc 0/N.
    20. Preparation of Competent Cells and Transformation
    21. All bacterial cultures were grown in Luria Bertani (LB) medium (NaCl 1%, Yeast extract 0.5%, and tryptone I%, pH 7.0) at 37oc with shaking. The medium was sterilized by autoclaving at 15 lbs/inch2 for 20 min. Solid growth medium was prepared by adding 1.5% agar to LB prior to autoclaving. Antibiotics were added after cooling the medium to 50°C.
    22. Media Composition and Bacterial Culture
    23. ligation reactions were carried out usmg conditions and buffers specified by the manufacturer.
    24. The PCR amplified eDNA fragment corresponding to bZP3 was resolved on a 0.8% agarose gel run using IX TAE buffer (0.04 M Tris-acetate, O.OOI M EDTA) and purified using the Geneclean® II kit. The PCR amplified bZP3 was digested with Kpn I and Sac I and ligated into the pBluescriptll SK(+) vector at the same sites. The digestion and
    25. Agarose Gel Electrophoresis, Digestion and Ligation
    26. Total RNA was isolated in the laboratory from frozen bonnet monkey ovaries and the poly (A)+ fraction purified using PolyAT tract® mRNA isolation system and used for eDNA synthesis using Riboclone eDNA synthesis system®. The bonnet monkey ovarian eDNA was used as a template for the amplification by PCR of the region of bZP3, corresponding to hZP3 exons 1-6 using forward pnmer 5'-TGCAGGTACCATGGAGCTGAGCTATAGGC-3' (corresponding to exon 1 and incorporating a Kpn I site shown m bold) and reverse primer 5'-CAGGTGGCAGGTGATGTA-3' (corresponding to exon 6), involving an initial melt at 94oc for 2 min and 35 cycles of 94oc for I min, 6QOC for 2 min and 72oc for 3 min followed by a final extension at 720C for I5 min. Similarly, the region corresponding to exons 4-8 of hZP3 was amplified using forward primer 5'-ATCACACCATCGTGGAC-3' (corresponding to ex on 4) and reverse pnmer 5'-AGATCTGAGCTCATTGCTTTCTTCTTTTATTCGGA-3' (corresponding to the exon 8 and incorporating a Sac I site) with the same conditions of the PCR as above except using an annealing temperature of 55°C. The PCR amplifications were carried out using Taq DNA polymerase in a 50 J.ll volume using 20 ng of eDNA. The full length bZP3 eDNA was assembled using the above purified fragments by second PCR involving i) one cycle of 94oc for 3 min, 55oc for 2 min, 72oc for 4 min; ii) addition of forward and reverse primers corresponding to exons I and 8 respectively; iii) 35 cycles of 94oc for I min, 55°C for 2 min, 72°C for 3 min; and iv) final extension at 720C for I5 min.
    27. PCR Amplification of bZP3
    28. CLONING AND SEQUENCING OF bZP3
    1. added and the sample vortexed thoroughly. The sample was then centrifuged for 10 minutes at 1000 x g. The supernate was carefully decanted, the rims of the tube wiped to absorb all residual supernate, and the precipitate counted on a gamma counter set for the detection of 125I. A standard curve was plotted with each assay by using different concentrations of purified hCG, starting from 0 miU 1 ml. The percent binding of the sample was estimated as a fraction of the zero standard and the hCG activity of the sample calculated from the standard curve of the known concentrations. The other RIA procedure used has been described previously by Salahuddin et al., ( 1976 ) . This procedure employed a monoclonal antibody shown to be specific to phcG (Gupta et al., 1982 ). The use of this antibody made this assay much more sensitive compared to the commercial assay described above.
    2. J3hCG was estimated using either a commercial RIA kit ( Micromedic ~hCG RIA kit, ICN Biomedicals, Inc., USA ) or by the procedure developed at Nil, the basic principle of estimation being the same in both assays, i.e., competitive inhibition. The Micromedic kit was used as detailed by the manufacturer. Briefly, 200 ul of the sample was incubated with 100 ul of the given antiserum solution for 30 minutes at room temperature. 100 ul of the tracer 125r hCG solution was then added and incubation continued for another 3 0 minutes. Subsequently, 1. 0 ml of the precipitating solution containing anti -rabbit serum with PEG was
    3. PBS and then replenished with the complete medium. Two days following transfection, the cells were subcultured into the appropriate selective medium for selection of stable clones as described below.
    4. Calcium phosphate mediated stable transfections were performed by the method of Graham and Van der Eb ( 1973 with modifications as described by Gorman ( 1986 ). For each plasmid, two petri dishes each containing 0. 5 x 106 CHO-K1 cells were used, with 10 ug of cesium purified DNA for each transfection. A mock transfection which did not contain any DNA, was performed simultaneously as negative control. Precipitation of the DNA was done with great care to ensure the obtention of a fine, translucent precipitate rather than a dense and opaque precipitate. The calcium phosphate I DNA precipitate was added in 4 ml medium to the cells and the cells incubated for 3 hours at 37°C. At this stage, the cells were examined under the microscope and a fine precipitate appeared as small grains all over the cells. The cells were washed once with serum free medium and a glycerol shock given for 3 minutes at 37°C. The cells were washed twice again with
    5. Using calcium phosphate.
    6. rinsed twice with serum free medium and replenished with 4 ml of DMEM containing 10 % FCS and 100 uM chloroquine. The incubation was continued for another 3 hours at the cells were washed and fed with the normal growth medium containing 10 % FCS. As in the case of FWIL cells, the supernate was collected after 72 hours of transfection and assayed for BhCG activity by RIA.
    7. ayed for BhCG activity by RIA. In case of the other five monolayer forming cell lines, a slightly different protocol was used. Only 1.8 ug plasmid DNA was used for each transfection using 0.5 x 106 cells, and 70 uM chloroquine was included in the DNA 1 DEAE-dextran mixture. Cells were fed 3 hours prior to transfection and washed twice with serum free medium just before exposure to DNA. Cells were exposed to DNA 1 DEAE-dextran mix for approximately 3 hours at 37°C. Following this, the cells were
    8. 1 - 5 ug of plasmid DNA using the DEAE -dextran procedure. DEAE dextran M.Wt. 500,000 was used to perform transient transfection by the method of Luthman and Magnusson 1983 ) , with modifications as described by Gorman ( 1986 ) . Six cell lines ( described above ) with two petri dishes ( 60 mm ) for each cell line were used. In case of FWIL, 5. 4 ug plasmid DNA was used to transfect approximately 5 x 106 cells. No exposure to chloroquine was given. The cells were treated with the DNA 1 DEAE -dextran mixture for 20 minutes at 37°C in a tightly capped tube, mixed gently and reincubated at 37°C for 10 minutes. The sample was then diluted with 3 ml of IMDM supplemented with 10 % FCS, centrifuged and the pellet washed once with normal growth medium. Finally, the pellet was resuspended in 4 ml of growth medium and transferred to a T-25 flask. After incubating for 24 hours at 37°C, 3 ml of fresh medium was added to the cells. The cells were harvested after 72 hours post transfection and the culture supernate was ass
    9. Transient expression of the cloned gene product was studied by transfection performed with
    10. Transient expression.
    11. hours. The NC filters having bound DNA liberated from bacterial colonies, were set up for hybridisation with radioactive probes as described by Maniatis et al., ( 1982 ). The filters were washed thoroughly with a solution containing 50 mM Tris.Cl, pH 8.0, 1 M NaCl, 1 mM EDTA, 1 % SDS, at 42°C, for 1 hour, to wash off any residual bacterial debris and agar etc. Prehybridisation and hybridisation was performed in aqueous solution without formamide in 5 X SSPE. The filters were washed up to a stringency of 0.2 X sse at 65°e.
    12. Colonies bound to nitrocellulose filter ( NC ) were lysed to liberate the DNA which was hybridised as described by Maniatis et al., 1982 ) . To obtain sharper autoradiography signals, the nitrocellulose filter bearing colonies was first overlaid on a 3 MM Whatman paper impregnated with 10 % SDS till the NC wetted evenly. The NC was peeled off and overlaid on another 3 MM paper impregnated with the denaturing solution. In this manner, the NC was successively treated with denaturing and neutralising solutions. Finally, the NC filter was air dried, sandwiched between two sheets of 3 MM paper and baked at 80°C for two
    13. Colony hybridisation.
    14. 400 ci 1 mmole to 3000 ci 1 mmole. The nick translation reaction was set up as recommended by the manufacturer of the kit, using about 0.5 ug DNA. The reaction was incubated at 12 -14 °C for 90 minutes, except in the case of small fragments ( 500 bp ) when the reaction was incubated for 45 minutes only. The reaction was terminated by the addition of stop buffer supplied with the kit.
    15. DNA was labelled using the nick translation kits supplied by BRL or NEN, USA, or Amersham, UK. The 32P-deTP was from either NEN or Amersham, UK, at a concentration of 10 mei I ml. The specific activity of the label ranged from
    16. Nick translation.
    17. bands seen in the DNA size marker, were marked with a ball -point pen at the places where small holes had been pierced in the gel earlier ( see above ). Thus it was easy to monitor the size of the fragments showing hybridisation to the probe. The gel was then peeled off and the membrane w~shed in 6 X sse with gentle rocking for 10 minutes to wash away any residual agarose sticking to the membrane. After air drying at room temperature, the membrane was baked at so0e for two hours. The baked filter was stored at room temperature in a dessicator, if not used immediately. The dehydrated gel was restained in water containing 0.5 ug I ml ethidium bromide for 30 minutes and examined on a short wave UV transilluminator to check for the presence of any DNA fragments that escaped blotting. The absence of any residual bands indicated that the transfer was complete.
    18. Restriction fragments of DNA resolved on agarose gel were transferred to nylon membrane ( GeneScreen or GeneScreen Plus by the capillary blotting procedure of Southern ( 1975 ) as described by Maniatis et al., ( 1982 ) . After the completion of electrophoresis, the gel was stained and photographed as described earlier. Position of the various bands obtained in the DNA size marker lane were marked by piercing small holes at the two ends of each band in the gel with a yellow tip. The gel was then denatured, neutralised and blotted essentially as described by Maniatis et al., ( 1982 ) . Locally available coarse absorbent paper was used to make the paper towels of the appropriate size. In case of genomic DNA from mammalian cells, the agarose gel was first treated with 0.25 M HCl for 10 minutes, followed by the rest of the procedure as mentioned above. The transfer buffer was 20 X SSPE in all cases. To prevent the absorption of fluid from the 3 MM paper under the gel directly to the blotting paper atop the nylon membrane, the gel was surrounded with polythene sheets to minimise the direct contact between the blotting paper and the 3 MM paper placed under the gel. The blotting was performed for 18 -24 hours. After the transfer was over, the paper towels and the 3 MM papers on top of the nylon filter were peeled off. The gel along with the attached membrane, was turned over and kept on a clean sheet of 3 MM paper with the gel side up. The position of the gel slots was marked with a ball -point pen. Also, the positions of the
    19. southern blot.
    20. Colony lifts were performed essentially as described by Maniatis et al. , 1982 ) . Recombinant colonies were grown 0/N at 37°C to have well separated colonies. The colonies were overlaid with 80 mm diameter nitrocellulose filter circles BA 85, S & S and after the filter became wet throughout, it was peeled off in a single, smooth motion, avoiding the smearing of the bacterial colonies. The plate was reincubated at 37°C for a few hours to regenerate the colonies. The colonies transferred to the filter were lysed to bind the liberated DNA to the nitrocellulose.
    21. Colony lifts.
    22. Transfer of DNA.
    23. were stored at -70°C for at least six months without any significant loss in the competence.
    24. A single ~.coli colony taken from an agar plate was used to inoculate 10 ml of LB and incubated 0/N at 37°C in an incubator-shaker. Next day, 0. 5 ml of this freshly grown culture was used to inoculate 100 ml of LB in a 500 ml flask. The culture was incubated at 37°C in an incubator -shaker and absorbance of the growing culture was monitored at 620 nm. When the A620 reached 0. 4 -0. 5 ( in about 120 -150 minutes), the flask was rapidly chilled by shaking in ice. The cells were harvested in sterile, chilled centrifuge bottles at 4, ooog for 10 minutes at 4 °c. The pellet was gently resuspended in 50 ml sterile, ice cold 100 mM cacl2 and the cells incubated in ice for 30 minutes. The cells were again centrifuged as above and the pellet resuspended in 6.5 ml of sterile, chilled, 100 mM cac12 containing 15 % glycerol. The cells were resuspended very gently, and a 200 ul aliquot was transformed with a standard plasmid DNA to check the competence of the cells. Meanwhile, the rest of the competent cells were incubated in ice for 16 -18 hours, to increase the competence of the cells a further few fold. After ascertaining high transformation efficiency of the competent cells, the cells were dispensed as 200 ul aliquots into prechilled, sterile 1.5 ml eppendorf tubes. These cells
    25. Preparation of competent E.coli cells.
    26. lectrophoresed on 0.7 % -1.2 % agarose gels in TAE or TBE buffer. Choice of the percentage of agarose and the electrophoresis buffer system was made following the guidelines of Maniatis et al., ( 1982 ). In general, upto 1 kb fragments were resolved on 1.2 % agarose gels using TBE buffer. For most other purposes, TAE buffer was used. Agarose gel electrophoresis was carried out as described by Maniatis et al., ( 1982 ) . The run was stopped when the bromophenol blue dye migrated to within 1 em -1.5 em from the edge of ' the gel, except when the sample had fragments smaller than 500 bp, in which case the elctrophoresis was terminated at an earlier stage. The gel was immersed in water containing 0.5 ug I ml ethidium bromide, for 30 minutes, to stain the DNA. When detecting very low amounts of DNA, the staining was done for 60 minutes followed by destaining in 1 mM Mgso4 for one hour at room temperature. The DNA bands were visualised on a short wavelength UV transilluminator ( Fotodyne, Inc., USA and photographed with a Polaroid MP-4 camera using Polaroid type 667 film.
    27. DNA digested with restriction enzymes was
    28. For rapid electrophoretic analysis of plasmid DNA prepared by miniprep protocol, or to monitor the progress of digestion during various cloning procedures, the DNA was resolved on short agarose gels, taking less than one hour for the run. The electrophoresis was carried out in TAE buffer using 8 em long gels with a comb of teeth size 0.4 x 0.2 em. The width of the gel was variable, depending on the number of samples to be analysed. Gels were run at 50 100 volts, till the bromophenol blue dye migrated to within 0.5 em of the edge of the gel.
    29. Mini gel electrophoresis
    30. Electrophoresis of DNA
    31. Routinely, with sterile double 0.2 - 1 ug DNA was made up to 18 ul distilled water in an autoclaved eppendorf tube. 2 ul of 10 X buffer and 2 - 5 unitp of restriction endonuclease were added. The reaction components were mixed well and incubated in a 37°C water bath for 1 - 2 hours. The digestion reaction was terminated by the addition of 2 ul of 10 X tracking dye ( 0.25 % xylene cyanol, 0.25 % bromophenol blue, 0.1 M EDTA, pH 8.0, and 50 % glycerol followed by brief vortexing to mix, after which the sample was loaded on to the gel.
