Reviewer #2 (Public review):

Summary:

This manuscript by Peters, Rakateli et al. aims to characterize the contribution of miR-26b in a mouse model of metabolic dysfunction-associated steatohepatitis (MASH) generated by Western-type diet on background of Apoe knock-out. In addition, the authors provide a rescue of the miR-26b using lipid nanoparticles (LNPs), with potential therapeutic implications. In addition, the authors provide useful insights on the role of macrophages and some validation of the effect of miR-26b LNPs on human liver samples.

Strengths:

The authors provide a well designed mouse model, that aims to characterize the role of miR-26b in a mouse model of metabolic dysfunction-associated steatohepatitis (MASH) generated by Western-type diet on background of Apoe knock-out. The rescue of the phenotypes associated with the model used using miR-26b using lipid nanoparticles (LNPs) provides an interesting avenue to novel potential therapeutic avenues.

Weaknesses:

Although the authors provide a new and interesting avenue to understand the role of miR-26b in MASH, the study needs some additional validations and mechanistic insights in order to strengthen the authors' conclusions.

(1) Analysis the expression of miRNAs based on miRNA-seq of human samples (see https://ccb-compute.cs.uni-saarland.de/isomirdb/mirnas) suggests that miR-26b-5p is highly abundant both on liver and blood. It seems hard to reconcile that despite miRNA abundance being similar on both tissues, the physiological effects claimed by the authors in Figure 2 come exclusively from the myeloid (macrophages).

- Thanks for the clarification provided on your revised version of the manuscript

(2) Similarly, the miRNA-seq expression from isomirdb suggests also that expression of miR-26a-5p is indeed 4-fold higher than miR-26b-5p both in liver and blood. Since both miRNAs share the same seed sequence, and most of the supplemental regions (only 2 nt difference), their endogenous targets must be highly overlapped. It would be interesting to know whether deletion of miR-26b is somehow compensated by increased expression of miR-26a-5p loci. That would suggest that the model is rather a depletion of miR-26.

UUCAAGUAAUUCAGGAUAGGU mmu-miR-26b-5p mature miRNA<br /> UUCAAGUAAUCCAGGAUAGGCU mmu-miR-26a-5p mature miRNA

- Thanks for the clarification provided. Nevertheless, I would note that measurements of the host transcript can be difficult to interpret. The processing of the hairpin by Drosha results in rapid decay of the reaming of the non-hairpin part, usually yielding very low expression levels. The mature levels of miR-26a-5p could be more accurate.

(3) Similarly, the miRNA-seq expression from isomirdb suggests also that expression of miR-26b-5p is indeed 50-fold higher than miR-26b-3p in liver and blood. This difference in abundance of the two strands are usually regarded as one of them being the guide strand (in this case the 5p) and the other being the passenger (in this case the 3p). In some cases, passenger strands can be a byproduct of miRNA biogenesis, thus the rescue experiments using LNPs with both strands on equimolar amounts would not reflect the physiological abundance miR-26b-3p. The non-physiological over abundance of miR-26b-3p would constitute a source of undesired off-targets.

- I agree with the authors that the functional data doesn't show evidence of undesired off-targets. Nevertheless, I would consider that for future studies. miRNA-phenotypes can be subtle in normal conditions and become more obvious on stressed conditions, the same might apply to off-target effects.

(4) It would also be valuable to check the miRNA levels on the liver upon LNP treatment, or at least the signatures of miR-26b-3p and miR-26b-5p activity using RNA-seq on the RNA samples already collected.

- Thanks for providing the miRNA quantification on the revised version of the manuscript.

(5) Some of the phenotypes described, such as the increase in cholesterol, overlap with the previous publication van der Vorst et al. BMC Genom Data (2021), despite in this case the authors are doing their model in Apoe knock-out and Western-type diet. I would encourage the authors to investigate more or discuss why the initial phenotypes don't become more obvious despite the stressors added in the current manuscript.

