Preparation of electrocompetent cells (E. coli cells) A protocol was employed. The procedure was carried out in cold under sterile conditions as follows: •A single colony of E. coli DH10B/ DH5α/XL1blue was inoculated in 20 mL of LB medium and grown overnight at 30 °C. •500 mL LB medium was inoculated with 5mL of this overnight grown culture of the E. coli and incubated with vigorous shaking (250 rpm) at 30 °C until an A600of 0.5 - 0.8 was achieved. •The cells were chilled in ice for 10-15 min and transferred to prechilled Sorvall® centrifuge tubes and sedimented at 4,000 rpm for 20 min at 4 °C. •The supernatant was decanted and cells were resuspended in 500 mL of sterile ice-cold water, mixed well and centrifuged as described above. •The washing of the cells described above was repeated with 250 mL of sterile ice-cold water, following which cells were washed with 40 mL of ice-cold 10 % (v/v) glycerol and centrifuged at 4,000 rpm for 10 min. •The glycerol solution was decanted and the cell volume was recorded. The cells were resuspended in an equal volume of ice-cold 10 % glycerol. •Cells were then dispensed in 40 μL volumes and stored at -80 °C until required.

Electrotransformation

Assay for cell viability by propidium iodide dye exclusion method

a buffered protein solution in the form of a droplet in contact with the precipitant through the vapor phase. The precipitant slowly causes dehydration to occur in the protein droplet increasing the effective concentration of the protein. The hanging drop crystallization experiment is set up in 24 well tissue culture plates, with the drop of protein solution containing 50% of the precipitant in the mother liquor suspended over the precipitant solution from a siliconized cover slip. This setup is sealed with silicon grease to facilitate controlled vapor diffusion between the well and the drop. For setting up hanging drop crystallization, a pure preparation of Fab molecules in the crystallization buffer (50 mM Na-cacodylate pH 6.7, 0.05% sodium azide or 50mM Tris-Cl pH 7.1, 0.05% sodium azide) was concentrated to a final concentration of 10 mg/ml. For the antibody-peptide complexes, 50-fold molar excess of the peptide was added to the Fab solution. Hanging drops of 8 Jll volume containing 4 111 of the Fab so:ution and 4 111 of varying concentrations of the precipitant were set up in 24-well tissue culture plates (Nunc, Denmark). Initially, a variety of precipitants were used in the crystallization experiments. Conditions which gave indications of crystal formation were then further explored to improve the quality of the crystals. The crystallization plates were maintained at room temperature in insulated conditions so as to prevent rapid changes in temperature. For crystallization of BBE6.12H3Fab-peptide complexes, the crystallization plates were also maintained at 8°C in vibration free incubator (RUMED, Rubarth Apparate, GmbH, Germany). The plates were checked for the presence of crystals every two weeks.

One of the most widely utilized methodologies of crystallization is hanging drop vapor diffusion technique (Wlodawer and Hodgson, 1975). The setup involves

Crystallization

For purification, the His6-bZP3 fusion protein was expressed in SG 13009[pREP4] and BL2I (DE3) strains transformed with the pQE-bZP3 plasmid. Expression was scaled up to a 2000 ml (250 ml X 8) batch flask culture. Cells were pelleted down at 4,000 g for 20 min at 4oc and stored at -7ooc till used. The cell pellet (I g/5 ml) was solubilized in buffer A (6 M Guanidine hydrochloride, O.I M NaH2P04, O.OI M Tris, pH 8.0). The suspension was centrifuged at I 0,000 g for I5 min at 4°C and the supernatant containing the r-fusion protein was mixed with gentle end to end shaking for 1 hat RT with the Ni-NT A resin (Qiagen GmbH). The resin was loaded on a column and washed with I_O volumes of buffer A. The column was subsequently washed with 5 volumes each of buffers B and C which contained 8 M Urea, 0.1 M NaH2P04 and 0.01 M Tris and had successively reducing pH values of 8 and 6.3. The recombinant fusion protein was eluted with buffers D and E in which the pH was further reduced to 5.9 and 4.5 respectively. The eluted protein was concentrated in an Amicon concentrator using a YM5 membrane and then dialyzed against I 00 mM phosphate buffer pH 7.4 having 4 M urea. The purified protein was quantitated with bicinchoninic acid. Twenty milligrams of r-bZP3 was conjugated to 13 mg of diphtheria toxoid (DT; Serum Institute, Pune, India) or 19 mg of tetanus toxoid (TT) using a modification of the "one step" glutaraldehyde coupling procedure (Avrameas, 1969). Conjugation was done in I 00 mM phosphate buffer, pH 7.4 with 4 M urea using O.I% glutaraldehyde, 0/N at RT with gentle end to end mixing. Unreacted sites were blocked with 100 mM lysine for 3 h at RT. The conjugate was dialyzed against 10 mM PBS having 0.3 M urea.