    32. ecanted and the pellet dried briefly under vacuum. The final DNA pellet was resuspended in 500 ul of TE. A 1:50 dilution of the sample was used to measure the absorbance at 260 nm and at 280 nm. The A260 and A280 values were used to estimate the concentration and purity of the sample as described by Maniatis et al., ( 1982).
    33. further purified by centrifugation to equilibrium in a 30 ml cesium chloride -ethidium bromide density gradient, as described by Maniatis et al., ( 1982 ) . The band corresponding to closed circular plasmid DNA was collected and further purified by a second centrifugation to equilibrium in a 6. 5 ml cesium chloride -ethidium bromide density gradient. The final DNA band collected from the gradient was extracted with an equal volume of isopropanol which had been previously saturated with TE and cesium chloride. This extraction was repeated twice to completely remove the ethidium bromide from the DNA sample. The DNA was then dialysed against one liter of TE for at least 8 hours, at 4 °c, with several changes of TE. To the dialysed sample, one tenth volume of 3 M sodium acetate, pH 5.2, was added and the DNA precipitated with two volumes of chilled ethanol. The precipitation was carried out 0/N at 0 -20 c. The precipitated centrifugation at 10, 000 rpm, DNA was collected by for 10 minutes. The supernate was carefully d
    34. resuspended in 20 ml of Tris -Glucose solution ( 25 mM Tris. HCl, pH 8. 0; 50 mM Glucose ) . The cells were vortexed followed by repeated pipetting to obtain a uniform cell suspension. To this, 6.0 ml of a freshly prepared lysozyme solution ( 10 mg 1 ml, prepared freshly in sterile distilled water ) was added. The cell suspension was swirled to mix thoroughly and incubated for 5 minutes at room temperature. Next, 0.5 M EDTA was added to a final concentration of 10 mM, the contents swirled to mix and incubated in ice for 20 minutes. Next, 40 ml of a lytic mix containing 0. 1 % SDS and 0. 2 N NaOH was added. This was prepared freshly by mixing 4 ml of 10 % SDS solution into 36 ml of 0.22 N NaOH solution. The solution was mixed by vigorous but brief shaking till the cell lysate became clear, followed by incubation on ice for 5 minutes. Finally, 20 ml of 5 M potassium acetate solution, pH 4.8 was added. Again the contents were swirled to mix, followed by incubation in ice for at least 1 - 2 hours. The lysate was centrifuged at 10,000 rpm for 30 minutes at 4°c. The supernate was filtered through sterilised glass wool kept in a funnel, and collected in a graduated cylinder. The measured volume of the cell lysate was transferred into another centrifuge bottle and two volumes of 95 % ethanol added to precipitate the DNA, at 0 -20 c, 0/N. The DNA was pelleted by centrifugation at 10,000 rpm at 4 °c for 30 minutes. The supernate was carefully poured off and the pellet res~spended in 25 ml of TE ( 10 mM Tris.HCl, pH 8.0; 1 mM EDTA ). The plasmid DNA was
    35. Plasmid DNA was isolated using the alkaline lysis method of Birnboim ( 1979 ) with slight modifications. One liter of TB supplemented with ampicillin @ 50 ug 1 ml was inoculated with 10 ml of a freshly grown primary culture and the culture incubated 0/N at 37°c, in an incubator -shaker. The cells were pelleted by centrifugation at 4000g for 10 minutes at 4 °c. The supernate was discarded and the pellet
    36. Isolation of plasmid DNA.
    37. yeast extract, and 10 g NaCl in distilled water, pH adjusted to 7.5 with NaOH and final volume made up to one liter (Maniatis et al., 1982). Cultures of ~.coli cells transformed with plasmid DNA were grown in media supplemented with 50 ug/ml of ampicillin. For large scale plasmid DNA isolation, ~.coli cells were grown in an enriched medium, Terrific Broth ( TB ) . One liter of TB was prepared by adding 100 ml of a sterile solution of 0.17 M KH2Po4 and 0.72 M K2HPo4 to a sterile solution containing 12 g Bacto -tryptone, 24 g Bacto -yeast extract, 4.0 ml glycerol and water to a final volume of 900 ml ( Tartof and Hobbs, 1987 ) . The media were sterilised by autoclaving at 15 psi for 20 minutes. Heat labile compounds and antibiotics were sterilised by filtration through a 0.45 u nitrocellulose membrane and added to autoclaved media after cooling the same to 55°C. Solid media was prepared by adding 1. 5 % bacto -agar prior to autoclaving. Storage of ~.coli was carried out essentially as described by Maniatis et al., ( 1982).
    38. Composition of growth media used for culturing ~. coli is given in Table 3. For routine propagation, ~.coli cells were grown in Luria Bertani medium LB ) . LB was prepared by dissolving 10 g Bacto -tryptone, 5 g Bacto -
    39. Growth and storage of bacteria.
    1. The membranes were suspended (1.4 x 108 cell equivalent) in 250 III of incorporation buffer (50 mM HEPES, pH = 7.4, 25 mM KCI, 5 mM MgCb, 5 mM MnCI2, 0.1 mM TlCK, 1 Ilg/ml leupeptin, 1 mM ATP, 0.5 mM dithiothreitol and 0.4 Ilg/ml tunicamycin). Each assay tube was prepared by adding 12.5 III of 1 % Chaps, 2.8 III of 200 IlM GOP-Man, 10 III of GOP-[3H]-Man (1IlCi) and 25 nmol of synthetic substrate (49). The contents were lyophilized and 250 III of membrane suspension (1 .4 x 108 cell equivalent in incorporation buffer) were added to each tube. The tubes were incubated at 28°C for 20 minutes, cooled to 0 °C and the membranes were pelleted at 4 °C for 10 minutes in a microcentrifuge. The eH] mannosylated products, that were recovered in the supernatant, were mixed with 0.5 ml 100 mM ammonium acetate and applied to a C18 Sep-pak cartridge that had been washed with 5 ml 80% propan-1-01 and 5 ml 100 mM ammonium acetate. The cartridge was washed with 1.5 ml of 100 mM ammonium acetate and then the eluate was reapplied to the same cartridge. The cartridge was subsequently washed with 5 ml of 100 mM ammonium acetate, after which the bound material was eluted with 5 ml of 60% propan-1-01. The final eluate was concentrated and redissolved in 100 III of 60% propan-1-01. One tenth of this volume was taken for scintillation counting. The above assay was then carried out with a range of concentrations of OMJ to assess it's effect on the activity of eMPT enzyme parse.
    2. eMPT inhibition assay
    3. mixture). These samples were lyophilized and 125 III of the reaction mixture was added to each tube. The tubes were then incubated at 25°C for 1 h and the biosynthetic LPG was extracted as described above. 10 III of the solvent E extract was taken for scintillation counting.
    4. 1. Mild acid hydrolysis: 0.6 ml of the pooled solvent E soluble fractions was dried with a stream of nitrogen and then suspended in 0.02 N HGI (200 Ill). The mixture was then placed in a 100 °G water bath for 5 minutes. After hydrolysis, the sample was again dried under nitrogen and codried thrice with toluene (0.5 ml). The residue was suspended in 0.6 ml of 0.1 M NaGI in 0.1 M glacial acetic acid, loaded onto phenyl sepharose column and elution done in the same manner as described before. Fractions of 0.6 ml each were collected and assayed for radioactivity. 2. Nitrous acid deamination: 0.6 ml of the pooled solvent E soluble fractions was dried with a stream of nitrogen and then suspended in 0.2 ml of 0.125 M sodium acetate (pH = 4.0) and 0.25 M sodium nitrite. The mixture was incubated at 25 °G for 40 h. The sample was dried under nitrogen, suspended in 0.6 ml of 0.1 M NaGI in 0.1 M glacial acetic acid, loaded onto phenyl sepharose column and elution done in the same manner as described before. Fractions of 0.6 ml each were collected and assayed for radioactivity. 3. PI-PLC treatment: 0.6 ml of the pooled solvent E soluble fractions was dried with a stream of nitrogen and suspended in 0.4 ml of PI-PlG buffer (0.1 M Tris chloride, pH = 7.4 with 0.1 % deoxycholate) and 0.2 ml of PI-PlG concentrate (B.subtifis culture supernatant) was added. The mixture was then incubated at 37 °G for 16 h. The sample was dried under nitrogen, suspended in 0.6 ml of 0.1 M NaGI in 0.1 M glacial acetic acid, loaded onto phenyl sepharose column and elution done in the same manner as described before. Fractions of 0.6 ml each were collected and assayed for radioactivity. The effect of deoxymannojirimycin (Sigma, Gat. no. 0-9160) on the cell free biosynthesis was carried out. OMJ (5 mg) was dissolved in 1 ml of MQ water and 2.5, 5, 25 and 50 III were transferred to eppendorf tubes separately (which corresponded to 0.5, 1, 5 and 10 IlM concentrations of OMJ in 125 III ofthe reaction
    5. Characterization of biosynthetic LPG
    6. NaGI in 0.1 M glacial acetic acid, 1.2 ml of 0.1 M glacial acetic acid, 0.6 ml of water and 3.6 ml of solvent E. Fractions of 0.6 ml each were collected and assayed for radioactivity.
    7. Parasites (6 X 109) were harvested, pelleted at 3000 g for 10 min, washed with PBS, repelleted and suspended in 10 mL of HEPES buffer (100 mM HEPES-NaOH, pH = 7.4, 50 mM KCI, 10 mM MnCI2, 10 mM MgCI2, 0.1 mM TLCK, 1 Jlg/mL leupeptin) containing 10% glycerol. The cells were disrupted in a Parr nitrogen cavitation bomb (1500 psi, 25 min, 4°C, 3 cycles). The debris was removed by centrifugation at 3000 g for 5 min and the supernatant was centrifuged at 100,000 g for 1 h at 4°C. The resulting membrane pellet was resuspended in 10 mL of HEPES buffer without glycerol and centrifuged again at 100,000 g for 1 h at 4°C. The membranes were finally suspended in 1 mL (13 mg/mL) of HEPES buffer without glycerol. The incubation mixture per reaction contained membrane protein (2 mg) in 125 JlL of 50 mM HEPES-NaOH buffer, pH = 7.2 containing supplements (25 mM KCI, 5 mM MgCI2, 5 mM MnCI2, 0.1 mM TLCK, 1 JlglmL leupeptin, 0.8 mM ATP, 0.4 mM On) with 2 JlM UOP-[3H]-galactose (2 JlCi) and 10 JlM GOP-mannose. The mixture was incubated at 25°C for 1 h, terminated by the addition of CHCI~CH30H (3:2) to give a final ratio of CHCI~CH30H/H20 (3:2:1) and sonicated. The layers were then allowed to separate out after which the lower layer was removed with the aid of a micropipette. The tube containing the upper and intermediate layer was centrifuged (10,000 rpm, 4°C, 5 minutes). The supernatant was discarded and the resultant pellet (membranes) was suspended in 1 mL of CHCI~CH30H/H20 (1:1 :0.3). The solution was again centrifuged (10,000 rpm, 4°C, 5 minutes) and the pellet was extracted with 1 mL of solvent E (H20/ethanol/diethylether/pyridine/NH40H 15:15:5:1 :0.017) thrice. The solvent E extracts were pooled and dried under a stream of nitrogen, suspended in 0.6 mL of 0.1 M NaCI in 0.1 M glacial acetic acid and chromatographed over a 1 mL column of phenyl sepharose. Phenyl Sepharose Column of Biosynthetic LPG. The solvent E extract suspended in 0.6 mL of 0.1 M NaCI in 0.1 M glacial acetic acid was applied to a column (0.5 x 2 cm) of phenyl sepharose (Pharmacia BioteCh), preequilibrated with 0.1 M NaCI in 0.1 M glacial acetic acid. The column was then washed sequentially with 3 mL of 0.1 M
    8. Cell-free Biosynthesis42 of LPG using Leishmania membranes
    9. Water was added and the mixture was concentrated under reduced pressure to afford 89; ESMS (mlz): 604.1 (M-Hr.
    10. ixture was stirred under argon atmosphere for 2 days.
    11. were diluted with ice cold water. The mixture was extracted with CH2CI2. The organic layer was thoroughly washed with water, dried over Na2S04 and concentrated to yield 84. 2,3,4,6-Tetra-O-acetyl-a-L-manno-di-O-benzyl phosphate (86). Compound 84 (50 mg, 0.128 mmol) was dissolved in anhydrous CH3CN saturated with dimethylamine (5 ml ) at -20 DC and stirred for 3h after which TlC confirmed the disappearance of starting material. Excess of dimethylamine was removed under reduced pressure at 30 DC and the reaction mixture was concentrated to afford 2,3,4,6-tetra-O-acetyl-a-l-mannose (85). To a stirred solution of compound 85 and 1 H-tetrazole (9.5 mg, 0.138 mmol) in anhydrous CH2CI2 (400 Ill) was added dibenzyl-N,N'-diisopropyl phosphoramidite (56.5 Ill, 59.4 mg, 0.172 mmol) and the mixture was stirred under argon atmosphere for 2 h at rt. Subsequently, the reaction mixture was cooled to-40 DC and m-CPBA (40 mg, 0.23 mmol) was added and stirring was continued for another 30 minutes at rt. The reaction was quenched by the addition of a solution of saturated bicarbonate. The mixture was extracted with CH2CI2. The organic phase was thoroughly washed with water, dried over Na2S04 and concentrated to afford 86, which was purified by running a silica coated preparative TlC plate; Rf = 0.16 in 50% ethyl acetate in hexane; 1H NMR: 8 3.9-4.22 (m, 4H), 5.02-5.06 (m, 4H), 5.21-5.28 (m, 2H), 5.59 (1 H, dd, JHP = 6.3 Hz, JHH = 1.8 Hz, H-1); 13C NMR: 8 20.49, 20.60, 61.68,65.19,68.14,68.68,69.75,69.92,70.31, 95.09, 127.89-128.72, 169.43; 31p NMR 8 -3.2; ESMS (mlz): 631.2 (M+Nat. a-L-mannosyl phosphate (88). To a solution of 86 (25 mg, 0.04 mmol) in CH30H (1 ml) was added palladium on charcoal (10%, 200 mg) and formic acid (100 Ill). The mixture was stirred at 50 DC for 3 h to afford compound 87. The catalyst was filtered off and the solvent was evaporated. The residue was taken in a mixture of CH30H:H20:triethylamine (5:3:2, 1.6 ml) and stirred for 2 days at rt. The reaction mixture was concentrated and the residue was repeatedly lyophilized to yield 88; ESMS (mlz): 259.19 (M-H)". Guanosine 5'-diphospho-a-L-mannose ( mono triethylamine salt) 89. A mixture of 4-morpholine-N,N'-dicyclohexylcarboxaminidium guanosine 5'-monophospho morpholidate (56 mg, 0.071 mmol) and 88 (16 mg, 0.034 mmol) was coevaporated with dry pyridine (3x500 Ill). 1 H-tetrazole (10 mg, 0.137 mmol) and dry pyridine (1.2 ml) were added and the m
    12. Penta-O-acetyl-a-L-Mannose (84): To a solution of l-mannose (30 mg, 0.16 mmol) in pyridine (300 Ill) was added acetic anhydride (500 Ill) at 0 °C. The flask was left at 4 °C for 12 h. The mixture was then stirred at rt for 1 h, following which the contents
    13. Synthesis of L-Mannose analogue of GOP Mannose (Scheme 18 of Results and Discussion)
    14. (1 ml) was added palladium on charcoal (10%, 176 mg) and formic acid (100 Ill). The mixture was stirred at 50°C for 3h after which the catalyst was filtered off and the solvent was evaporated. The residue was taken in a mixture of CH30H:water:triethylamine (5:3:2, 1.6 ml) and stirred for 2 days at rt. The reaction mixture was concentrated and the residue was repeatedly lyophilized to yield 82; ESMS (mlz): 387.34 (M-H)'. Guanosine 5'-diphospho-6-deoxy-6-fluoro-a-D-mannose (mono-triethylamine salt) 83. Mixture of 4-morpholine-N,N'-dicyclohexylcarboxaminidium guanosine 5'-monophosphomorpholidate (43 mg, 0.054 mmol ) and 82 (16 mg, 0.034 mmol) was coevaporated with dry pyridine (3 x 500 Ill). 1 H-tetrazole (8 mg, 0.108 mmol ) and dry pyridine (1 ml) were added and the mixture was stirred under argon atmosphere for 2 days. Water was added and the mixture was concentrated under reduced pressure to yield 83; ESMS (mlz): 606.11 (M-Hr.