- Thanks for the clarification provided on your revised version of the manuscript.

(6) The authors have focused part of their analysis on a few gene markers that show relatively modest changes. Deeper characterization using RNA-seq might reveal other genes that are more profoundly impacted by miR-26 depletion. It would strengthen the conclusions proposed if the authors validated that changes on mRNA abundance (Sra, Cd36) do impact the protein abundance. These relatively small changes or trends in mRNA expression, might not translate into changes in protein abundance.

- Thanks for addressing this concern raised by R1 and R2.

(7) In figures 5 and 7, the authors run a phosphorylation array (STK) to analyze the changes in the activity of the kinome. It seems that a relatively big number of signaling pathways are being altered, I think that should be strengthened by further validations by Western blot on the collected tissue samples. For quite a few of the kinases there might be antibodies that recognise phosphorylation. The two figures lack a mechanistic connection to the rest of the manuscript.

- I appreciate the clarification provided by the authors regarding the difference between the activity assay and a Western blot for phosphorylated proteins. Is there any orthogonal technique to validate the PamGene activity assay available?

Comments on revised version:

The authors have addressed most of the changes suggested by R1 and R2.

Reviewer #2 (Public review):

Summary:

Bos and colleagues address the important question of how two major inhibitory interneuron classes in the neocortex differentially affect cortical dynamics. They address this question by studying Wilson-Cowan-type mathematical models. Using a linearized fixed point approach, and subsequent simulations of neural circuits operating in the dynamic stochastically-driven regime, they provide compelling evidence that the existence of multiple interneuron classes can explain the counterintuitive finding that inhibitory modulation can increase the gain of the excitatory cell population while also increasing the stability of the circuit's state to minor perturbations. This effect depends on the connection strengths within their circuit model, providing important guidance as to when and why it arises.

Overall, I find this study to have substantial merit. The authors have also done a commendable job of revising the paper in light of the critiques raised by myself and the other reviewers.

Strengths:

(1) The thorough investigation of how changes in the connectivity structure affect the gain-stability relationship is a major strength of this work. It provides an opportunity to understand when and why gain and stability will or will not both increase together. It also provides a nice bridge to the experimental literature, where different gain-stability relationships are reported from different studies.

(2) The simplified and abstracted mathematical model has the benefit of facilitating our understanding of this puzzling phenomenon. It is not easy to find the right balance between biologically-detailed models vs simple but mathematically tractable ones, and I think the authors struck an excellent balance in this study.

(3) While the fixed-point analysis has potentially substantial limitations for understanding cortical computations away from the steady-state, the authors used simulations to verify that their main findings hold in the stochastically-driven regime that more closely reflects the dynamics observed in in vivo neuroscience experiments.

Weaknesses:

(1) As the authors note in their Discussion, it would be worthwhile to study this effect in chaotic and/or oscillatory regimes, in addition to the ones they included here. I agree with their assessment that those investigations should be left for a future study.

(2) The analysis is limited to paths within this simple E,PV,SOM circuit. This misses more extended paths (like thalamocortical loops) that involve interactions between multiple brain areas. Including those paths in the expansion in Eqs. 11-14 (Fig. 1C) may be an important direction for future work.

Reviewer #2 (Public review):

Summary:

This study investigates the effect of fed vs hungry state on food decision making.

70 participants performed a computerized food choice task with eye tracking. Food images came from a validated set with variability in food attributes. Foods ranged from low caloric density unprocessed (fruits) to high caloric density processed foods (chips and cookies).

Prior to the choice task participants rated images for taste, health, wanting, and calories. In the choice task participants simply selected one of two foods. They were told to pick the one they preferred. Screens consisted of two food pictures along with their "Nutri-Score". They were told that one preferred food would be available for consumption at the end.

A drift-diffusion model (DDM) was fit to the reaction time values. Eye tracking was used to measure dwell time on each part of the monitor.