Purification and Conjugation

E. coli DH5a cells were grown overnight (0/N) in LB at 37oc and subcultured in 100 ml of fresh LB. The culture was maintained at 37°C with shaking till absorbance at 600 nm (A6oO) reached 0.3. The culture was chilled and centrifuged at 4,500 rpm iil a Sorvall SS34 rotor for .15 min. Cells were resuspended in 50 ml of freshly prepared sterile ice cold CaCl2 (100 mM) solution and incubated on ice for 1 h. Cells were pelleted at 2,500 rpm and very gently resuspended in I 0 ml of chilled 100 mM CaCl2 having 15% glycerol. 200 Jll of competent cells were aliquoted into sterile, chilled 1.5 rn1 tubes and stored at -7ooc. The ligation mix was added to competent cells thawed on ice, tubes were gently mixed and incubated on ice for 1 h. Cells were subjected to a heat shock at 42oc for 90 sec and then revived in 1 ml of LB at 37°C for 1 h with gentle shaking. Aliquots were plated on LB plates containing the appropriate antibiotics and incubated at 37oc 0/N.

Preparation of Competent Cells and Transformation

Routinely, with sterile double 0.2 - 1 ug DNA was made up to 18 ul distilled water in an autoclaved eppendorf tube. 2 ul of 10 X buffer and 2 - 5 unitp of restriction endonuclease were added. The reaction components were mixed well and incubated in a 37°C water bath for 1 - 2 hours. The digestion reaction was terminated by the addition of 2 ul of 10 X tracking dye ( 0.25 % xylene cyanol, 0.25 % bromophenol blue, 0.1 M EDTA, pH 8.0, and 50 % glycerol followed by brief vortexing to mix, after which the sample was loaded on to the gel.

Water was added and the mixture was concentrated under reduced pressure to afford 89; ESMS (mlz): 604.1 (M-Hr.

ixture was stirred under argon atmosphere for 2 days.

were diluted with ice cold water. The mixture was extracted with CH2CI2. The organic layer was thoroughly washed with water, dried over Na2S04 and concentrated to yield 84. 2,3,4,6-Tetra-O-acetyl-a-L-manno-di-O-benzyl phosphate (86). Compound 84 (50 mg, 0.128 mmol) was dissolved in anhydrous CH3CN saturated with dimethylamine (5 ml ) at -20 DC and stirred for 3h after which TlC confirmed the disappearance of starting material. Excess of dimethylamine was removed under reduced pressure at 30 DC and the reaction mixture was concentrated to afford 2,3,4,6-tetra-O-acetyl-a-l-mannose (85). To a stirred solution of compound 85 and 1 H-tetrazole (9.5 mg, 0.138 mmol) in anhydrous CH2CI2 (400 Ill) was added dibenzyl-N,N'-diisopropyl phosphoramidite (56.5 Ill, 59.4 mg, 0.172 mmol) and the mixture was stirred under argon atmosphere for 2 h at rt. Subsequently, the reaction mixture was cooled to-40 DC and m-CPBA (40 mg, 0.23 mmol) was added and stirring was continued for another 30 minutes at rt. The reaction was quenched by the addition of a solution of saturated bicarbonate. The mixture was extracted with CH2CI2. The organic phase was thoroughly washed with water, dried over Na2S04 and concentrated to afford 86, which was purified by running a silica coated preparative TlC plate; Rf = 0.16 in 50% ethyl acetate in hexane; 1H NMR: 8 3.9-4.22 (m, 4H), 5.02-5.06 (m, 4H), 5.21-5.28 (m, 2H), 5.59 (1 H, dd, JHP = 6.3 Hz, JHH = 1.8 Hz, H-1); 13C NMR: 8 20.49, 20.60, 61.68,65.19,68.14,68.68,69.75,69.92,70.31, 95.09, 127.89-128.72, 169.43; 31p NMR 8 -3.2; ESMS (mlz): 631.2 (M+Nat. a-L-mannosyl phosphate (88). To a solution of 86 (25 mg, 0.04 mmol) in CH30H (1 ml) was added palladium on charcoal (10%, 200 mg) and formic acid (100 Ill). The mixture was stirred at 50 DC for 3 h to afford compound 87. The catalyst was filtered off and the solvent was evaporated. The residue was taken in a mixture of CH30H:H20:triethylamine (5:3:2, 1.6 ml) and stirred for 2 days at rt. The reaction mixture was concentrated and the residue was repeatedly lyophilized to yield 88; ESMS (mlz): 259.19 (M-H)". Guanosine 5'-diphospho-a-L-mannose ( mono triethylamine salt) 89. A mixture of 4-morpholine-N,N'-dicyclohexylcarboxaminidium guanosine 5'-monophospho morpholidate (56 mg, 0.071 mmol) and 88 (16 mg, 0.034 mmol) was coevaporated with dry pyridine (3x500 Ill). 1 H-tetrazole (10 mg, 0.137 mmol) and dry pyridine (1.2 ml) were added and the m

Penta-O-acetyl-a-L-Mannose (84): To a solution of l-mannose (30 mg, 0.16 mmol) in pyridine (300 Ill) was added acetic anhydride (500 Ill) at 0 °C. The flask was left at 4 °C for 12 h. The mixture was then stirred at rt for 1 h, following which the contents

Synthesis of L-Mannose analogue of GOP Mannose (Scheme 18 of Results and Discussion)