    15. solution of compound 80 and 1 H-tetrazole (7 mg, 0.102 mmol) in anhydrous CH2CI2 was added dibenzyl-N,N'-diisopropylphosphoramidite (42 Ill, 43.8 mg, 0.127 mmol) and the mixture was stirred under argon atmosphere for 2 h at rt. Subsequently, the reaction mixture was cooled to -40°C and m-CPBA (30 mg, 0.17 mmol) was added and stirring was continued for another 30 minutes at rt. The reaction was quenched by the addition of a solution of saturated sodium bicarbonate. The mixture was extracted with CH2CI2. The organic phase was thoroughly washed with water, dried over Na2S04 and concentrated to afford 81, which was purified by running a silica coated preparative TlC plate; R, = 0.12 (twice run in 30% ethyl acetate in hexane); 1H NMR: characterstic () 5.6 (1 H, dd, JHP = 6.3 Hz and JHH = 1.8 Hz); 13C NMR: () 20.50, 20.53, 20.60, 64.75, 68.11, 68.58, 69.86, 70.67, 70.93, 81.87, 95.01, 128-128.72, 169.38, 169.50, 169.67; 31 P NMR () -3.11; ESMS (m/z): 591.34 (M+Nat. 6-Deoxy-6-fluoro-a-D-mannosyl phosphate (82). To a solution of 81 (20 mg, 0.035 mmol) in CH30H
    16. Methyl-S-deoxy-S-difluoro-a-D-mannopyranoside (78). DAST (134 Ill, 1 mmol) was added with stirring at -40 °c, to a suspension of methyl-a-D-mannopyranoside S2 (200 mg, 1 mmol) in anhydrous CH2Cb (4 ml). The mixture was stirred at -40 °c for another 30 minutes and then at rt for 3h. After cooling to -20°C, the excess of reagent was destroyed by addition of CH30H (600 Ill) and sodium bicarbonate (200 mg). The cooling bath was removed, and the mixture was filtered once effervescence ceased. The filtrate was concentrated and purified by silica column chromatography (3% CH30H in CH2CI2) to yield 78; Rf = 0.21 in 12.5% CH30H in CH2CI2• 1 ,2,3,4-Tetra-O-acetyl-S-deoxy-S-fluoro-a-D-mannopyranoside (79). To compound 78 (100 mg, 0.51 mmol) was added 2% sulfuric acid solution in acetic anhydride (1.2 ml). The mixture was stirred at rt for 90 minutes. The contents were diluted with saturated sodium bicarbonate solution. The mixture was extracted with ethyl acetate. The organic phase was thoroughly washed with water, dried over Na2S04and concentrated to afford 79; Rf = 0.35 in 50% ethyl acetate in hexane. 2,3,4-Tri-O-acetyl-S-deoxY-S-fluoro-a-D-manno-di-O-benzyl phosphate (81). Compound 79 ( 30 mg, 0.085 mmol) was dissolved in anhydrous acetonitrile saturated with dimethylamine (5 ml ) at -20°C and stirred for 3 h after which TlC confirmed the disappearance of starting material. Excess of dimethylamine was removed under reduced pressure at 30°C and the reaction mixture was concentrated to afford 2,3,4-tri-O-acetyl-6-deoxY-6-floro-a-D-mannopyranoside (80). To a stirred
    17. Synthesis of [6-Deoxy-6-fluoro]-GDP Mannose95 (Scheme 17 of Results and Discussion)
    18. mixture was concentrated and the residue was repeatedly lyophilized to yield 7S; ESMS (mlz): 263.1 (M-Hr. Guanosine 5'-diphospho-4,S-di-deoxy-4,S-difluoro-a-D-talose mono triethyl amine salt) 77. A mixture of 4-morpholine-N,N'-dicyclohexylcarboxaminidium guanosine 5'-monophosphomorpholidate (27 mg, 34.4 Ilmol) and 7S (10 mg, 21.5 Ilmol) was coevaporated with anhydrous pyridine (3 x 500 Ill). 1 H-tetrazole (5 mg, 68.7 Ilmol) and anhydrous pyridine (1 ml) were added and the mixture was stirred under argon atmosphere for 2 days. Water was added and the mixture was concentrated under reduced pressure to afford 77; ESMS (mlz): 608.3 (M-Hr.
    19. 6 Hz), 4.85 (1H, s); 13C NMR 853.28,65.12 (15 Hz, C3), 67.3 (24 Hz, C5), 69.72 (C2), 81.1 (JCF = 168 Hz, C4), 89.9 (JCF = 171 Hz, C4), 101.47 (C1). 1 ,2,3-Tri-O-acetyl-4,6-di-deoxy-4,6-difluoro-a-D-talopyranoside (73). To compound 72 (100 mg, 0.543 mmol) was added 2% sulfuric acid solution in acetic anhydride (1.2 ml). The mixture was stirred at rt for 90 minutes. The contents were diluted with saturated sodium bicarbonate solution. The mixture was extracted with ethyl acetate. The organic phase was thoroughly washed with water, dried over sodium sulfate and concentrated to afford 73. 2,3-Di-O-acetyl-4,6-di-deoxY-4,6-difluoro-a-D-talo-di-O-benzyl phosphate (75) : Compound 73 ( 70 mg, 0.225 mmol) was dissolved in anhydrous CH3CN saturated with dimethylamine (5 ml ) at -20°C and stirred for 3h after which TlC confirmed the disappearance of starting material. Excess of dimethylamine was removed under reduced pressure at 30°C and the reaction mixture was concentrated to afford 2,3, di-O-acetyl-4,6-di-deoxy-4,6-difloro-a-D-talopyranoside (74). To a stirred solution of compound 74 and 1 H-tetrazole (21 mg, 0.3 mmol) in anhydrous CH2CI2 (400 Ill) was added dibenzyl-N,N-diisopropylphosphoramidite (99.4 Ill, 104.3 mg, 0.3 mmol) and the mixture was stirred under argon atmosphere for 2 h at rt. Subsequently, the reaction mixture was cooled to -40°C and m-CPBA (87 mg, 0.504 mmol) was added and stirring was continued for another 30 minutes at rt. The reaction was quenched by the addition of a solution of saturated sodium bicarbonate. The mixture was extracted with CH2CI2. The organic phase was thoroughly washed with water, dried over Na2S04 and concentrated to afford 75, which was purified by running a silica coated preparative TlC plate; Rf = 0.24 (50% ethyl acetate in hexane); 1H NMR characterstic ¢ 5.67 (1 H, dd, J = 6.3 Hz and 1.8 Hz, H-1); 13C NMR: ~ 20.5-20.6 (OAc), 64.77, 64.99, 66.28, 66.43, 69.9 (24 Hz, C5), 79.96 (JCF = 169 Hz, JCH = 7.1 Hz, C6), 84.08 (JCF= 180, JCH = 5.4 Hz, C4), 95.68,126.85-128.7,169.50,169.77; 31p NMR 8 -3.03; ESMS (mlz): 551.2 (M+Nat. 4,6-Di-deoxy-4,6-difluoro-a-D-talosyl phosphate (76). To a solution of 75 (30 mg, 0.056 mmol) in CH30H (1 ml) was added palladium on charcoal (10%, 280 mg) and formic acid (100 Ill). The mixture was stirred at 50°C for 3h. The catalyst was filtered off and the solvent was evaporated. The residue was taken in a mixture of CH30H:water:triethylamine (5:3:2, 1.6 ml) and stirred for 2 days at rt. The reaction
    20. Methyl-4,6-di-deoxy-4,6-difluoro-a-D-talopyranoside (72). DAST (750 j.!L, 5.6 mmol) was added with stirring at -40 °c, to a suspension of methyl-a-D-mannopyranoside 62 (200 mg, 1 mmol) in anhyd CH2CI2 (4 mL). The mixture was stirred at -40 °c for another 30 minutes and then at rt for 3 h. After cooling to -200C, the excess of reagent was destroyed by addition of CH30H (600 j.!L) and sodium bicarbonate (200 mg). The cooling bath was removed, and the mixture was filtered once effervescence ceased. The filtrate was concentrated, loaded onto a silica column and eluted out with CH2CI2 to yield 72; Rf= 0.7 in 12.5% CH30H in CH2CI2; 1H NMR (CDCI3) 83.40 (3H, s, OCH3), 4.19 (1 H, m), 4.52 (1 H, d, 6 Hz), 4.68 (1 H, d,
    21. Synthesis of [4,6-Dideoxy-4,6-difluoro]-GDP Talose (Scheme 16 of Results and Discussion)
    22. (34 mg, 0.198 mmol) was added and stirring was continued for another 30 minutes at rt. The reaction was quenched by the addition of a solution of saturated bicarbonate. The mixture was extracted with CH2CI2. The organic phase was thoroughly washed with water, dried over Na2S04 and concentrated to afford 69, which was purified by running a silica coated preparative TLC plate; Rf = 0.23 in 50% ethyl acetate in hexane; 1H NMR characterstic.8 5.72 (1 H, dd, JHP = 6.9 Hz, JHH = 1.8 Hz, H-1), 5.83 (1 H, t, JHF = 53.4 Hz, H-6); 31p NMR 8 -2.81; ESMS (mlz): 753.36 (M+Nat. 6-Deoxy-6,6-difluoro-a-D-mannosyl phosphate (70). To a solution of 69 (25 mg, 0.034 mmol) in CH30H (1 mL) was added palladium on charcoal (10%, 170 mg) and formic acid (100 j.!L). The mixture was stirred at 50°C overnight. The catalyst was removed by passing the mixture through a pad of celite. A few drops of triethylamine were added and the solution was stirred for 15 minutes. The solvent was evaporated and the product was repeatedly lyophilized to afford 70; ESMS (mlz): 279.22 (M-H)". Guanosine 5'-diphospho-6-deoxy-6,6-difluoro-a-D-mannose (mono-triethyl amine salt) 71. A mixture of 4-morpholine-N,N'-dicyclohexylcarboxaminidium guanosine 5'-monophosphomorpholidate (29 mg, 0.037 mmol) and 70 (11 mg, 0.023 mmol) was coevaporated with dry pyridine (3 x 200 j.!L). 1 H-tetrazole (5.5 mg, 0.074 mmol) and anhydrous pyridine (900 j.!L) were added and the mixture was stirred under argon atmosphere for 2 days. Water was added and the mixture was concentrated under reduced pressure to afford 71; ESMS (mlz): 624.15 (M-H)"
    23. Methyl-6-deoxy-6,6-difluoro-2,3,4-tri-O-benzyl-a-D-mannopyranoside (66). A solution of oxalyl chloride (54.62 mg, 37.6 Ill, 0.43 mmol) in anhydrous CH2CI2 (15 ml) was cooled to -78°C and DMSO (67.2 mg, 62 Ill, 0.86 mmol) was added dropwise, followed by the addition of a solution of 65 (500 mg, 1.07 mmol) in CH2CI2 (5 ml) over a period of 5 minutes. The mixture was stirred for another 30 minutes and then triethylamine (1.2 ml) was added. The solution was brought to room temperature, water was added and the mixture was extracted with CH2CI2. The organic layer was dried over Na2S04 to give the intermediate aldehyde. A solution of DAST (112.8 mg, 92.5 Ill, 0.7 mmol) in anhydrous CH2CI2 (1.5 ml) was cooled to -78°C. To this was added a solution of the aldehyde (325 mg, 0.7mmol) in anhydrous CH2CI2 (1.5 ml) dropwise. The mixture was stirred at rt for 90 minutes. After cooling to -20°C, excess of reagent was destroyed by the addition of CH30H and sodium bicarbonate. The mixture was filtered once effervescence ceased. The filtrate was concentrated and the residue was purified by silica column chromatography (5% ethyl acetate in hexane) to afford 66; Rt = 0.34 in 25% ethyl acetate in hexane; 1H NMR characterstic 8 5.97 (1 H, t, JHF = 52.6 Hz, H-6); 19F NMR &-132.65 (dd, J = 57 and 10.9 Hz), -132.90 (d
    24. d, J = 57 and 16.4 Hz); ESMS (mlz): 507.2 (M+Nat. Acetyl-2,3,4-tri-O-benzyl-6-deoxY-6,6-difluoro-a-D-mannopyranoside (67). To compound 66 (70 mg, 0.144 mmol) was added 1 % sulfuric acid solution in acetic anhydride (1 ml). The mixture was stirred at rt for 1 h. The contents were diluted with saturated sodium bicarbonate solution. The mixture was extracted with ethyl acetate. The organic phase was thoroughly washed with water, dried over Na2S04 and concentrated to afford 67 which was purified by silica column chromatography (5% ethyl acetate in hexane); Rt = 0.34 (30% ethyl acetate in hexane). 2,3,4-Tri-O-benzyl-6-deoxy-6,6-difluoro-a-D-manno-di-O-benzyI phosphate (69). Compound 67 (50 mg, 0.105 mmol) was dissolved in anhydrous CH3CN saturated with dimethylamine (5 ml) at -20°C and stirred for 3h after which TlC confirmed the disappearance of starting material. Excess of dimethylamine was removed under reduced pressure at 30°C and the reaction mixture was concentrated to afford 2,3,4-tri-O-benzyl-6,6-difluoro-a-D-mannopyranoside (68). To a stirred solution of compound 68 (46 mg, 0.097 mmol) and 1 H-tetrazole (8.5 mg, 0.118 mmol) in anhydrous CH2CI2 (400 Ill) was added dibenzyl-N,N-diisopropylphosphoramidite (39 Ill, 40.9 mg, 0.118 mmoL) and the mixture was stirred under argon atmosphere for 2 h at rt. Subsequently, the reaction mixture was cooled to -40 °C and m-CPBA
    25. Methyl-6-0-(triphenylmethyl)-a-D-rnannopyranoside (63). Methyl-a-D-manno pyranoside (62, 5g, 25.7 mmol) was dissolved in DMF (17 mL). Trityl chloride (7.9 g, 28.3 mmol), DMAP (515 mg, 2.06 mmol) and triethylamine (3.9 mL, 28.3 mmol) were added, and the mixture was stirred at room temperature overnight. The reaction mixture was concentrated and the residue was purified by silica column chromatography (5% CH30H in CH2CI2) to give 63 (8 g, 71.4%); R, = 0.14 in 5% CH30H in CH2CI2; ESMS (mlz): 459 (M+Nat. Methyl 2,3,4-tri-O-benzyl-6-0-(triphenylmethyl)-a-D-mannopyranoside (64). Compound 63 (5.8 g, 13.3 mmol) was dissolved in DMF (80 mL), followed by addition of sodium hydride (60% dispersion, 2.12 g, 53.2 mmol) and benzyl bromide (6.3 mL, 53.2 mmol) dropwise at 0 °C. The reaction mixture was stirred overnight at rt and the excess of sodium hydride was destroyed by addition of CH30H and water. The mixture was extracted with CH2CI2. The organic phase was washed thoroughly with saturated NaHC03 solution and water, dried over Na2S04 and concentrated to give 64; R,= 0.45 in 20% ethyl acetate in hexane; 1H NMR: 83.25 (dd, 1 H, H-2), 3.39 (s, 3H), 3.7-4.0 (m, 5H), 4.29-4.82 (7H, m, 3 x PhCH2 and H-1), 6.9-7.54 (m, 30H, Ph). Methyl 2,3,4-tri-O-benzyl-a-D-mannopyranoside (65). To a solution of compound 64 (1 g, 1.415 mmol) in CH2CI2 : CH30H (1 :2, 9 mL) was added p-toluene sulfonic acid (14 mg) and the mixture was stirred at rt for 2 h. Excess of acid was neutralized by the addition of triethylamine. The mixture was concentrated and purified by silica column chromatography (40% ethyl acetate in hexane) to yield 65 (4.5 g, 72.5%); R, = 0.13 in 30% ethyl acetate in hexane; 1H NMR: 8 3.29 (s, 3H, OMe), 3.61-3.96 (m, 5H), 3.93 (dd, J = 9 and 7.5 Hz, 1 H, H-3), 4.69 (d, J = 3 Hz, H-1), 4.63-4.95 (m, 6H, 3 x Ph CH2) , 7.25-7.34 (m, 15H, Ph); 13C NMR: 8 54.68, 62.34, 71.95, 72.89, 74.67, 74.79,75.10,80.13,99.27,127.50-128.30; ESMS (mlz): 487.3 (M+Nat.