Findings: participants tended to select the item they had rated as "tastier", however, health also contributed to decisions.

Strengths:

The most interesting and innovative aspect of the paper is the use of the DDM models to infer from reaction time and choice the relative weight of the attributes.

Were the ratings re-done at each session? E.g. were all tastiness ratings for the sated session made while sated? This is relevant as one would expect the ratings of tastiness and wanting to be affected by current fed state.

Weaknesses:

My main criticism, which doesn't affect the underlying results, is that the labeling of food choices as being taste- or health-driven is misleading. Participants were not cued to select health vs taste. Studies in which people were cued to select for taste vs health exist (and are cited here). Also, the label "healthy" is misleading, as here it seems to be strongly related to caloric density. A high-calorie food is not intrinsically unhealthy (even if people rate it as such). The suggestion that hunger impairs making healthy decisions is not quite the correct interpretation of the results here (even though everyone knows it to be true). Another interpretation is that hungry people in negative calorie balance simply prefer more calories.

Comments on revisions: No further comments - all my questions addressed.

Reviewer #2 (Public Review):

• A summary of what the authors were trying to achieve<br /> Drawing from theoretical insights on the pivotal role of mossy cells (MCs) in pattern separation - a key process in distinguishing between similar memories or inputs - the authors investigated how MCs in the dentate gyrus of the hippocampus encode and process complex neural information. By recording from up to five MCs simultaneously, they focused on membrane potential dynamics linked to sharp wave-ripple complexes (SWRs) originating from the CA3 area. Indeed, using a machine learning approach, they were able to demonstrate that even a single MC's synaptic input can predict a significant portion (approximately 9%) of SWRs, and extrapolation suggested that synaptic input obtained from 27 MCs could account for 90% of the SWR patterns observed. The study further illuminates how individual MCs contribute to a distributed but highly specific encoding system. It demonstrates that SWR clusters associated with one MC seldom overlap with those of another, illustrating a precise and distributed encoding strategy across the MC network.

• An account of the major strengths and weaknesses of the methods and results<br /> Strengths:<br /> (1) This study is remarkable because it establishes a critical link between the subthreshold activities of individual neurons and the collective dynamics of neuronal populations.<br /> (2) The authors utilize machine learning to bridge these levels of neuronal activity. They skillfully demonstrate the predictive power of membrane potential fluctuations for neuronal events at the population level and offer new insights into neuronal information processing.<br /> (3) To investigate sharp wave/ripple-related synaptic activity in mossy cells (MCs), the authors performed challenging experiments using whole-cell current-clamp recordings. These recordings were obtained from up to five neurons in vitro and from single mossy cells in live mice. The latter recordings are particularly valuable as they add to the limited published data on synaptic input to MCs during in vivo ripples.