(1 ml) was added palladium on charcoal (10%, 176 mg) and formic acid (100 Ill). The mixture was stirred at 50°C for 3h after which the catalyst was filtered off and the solvent was evaporated. The residue was taken in a mixture of CH30H:water:triethylamine (5:3:2, 1.6 ml) and stirred for 2 days at rt. The reaction mixture was concentrated and the residue was repeatedly lyophilized to yield 82; ESMS (mlz): 387.34 (M-H)'. Guanosine 5'-diphospho-6-deoxy-6-fluoro-a-D-mannose (mono-triethylamine salt) 83. Mixture of 4-morpholine-N,N'-dicyclohexylcarboxaminidium guanosine 5'-monophosphomorpholidate (43 mg, 0.054 mmol ) and 82 (16 mg, 0.034 mmol) was coevaporated with dry pyridine (3 x 500 Ill). 1 H-tetrazole (8 mg, 0.108 mmol ) and dry pyridine (1 ml) were added and the mixture was stirred under argon atmosphere for 2 days. Water was added and the mixture was concentrated under reduced pressure to yield 83; ESMS (mlz): 606.11 (M-Hr.

solution of compound 80 and 1 H-tetrazole (7 mg, 0.102 mmol) in anhydrous CH2CI2 was added dibenzyl-N,N'-diisopropylphosphoramidite (42 Ill, 43.8 mg, 0.127 mmol) and the mixture was stirred under argon atmosphere for 2 h at rt. Subsequently, the reaction mixture was cooled to -40°C and m-CPBA (30 mg, 0.17 mmol) was added and stirring was continued for another 30 minutes at rt. The reaction was quenched by the addition of a solution of saturated sodium bicarbonate. The mixture was extracted with CH2CI2. The organic phase was thoroughly washed with water, dried over Na2S04 and concentrated to afford 81, which was purified by running a silica coated preparative TlC plate; R, = 0.12 (twice run in 30% ethyl acetate in hexane); 1H NMR: characterstic () 5.6 (1 H, dd, JHP = 6.3 Hz and JHH = 1.8 Hz); 13C NMR: () 20.50, 20.53, 20.60, 64.75, 68.11, 68.58, 69.86, 70.67, 70.93, 81.87, 95.01, 128-128.72, 169.38, 169.50, 169.67; 31 P NMR () -3.11; ESMS (m/z): 591.34 (M+Nat. 6-Deoxy-6-fluoro-a-D-mannosyl phosphate (82). To a solution of 81 (20 mg, 0.035 mmol) in CH30H

Methyl-S-deoxy-S-difluoro-a-D-mannopyranoside (78). DAST (134 Ill, 1 mmol) was added with stirring at -40 °c, to a suspension of methyl-a-D-mannopyranoside S2 (200 mg, 1 mmol) in anhydrous CH2Cb (4 ml). The mixture was stirred at -40 °c for another 30 minutes and then at rt for 3h. After cooling to -20°C, the excess of reagent was destroyed by addition of CH30H (600 Ill) and sodium bicarbonate (200 mg). The cooling bath was removed, and the mixture was filtered once effervescence ceased. The filtrate was concentrated and purified by silica column chromatography (3% CH30H in CH2CI2) to yield 78; Rf = 0.21 in 12.5% CH30H in CH2CI2• 1 ,2,3,4-Tetra-O-acetyl-S-deoxy-S-fluoro-a-D-mannopyranoside (79). To compound 78 (100 mg, 0.51 mmol) was added 2% sulfuric acid solution in acetic anhydride (1.2 ml). The mixture was stirred at rt for 90 minutes. The contents were diluted with saturated sodium bicarbonate solution. The mixture was extracted with ethyl acetate. The organic phase was thoroughly washed with water, dried over Na2S04and concentrated to afford 79; Rf = 0.35 in 50% ethyl acetate in hexane. 2,3,4-Tri-O-acetyl-S-deoxY-S-fluoro-a-D-manno-di-O-benzyl phosphate (81). Compound 79 ( 30 mg, 0.085 mmol) was dissolved in anhydrous acetonitrile saturated with dimethylamine (5 ml ) at -20°C and stirred for 3 h after which TlC confirmed the disappearance of starting material. Excess of dimethylamine was removed under reduced pressure at 30°C and the reaction mixture was concentrated to afford 2,3,4-tri-O-acetyl-6-deoxY-6-floro-a-D-mannopyranoside (80). To a stirred

Synthesis of [6-Deoxy-6-fluoro]-GDP Mannose95 (Scheme 17 of Results and Discussion)

mixture was concentrated and the residue was repeatedly lyophilized to yield 7S; ESMS (mlz): 263.1 (M-Hr. Guanosine 5'-diphospho-4,S-di-deoxy-4,S-difluoro-a-D-talose mono triethyl amine salt) 77. A mixture of 4-morpholine-N,N'-dicyclohexylcarboxaminidium guanosine 5'-monophosphomorpholidate (27 mg, 34.4 Ilmol) and 7S (10 mg, 21.5 Ilmol) was coevaporated with anhydrous pyridine (3 x 500 Ill). 1 H-tetrazole (5 mg, 68.7 Ilmol) and anhydrous pyridine (1 ml) were added and the mixture was stirred under argon atmosphere for 2 days. Water was added and the mixture was concentrated under reduced pressure to afford 77; ESMS (mlz): 608.3 (M-Hr.