    26. Synthesis of [6-0eoxy-6,6-difluoro]-GOP Mannose94 (Scheme 15 of Results and Discussion)
    27. Synthesis of GOP Mannose analogues
    28. incubated at 23°C in a cooling incubator (CI-12S; Remi). Fresh passaging was done weekly in a similar fashion. After about 15 passages, a fresh cryostock from liquid nitrogen was expanded and passaging done as mentioned before. Random samples from culture flasks free from any visible microbial contamination and full of all healthy, motile parasites under microscopic examinations formed the basis of selection of the culture suitable for further use. After culturing, used flasks, pipettes, glassware etc were decontaminated by immersing them in 5% formaldehyde solution and then discarded. All other routine standard cell culture practices were observed.
    29. For both routine as well as bulk culture of L.donovani 008 strain promastigotes, medium dMEM was used. This media was prepared by dissolving one sachet of powdered media dMEM (GIBCO BRl) in 800 ml of distilled water. To this was added 25 mM HEPES and other supplements (0.05 mM adenosine, 0.05 mM xanthine, 1 mg biotin, 0.04% tween 80, 5 mg hemin, 0.5% triethanolamine, 0.3% bovine serum albumin, 50 mg gentamycin sulfate). pH of the media was adjusted to 7.2 , volume made upto one litre and the media was sterilized using bell filter (0.22 Il, Sterivex GV; Millipore). The media was used within two months of preparation. To this media, as per requirement of routine culture, heat inactivated fetal bovine serum (HI-FBS) was added @ 10%. In the present study Leishmania donovani, 008 strain, promastigotes were used throughout obtained from Prof. K.P.Chang, Chicago Medical Centre, USA. These were initially isolated from patients native to central Bihar. Upon arrival these promastigotes were expanded in medium 199 and cell bank was raised where -107 viable parasites were taken in 1 ml of complete medium 199 containing 10% glycerol. These were stored in liquid nitrogen. The revival capacity of these frozen cells was checked after one week storage by snap thawing the contents of one vial at 37°C, inoculating 50 ml of dMEM media with the entire contents and incubation at 23°C for one week. A luxuriant growth with healthy viable parasites was observed under the microscope. Routinely, L.donovani promastigotes were cultured in T-125 culture flasks having 50 ml of dMEM media each supplemented with 10% FBS. Media was inoculated with 100 III of a previous culture containing _106 promastigotes. These flasks were
    30. Maintenance and revival of L.donovani culture
    31. mg, 0.03 mmol) in 95% aqueous pyridine (1 ml) was added. After 30 min CH2Cb was added and the solution was washed successively with cold 1 M Na2S203 (2 x 5 ml) and cold 1 M TEA hydrogen carbonate (2 x 5 ml), dried over Na2S04 and concentrated. The residue was purified by silica column chromatography (1.5% CH30H in CH2Cb with 0.1 % Et3N); Rf = 0.54 in 20% CH30H in CH2CI2; 1 H NMR: 8 -0.01 (s, 6H, Me~iCMe3), 0.84 (s, 9H, Me2SiCMe3), 1.95-2.11 (m, 18H, OAc), 3.62 (m), 3.88 (m), 4.2 (m), 4.5 (m), 4.9 (m, 2H, H-2', 3'), 5.28 (m, 3H, H-1, 2, 3), 5.44 (m, 1 H, CH=CH2); 31 P NMR .8-2.68; ESMS (mlz) : 925.3 (M-Et3N-H)". Dec-9-enyl-6-dihydroxyl-4-~-D-galactopyranosyl-a-D-mannopyranosyl phospha te triethylammonium salt (55). A solution of aqueous HF (48%) in CH3CN (5:95, 400 Ill) was added to compound 54 (10 mg, 0.009 mmol) at 0 aC. The solution was stirred at 0 aC for 2 h. The reaction was quenched by the addition of the aqueous NaHC03 solution until effervescence ceased and diluted with CH2CI2. The organic layer was extracted with water and TEAS solution thoroughly, dried over Na2S04 and concentrated to give dec-9-enyl-2,3,4-tri-O-acetyl-4-~-D-galactopyranosyl-a-D­mannopyranosyl phosphate triethylammonium salt; ESMS (m/z): 811.4 (M-EtsN-H)". A solution of oxalyl chloride (0.38 mg, 1.5 Ill, 0.003 mmol) in anhydrous CH2CI2 (50 Ill) was cooled to -78 aC and DMSO (0.47 mg, 1.7 Ill, 0.006 mmol) was added, followed by the addition of a solution of dec-9-enyl-2,3,4-tri-O-acetyl-4-~-D­galactopyranosyl-a-D-mannopyranosyl phosphate (7 mg, 0.007 mmol) in CH2CI2 (100 Ill). The mixture was stirred for another 30 minutes and then triethylamine (10 Ill) was added. The solution was brought to rt, water was added and the mixture was extracted with CH2Cb. The organic layer was dried over Na2S04 to give the aldehyde 55. Dec-9-enyl-6-dihydroxyl-4-~-D-galactopyranosyl-a-D-mannopyranosyl phosphate triethylammonium salt (56). The residue was taken in a mixture of CH30H:water:triethylamine (5:3:2, 1.6 ml) and stirred for 2 days at rt. The reaction mixture was concentrated and the residue was repeatedly lyophilized to yield 56.
    32. Dec-9-enyl-2,3,4-tri-O-acetYI-[6-0-(t-butYldimethYlsilyl)-4-~-D-galactopyranosyl] -a-D-mannopyranosyl phosphate tri ethylammonium salt (54). A mixture of H-phosphonate 6 (from scheme 1, 50 mg, 0.057 mmol) and dec-9-en-1-01 (30 Ill, 0.172 mmol) was dried by evaporation of pyridine (2 x 0.5 ml). The residue was dissolved in anhydrous pyridine (1 ml), pivaloyl chloride (22 Ill, 0.172 mmol) was added, and the mixture was stirred at rt for 1 h whereafter a freshly prepared solution of iodine (6
    33. (Scheme 13 of Results and Discussion)
    34. Synthesis of S'-hemiacetal analogue90 of Gal 1,4~-Man-a­phosphate acceptor
    35. was diluted with water and the aqueous layer was thoroughly extracted with ethyl acetate (15 ml x 2). The organic layer was dried over Na2S04, concentrated and dried to yield C4C] labelled stearyl alcohol 51. [14C]-Stearyl-2,3,6-tetra-O-acetyl-4-0-(2,3,4 ,6-tretra-O-acetyl-~-D-gal actopyrano syl)-a-D-mannopyranosyl phosphate triethylammonium salt (52). A mixture of H-phosphonate 47 (296 mg, 0.37 mmol) and [14C] stearyl alcohol (51,100 mg, 0.37 mmol) was dried by evaporation of pyridine (2 x 3 ml). The residue was dissolved in anhydrous pyridine (5 ml), adamantane carbonyl chloride (160 mg, 0.8 mmol) was added, and the mixture was stirred at rt for 1 h whereafter a freshly prepared solution of iodine (160 mg, 0.63 mmol) in 95% aqueous pyridine (5 ml) was added. After 30 min CH2Cb was added and the solution was washed successively with cold 1 M Na2S203 (2 x 10 ml) and cold 1 M TEA hydrogen carbonate (2 x 10 ml), dried over Na2S04 and concentrated. The residue was purified by silica column chromatography (2.5% CH30H in CH2CI2 with 1 % Et3N) to afford 52. [14C]-Stearyl-4-~-D-galactopyranosyl-a-D-mannopyranosyI phosphate triethyl ammonium salt (53). To a solution of compound 4 (75 mg, 0.07 mmol) in anhydrous CH30H (12.5 ml) was added anhydrous sodium carbonate (80 mg, 0.75 mmol). The mixture was stirred at rt for 2 h, whereafter sodium carbonate was removed by filtration. The solvent was evaporated and residue concentrated to yield 53; R,= 0.55 in 10: 1 0:3 CH30H:CH2CI2:O.25% KC!.
    36. [14C]-Stearyl alcohol (51). Stearic acid (50,100 mg) in anhydrous THF (1 mL) was diluted with C4C] stearic acid (1.2 mL, 120 !lCi). To this was added THF-borane complex (4 mL). The mixture was refluxed at 90°C for 36 h. The contents were then poured onto CH3COOH:H20 (8 mL, 1:1), taken in a separating funnel. The mixture
    37. Synthesis of [14C] labeled Stearyl linked Gal 1,4 f3 Man phosphate (Scheme 12 of Results and Discussion)
    38. 5.2 (m, 3H, H-1, 4, 3), 5.28 (dd, J = 2.1 and 3.6 Hz, 1 H, H-2), 7.95 (d, JHP=637 Hz, 1 H); 31 P NMR f> 0.129; ESMS (mlz) 699.27 (M-Et3N-H)" Stearyl-2,3,6-tetra-O-acetyl-4-0-(2,3,4,6-tetra-O-acetyl-~-D-galactopyranosyl)-a­D-mannopyranosyl phosphate triethylammonium salt (48). A mixture of H-phosphonate 47 (25 mg, 0.031 mmol) and stearyl alcohol (11 mg, 0.04 mmol) was dried by evaporation of pyridine (2 x 0.5 mL). The residue was dissolved in anhydrous pyridine (1 mL), adamantane carbonyl chloride (16 mg, 0.08 mmol) was added, and the mixture was stirred at rt for 1 h whereafter a freshly prepared solution of iodine (16 mg, 0.063 mmol) in 95% aqueous pyridine (3 mL) was added. After 30 min CH2CI2 was added and the solution was washed successively with cold 1 M Na2S203 (2 x 5 mL) and cold 1 M TEA hydrogen carbonate (2 x 5 mL), dried over Na2S04 and concentrated .The residue was purified by silica column chromatography (2.5% CH30H in CH2CI2 with 1 % Et3N) to afford 48; Rt = 0.46 in 20% CH30H in CH2CI2; 1H NMR: 8 0.84 (t, 3H, CH3), 1.23-1.45 (lipid protons), 1.85-2.12 (m, 21 H, OAc), 3.84-4.16 (m), 4.51 (d, J = 7.8 Hz, 1H, H-1'), 4.85-5.01 (m, 2H, H-2', 3'), 5.25 (m, 3H, H-1, 4, 3), 5.52 (dd, J = 2.1 and 3.6 Hz, 1 H, H-2), 5.69 (dd, 1 H, JHP = 6.8 and J1,2 =1.9 Hz, H-1); 13C NMR: 8 13.99, 20.48-20.77, 22.56, 27.8-29.59, 31.80, 36.44, 38.78, 52.82, 60.69, 68.99, 69.48, 70.23, 70.91, 76.52, 93.26, 100.93, 168.99-170.42; 31p NMR: 8 -2.90; ESMS (mlz): 967 (M-Et3N-H)' Stearyl-4-~-D-galactopyranosyl-a-D-mannopyranosylphosphate triethylammo nium salt (49). To a solution of compound 48 (15 mg, 0.014 mmol) in anhydrous CH30H (2.5 mL) was added anhydrous sodium carbonate (16 mg, 0.15 mmol). The mixture was stirred at rt for 2 h, whereafter sodium carbonate was removed by filtration. The solvent was evaporated and residue concentrated to yield 49 in quantitative yield; Rt= 0.55 in 10:10:3 CH30H:CH2CI2:O.25% KCI; 31p NMR.8 -1.72; ESMS (mlz): 673 (M-Et3N-H)'
    39. 1 ,2,3,6-Tetra-O-acetyl-4-0-(2,3,4,6-tetra-O-acetyl-~-D-galactopyranosyl)-a.-D­mannopyranose (46). Acetic anhydride (4 ml) was added dropwise to a stirring solution of Gal (1-4)~ Man (45, 700 mg, 2.04 mmol) in anhydrous pyridine (6 ml) at 0 °C. The reaction mixture was gradually brought to room temperature and stirred for 16 h. After completion of the reaction, the mixture was poured over ice and the product crystallized out to afford 46 in quantitative yield. Triethylammonium 2,3,6-tri-O-acetyl-4-0-[2,3,4,6-tetra-O-acetyl-~-D-galacto pyranosyl]-a.-D-mannopyranosyl hydrogen phosphonate (47). Compound 46 (600 mg, 0.89 mmol) was dissolved in anhydrous CH3CN saturated with dimethylamine (40 mL) at -20°C and stirred for 3 h after which TLC confirmed disappearance of the starting material. Excess of dimethylamine was removed under reduced pressure at 30°C and the reaction mixture was concentrated to provide 2,3,6-tri-O-acetyl-4-0-(2,3,4,6-tetra-O-acetyl-~-D-galactopyranosyl)-a.-D-mannopyra nose. To a stirred solution of imidazole (1 g, 14.68 mmol) in anhydrous CH3CN (20 mL) at 0 °C was added phosphorus trichloride (0.8 ml, 9.14 mmol) and triethylamine (2.4 mL, 0.86 mmol). The mixture was stirred for 20 min, after which a solution of the above anomeric deprotected compound (500 mg, 0.786 mmol) in anhydrous CH3CN (20 mL) was added dropwise. The mixture was stirred at 0 °C for 2 h and quenched with 1 M triethylammonium (TEA) hydrogen carbonate solution (pH=7.2, 10 mL). The clear solution was stirred for 15 min. CH2CI2 was added and the organic layer was washed with ice cold water (2 x 10 ml) and cold 1 M TEA hydrogen carbonate solution (2 x 10 ml), dried over Na2S04 and concentrated to yield 47 (500 mg, 86.2%); Rt = 0.35 in 20% CH30H in CH2CI2; 1H NMR: 8 1.9-2.08 (m, 21 H, 7 x OAc), 3.84-4.13 (m, 6H, H-5, 5', 6, 6'), 4.35 (d, J = 4.5 Hz, 1 H, H-4), 4.47 (d, J = 7.8 Hz, 1 H, H-1 '), 4.9 (dd, J =3.3 and 7.8 Hz, 1 H, H-3'), 5.05 (dd, J = 2.1 and 7.8 Hz, 1 H, H-2'),
    40. Synthesis of Stearyl linked Gal 1,4 ~ Man phosphate (synthetic substrate for elongating-MPT activity)
    41. Synthesis of Radiolabeled Exogenous Precursor of Phosphoglycan Biosynthesis
    42. Polycondensation. Compound 26 (25 mg, 0.033 mmol) was dried by evaporation of pyridine (500 III x 3) therefrom. The residue was dissolved in 10:1 pyridine:triethylamine (40 Ill), and pivaloyl chloride (9 Ill, 0.073 mmol) was added. Another lot of pivaloyl chloride (6 Ill, 0.04B mmol) was added in 45 min. After 3 h, the mixture became viscous, and a freshly prepared solution of iodine (220 Ill, 35 mg, 0.137 mmol in pyridine-water, 95:5) was added. After 2 h, CHCI3 was added and the organic layer was successively washed with cold 1 M aqueous Na2S203 solution and 1 Mice-cold TEAB buffer, dried over Na2S04 and concentrated to dryness to afford 27. For final deprotection, above residue was dissolved in 0.1 M NaOMe solution in CH30H (440 Ill), 1,4-dioxane (BOO Ill), and CHCI3 (BOO Ill). The mixture was stirred at rt for 7 h and left at 4 °C for 16 h, then diluted with CH30H, deionized with Dowex 50W-X4 (H+) resin, filtered and immediately neutralized with drops of triethylamine. The mixture was concentrated to dryness to afford fully deprotected phosphoglycans (28). 31 P (D~O): 8 -1.73, O.BB. Preliminary CD analysis of Phosphoglycans. The above polycondensation product (28) was lyophilized repeatedly and then redissolved in H20 (400 Jll). This solution was taken in a glass cuvette (300 Ill, 1 mm pathlength). It's CD spectra was recorded on a spectropolarimeter (JASCO, J-710) between 175-250 nm at 25°C. For reference, the CD spectra of agarose (15% W/V)87 was also recorded under the same conditions as mentioned above.