Weaknesses:<br /> (1) The model description could significantly benefit from additional details regarding its architecture, training, and evaluation processes. Providing these details would enhance the paper's transparency, facilitate replication, and strengthen the overall scientific contribution. For further details, please see below.<br /> (2) The study recognizes the concept of pattern separation, a central process in hippocampal physiology for discriminating between similar inputs to form distinct memories. The authors refer to a theoretical paper by Myers and Scharfman (2011) that links pattern separation with activity backpropagating from CA3 to mossy cells. Despite this initial citation, the concept is not discussed again in the context of the new findings. Given the significant role of MCs in the dentate gyrus, where pattern separation is thought to occur, it would be valuable to understand the authors' perspective on how their findings might relate to or contribute to existing theories of pattern separation. Could the observed functions of MCs elucidated in this study provide new insights into their contribution to processes underlying pattern separation?<br /> (3) Previous work concluded that sharp waves are associated with mossy cell inhibition, as evidenced by a consistent ripple function-related hyperpolarization of the membrane potential in these neurons when recorded at resting membrane potential (Henze & Buzsáki, 2007). In contrast, the present study reveals an SWR-induced depolarization of the membrane potential. Can the authors explain the observed modulation of the membrane potential during CA1 ripples in more detail? What was the proportion of cases of depolarization or hyperpolarization? What were the respective amplitude distributions? Were there cases of activation of the MCs, i.e., spiking associated with the ripple? This more comprehensive information would add significance to the study as it is not currently available in the literature.<br /> (4) In the study, the observation that mossy cells (MCs) in the lower (infrapyramidal) blade of the dentate gyrus (DG) show higher predictability in SWR patterns is both intriguing and notable. This finding, however, appears to be mentioned without subsequent in-depth exploration or discussion. One wonders if this observed predictability might be influenced by potential disruptions or severed connections inherent to the brain slice preparation method used. Furthermore, it prompts the question of whether similar observations or trends have been noted in MCs recorded in vivo, which could either corroborate or challenge this intriguing in vitro finding.<br /> (5) The study's comparison of SWR predictability by mossy cells (MCs) is complicated by using different recording sites: CA3 for in vitro and CA1 for in vivo experiments, as shown in Fig. 2. Since CA1-SWRs can also arise from regions other than CA3 (see e.g. Oliva et al., 2016, Yamamoto and Tonegawa, 2017), it is difficult to reconcile in vitro and in vivo results. Addressing this difference and its implications for MC predictability in the results discussion would strengthen the study.

• An appraisal of whether the authors achieved their aims, and whether the results support their conclusions<br /> As outlined in the abstract and introduction, the primary aim is to investigate the role of MCs in encoding neuronal information during sharp wave ripple complexes, a crucial neuronal process involved in memory consolidation and information transmission in the hippocampus. It is clear from the comprehensive details in this study that the authors have meticulously pursued their goals by providing extensive experimental evidence and utilizing innovative machine learning techniques to investigate the encoding of information in the hippocampus by mossy cells (MCs). Together, this study provides a compelling account supported by rigorous experimental and analytical methods. Linking subthreshold membrane potentials and population activity by machine learning provides a comprehensive new analytic approach and sheds new light on the role of MCs in information processing in the hippocampus. The study not only achieves the stated goals, but also provides novel methodology, and valuable insights into the dynamics of neural coding and information flow in the hippocampus.

• A discussion of the likely impact of the work on the field, and the utility of the methods and data to the community<br /> Impact: Both the novel methodology and the provided biological insights will be of great interest to the community.<br /> Utility of methods/data: The applied deep learning approach will be of particular interest if the authors provide more details to improve its reproducibility (see related suggestions below).

Reviewer #2 (Public review):

In their manuscript, Rijal and colleagues describe a 'loop grafting' strategy to enhance expression levels and stability of recombinant neuraminidase. The work is interesting and important, but there are several points that need the author's attention.

Major points

(1) The authors overstress the importance of the epitopes covered by the loops they use and play down the importance of antibodies binding to the side, the edges, or the underside of the NA. A number of papers describing those mAbs are also not included.

(2) The rationale regarding the PR8 hybrid is not well described and should be described better.

(3) Figure 3B and 6C: This should be given as numbers (quantified), not as '+'.

(4) Figure 5A and 7A: Negative controls are missing.

(5) The authors claim that they generate stable tetramers. Judging from SDS-PAGE provided in Supplementary Figure 3B (BS3-crosslined), many different species are present including monomers, dimers, tetramers, and degradation products of tetramers. In line 7 for example there are at least 5 bands.

Reviewer #2 (Public review):

This manuscript by Wu, Liao et al. reports that simultaneous knockdown of P27Kip1 with overexpression of Cyclin D can stimulate Muller glia to re-enter the cell cycle in the mouse retina. There is intense interest in reprogramming mammalian muller glia into a source for neurogenic progenitors, in the hopes that these cells could be a source for neuronal replacement in neurodegenerative diseases. Previous work in the field has shown ways in which mouse Muller glia can be neurogenically reprogrammed and these studies have shown cell cycle re-entry prior to neurogenesis. In other works, typically, the extent of glial proliferation is limited, and the authors of this study highlight the importance of stimulating large numbers of Muller glia to re-enter the cell cycle with the hopes they will differentiate into neurons.