6 Hz), 4.85 (1H, s); 13C NMR 853.28,65.12 (15 Hz, C3), 67.3 (24 Hz, C5), 69.72 (C2), 81.1 (JCF = 168 Hz, C4), 89.9 (JCF = 171 Hz, C4), 101.47 (C1). 1 ,2,3-Tri-O-acetyl-4,6-di-deoxy-4,6-difluoro-a-D-talopyranoside (73). To compound 72 (100 mg, 0.543 mmol) was added 2% sulfuric acid solution in acetic anhydride (1.2 ml). The mixture was stirred at rt for 90 minutes. The contents were diluted with saturated sodium bicarbonate solution. The mixture was extracted with ethyl acetate. The organic phase was thoroughly washed with water, dried over sodium sulfate and concentrated to afford 73. 2,3-Di-O-acetyl-4,6-di-deoxY-4,6-difluoro-a-D-talo-di-O-benzyl phosphate (75) : Compound 73 ( 70 mg, 0.225 mmol) was dissolved in anhydrous CH3CN saturated with dimethylamine (5 ml ) at -20°C and stirred for 3h after which TlC confirmed the disappearance of starting material. Excess of dimethylamine was removed under reduced pressure at 30°C and the reaction mixture was concentrated to afford 2,3, di-O-acetyl-4,6-di-deoxy-4,6-difloro-a-D-talopyranoside (74). To a stirred solution of compound 74 and 1 H-tetrazole (21 mg, 0.3 mmol) in anhydrous CH2CI2 (400 Ill) was added dibenzyl-N,N-diisopropylphosphoramidite (99.4 Ill, 104.3 mg, 0.3 mmol) and the mixture was stirred under argon atmosphere for 2 h at rt. Subsequently, the reaction mixture was cooled to -40°C and m-CPBA (87 mg, 0.504 mmol) was added and stirring was continued for another 30 minutes at rt. The reaction was quenched by the addition of a solution of saturated sodium bicarbonate. The mixture was extracted with CH2CI2. The organic phase was thoroughly washed with water, dried over Na2S04 and concentrated to afford 75, which was purified by running a silica coated preparative TlC plate; Rf = 0.24 (50% ethyl acetate in hexane); 1H NMR characterstic ¢ 5.67 (1 H, dd, J = 6.3 Hz and 1.8 Hz, H-1); 13C NMR: ~ 20.5-20.6 (OAc), 64.77, 64.99, 66.28, 66.43, 69.9 (24 Hz, C5), 79.96 (JCF = 169 Hz, JCH = 7.1 Hz, C6), 84.08 (JCF= 180, JCH = 5.4 Hz, C4), 95.68,126.85-128.7,169.50,169.77; 31p NMR 8 -3.03; ESMS (mlz): 551.2 (M+Nat. 4,6-Di-deoxy-4,6-difluoro-a-D-talosyl phosphate (76). To a solution of 75 (30 mg, 0.056 mmol) in CH30H (1 ml) was added palladium on charcoal (10%, 280 mg) and formic acid (100 Ill). The mixture was stirred at 50°C for 3h. The catalyst was filtered off and the solvent was evaporated. The residue was taken in a mixture of CH30H:water:triethylamine (5:3:2, 1.6 ml) and stirred for 2 days at rt. The reaction

Methyl-4,6-di-deoxy-4,6-difluoro-a-D-talopyranoside (72). DAST (750 j.!L, 5.6 mmol) was added with stirring at -40 °c, to a suspension of methyl-a-D-mannopyranoside 62 (200 mg, 1 mmol) in anhyd CH2CI2 (4 mL). The mixture was stirred at -40 °c for another 30 minutes and then at rt for 3 h. After cooling to -200C, the excess of reagent was destroyed by addition of CH30H (600 j.!L) and sodium bicarbonate (200 mg). The cooling bath was removed, and the mixture was filtered once effervescence ceased. The filtrate was concentrated, loaded onto a silica column and eluted out with CH2CI2 to yield 72; Rf= 0.7 in 12.5% CH30H in CH2CI2; 1H NMR (CDCI3) 83.40 (3H, s, OCH3), 4.19 (1 H, m), 4.52 (1 H, d, 6 Hz), 4.68 (1 H, d,

Synthesis of [4,6-Dideoxy-4,6-difluoro]-GDP Talose (Scheme 16 of Results and Discussion)