    43. Triethylammonium 2,3,6-tri-o.acetyl-4-o.(2,3,4-tri-o.acetyl-~-D-galactopyrana syl)-a-D-manno pyranosyl hydrogen phosphonate (26). Compound 6 (30 mg, 0.034 mmol) was dissolved in a mixture of acetic acid-water-THF (3:1:1,2.5 ml). The mixture was stirred at 40°C for 9 h, after which the solvent was evaporated off under vacuo at rt. To remove excess of acid, water (1 ml) was added and evaporated off twice to afford 26 in quantitative yield; 1H NMR (CDCI3, 300 MHz) 0 1.95-2.09 (m, 21 H), 3.49-3.68 (m, 4H), 3.88 (m, 1 H), 4.14 (m, 1 H), 4.36 (d, J = 4.5 Hz, 1 H), 4.47 (d, J = 7.8 Hz, 1 H), 4.95 (dd, J = 3_3 and 7_8 Hz, 1 H), 5.05 (dd, J = 2_1 and 7.8 Hz, 1 H), 5.21 (dd, J = 2.1 and 3.6 Hz, 1 H), 5.41 (d, J = 3.3 Hz, 1 H), 5.48 (dd, J = 2.1 and 7.8 Hz, 1 H), 7.99 ( d, JH,p = 637_0 Hz, 1 H); 13C NMR (CDCI3, 75 MHz) 0 20.48-20.76, 60.10, 62.42, 66.57, 69.36, 69.53, 69.69, 71.20, 73.30, 73.86, 91.59, 92.54, 101_09, 169.13-170.49; 31p (CDCI3): 00.22; ESMS mlz657.3 (M-EhN-Hr.
    44. Synthesis of phosphoglycans by polycondensation
    45. Selective cleavage of phosphoglycans from the resin. This was accomplished by taking the PG loaded resin (3 mg) and Wilkinson's catalyst (1 mg) in argon-purged solvent mixture (300 Ill, toluene-PrOH-H20, 2:1 :0.08 containing 0.01 N HCI) and shaking it for 7 h at rt. The cleavage after first cycle of coupling provided 2,3,6-tri-0-acetyl-4-0-[2,3,4-tri-O-acetyl-6-0-(t-butyldimethylsilyl)-~-D-galacto pyranosyl]-a-D-mannopyranosyl-phosphate. This intermediate was subjected to full deprotection to provide ~-D-galactopyranosyl-a-D-mannopyranosyl phosphate (25) and compared with authentic sample earlier reported86 by our laboratory; [a]D = +10° (c 0.1, H20); lH NMR (D20, assignments by 2D COSY and TOCSY experiments) 0 3.45 (dd, J = 6.67 and 1.5 Hz, 1 H, H-2'), 3.46 (m, 1 H, H-5), 3.60 (m, 1 H, H-5'), 3.53-3.56 (m, 2H, H-2,3'), 3.68 (m, 2H, H-6), 3.76 (t, J = 7.11 and 2.64 Hz, 1 H, H-3), 3.83 (m, 2H, H-6'), 3.83 (m, 1 H, H-4'), 3.94 (m, 1 H, H-2), 4.38 (d, J = 9.65 Hz, 1 H, H-4), 4.38 (d, J = 7.6 Hz, 1 H, H-1'), 5.27 (dd, J1H-P = 6.8 Hz and J1•2 = 1.9 Hz, 1 H, H-1); 31p NMR 0 -2.07; ESMS, 421.2 [M-1 Ht; HRMS (ESMS): calcd for [M-Hr C12H22014P 421.2720 found 421.2718. Similar procedure was used to cleave phosphotetrasaccharide 22 from resin followed by complete deprotection, which provided compound 23 that was characterized by its comparison with standard prepared by solution method.
    46. opyranosyl phosphate] triethylammonium salt (22). The butenediol-linker functionalized Merrifield resin (19, 50 mg, 0.43 mmol/g, 0.021 mmol) was swollen in anhydrous pyridine (100 Ill) for 15 min, followed by addition of phosphoglycan H-phosphonate donor 6 (26 mg, 0.03 mmol) dissolved in anhydrous pyridine (500 Ill). Now pivaloyl chloride (20 Ill) was added and the resin mixture was shaken for 2 h. Thereafter a 200 III solution of iodine (4 mg) in 95% aqueous pyridine was added and stirring continued for another hour. The resin was then thoroughly washed with CH30H (700 III x 3) and dried over P20S overnight to afford acceptor-functionalized resin (20, 50 mg). ~ The coupled intermediate was characterized by positive ion ESMS after cleaving it off from the resin (2 mg) by treatment with 0.1 N HCI (100 Ill) at 100°C for 1 min. The product that got cleaved under this condition was characterized as 2,3,6-tri-0-acetyl-4-0-[2,3,4-tri-O-acetyl-6-0-(t-butyldimethylsilyl)-~-D-galactopyranosyl-a-D­mannopyranose which was identical to compound 5, already synthesized by solution method described earlier; ESMS m/z 731.3 (M+Nat. This compound on full deprotection with 48% aqueous HF-CH3CN (5:95) and CH30H-H20-EhN (5:2:1) provided disaccharide Gal1 ,4~Man (24); lH NMR 8 5.12 (d, J = 1.67 Hz, 1 H, H-1 a), 4.85 (d, 1 H, J = 0.98 Hz, 1 H, H-1 ~), 4.40-4.36 (m, 2H, H-1' and H-4), 3.75 (dd, 1 H, H-2'),3.94-3.92 (m, 2H, H-4' and H-2), 3.89-3.83 (m, 2H, H-6'), 3.81-3.79 (dd, 1H, J= 6 and 2 Hz, 1 H, H-3), 3.75-3.71 (m, 2H, H-6), 3.63-3.59 (dd, 1 H, H-3'), 3.51-3.46 (m, 2H, H-5, H-5'); ESMS: m/z 341.0 [M-Hr. To a part of the PG loaded resin 20 (15 mg), 48% aqueous HF-CH3CN (5:95,500 Ill) was added at 0 °C and the mixture was stirred on a orbital shaker for 3 h. The resin was then washed with CH30H (500 III x 2) and dried under vacuum to afford acceptor bound resin (21) with free 6' hydroxyl groups. This intermediate was again characterized by ESMS after cleaving it off from a small part of the resin (2 mg) by treatment with 0.1 N HCI (100 Ill) at 100°C for 1 min. The product that got cleaved under this condition was characterized as 2,3,6-tri-O-acetyl-4-0-(2,3,4-tri-O-acetyl-~­D-galactopyranosyl)-a-D-mannopyranose. Authenticity of this compound was confirmed by its comparison (TlC, NMR, ESMS) with standard separately prepared via solution synthesis by deprotection (HF-CH3CN) of TBDMS group from compound 5 (Scheme-1). A second cycle of PG coupling was carried out with identical procedure given above to afford phosphotetrasaccharide (22).
    47. and water (150 mL). The organic layer was dried (Na2S04) and concentrated. The crude product was purified by silica column chromatography (20% ethyl acetate in hexane with 1% EhN) to afford 17 (4.2 g, 80%); Rf = 0.3 in 50% ethyl acetate in hexane; 1H NMR (CDCI3, 300 MHz): <52.03 (s, 1 H), 3.68 (d, J = 4.8 Hz, 2H), 3.78 (s, 6H), 4.03 (d, J = 5.4 Hz, 2H), 5.73-5.75 (m, 2H), 6.82 (tt, J = 1.2 and 9.0 Hz, 4H), 7.25-7.44 (m, 9H); 13C NMR (CDCb, 75 MHz): 55.12, 55.13, 58.75, 59.93, 113.05, 126.68,127.76,127.99,128.95,129.87,130.92, 136.07,144.79,158.37; ESMS m/z 413.39 (M+Nat Preparation of functionalized resin by coupling of linker (19). 4-(4,4'-Dimethoxytrityl)-2-cis-butenol (17, 1 g, 2.56 mmol) was dissolved in anhydrous DMF (8 mL). Upon cooling to 0 °C, sodium hydride (60% dispersion in mineral oil, 150 mg, 3.75 mmol) was added and the solution was stirred for 1 h. Merrifield's resin (18, 650 mg, chloromethylated polystyrene cross-linked with 1 % divinylbenzene, Fluka-63865) was added along with tetra-butylammonium iodide (95 mg, 0.256 mmol) and shaking was continued for an additional hour at 0 °C after which the reaction mixture was brought to rt and shaken for another 12 h. The capping of unreacted sites on resin was accomplished by addition of CH30H (100 ilL) and sodium hydride (100 mg) and shaking the contents for another 4 h, after which more CH30H (5 mL) was added and the resin was washed sequentially with 1:1 CH30H: DMF (10 mL), THF (10 mL x 3) and CH2CI2 (10 mL x 3). The resin was dried over P20s under vacuum to afford 836 mg of the linker-attached resin (19). To quantify loading8S of linker onto the solid support, a stock solution of 3% TFA in CH2CI2 (10 ml) was prepared which contained effectively 0.167 mg of the protected resin. The resulting orange colour liberated by the release of dimethoxytrityl (DMTr) cation was measured by UV at 503 nm, and the loading of the linker onto the resin was calculated to be 0.43 mmol/g of resin. The deprotection of the entire DMTr-linker functionalized resin was then carried out by treating the resin with 1 % TFA in CH2CI2 (10 mL). Further washing with CH2CI2 (20 mL x 3), 1% EhN in CH2CI2 (10 mL) and CH2CI2 (10 mL) and drying under vacuum afforded 640 mg of deprotected resin ready for coupling with phosphoglycan donors. Solid Phase Synthesis of 2,3,4-Tri-O-acetyl-~-D-galactopyranosyl-(1 ~4)-2,3,6-tri-O-acetyl-a.-D-mannopyranosyl phosphate 6-[2,3,4-tri-O-acetyl-6-0-(t-butyldi methylsi lyl)-~-D-galactopyranosyl-(1 ~4 )-1 ,2,3,6-tetra-O-acetyl-a.-D-mann
    48. Synthesis of SOlid-phase linker, 4-(4,4'-Dimethoxytrityl)-cis-2-butenol (17). To a solution of cis-butene-1,4-diol (16, 4.7 mL, 5 g, 56.7 mmol) in anhydrous pyridine (100 mL) at 0 °C was added 4,4'-dimethoxytrityl chloride (6.4 g, 18.9 mmol). The reaction mixture was gradually brought to rt over 3 h and stirred for additional 12 h. Ethyl acetate (200 mL) was added and the organic phase was washed with water (150 mL), saturated aqueous NaHC03 (200 mL), saturated aqueous NaCI (200 mL)
    49. Solid phase phosphoglycan synthesis
    50. (250 ~L) was added dropwise. The mixture was stirred at 0 °C for 2 h and quenched with 1 M TEAS solution (pH=7, 1 mL). The clear solution was stirred for 15 min. after which CH2CI2 was added and the organic layer was washed with ice cold water (1 mL x 2), cold 1 M TEAS buffer (1 mL x 2), dried over Na2S04, and concentrated to yield compound 13 (5.1 mg, 86%); ESMS m/z 1'427.9 (M-Et3N-H): 2,3,4-Tri-O-acetyl-~-D-galactopyranosyl-(1 ~4 )-1 ,2,3,6-tetra-O-acetyl-a-D-manno pyranoside 6-{2,3,4-tri-O-acetyl-6-0-(t-butyldimethylsilyl)-~-D-galactopyranosyl -(1~4)-2,3,6-tri-O-acetyl-a-D-mannopyranosyl phosphate 6-[2,3,4-tri-O-acetyl-~­D-galactopyranosyl-(1~4)-2,3,6-tri-O-acetyl-a-D-mannopyranosyl phosphate] } bistriethylammonium salt (14). Mixture of compounds 13 (5.1 mg, 0.003 mmol) and 6 (5 mg, 0.007 mmol) was dried by evaporation of pyridine (500 ~L x 2). The residue was dissolved in anhydrous pyridine (200 ~L) and pivaloyl chloride (2.4 ~L, 0.02 mmol) was added. The mixture was stirred at rt for 1 h and a freshly prepared iodine solution (200 ~L, 4 mg, 0.015 mmol in pyridine-water, 95:5) was added. After 30 min CH2CI2 was added and the solution was washed successively with cold 1 M aqueous Na2S203 solution (2 mL x 2), ice-cold 1 M TEAS buffer (2 mL x 2), dried over Na2S04 and concentrated to afford 14 (4.5 mg, 61%); Rf = 0.11 in 10% CH30H in CH2CI2; ESMS m/z2061.44 (M-2EhN-H), 2062.35 (M-2EhN). ~-D-Galactopyranosyl-(1~4)-a-D-mannopyranoside {6-~-D-galactopyranosyl­(1~4)-a-D-mannopyranosyl phosphate 6-[ ~-D-galactopyranosyl-(1~4)-a-D­mannopyranosyl phosphate]} bis-triethylammonium salt (15). The global deprotection of fully protected phosphohexasaccharide 14 was carried out by same method as given for preparation of compound 9, and this compound was identical to PG oligomer 12 prepared by upstream extension described earlier.