The authors have satisfactorily responded to all my previous reviewer comments. The authors have significantly improved their imaging quality in Figure 1 and 4. The authors have admirably re-considered their FISH and scRNA-seq data and performed critical control experiments. They now provide a more nuanced interpretation of their data by removing reference to MG-inducing rod genes which is now interpreted as ambient contamination. Taken together, this manuscript now provides strong evidence of a viral way to induce large numbers of MG to re-enter the cell cycle without a damage stimulus.

Reviewer #2 (Public review):

Summary:

In this manuscript, Kaplan et al. study mesenchymal Meis2 in whisker formation and the links between whisker formation and sensory innervation. To this end, they used conditional deletion of Meis2 using the Wnt1 driver. Whisker development was arrested at the placode induction stage in Meis2 conditional knockouts leading to absence of expression of placodal genes such as Edar, Lef1, and Shh. The authors also show that branching of trigeminal nerves innervating whisker follicles was severely affected but that whiskers did form in the complete absence of trigeminal nerves.

Strengths:

The analysis of Meis2 conditional knockouts shows convincingly lack of whisker formation and all epithelial whisker/hair placode markers analyzed. Using Neurog1 knockout mice, the authors show that whiskers and teeth develop in the complete absence of trigeminal nerves.

Comments on revised version:

In the revised manuscript, Kaplan et al. have addressed some of my previous concerns, e.g., the methodological section has been updated to include the relevant information, and the Introduction now better considers the previous literature.

In the revised manuscript, the authors have made limited efforts to address the main criticism of my original review: lack of mechanistic insight as to why mesenchymal Meis2 leads to the absence of whisker placodes. The new data reported indicate that the lack of whisker placodes is not a mere delay. In this context, the authors also show one images of E18.5 snouts that includes developing hair follicles. Interestingly, the image shown seems to indicate that hair follicles do develop normally in the absence of mesenchymal Meis2 although this finding is not reported in any detail or quantified. The authors suggest that this could be due to an early role of Meis2 in the mesenchyme because HFs develop later. Indeed, one plausible possibility is that Meis2 does not have any direct role in whisker (or hair) follicle development but is specifically required for some other function in the whisker pad mesenchyme, a function that remains unidentified in the current study as it mainly focuses on analyzing hair follicle marker expression in whisker follicles. I think this should be better reflected in the Discussion.

Additional comments:

The revised manuscript included the quantification of Lef1 intensity in control and Meis2 cKO whisker follicles (lines 251-252 and 255-258). Maybe I missed, but I failed to find the information how the quantification of the intensities was made, and therefore it was not possible for me to evaluate this part of the data. Nevertheless, I think the main text is not the place for these quantifications; rather, they would better fit e.g. Suppl. Figure 4.

Reviewer #2 (Public Review):

Summary:

In this study, Karashchuk et al. develop a hierarchical control system to control the legs of a dynamic model of the fly. They intend to demonstrate that temporal delays in sensorimotor processing can destabilize walking and that the fly's nervous system may be operating with as long of delays as could possibly be corrected for.

Strengths:

Overall, the approach the authors take is impressive. Their model is trained using a huge dataset of animal data, which is a strength. Their model was not trained to reproduce animal responses to perturbations, but it successfully rejects small perturbations and continues to operate stably. Their results are consistent with the literature, that sensorimotor delays destabilize movements.