(34 mg, 0.198 mmol) was added and stirring was continued for another 30 minutes at rt. The reaction was quenched by the addition of a solution of saturated bicarbonate. The mixture was extracted with CH2CI2. The organic phase was thoroughly washed with water, dried over Na2S04 and concentrated to afford 69, which was purified by running a silica coated preparative TLC plate; Rf = 0.23 in 50% ethyl acetate in hexane; 1H NMR characterstic.8 5.72 (1 H, dd, JHP = 6.9 Hz, JHH = 1.8 Hz, H-1), 5.83 (1 H, t, JHF = 53.4 Hz, H-6); 31p NMR 8 -2.81; ESMS (mlz): 753.36 (M+Nat. 6-Deoxy-6,6-difluoro-a-D-mannosyl phosphate (70). To a solution of 69 (25 mg, 0.034 mmol) in CH30H (1 mL) was added palladium on charcoal (10%, 170 mg) and formic acid (100 j.!L). The mixture was stirred at 50°C overnight. The catalyst was removed by passing the mixture through a pad of celite. A few drops of triethylamine were added and the solution was stirred for 15 minutes. The solvent was evaporated and the product was repeatedly lyophilized to afford 70; ESMS (mlz): 279.22 (M-H)". Guanosine 5'-diphospho-6-deoxy-6,6-difluoro-a-D-mannose (mono-triethyl amine salt) 71. A mixture of 4-morpholine-N,N'-dicyclohexylcarboxaminidium guanosine 5'-monophosphomorpholidate (29 mg, 0.037 mmol) and 70 (11 mg, 0.023 mmol) was coevaporated with dry pyridine (3 x 200 j.!L). 1 H-tetrazole (5.5 mg, 0.074 mmol) and anhydrous pyridine (900 j.!L) were added and the mixture was stirred under argon atmosphere for 2 days. Water was added and the mixture was concentrated under reduced pressure to afford 71; ESMS (mlz): 624.15 (M-H)"

Methyl-6-deoxy-6,6-difluoro-2,3,4-tri-O-benzyl-a-D-mannopyranoside (66). A solution of oxalyl chloride (54.62 mg, 37.6 Ill, 0.43 mmol) in anhydrous CH2CI2 (15 ml) was cooled to -78°C and DMSO (67.2 mg, 62 Ill, 0.86 mmol) was added dropwise, followed by the addition of a solution of 65 (500 mg, 1.07 mmol) in CH2CI2 (5 ml) over a period of 5 minutes. The mixture was stirred for another 30 minutes and then triethylamine (1.2 ml) was added. The solution was brought to room temperature, water was added and the mixture was extracted with CH2CI2. The organic layer was dried over Na2S04 to give the intermediate aldehyde. A solution of DAST (112.8 mg, 92.5 Ill, 0.7 mmol) in anhydrous CH2CI2 (1.5 ml) was cooled to -78°C. To this was added a solution of the aldehyde (325 mg, 0.7mmol) in anhydrous CH2CI2 (1.5 ml) dropwise. The mixture was stirred at rt for 90 minutes. After cooling to -20°C, excess of reagent was destroyed by the addition of CH30H and sodium bicarbonate. The mixture was filtered once effervescence ceased. The filtrate was concentrated and the residue was purified by silica column chromatography (5% ethyl acetate in hexane) to afford 66; Rt = 0.34 in 25% ethyl acetate in hexane; 1H NMR characterstic 8 5.97 (1 H, t, JHF = 52.6 Hz, H-6); 19F NMR &-132.65 (dd, J = 57 and 10.9 Hz), -132.90 (d

d, J = 57 and 16.4 Hz); ESMS (mlz): 507.2 (M+Nat. Acetyl-2,3,4-tri-O-benzyl-6-deoxY-6,6-difluoro-a-D-mannopyranoside (67). To compound 66 (70 mg, 0.144 mmol) was added 1 % sulfuric acid solution in acetic anhydride (1 ml). The mixture was stirred at rt for 1 h. The contents were diluted with saturated sodium bicarbonate solution. The mixture was extracted with ethyl acetate. The organic phase was thoroughly washed with water, dried over Na2S04 and concentrated to afford 67 which was purified by silica column chromatography (5% ethyl acetate in hexane); Rt = 0.34 (30% ethyl acetate in hexane). 2,3,4-Tri-O-benzyl-6-deoxy-6,6-difluoro-a-D-manno-di-O-benzyI phosphate (69). Compound 67 (50 mg, 0.105 mmol) was dissolved in anhydrous CH3CN saturated with dimethylamine (5 ml) at -20°C and stirred for 3h after which TlC confirmed the disappearance of starting material. Excess of dimethylamine was removed under reduced pressure at 30°C and the reaction mixture was concentrated to afford 2,3,4-tri-O-benzyl-6,6-difluoro-a-D-mannopyranoside (68). To a stirred solution of compound 68 (46 mg, 0.097 mmol) and 1 H-tetrazole (8.5 mg, 0.118 mmol) in anhydrous CH2CI2 (400 Ill) was added dibenzyl-N,N-diisopropylphosphoramidite (39 Ill, 40.9 mg, 0.118 mmoL) and the mixture was stirred under argon atmosphere for 2 h at rt. Subsequently, the reaction mixture was cooled to -40 °C and m-CPBA