    51. (19 x OCOCH3), 3.50 (m, 6H, H2-6 Gal/Gal'/Gal"), 3.87-3.94 (m, 3H, H-5, Gal/Gal'/Gal"), 4.14-4.07 (m, 3H, 5-H, Man/Man'/Man"), 4.30-4.35 (m, 3H, 4-H, Man/Man'/Man"), 4.39 (m, 6H, H2-6, Man/Man'/Man"), 4.48 (m, 2H, 3-H, Man'/Man"), 4.52 (m, 1 H, 3-H, Man), 4.94 (d, J = 7.7 Hz, 3H, H-1, Gal/Gal'/Gal"), 5.28 (m, 6H, 2-H Man, H-4 Gal/Gal'/Gal", H-3 Gal'/Gal"), 5.29 (m, 1 H, H-3, Gal), 5.43 (m, 2H, H-2 Gal'/Gal"), 5.45 (dd, JHH = 1.9 and JHP = 7.0 Hz, 2H, H-1, Man'/Man"), 5.46 (m, 3H, H-2, Gal/Gal'/Gal"), 6.01 (d, J = 1.9 Hz, 1 H, 1-H, Man); 31p_NMR: 8 -1.94; ESMS m/z2061.44 (M-2Et3N-H), 2062.35 (M-2Et3N). ~-D-Galactopyranosyl-(1 ~4)-a-D-mannopyranoside {S-~-D-galactopyranosyl­(1~4)-a-D-ma nnopyranosyl phosphate S-[ ~-D-galactopyranosyl-(1~4)-a-D­mannopyranosyl phosphate]) bis-triethylammonium salt (12). The global deprotection of fully protected phosphohexasaccharide 11 was carried out by same method as given for preparation of compound 9 earlier; 1 H-NMR (020), due to Oligomeric nature of the molecule (three identical PG repeats), all NMR peaks could not be assigned,: 3.45 (m, 3H, H-2, Gal/Gal'/Gal"), 3.46 (m, 2H, H-5, Man'/Man"), 3.55 (m, 1 H, H-5, Man), 3.56-3.53 (m, 3H, H-3, Gal/Gal'/Gal"), 3.60 (m, 3H, H-5, Gal/Gal'/Gal"), 3.68 (m, 6H, H2-6, Man/Man'/Man"), 3.76 (m, 3H, H-3, Man/Man'/Man"), 3.80 (m, 6H, H2-6, Gal/Gal'/Gal"), 3.83 (m, 3H, H-4, GaVGal'/Gal"), 3.85 (m, 1 H, H-2, Man), 3.94 (m, 2H, H-2, Man'/Man"), 4.32 (m, 1 H, H-4, Man), 4.37 (d, J= 7.6 Hz, 2H, H-1, Gal'/Gal"), 4.35 (d, J= 7.6, 1H, H-1, Gal), 5.09 (d, J= 1.8, 1 H, H-1, Man), 5.36 (dd, JHH = 1.9 and JHP = 6.8 Hz, 2H, H-1, Man'/Man"); 31p_NMR: -1.29; ESMS: m/z 574.12 ([M-2Et3N-2Hf 2,3,4-Tri-O-acetyl-~-D-galactopyranosyl-(1 ~4 )-1 ,2,3,S-tetra-O-acetyl-a-D-manno pyranoside S-[2,3,4-tri-O-acetyl-S-0-(t-butyldimethylsilyl)-~-D-galactopyrano syl-(1 ~4 )-2,3,S-tri-O-acetyl-a-D-mannopyranosyl-H-phosphonate] triethylamm onium salt (13). Compound 8 (5 mg, 0.003 mmol) was dissolved in saturated solution of Me2NH in anhydrous CH3CN (2 mL) at -20°C and the solution was stirred for 3 h during which TLC confirmed disappearance of the starting material. Excess of Me2NH was removed und
    52. = 1.9 and JHP = 6.8 Hz, 2H, H-1, Man'/Man"); 31p_NMR: -1.29; ESMS: m/z 574.12 ([M-2Et3N-2Hf 2,3,4-Tri-O-acetyl-~-D-galactopyranosyl-(1 ~4 )-1 ,2,3,S-tetra-O-acetyl-a-D-manno pyranoside S-[2,3,4-tri-O-acetyl-S-0-(t-butyldimethylsilyl)-~-D-galactopyrano syl-(1 ~4 )-2,3,S-tri-O-acetyl-a-D-mannopyranosyl-H-phosphonate] triethylamm onium salt (13). Compound 8 (5 mg, 0.003 mmol) was dissolved in saturated solution of Me2NH in anhydrous CH3CN (2 mL) at -20°C and the solution was stirred for 3 h during which TLC confirmed disappearance of the starting material. Excess of Me2NH was removed under reduced pressure below 30°C and the reaction mixture was concentrated to give the anomeric deprotected product in quantitative yield. To a stirred solution of imidazole (6 mg, 0.87 mmol) in anhydrous CH3CN (250 J!L) at 0 °C was added PCI3 (10 J!L, 0.112 mmol) and EhN (30 J!L, 0.215 mmol). The mixture was stirred for 20 min, after which a solution of the above compound in anhydrous CH3CN
    53. Man), 61.37 (C-6, Man'), 62.30 (C-6, Gal'), 65.53 (C-6, d, Jcp = 5.5 Hz, Gal), 69.28 (C-4, Gal), 69.83 (C-4, Gal' and C-3, Man'), 70.84 (C-3, Man and C-2, Man), 71.08 (C-2, d, Jcp = 7.4 Hz, Man'), 72.13 (C-2, Gal' and C-2, Gal), 72.34 (C-5, Man), 73.69 (C-3, Gal', C-3, Gal and C-5, Man'), 74.89 (C-5, d, JcP = 7.5 Hz, Gal), 76.52 (C-5, Gal'), 77.05 (C-4, Man'), 78.14 (C-4, Man), 97.03 (C-1, d, Jcp = 5.5 Hz, Man'), 100.76 (C-1, Man), 104.20 (C-1, Gal'), 104.42 (C-1, Gal); 31p-NMR: -1.29; ESMS m/z 745.38 (M-Et3N-H)"; HRMS (ESMS): calcd for (M-Et3N-H)" C24H42024P 745.1804, found 745.1830. 2,3,4-Tri-O-acetyl-(3-D-galactopyranosyl-(1 ~4)-1 ,2,3,6-tetra-O-acetyl-a-D-mann opyranoside 6-(2,3,4-tri-O-acetyl-(3-D-galactopyranosyl-(1~4)-2,3,6-tri-O-acetyl­a-D-mannopyranosylphosphate ) triethylammonium salt (10). A solution of 48% aqueous HF in CH3CN (5:95, 5 ml) was added to compound 8 (20 mg, 0.015 mmol) at 0 DC and stirred at 0 DC for 2 h. The reaction was quenched by the addition of the aqueous NaHC03 solution until effervescence ceased and diluted with CH2CI2 (5 ml). The organic layer was washed with water, dried over Na2S04 and concentrated to give compound 10 (15.6 mg, 85%); ESMS m/z 1290.4 (M-EhN-H)" 2,3,4-Tri-O-acetyl-(3-D-galactopyranosyl-(1 ~4 )-1 ,2,3,6-tetra-O-acetyl-a-D-manno pyranoside 6-{2,3,4-tri-O-acetyl-6-0-(t-butyldimethylsilyl)-(3-D-galactopyrano syl-(1~4)-2,3,6-tri-O-acetyl-a-D-mannopyranosyl phosphate 6-[2,3,4-tri-O-acetyl -(3-D-galactopyranosyl-(1 ~4)-2,3,6-tri-O-acetyl-a-D-mannopyranosyl phosphate ]) bis-triethylammonium salt (11). Mixture of phosphotetrasaccharide acceptor 10 (15.6 mg, 0.015 mmol) and H-phosphonate donor 6 (20.8 mg, 0.024 mmol) was dried by evaporation of pyridine (500 III x 3). The residue was dissolved in anhydrous pyridine (500 Ill), and pivaloyl chloride (10 Ill, 0.083 mmol) was added. The mixture was stirred for 1 h at rt after which a freshly prepared solution of iodine (500 Ill, 16 mg, 0.06 mmol in pyridine-water, 95:5) was added. After 30 min, CH2CI2 was added and the solution was washed successively with cold 1 M aq Na2S203 solution (5 ml x 2) and ice-cold 1 M TEAS buffer (5 ml x 2), dried over Na2S04 and concentrated. The silica column purification using 5% CH30H in CH2CI2 with 1 % EhN afforded compound 11 (16 mg, 63%); R, = 0.11 in 10% CH30H in CH2Cb; lH-NMR (CDCI3); assignments by 1 H_l H COSY and HMQC experiments. Due to repeating nature (three repeats of phosphoglycan) of the molecule, all NMR peaks could not be assigned:1H NMR 0 0.01 (s, 6H, OSiM~CMe3), 0.84 (s, 9H, OSiMe2CMe3), 2.15-1.96
    54. 2.15 (13 x OCOCH3), 3.50 (m, 4H, H2-6 Gal and Gal'), 3.87 (m, 1 H, H-5, Gal'), 3.94 (m, 1H, H-5, Gal), 4.07-4.10 (m, 1H, H-5, Man'), 4.07-4.14 (m, 1H, H-5, Man), 4.35 (m, 1 H, H-4, Man'), 4.39 (m, 4H, 4-H, H2-6, Man and H2-6, Man'), 4.40 (m, 1 H, H-4, Man), 4.48 (m, 1 H, H-3, Man'), 4.52 (m, 1 H, H-3, Man), 4.94 (d, J = 7.7 Hz, 2H, H-1 ,Gal and H-1, Gal'), 5.28 (m, 4H, H-2 Man, H-4 Gal, H-3 Gal' and H-4 Gal'), 5.29 (m, 1 H, H-3, Gal), 5.43 (m, 1 H, H-2 Gal'), 5.45 (dd, JHH= 1.9 and JHP = 7.0 Hz, 1 H, H-1, Man'), 5.46 (m, 1 H, H-2, Gal), 6.01 (d, J = 2.7 Hz, 1 H, H-1, Man); 13C NMR: 0 -5.75, 17.95 and 25.57 (for TBOMS group), 20.48-20.79 (CH~02 x 13), 60.06 (C-6, Gal'), 60.42 (d, Jcp = 8 Hz, C-6, Gal), 62.22 (C-6, Man), 62.63 (C-6, Man'), 66.55 (d, C-2, Man'), 67.46 (d, C-5, Gal), 68.27 (C-4, Gal), 68.64 (C-4, Gal'), 69.37 (C-3, Man'), 69.66 (C-5, Man), 69.84 (C-3, Man), 70.14 (C-5, Man'), 70.75 (C-2, Gal'), 70.88 (C-2, Gal), 71.20 (C-2, Man), 73.31 (C-3, Gal'), 73.76 (C-3, Gal), 74.24 (C-4, Man'), 77.15 (C-4, Man), 78.95 (C-5, Gal'), 90.41 (d, C-1, Man'), 91.69 (C-1, Gal), 101.08 (C-1, Man), 101.29 (C-1, Gal'), 168-171 (CH3CO x 13); 31p_NMR: 0 -2.90 (dt, JPH 7.5 and 10); ESMS m/z 1405.2 (M-EhN-Hf; HRMS (ESMS): calcd for (M-Et3N-Hf C56H82037PSi 1405.4042, found 1405.4105. J3-D-Galactopyranosyl-(1 ~4)-a-D-mannopyranoside 6-[J3-D-galactopyranosyl-(1~)-a-D-mannopyranosyl phosphate] triethylammonium salt (9). A solution of 48% aqueous HF in CH3CN (5:95, 1.5 ml) was added to compound 8 (15 mg, 0.01 mmol) at 0 °C. The solution was stirred at 0 °C for 2 h. The reaction was quenched by the addition of aqueous NaHC03 solution until effervescence ceased, and diluted with CH2CI2 (5 ml). The organic layer was washed with water, dried over Na2S04 and concentrated. The residue was dissolved in anhydrous CH30H (500 Ill) and NaOMe (15 mg) was added, the solution was stirred overnight at rt, deionized with AG-X8 resin (H+), filtered and immediately neutralized with Et3N. After concentration, water (500 III x 3) was evaporated off from the residue to afford tetrasaccharide phosphodiester 9 (7.9 mg, 94%); [a]o = 34° (c 0.15, H20); lH-NMR (020), lH_1H_ COSY assignments: 3.45 (m, 2H, H-2, GaVGal'), 3.46 (m, 1 H, H-5, Man'), 3.55 (m, 1 H, H-5, Man), 3.56-3.53 (m, 2H, H-3, Gal/Gal'), 3.60 (m, 2H, H-5, Gal/Gal'), 3.68 (m, 4H, H2-6, Man/Man'), 3.76 (m, 2H, H-3, Man/Man'), 3.80 (m, 4H, H2-6, Gal/Gal'), 3.83 (m, 2H, H-4, GaVGal'), 3.85 (m, 1 H, H-2, Man), 3.94 (m, 1 H, H-2, Man'), 4.32 (m, 1 H, H-4, Man), 4.37 (d, J = 7.6 Hz, 1 H, H-1, Gal'), 4.35 (d, J = 7.6 Hz, 1 H, H-1, Gal), 5.09 (d, J = 1.8 Hz, 1 H, H-1, Man), 5.36 (dd, JHH = 1.9 Hz and JHP = 6.8 Hz, 1 H, H-1, Man'); 13C-NMR, assignment made by 20 lH_13C HETCOR experiment, 61.37 (C-6,
    55. 66.57 (C-4'), 69.36 (C-3), 69.53 (C-5), 69.69 (C-2'), 71.20 (C-2). 73.30 (C-3'), 73.86 (C-5'), 91.59 (C-4), 92.54 (C-1), 101.09 (C-1'), 169.13-170.49 (COMe); 31p NMR: 8= 0.13; ESMS m/z 771.26 (M-Et3N-Hr; HRMS (ESMS): calcd for (M-EbN-Hr C30H48019PSi 771.2297, found 771.2276. 1 ,2,3,6-Tetra-O-acetyl-4-0-(2,3,4-tri-O-acetyl-j3-D-galactopyranosyl)-a-D-manno pyranose (7). A solution of 48% aqueous HF in CH3CN (5:95, 8 ml) was added to compound 4 (100 mg, 0.132 mmol) at 0 °C and the solution was stirred for 2 h. The reaction was quenched with aqueous NaHC03 solution until effervescence ceased, and diluted with CH2CI2. The organic layer was washed thoroughly with water, dried over Na2S04 and concentrated to give 7 (72 mg, 85.7%); Rt = 0.3 in 70% ethyl acetate in hexane; [a]o = +4.6° (c 0.3, CHCI3); 1H NMR (CDCI3, 300 MHz) 81.97-2.16 (m, 21 H, 7 x OAc), 3.67-3.74 (m, 3H, H-5',6), 4.08-4.14 (m, 3H, H-5,6'), 4.58 (d, J = 7.8 Hz, 1H, H-1'), 5.16 (dd, J = 2.1 and 7.8 Hz, 1H, H-2'), 5.23 (dd, J = 2.1 and 3.6 Hz, 1 H, H-2), 5.32 (d, J = 3.3 Hz, 1 H, H-4), 5.41 (dd, J = 3.6 and 4.5 Hz, 1 H, H-3), 6.01 (d, J = 2.1 Hz, 1 H, H-1); 13C NMR (CDCI3, 75 MHz) 8 20.42-20.77 (7 x COMe), 60.74 (C-6'), 62.25 (C-6), 67.56 (C-4'), 68.31 (C-3), 69.35 (C-5), 69.43 (C-2'), 70.77 (C-2), 70.83 (C-3'), 73.98 (C-5'), 74.32 (C-4), 90.45 (C-1), 101.30 (C-1'), 168.32-170.80 (7 x COMe),; ESMS m/z659.28 (M+Nar; HRMS (ESMS): calcd for (M+NH4r C26H40N018 654.2245, found 654.2272. 2,3,4-Tri-O-acetyl-j3-D-galactopyranosyl-(1-?4)-1 ,2,3,6-tetra-O-acetyl-a-D-manno pyranoside 6-[2,3,4-tri-O-acetyl-6-0-(t-butyldimethylsilyl)-j3-D-galactopyranosyl -(1 ~4)-1 ,2,3,6-tetra-O-acetyl-a-D-mannopyranosyl phosphate] triethyl ammonium salt (8). Mixture of H-phosphonate donor 6 (32 mg, 0.036 mmol) and acceptor 7 (23 mg, 0.036 mmol) was dried by evaporation of pyridine (500 III x 3). The residue was dissolved in anhydrous pyridine (600 Ill) and pivaloyl chloride (15 Ill, 0.123 mmol) was added. The reaction mixture was stirred for 1 h at rt and a freshly prepared iodine solution (600 Ill, 18 mg, 0.078 mmol in pyridine-water, 95:5) was added. After 30 min. CH2CI2 (10 ml) was added and the solution was washed successively with cold 1 M aqueous solution of Na2S203 (5 ml x 2) and ice-cold 1 M TEAS buffer (5 ml x 2), dried over Na2S04 and concentrated. Column chromatography on silica gel (3% CH30H in CH2CI2 with 1 % EbN) afforded product 8 (40 mg, 73.8%); Rt= 0.21 in 10% CH30H in CH2CI2; [a]o = -6.1° (c 0.18, CHCI3); 1H_ NMR (CDCI3, 300 MHz); assignments confirmed by 1H_1H COSY and HMQC experiments: 1 H NMR 8 0.01 (5, 6H, OSiM9:2CMe3), 0.84 (s, 9H, OSiMe2CMe3). 1.96-