Weaknesses:

The model is sophisticated and interesting, but the reviewer has great concerns regarding this manuscript's contributions, as laid out in the abstract:

(1) Much simpler models can be used to show that delays in sensorimotor systems destabilize behavior (e.g., Bingham, Choi, and Ting 2011; Ashtiani, Sarvestani, and Badri-Sproewitz 2021), so why create this extremely complex system to test this idea? The complexity of the system obscures the results and leaves the reviewer wondering if the instability is due to the many, many moving parts within the model. The reviewer understands (and appreciates) that the authors tested the impact of the delay in a controlled way, which supports their conclusion. However, the reviewer thinks the authors did not use the most parsimonious model possible, and as such, leave many possible sources for other causes of instability.

(2) In a related way, the reviewer is not sure that the elements the authors introduced reflect the structure or function of the fly's nervous system. For example, optimal control is an active field of research and is behind the success of many-legged robots, but the reviewer is not sure what evidence exists that suggests the fly ventral nerve cord functions as an optimal controller. If this were bolstered with additional references, the reviewer would be less concerned.

(3) "The model generates realistic simulated walking that matches real fly walking kinematics...". The reviewer appreciates the difficulty in conducting this type of work, but the reviewer cannot conclude that the kinematics "match real fly walking kinematics". The range of motion of several joints is 30% too small compared to the animal (Figure 2B) and the reviewer finds the video comparisons unpersuasive. The reviewer would understand if there were additional constraints, e.g., the authors had designed a robot that physically could not complete the prescribed motions. However the reviewer cannot think of a reason why this simulation could not replicate the animal kinematics with arbitrary precision, if that is the goal.

Comments on revisions:

The authors have addressed the concerns and questions raised in the original review.

Reviewer #2 (Public review):

Trac, Huang, et al used the AZ Drug Combination Prediction DREAM challenge data to make a new random forest-based model for drug synergy. They make comparisons to the winning method and also show that their model has some predictive capacity for a completely different dataset. They highlight the ability of the model to be interpretable in terms of pathway and target interactions for synergistic effects.

In their revised manuscript, the authors attempt to address the points raised about a comparison to the full TAJI model and showing how molecular can be integrated into DIPx.

(1) Their argument that "Using only molecular data allows for more convenient and intuitive inference of pathway importance compared to integrating multiple data types" is unconvincing. It's not clear how adding a data source here confounds pathway inference. They need to add examples.<br /> (2) They have revised the method of calculating p-values instead of bootstrapping them, so the new numbers appear a lot more meaningful now.<br /> (3) The performance on the O'Neill dataset shows the limitations of their training regime and shows the limits of the model in terms of picking new drug combinations. I would argue that is the very definition of overfitting, not being able to model any combination it has never seen.

Reviewer #2 (Public review):

Summary:

The authors present an important study on identifying and comparing orthologous cell types across multiple species. This manuscript focuses on characterizing cell types in embryoid bodies (EBs) derived from induced pluripotent stem cells (iPSCs) of four primate species, humans, orangutans, cynomolgus macaques, and rhesus macaques, providing valuable insights into cross-species comparisons.

Strengths:

To achieve this, the authors developed a semi-automated computational pipeline that integrates classification and marker-based cluster annotation to identify orthologous cell types across primates. This study makes a significant contribution to the field by advancing cross-species cell type identification.

Weaknesses:

However, several critical points need to be addressed.

(1) Use of Liftoff for GTF Annotation

The authors used Liftoff to generate GTF files for Pongo abelii, Macaca fascicularis, and Macaca mulatta by transferring the hg38 annotation to the corresponding primate genomes. However, it is unclear why they did not use species-specific GTF files, as all these genomes have existing annotations. Why did the authors choose not to follow this approach?

(2) Transcript Filtering and Potential Biases

The authors excluded transcripts with partial mapping (<50%), low sequence identity (<50%), or excessive length differences (>100 bp and >2× length ratio). Such filtering may introduce biases in read alignment. Did the authors evaluate the impact of these filtering choices on alignment rates?

(3) Data Integration with Harmony

The methods section does not specify the parameters used for data integration with Harmony. Including these details would clarify how cross-species integration was performed.