Methyl-6-0-(triphenylmethyl)-a-D-rnannopyranoside (63). Methyl-a-D-manno pyranoside (62, 5g, 25.7 mmol) was dissolved in DMF (17 mL). Trityl chloride (7.9 g, 28.3 mmol), DMAP (515 mg, 2.06 mmol) and triethylamine (3.9 mL, 28.3 mmol) were added, and the mixture was stirred at room temperature overnight. The reaction mixture was concentrated and the residue was purified by silica column chromatography (5% CH30H in CH2CI2) to give 63 (8 g, 71.4%); R, = 0.14 in 5% CH30H in CH2CI2; ESMS (mlz): 459 (M+Nat. Methyl 2,3,4-tri-O-benzyl-6-0-(triphenylmethyl)-a-D-mannopyranoside (64). Compound 63 (5.8 g, 13.3 mmol) was dissolved in DMF (80 mL), followed by addition of sodium hydride (60% dispersion, 2.12 g, 53.2 mmol) and benzyl bromide (6.3 mL, 53.2 mmol) dropwise at 0 °C. The reaction mixture was stirred overnight at rt and the excess of sodium hydride was destroyed by addition of CH30H and water. The mixture was extracted with CH2CI2. The organic phase was washed thoroughly with saturated NaHC03 solution and water, dried over Na2S04 and concentrated to give 64; R,= 0.45 in 20% ethyl acetate in hexane; 1H NMR: 83.25 (dd, 1 H, H-2), 3.39 (s, 3H), 3.7-4.0 (m, 5H), 4.29-4.82 (7H, m, 3 x PhCH2 and H-1), 6.9-7.54 (m, 30H, Ph). Methyl 2,3,4-tri-O-benzyl-a-D-mannopyranoside (65). To a solution of compound 64 (1 g, 1.415 mmol) in CH2CI2 : CH30H (1 :2, 9 mL) was added p-toluene sulfonic acid (14 mg) and the mixture was stirred at rt for 2 h. Excess of acid was neutralized by the addition of triethylamine. The mixture was concentrated and purified by silica column chromatography (40% ethyl acetate in hexane) to yield 65 (4.5 g, 72.5%); R, = 0.13 in 30% ethyl acetate in hexane; 1H NMR: 8 3.29 (s, 3H, OMe), 3.61-3.96 (m, 5H), 3.93 (dd, J = 9 and 7.5 Hz, 1 H, H-3), 4.69 (d, J = 3 Hz, H-1), 4.63-4.95 (m, 6H, 3 x Ph CH2) , 7.25-7.34 (m, 15H, Ph); 13C NMR: 8 54.68, 62.34, 71.95, 72.89, 74.67, 74.79,75.10,80.13,99.27,127.50-128.30; ESMS (mlz): 487.3 (M+Nat.

Synthesis of [6-0eoxy-6,6-difluoro]-GOP Mannose94 (Scheme 15 of Results and Discussion)

Synthesis of GOP Mannose analogues

COS-I cells were seeded at a density of 2.5 x 105 cells per well in a 6-well tissue culture plate and transfected with plasmid DNA essentially as described above. After 48 h incubation, cells Were trypsinized and counted in a hemocytometer. Cells ( ~ 1 06) were washed twice with PBS and fixed with 0.4% paraformaldehyde in PBS followed by all washings and incubations with respective primary and secondary antibodies in presence of 0.1% Saponin. Antibody concentrations used were same as in indirect immunofluorescence assay. After the final wash, cells were resuspended in PBS and samples were run on an Elite ESP flow cytometer (Coulter Electronics, Hialeh, FL, USA) and data analyzed using WinMDI (version 2.8) software. Cells stained with just secondary antibody were used to account for the background fluorescence. Cells tranfected with VR 1020 vector and probed with primary antibody were used as negative control.

Analysis of mammalian cells, transfected in vitro with the plasmid DNA, by flow cytometry

mm followed by the addition of forward and reverse primers and another round of amplification for 35 cycles involving denaturation at 94°C for 1 min, annealing at 55°C for 2 min and extension at 72°C for 2 min followed by a final extension at noc for 15 min. Rest of the PCR conditions were same as described for bmZPl.

The general strategy to assemble by PCR the eDNA encoding dZP3-rG fusion protein is schematically shown in Fig. 1. Two rounds ofPCR were carried out to assemble the dZP3-rG eDNA. Jn the first round, eDNA corresponding to dZP3 encompassing part of the N-terminal segment of rG and rG eDNA encompassing part of the C-terminal segment of dZP3 were PCR amplified using pQE30-dZP3 and pQE30-rG plasmids respectively as templates. The eDNA corresponding to dZP3 was PCR amplified using forward primer 5 '-GAAGATCTCAGACCATCTGGCCAACT-3' having Bgl II site and reverse primer 5'-CGTGTAAATAGGGAATTTAGTGTGGGAAACAGACTT-3', containing 12 nucleotides from the N-terminal end of rG eDNA at the 3 'end of the primer, using an annealing temperature of 49°C. The eDNA corresponding to rG was PCR amplified using forward primer 5'-AAGTCTGTTTCCCACACTAAATTCCCTATTTACACG-3' containing 12 nucleotides from the C-terminal end of dZP3 eDNA at the 5 'end of the primer and reverse primer 5'-GAAGATCTTTACCCCCAGTTCGGGAG-3' having Bgl II site using an annealing temperature of 45°C. The amplified fragments of dZP3 eDNA containing a part of N-terminal end of rG eDNA at its 3'end and rG eDNA containing a part of C-terminal end of dZP3 eDNA at its 5' end were gel purified and used as templates for the next round of PCR employing forward primer of dZP3 eDNA and reverse primer of rG eDNA to obtain amplified fusion product of dZP3 followed by rG eDNA ( dZP3-rG). The templates were denatured at 94 oc for 10 min. Initial amplification was carried out for 2 cycles of denaturation at 94°C for 2 min, annealing at 51 oc for 2 min and extension at 72°C for 2