    56. 2,3,6-Tri-O-acetyl-4-0-[2,3,4-tri-O-acetyl-6-0-(t-butyldimethylsilyl)-(3-D-galactop yranosyl]-a-D-mannopyranose (5). Compound 4 (100 mg, 0.132 mmol) was dissolved in saturated Me2NH solution in anhydrous CH3CN (20 ml) at -20°C and stirred for 3 h after which TlC confirmed disappearance of the starting material. Excess of Me2NH was removed under reduced pressure below 30°C and the reaction mixture was concentrated to give the desired anomeric deprotected compound 5 in quantitative yield; R, = 0.25 in 70% ethyl acetate in hexane; [a]D = +3.75° (c 0.16, CHCI3); 1H NMR (CDCI3, 300 MHz) 80.01 (s, 6H, M~SiCMe3), 0.84 (s, 9H, Me2SiCMSJ), 1.95-2.19 (m, 18H, 6 x OAc), 3.56-3.66 (m, 4H, H-6,6'), 3.91 (m, 1H, H-5), 4.12-4.16 (m, 2H, H-5', OH), 4.40 (d, J= 4.5 Hz, 1H, H-4), 4.40 (d, J= 7.8 Hz, 1 H, H-1'), 4.99 (dd, J = 3.3 and 7.8 Hz, H-3'), 5.09 (dd, J = 2.1 and 7.8 Hz, 1 H, H-2'), 5.17 (dd, J = 2.1 and 3.6 Hz, 1 H, H-2), 5.23 (dd, J = 3.6 and 4.5 Hz, 1 H, H-3), 5.43 (m, 2H, H-4',1); 13C NMR (CDCI3, 75 MHz) 8 -5.77 (M~SiCMe3), 17.98 , (Me2SiCMe3)" 20.40-21.38 (OAc), 25.58 (Me2SiCMe3), 60.06 (C-6'), 62.62 (C-6), 66.56 (C-4'), 68.78 (C-3), 69.30 (C-5), 69.51 (C-2'), 70.06 (C-2), 71.21 (C-3'), 73.37 (C-5'), 74.15 (C-4), 91.82 (C-1), 101.04 (C-1'), 169.10-170.52 (COMe); ESMS m/z 731.3 (M+Nat. Triethylammonium 2,3,6-tri-O-acetyl-4-0-[2,3,4-tri-O-acetyl-6-0-(t-butyldimethyl silyl)-(3-D-galactopyranosyl]-a-D-mannopyranosyl hydrogen phosphonate (6). To a stirred solution of imidazole (224 mg, 3.28 mmol) in anhydrous CH3CN (5 ml) at o °C was added PCI3 (160 Ill, 1.8 mmol) and EhN (480 Ill, 3.44 mmol). The mixture was stirred for 20 min, after which a solution of compound 5 dissolved in anhydrous CH3CN (5 ml) was added dropwise. The mixture was stirred at 0 °C for 3 hand quenched with 1 M triethylammonium bicarbonate (TEAS) buffer (pH 7, 2 ml). The clear solution was stirred for 15 min, diluted with CH2CI2 (20 ml), and the organic layer was washed with ice cold water (10 ml x 2) and cold 1 M TEAS solution (10 ml x 2) successively, dried over Na2S04 and concentrated to yield phosphoglycan donor 6 (100 mg, 86%); R, = 0.45 in 20% CH30H in CH2CI2; [a]D = -4.5° (c 0.27, CHCb); 1H NMR (CDCI3, 300 MHz) 8 0.01 (s, 6H, M~SiCMe3), 0.82 (s, 9H, M~SiCMSJ), 1.95-2.09 (m, 18H, 6 x OAc), 3.49-3.68 (m, 4H, H-6,6'), 3.88 (m, 1 H, H-5), 4.14 (m, 1 H, H-5'),4.36 (d, J = 4.5 Hz, 1 H, H-4), 4.47 (d, J = 7.8 Hz, 1 H, H-1'), 4.95 (dd, J = 3.3 and 7.8 Hz, 1H, H-3'), 5.05 (dd, J = 2.1 and 7.8 Hz, 1H, H-2'), 5.21 (dd, J = 2.1 and 3.6 Hz, 1 H, H-2), 5.41 (d, J = 3.3 Hz, 1 H, H-4'), 5.48 (dd, J = 1.8 and 8 Hz, 1 H, H-1), 6.92 (d, JH,p= 637.0 Hz, 1H, H-1); 13C NMR (CDCI3, 75 MHz) 8 -5.80, (M~SiCMe3), 17.98 (Me2SiCMe3), 20.48-20.76 (OAc), 25.57 (Me2SiCMSJ), 60.10 (C-6'), 62.42 (C-6),
    57. chromatography (8% CH30H in CH2CI2) to provide compound 2 (10.8 g, 79.5%); Rf = 0.47 in 15% CH30H in CH2CI2; [a]o = +3.45° (c 0.29, CH30H); 1H NMR (020, 300 MHz) 00.01 (s, 6H, M~SiCMe3), 0.82 (s, 9H, Me2SiCM~), 3.48 (m, 1 H, H-2'), 3.58 (m, 1 H, H-3'), 3.65 (m, 1 H, H-5), 3.76 (m, 4H, H-6,6'), 3.82 (d, J = 3.1 Hz, 1 H, H-4'), 3.92 (m, 1 H, H-5'), 4.38 (m, 1 H, H-3), 4.31 (d, J = 5.7 Hz, 1 H, H-4), 4.46 (d, J = 7.8 Hz, 1 H, H-1'), 4.76 (dd, J = 3.6 and 6.3 Hz, 1 H, H-2), 6.37 (dd, J = 1.1 and 6.2 Hz, 1 H, H-1); 13C NMR (020, 75 MHz) 0 -4.84 (M~SiCMe3), 25.23 (Me2SiCM~), 59.57 (C-6'), 60.89 (C-6), 67.14 (C-4'), 68.45 (C-3), 70.87 (C-5), 72.52 (C-2'), 75.23 (C-2), 76.68 (C-3'), 77.43 (C-5'), 101.73 (C-4), 102.87 (C-1'), 143.88 (C-1); ESMS m/z 445.10 (M+Naf; HRMS (FAB): calcd for (M+Lif C18H3409SiLi 429.2132, found 429.2126. 1,2,3,6-Tetra-O-acetyl-4-0-[2,3,4-tri-O-acetyl-6-0-( t-butyldimethylsilyl)-~-D-gala ctopyranosyl]-a-D-mannopyranose (4). A solution of 2 (5 g, 11.8 mmol) in water (50 mL) was stirred, to which was added a solution of m-CPBA (6.5 g, 36 mmol) in diethyl ether (50 mL) dropwise at -10 °C. The reaction mixture was brought to 0 °C and stirred for 4 h, and aqueous layer was extracted thoroughly with ether, Iyoph iii zed to afford 4-0-[6-0-( t-butyldi methylsilyl)-f3-0-galactopyranosyl]-a-0-mannopyranose (3) . This was dissolved in anhydrous pyridine (25 mL) and acetic anhydride (25 mL) was added dropwise at 0 °C. The mixture was gradually brought to rt and stirred for 16 h, and after completion of the reaction it was quenched with ice and diluted with CH2CI2. The organic layer was washed with water, dried (Na2S04) and concentrated to give a syrup which was purified by silica column (20% ethyl acetate in hexane) to provide compound 4 as white amorphous solid (7.5 g, 84%); [a]o = +6.72° (c 0.55, CHCI3); Rf = 0.69 in 70% ethyl acetate in hexane; 1H NMR (COCI3, 300 MHz) 0 0.01 (s, 6H, M~SiCMe3)' 0.84 (s, 9H, Me2SiCMe3), 1.95-2.14 (m, 21 H, 7 x OAc), 3.56-3.64 (m, 4H, H-6,6'), 4.17-5.04 (m, 2H, H-5,5'), 4.53 (d, J = 7.8 Hz, 1H, H-1'), 5.01 (dd, J = 3.3 and 7.8 Hz, 2H, H-4), 5.12 (dd, J = 2.1 and 7.8 Hz, 1H, H-2'), 5.21 (dd, J = 2.1 and 3.6 Hz, 1H, H-2), 5.34 (dd, J = 3.6 and 4.5 Hz, 1H, H-3), 5.41 (d, J = 3.3 Hz, 1H, H-4'), 6.01 (d, J = 2.1 Hz, 1H, H-1); 13C NMR (COCI3, 75 MHz) 8 -5.85 (M~SiCMe3), 17.94 (Me2SiCMe3), 20.40-20.86 (OAc), 25.54 (Me2SiCMe3), 60.01 (C-6'), 62.14 (C-6), 66.45 (C-4'), 68.18 (C-3), 69.25 (C-5), 69.39 (C-2'), 70.58 (C-2), 70.79 (C-3'), 73.38 (C-5'), 73.62 (C-4), 90.25 (C-1), 101.14 (C-1'), 168.08-170.23 (7 x CO); ESMS m/z 773.24 (M+Naf; HRMS (ESMS): calcd for (M+NH4f C32Hs4 N018 Si 768.3110, found 768.3139
    58. Lactal (1). A solution of cyanocobalamin83 (Vitamin B12, 1.5 g, 1.14 mmol) in anhydrous CH30H (400 mL) was thoroughly purged with nitrogen gas for 30 min and zinc powder (87.5 g, 1.338 mol) and ammonium chloride (71 g, 1.33 mol) were added to the solution. The reaction was stirred for another 45 min and hepta-O-acetyl lactosyl bromide (47 g, 67.5 mmol), freshly prepared from lactose [peracetylation using acetic anhydride and sodium acetate, followed by anomeric bromination (48% hydrobromic acid in acetic acid)], was dissolved in CH30H (150 mL) and added. Immediately after addition of the bromide, the dark red solution changed to reddish-yellow and then back to dark red in 5 min. The solution was filtered through celite to remove zinc, the celite pad was washed with CH30H and the filtrate was concentrated to give a white and red solid. This mixture was dissolved in water (500 mL) and extracted with CH2CI2 (300 mL x 3). Organic extracts were combined, dried over Na2S04, and concentrated to provide hexa-O-acetyl lactal (36 g, 87%) as an amorphous solid, mp 113° (lit84 mp 114°); [a)D = -18° (c 1.0, CHCI3) (Iit84, -18°, c 1.0, CHCI3). In the next step of complete deacylation, hexa-O-acetyl lactal (36 g, 64.5 mmol) and freshly dried Na2C03 (45 g, 425 mmol) were suspended in anhydrous CH30H (750 mL) and stirred for 90 min at rt. The suspension was filtered to remove excess of Na2C03 and the filtrate was concentrated under reduced pressure to give deprotected lactal (1) as an amorphous solid (19.4 g, 98%); R,= 0.2 in 30% CH30H in CH2CI2; mp 191-193°; [a]D = +27° (c 1.6, H20) (lit84, +27°, c 1.6, H20). 6'-0-(f-butyldimethylsilyl)-lactal (2). A solution of lactal (1, 10 g, 32.4 mmol) and BU2SnO (8 g, 32.5 mmol) in anhydrous CH30H (1000 mL) was heated to reflux for 4 h followed by removal of solvent which provided a yellow powder. The dibutyltin complex was dissolved in anhydrous THF (1000 mL) and TBDMSCI (4.9 g, 32.3 mmol) was added, and the solution was stirred for 48 h at rt. After the completion of reaction, the solvent was evaporated to give a residue which was purified by silica
    59. Solution Phase Synthesis of Phosphoglycans
    60. Synthesis of Phosphoglycan Repeats of Lipophosphoglycan
    61. The NMR spectra of the compounds were obtained on a 300 MHz (for 1H) NMR spectrometer (Avance-DRX 300; Bruker), equipped with a quadrinuclear probe (QNP) and an inverse gradient probe, using XWIN NMR software. Both these probes were 5 mm probes. Deutrated solvents (CDCI3, CD30D, 020 etc) were used for dissolving samples and locking the instrument. Tetramethylsilane (TMS, SiMe4) was used as the internal reference for 1H NMR and 80% ortha-phosphoric acid as external reference for 31 P-NMR. The chemical shifts have been expressed in terms of parts per million (ppm, 6) relative to TMS and coupling constants (J-values) have been expressed in Hertz (Hz). Molecular masses of the compounds were determined by mass spectrometry. Depending on the nature of the compound, electrospray-ionization (ES-MS) was obtained in negative or positive ion mode on a quadrupole mass spectrometer (VG Platform II; VG BioTech, Fisons Instruments, Altrincham, UK) using MassLynx software. High resolution mass spectra were obtained from IICT, Hyderabad and University of Kansas mass spectrometry facility. Optical rotations were obtained using a Perkin-Elmer 241 Spectropolarimeter. Measurements were made at 25°C using sodium D-line. The [alo values have been expressed in the units of 10.1 deg cm2 gm-1. The entire radioactivity operation was carried out in a fume-hood devoted to radiochemical work. Disposable items were discarded at a defined and instructed place. All other necessary precautions for handling radioactivity were taken. Liquid scintillation counting of samples was done on a scintillation counter using preset program for 1H ~ emitter. A suitable aliquot in triplicate was mixed with 5 mL scintillation fluid (Cocktail W-10 g PPO, 0.25 g POPPO and 100 g naphthalene per litre of 1,4-dioxan; SRL) in scintillation vials. For solvent blank, vial containing 5 mL scintillation cocktail was used.