Assembly of eDNA encoding dZP3-rG fusion protein by PCR

54Primer NameGenome Co-ordinatesSequence (5’-3’)Brk_RE_FchrX:7200547-7200702AAACCTCTGTGTTCGTCTGGCBrk_RE_RTCCGTAGAAACCGCGCAACBrk_RC_FchrX:7200789-7200926CCGATGTGGAAGGGGTATGGBrk_RC_RGGCTCTGCCAGTTGCTCATAC15_RE_Fchr3R:17325974-17326067GCCAAAATGTCCAGCCACGAC15_RE_RTGACATCCGCGAGTCCGAC15_RC_Fchr3R:17325763-17325861CCGTAGACCGTAATCCGTGAAC15_RC_RCCGCGAAGCACACACTAATCTable 2.4. | Primer sequences to determine DpnII digestion efficiency. Digestion efficiency was calculated using the following formula (Hagège et al., 2007):Digestion Efficiency %= 100-1002CtRE-CtRCDigested-CtRE-CtRCUndigestedSequencing Library Preparation:Prior to preparation of sequencing libraries, 5-6μg 3C libraries were sonicated using a S220 Focussed Ultrasonicator (Covaris) aiming for a peak size of 200bp. Libraries were sonicated with the following settings: Duty Cycle: 10%, Intensity: 5, Cycles per burst: 200 and Mode set as Frequency Sweeping with 6 cycles each of 60s. Following sonication, samples underwent clean-up using AMPure XP SPRI beads (Beckmann Coulter), with sonication quality assessed using a TapeStation 2200 (Agilent). Sequencing libraries were prepared using the NEBNext DNA Prep Reagent set and the NEBNext Multiplex Oligos for Illumina (NEB), following the manufacturers instructions with the following modifications. Firstly, AMPure bead clean up steps were performed x1.8 volume to avoid skewing for larger fragments. Secondly, library PCR amplification was performed using Herculase II Fusion DNA Polymerase kit (Agilent) to a total of 50μl using: 1x Herculase II Buffer, 250μM dNTPs, 0.5μM of both the NEB Universal and NEB Index Primer, and Units Herculase II Polymerase. Libraries were assessed after adaptor ligation and post indexing PCR on a TapeStation 2200 (Agilent)

until 2-4h AEL. Collected embryos were dechorionated in cold 50% Bleach (Sodium Hydrochlorate) for 3mins and rinsed thoroughly in cold dH20 and cold Triton-NaCl (previously described). The subsequent steps for both cross-linking and nuclei isolation were based on a ChIP protocol for Drosophilaembryos (Sandmann et al., 2006).Covalent Cross-linking: Collected embryos were blotted dry then rinsed in 100% isopropanol, to remove the excess water. Covalent cross-linking was performed using 2% methanol-free formaldehyde (ThermoFisher Scientific) for 20mins with 50% Heptane and Cross-linking Buffer (1mM EDTA, 0.5mM EGTA, 50mM HEPES pH 8.0, 100mM NaCl) and quenched using 125mM Glycine in 1x PBS, 0.1% Triton X-100 for 1min. Embryos were subsequently washed in 1x PBS, 0.1% Triton X-100, flash frozen andthen stored at -80°C. Replicates were obtained through collections of two independent sets of cages.Isolating Nuclei: 1.2 ml of embryos were resuspended in cold 1x PBS with 0.1% Triton X-100 and dounced 5 times in 4ml aliquots in a 7ml Wheaton Dounce Homogenizer. The homogenate was centrifuged at 400g for 1min at 4°C and transferred to a new tube and centrifuged at 1100g for 10mins at 4°C. The cell pellet was resuspended in 5ml of cold cell lysis buffer (85mM KCl, 0.5% (v/v) IGEPAL CA-630, 5mM HEPES pH 8.0, 1mM PMSF and 1x Protease and Phosphatase inhibitors (Roche)) and dounced 20 times. Nuclei were pelleted by centrifugation at 2000g for 4min at 4°C. 3C Library Preparation: Preparation of Capture-C libraries were performed according to the Next-Generation (NG) Capture-C Protocol (Davies et al., 2015). Briefly, nuclei were resuspended to a total volume of 650μl and digested overnight at 37°C whilst agitating at 1400rpm on an Eppendorf Thermomixer. Digestion was performed using 1500 Units DpnII (NEB High Concentration 50,000 U/ml), 1x NEBuffer DpnII, 0.25% SDS and 1.65% Triton X-100, including a non-digested control. Digested 3C libraries were ligated using 240 Units T4 DNA HC Ligase (ThermoFisher Scientific) and 1x Ligation Buffer overnight at 16°C whilst agitating. Following ligation, all 3C libraries including controls were de-crosslinked overnight at 65°C with 3 Units Proteinase K (ThermoFisher Scientific). Ligated 3C libraries were digested with 15μg/μl RNAse (Roche) and DNA subsequently extracted with phenol-chloroform followed by ethanol precipitation. Digestion efficiency: Digestion efficiency was determined using primers pairs designed against DpnII digestion sites and genomic controls at two independent regions comparing the digested and undigested controls for both replicates. Efficiency was determined through qPCR on a StepOnePlus Real-Time PCR System (ThermoFisher Scientific) using the SYBR Select Master Mix (ThermoFisher Scientific) as per the manufacturers instructions. Primers used to determine restriction efficiency are shown in Table 2.4

Embryo Collection: Embryo collections were carried out as described above with the following modifications. Prior to collections, plates from the first 2hrs were discarded to prevent inclusion of older embryonic stages. After pre-clearing, collections were carried out as above with ageing

Capture-C

was observed by the formation of a clear zone of hydrolysis around the bacterial/fungal colony. Tannase production, in terms of the diameter of the zone of hydrolysis around the colony, was measured (in mm) after 24 (bacteria) and 48 hours (fungi) of incubation. The diameter of the hydrolytic zone was measured at three points and the average was calculated. The microorganisms showing a zone of tannic acid hydrolysis were considered as tannase producers. The potent tannase producers were further tested quantitatively for the amount of enzyme produced in broth.

The procedure of Bradoo et al. (1996), involving point inoculation of the microorganisms on tannic acid agar plates was followed. The plates were incubated at 37 and 30±1°C for bacterial and fungal isolates. The presence of tannase activity

Qualitative screening for tannase producer/s

vii.RNA buffer II from Ambion(1-2X Xylene cyanol + Bromophenol blue)used for loading the samples. RNA isolation for Northern blotting for lacZtranscript was done aftergrowing cultures till A600of 0.6 in LB in the presence or absence of 1mM IPTG at 30oC while for lacZ-lacYʹ-tRNA(U73)Arg5or lacZʹ-tRNA(U73)Arg5transcripts, cultures were grown in LBupto A600of 0.3 and induced with 1mM IPTG for 30 min followed by RNA extraction.30ml of 10% polyacrylamide gels of 1.5mm thickness were cast in the Broviga slab vertical gel electrophoresis apparatus. Gels were polymerizedby the addition of TEMED and APS (1/100th volume of gel mix). The gel was pre-runat 300V for 15-20 minutes prior to loading.Sample preparation for gel loading was done as follows. The normalizedamounts of RNA samplesto be analyzed were mixed with the equal volumes of 2X gel loadingbuffer II(Ambion)making a final concentration of 1X. The samples were then heated at 80 degrees in a thermoblock (eppendorf) for 10 minutes and loaded on the gel when still warm. The gel was run at constant voltage of 300Vfor 3-4 hours till xylene cynol covered 2/3rddistance

The following solutions were used to cast and run denaturing PAGE gels:i.40% acrylamidestock solution ii.7.5M Ureaiii.5X TBEiv.Ammonium persulphate (APS) stock: 10% (w/v) solution made fresh v.TEMED (N,N,N′, N′-tetramethyl ethylene diamine) vi.Gel running buffer (0.5X TBE)

Denaturing polyacrylamide gel electrophoresis of RNA

C. LBON temperature-sensitivityStrains were streaked on LBON agar plates and after an overnight incubation at42°C, growth was monitored (compared to that on LBON at 30°C as control). Absence of single colony growth was taken to reflect temperature sensitivity. D. In vivotranscription termination phenotypes The rationale for each phenotype is described in the relevant section. SMG-sensitivityThe E. coli relA mutants exhibit SMG-sensitive (SMGs) phenotype,that is,growth-inhibition in the presence of serine, methionine and glycine at 1mM concentration each(Uzan & Danchin, 1978)and is proposed to be a consequence of transcriptional polarity exerted by a frameshift mutation in the ilvG gene on the expression of downstream genes of the ilvGMEDA operon(Lopes & Lawther, 1989).This test was therefore used to distinguish relA+from relA−strains. Growth in the presence of amino acids serine, methionine, and glycine (SMG) was scored on glucose-minimal A plates supplemented with each of the amino acids at 40μg/ml and compared with the growth on non-supplemented glucose-minimal A plates to score for SMG phenotype. galEp3assayThis assay was used to test for relief of transcriptional polarity in the rho and nusG mutants. The galEp3 (galE490*) mutation represents a 1.3kb IS2 insertion in the gal leader region (between the promoter and structural genes of the galETKM operon). The mutation causes transcriptional polarity on the structural genes due to Rho-dependent transcription termination within IS2. In this assay, the gal operon expression in a galEp3 mutant or its derivatives was monitored by usingMacConkey galactose indicator plates (with 1% galactose), where Gal+colonies are red, and Gal−colonies are white. Therefore, the depth of color serves as an indicator of relative levels of gal expression, i.e., the extent of transcriptional polarity relief

A.lacZphenotype lacZ+colonies were distinguished from lacZ–colonies on X-gal containing plate or MacConkey lactose plate. X-gal is non-inducing colourless substrate of β-galactosidase enzyme which upon hydrolysis yields dark blue indolyl group and hence the lacZ+colonies on X-gal plate appear as dark blue colonies. Similarly, on the MacConkey agar plateslacZ+colonies appear dark pink whereas lacZ–colonies remain colourless. B. UV-sensitivityTo check the UV-sensitivity of the strains qualitatively, the strains were streaked on duplicate LB-agar plates and one of the plates was UV-irradiatedwith a 15-W UV-germicidal lamp at a distance of 70cm for 30 seconds. The UV-exposed and unexposed plates were incubated overnight in the dark after wrapping with aluminium foil and then growth was scored. This test could differentiate a recA–strain (UVs) from a recA+strain (UVr)

Scoring for Phenotypes