    62. All the reagents used in chemical syntheses and biosynthetic experiments were of the highest purity grade available. Glass-backed and aluminium TLC plates (Kieselgel 60 F254) were procured from Merck. Silica coated preparative glass-backed TLC plates were purchased from AnalTech. AG1-X8 and Dowex 2X8 anion exchange resins were obtained from Bio-Rad. All dry solvents were prepared in the laboratory using standard procedures for drying. Milli Q UF (Reverse Osmosed, ion exchanged and Ultra-filtered; Millipore Corporation, USA) grade water was used. For refluxing an oil-bath (high boiling silicone oil) was used and the temperature was controlled by a variostate and sensor. Stirring of the contents of reaction flasks, oil bath etc., were done using appropriate sized magnetic bars and Magnetic stirrer (Remi). For filtration of materials, Whatman #1 paper and Celite (Fluka) was used. For removing solvent from compounds, a flash evaporator (Rotavapour R-114, Buchi) was used which was connected to a water-chiller circulator and at times with a high vacuum pump to remove high boiling solvents. Monitoring the progress of reactions, analysis of column fractions and identification of reaction intermediates were done by thin layer chromatography on glass backed precoated TLC plates. The developed plates were air-dried and subjected to the following detection system: 1. Iodine vapors: Sublime iodine crystals were mixed with silica gel in an air-tight chamber. When the chamber was full of iodine vapors, the plates were exposed to this when yellowish brown spots were visible against white background. 2. Ultraviolet light: U.V. absorbing compounds were visualized by a hand-held UV lamp (Spectroline Model ENF-260C/F) employing both long and short wavelength UV. 3. Ammonium molybdate-ceric sulfate reagent: This reagent was prepared by dissolving ammonium molybdate (2.5 g) and ceric sulfate (1 g) in water (90 mL) and conc. Sulfuric acid (10 mL). The developed plates were immersed in this reagent and heated with a heat-gun (HEJET Model, Aldrich). Blue spots were observed when the compounds reacted with this reagent.
    63. General procedures
    1. 492 run with 620 nm as the reference filter. The antibody response generated was represented as the geometric mean of the absorbance of individual mice sera in a group of immunized animals. b1 addition, the antibody titer against r-dZP3 was also determined by ELISA. The assay was carried out as described above except that 100 ~l of doubling dilutions of the serum samples (dilutions made in PBST supplemented with 0.1% BSA) were added per well in duplicate. For each serum sample tested, a reciprocal of dilution giving an absorbance of 1.0 was calculated by regression analysis and represented as antibody units (AU).
    2. Microtitration plates were coated with optimized concentration of r-bmZP1 (250 ng/well), r-dZP3 (400 ng/well) or r-rG (500 ng/well) in 50 mM PBS, pH 7.4, at 37°C for 1 h and then at 4°C, 0/N. The plates were washed once with PBS and incubated with 1% BSA, (200 Jll/ well) in PBS for 2 h at 37°C for blocking the non-specific sites. All subsequent incubations were carried out for 1 h at 37°C and each incubation was followed by three washings with PBS containing 0.05% Tween-20 (PBST). Post-blocking, the plates were incubated with 1 :50 dilution of either the preimmune or the immune serum samples obtained from mice immunized with the respective plasmid DNA. Antibodies bound tor-bmZP 1, r-dZP3 and r-rG were revealed with 1:2000 dilution of goat anti-mouse IgG (whole molecule) HRPO (Dako). Estimation of the enzymatic activity was carried out with 0.05% OPD in 50 mM citrate phosphate buffer, pH 5.0, containing 0.06% H202 as the substrate. The reaction was stopped with 50 Jll of 5 N H2S04 and the absorbance read at
    3. Enzyme Linked Immunosorbant Assay (ELISA)
    4. Inbred male BALB/c.T mice (6-8 week, Small Experimental Animal Facility, National Institute of Immunology, New Delhi, India) were immunized intramuscularly (i.m.) with 100 J.lg of respective plasmid DNA or VR1020 vector in 100 J.ll saline (0.9% NaCl) in the anterior tibialis muscle in the hind limbs (each receiving 50 J.ll). Two booster injections of 100 J.lg DNA in saline were given on day 21 and 35. On day 45, mice in each group received i.m. injection of E. coli expressed recombinant protein (20 J.lg/mouse in saline). Mice were anesthetized and bled retro-orbitally on days 0, 45 and 52 for analysis of respective antibody responses.
    5. Plasmid DNA administered in saline
    6. The proteins were purified by nickel affinity chromatography. The cell pellet ( ~ 1 g) of each clone was solubilized in 5 ml ofbuffer A (6 M guanidine hydrochloride, 0.1 M NaH2P04, 0.01 M Tris, pH 8.0). The suspension was centrifuged at 8000 X g for 15 min at 4°C and the supernatant containing the recombinant protein was mixed with Ni-NT A resin (Nickel-Nitrilotriacetic acid equilibrated with buffer A) and kept for gentle end-to-end shaking for 1 hat RT. The resin was loaded on a column and washed with 10 bed-volumes of buffer A. The column was subsequently washed with 5 bed-volumes each of buffers B, and C, which contained 8 M urea, 0.1 M NaH2P04 and 0.01 M Tris and had successively reducing pH values of 8.0 and 6.3 respectively. The protein was eluted with buffers D and E (composition same as buffer B) in which the pH was further reduced to 5.9 and 4.5 respectively. Five fractions of 4 ml each were collected during elution with buffer D and buffer E respectively. The eluted proteins were analysed by 0.1% SDS-1 0% PAGE (gels stained with Coomassie blue) and Western blot. The fractions showing the purified recombinant protein were pooled and concentrated in an Amicon concentrator using a YM30 membrane and dialyzed against 100 mM phosphate buffer, pH 7.4, containing 4 M urea. The concentration of each purified protein was estimated by bicinchoninic acid (BCA).
    7. Purification in denatured form
    8. incubations were carried out for I h at RT and each incubation was followed by three washings with PBS containing 0.1% Tween-20 (PBST). Post-blocking, the membranes were incubated with 1:1000 dilution ofMA-813 ascites (for detection ofr-bmZP1), MA-451 ascites (for detection of r-dZP3) or rabbit polyclonal anti-r-rG antibodies (for detection of r-rG), followed by an incubation with 1:5000 dilution of goat anti-mouse or goat anti-rabbit immunoglobulins conjugated to horseradish peroxidase (HRPO) (Pierce) respectively. The blots were developed with 0.6% (w/v) 4-chloro-1-naphthol in 50 mM PBS containing 25% methanol and 0.06% H202• The reaction was stopped by extensive washing with double distilled water
    9. The cells (2 - 4 x 1 06) transfected with plasmid DNA were resuspended in minimum volume of 2X sample buffer (0.0625 M Tris, pH 6.8, 2% SDS, 10% glycerol, 5% P-mercaptoethanol, and 0.001% bromophenol blue). The samples were boiled for 10 min and resolved on a 0.1% SDS-1 0% PAGE (Laemmli, 1970). The expression of recombinant proteins was analyzed by Western Blot. The proteins were electrophoretically transferred to 0.45 J.lm nitrocellulose membrane 0/N at a constant current of 30 rnA (milliampere) in Tris-Giycine buffer (25 mM of Tris-HCl and 200 mM glycine) containing 20% methanol (Towbin et al., 1979). Post-transfer, the membranes were washed once with PBS and non-specific sites were blocked with 3% BSA in PBS for 90 min at RT. All the subsequent
    10. Analysis of expressed recombinant protein by immunoblot
    11. COS-I cells were seeded at a density of 2.5 x 105 cells per well in a 6-well tissue culture plate and transfected with plasmid DNA essentially as described above. After 48 h incubation, cells Were trypsinized and counted in a hemocytometer. Cells ( ~ 1 06) were washed twice with PBS and fixed with 0.4% paraformaldehyde in PBS followed by all washings and incubations with respective primary and secondary antibodies in presence of 0.1% Saponin. Antibody concentrations used were same as in indirect immunofluorescence assay. After the final wash, cells were resuspended in PBS and samples were run on an Elite ESP flow cytometer (Coulter Electronics, Hialeh, FL, USA) and data analyzed using WinMDI (version 2.8) software. Cells stained with just secondary antibody were used to account for the background fluorescence. Cells tranfected with VR 1020 vector and probed with primary antibody were used as negative control.
    12. Analysis of mammalian cells, transfected in vitro with the plasmid DNA, by flow cytometry
    13. To investigate if the expressed protein was membrane bound or cytosolic, cells were fixed in 3. 7% paraformaldehyde followed by all washings and incubations with primary and secondary antibodies either in presence or absence of 0.1% Saponin and processed for indirect immunofluorescence as described above.
    14. Localization of the expressed recombinant protein in COS-1 cells
    15. albumin (BSA) in PBS for 2 hat 4°C. For detection of r-bmZPI, a murine monoclonal antibody (MAb), MA-813, generated against E. coli expressed r-bmZP1 (Govind et al., 2000), was used as the primary antibody. The cells were incubated with 1 :500 dilution of MA-813 ascites fluid for 2 hat 4°C. Cells were washed 5 times with PBS and incubated for 1 h with a 1:800 dilution of goat anti-mouse Ig-fluorescein isothiocyanate (FITC) conjugate (Sigma) at 4°C. After washing with PBS, coverslips with the cells were mounted in glycerol : PBS (9 : 1 ), and examined under an Optiphot fluorescent microscope (Nikon, Chiyoda-Ku, Tokyo, Japan). For detecting r-dZP3, MAb, MA-451 (1 :500 dilution of ascites fluid), generated against porcine ZP3f3 (a homologue of dZP3) and immunlogically cross-reactive with dZP3 (Santhanam et al., 1998) was used. For detecting r-rG, rabbit polyclonal antibodies (1:1000 dilution) against E. coli expressed r-rG, was used as primary antibody. The polyclonal antibody was provided by Dr. Sangeeta Choudhury, Project Associate, Gamete Antigen Laboratory, National Institute of Immunology, New Delhi. Goat anti-mouse immunoglobulins-FITC conjugate (1 :800) and goat anti-rabbit immunoglobulins-FITC conjugate (1 :2000; Pierce) were used for detecting anti-dZP3 and anti-rG antibodies respectively
    16. Initial standardization of transfection conditions was done using VRbmZPl plasmid DNA and COS-I mammalian cell line. In brief, cells were cultured in T-25 tissue culture flasks in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal calf serum (FCS) at 37°C with 5% C02. For subculturing, cells were trypsinized (0.5% trypsin + 0.2% EDTA in DMEM without FCS), centrifuged at 250 X g for 10 min, resuspended in DMEM supplemented with 10% FCS and aliquoted into T-25 flasks. For transfection, cells were seeded on coverslips in a 24-well tissue culture plate at a density of 5x 104 cells/well, a day prior to transfection. To standardize in vitro transfection conditions for optimum expression of bmZP1, varying amount of plasmid DNA was mixed with lipofectamine in DMEM devoid ofFCS (final reaction volume 200 f.!l) and incubated at RT for 45 min. The cells on the coverslips were washed twice with plain DMEM devoid of FCS. DNA-Iipofectamine complex was added dropwise to the cells and the plate incubated for 8 h at 3 7°C in humidified atmosphere of 5% C02• Subsequently, 1 ml of DMEM containing 10% FCS was added per well and cells allowed to grow for 48 h. After incubation, cells were processed for visualization of r-bmZPl by indirect immunofluorescence assay. Cells were washed twice with phosphate buffer saline (PBS; 50 mM Phosphate and 150 mM NaCI, pH 7.4), fixed in chilled methanol (-20°C) for 3 min and blocked with 3% bovine serum
    17. Detection of the expressed recombinant protein following i11 vitro transfection of mammalian cells with the plasmid DNA.
    18. 6000 X g for 15 min at 4°C. Plasmid DNA was purified from the pellet using QIAGEN DNA purification kit according to the manufacturer's instructions. The purified plasmid DNA (1.5 -2.0 mg/ml) was dissolved in autoclaved double distilled water and stored in aliquots (500 f.!l each) at -20°C until further use.
    19. A single colony of the respective clones was picked up from a freshly streaked LB + Kan (50 f.!g/ml) plate, inoculated into 5 ml of LB + Kan medium and incubated for 8 hat 37°C with vigorous shaking (-250 rpm). Subsequently, 500 fll of this primary culture was inoculated into 500 ml LB+ Kan and grown at 37°C 0/N. The culture was centrifuged at
    20. Purification of plasmid DNA in large amount
    21. N-VITRO TRANSFECTION OF MAMMALIAN CELLS WITH V ARlO US PLASMID DNA CONSTRUCTS AND CHARACTERIZATION OF EXPRESSED RECOMBINANT PROTEINS
    22. stranded DNA. The reaction was carried out at 37°C for 1 h. The reaction mixture contained 100 ng Bgl II digested VR1020 vector, SAP (0.5 U) and 1 fll lOX SAP buffer (20 mM Tris-HCl, pH 8.0, 10 mM MgCh) in 10 f.!l oftotal reaction volume. The reaction was stopped by inactivating the enzyme at 65°C for 15 min. The digested bmZP1 eDNA was ligated with SAP treated VR1 020 at vector : insert ratio of 1:10 in a 10 fll reaction volume for 16 h at l6°C. The reaction mixture contained 10 ng VR1020 vector, 26 ng bmZPl insert, 1 fll lOX ligase quffer (30 mM Tris-HCl, pH 7.8, 10 mM MgCh, 10 mM DTT and 1 mM ATP), lfll T4 DNA ligase (20 U) in a total reaction volume of 10 fll. The ligation product was used for transformation of DH5a competent cells as described previously. Transformants were selected on LB plates containing 50 f.!g/ml Kanamycin (Kan). Similarly, the inserts corresponding to dZP3, rG and dZP3-rG fusion were digested with Bgl II restriction enzyme, gel purified and cloned in VR1020 vector, except that the ligation product of dZP3-rG fusion with VR1020 was transformed into JM109 competent cells
    23. The insert corresponding to bmZP1 was released from the pPCR-Script-bmZPl clone by Bgl II restriction and purified on the agarose gel. VR1020 vector was similarly digested and gel purified. To prevent self-ligation, the digested vector was treated with Shrimp Alkaline Phosphatase (SAP), which removes 5'-phosphate from the termini of double
    24. Cloning in VRl 020 mammalian expression vector