Reviewer #3 (Public review):

In their study, Zhao et al. investigated the population activity of mirror neurons (MNs) in the premotor cortex of monkeys either executing or observing a task consisting of reaching to, grasping, and manipulating various objects. The authors proposed an innovative method for analyzing the population activity of MNs during both execution and observation trials. This method enabled to isolate the condition dependent variance in neural data and to study its temporal evolution over the course of single trials. The method proposed by the authors consists of building a time series of "instantaneous" subspaces with single time step resolution, rather than a single subspace spanning the entire task duration. As these subspaces are computed on an instant time basis, projecting neural activity from a given task time into them results in latent trajectories that capture condition-dependent variance while minimizing the condition-independent one. Authors then analyzed the time evolution of these instantaneous subspaces and revealed that a progressive shift is present in subspaces of both execution and observation trials, with slower shifts during the grasping and manipulating phases compared to the initial preparation phase. Finally, they compared the instantaneous subspaces between execution and observation trials and observed that neural population activity did not traverse the same subspaces in these two conditions. However, they showed that these distinct neural representations can be aligned with Canonical Correlation Analysis, indicating dynamic similarities of neural data when executing and observing the task. The authors speculated that such similarities might facilitate the nervous system's ability to recognize actions performed by oneself or another individual.

Unlike other areas of the brain, the analysis of neural population dynamics of premotor cortex MNs is not well established. Furthermore, analyzing population activity recorded during non-trivial motor actions, distinct from the commonly used reaching tasks, serves as a valuable contribution to computational neuroscience. This study holds particular significance as it bridges both domains, shedding light on the temporal evolution of the shift in neural states when executing and observing actions. The results are moderately robust, and the proposed analytical method could potentially be used in other neuroscience contexts.

Reviewer #2 (Public review):

Summary:

This study genetically identifies two key enzymes involved in the biosynthesis of glycosphingolipids, GlcT and Egh, which act as tumor suppressors in the adult fly gut. Detailed genetic analysis indicates that a deficiency in Mactosyl-ceramide (Mac-Cer) is causing tumor formation. Analysis of a Notch transcriptional reporter further indicates that the lack of Mac-Ser is associated with reduced Notch activity in the gut, but not in other tissues.

Addressing how a change in the lipid composition of the membranes might lead to defective Notch receptor activation, the authors studied the endocytic trafficking of Delta and claimed that internalized Delta appeared to accumulate faster into endosomes in the absence of Mac-Cer. Further analysis of Delta steady-state accumulation in fixed samples suggested a delay in the endosomal trafficking of Delta from Rab5+ to Rab7+ endosomes, which was interpreted to suggest that the inefficient, or delayed, recycling of Delta might cause a loss in Notch receptor activation.

Finally, the histological analysis of mouse guts following the conditional knock-out of the GlcT gene suggested that Mac-Cer might also be important for proper Notch signaling activity in that context.

Strengths:

The genetic analysis is of high quality. The finding that a Mac-Cer deficiency results in reduced Notch activity in the fly gut is important and fully convincing.

The mouse data, although preliminary, raised the possibility that the role of this specific lipid may be conserved across species.

Weaknesses:

This study is not, however, without caveats and several specific conclusions are not fully convincing.

First, the conclusion that GlcT is specifically required in Intestinal Stem Cells (ISCs) is not fully convincing for technical reasons: NRE-Gal4 may be less active in GlcT mutant cells, and the knock-down of GlcT using Dl-Gal4ts may not be restricted to ISCs given the perdurance of Gal4 and of its downstream RNAi.

Second, the results from the antibody uptake assays are not clear.: i) the levels of internalized Delta were not quantified in these experiments; ii) additionally, live guts were incubated with anti-Delta for 3hr. This long period of incubation indicated that the observed results may not necessarily reflect the dynamics of endocytosis of antibody-bound Delta, but might also inform about the distribution of intracellular Delta following the internalization of unbound anti-Delta. It would thus be interesting to examine the level of internalized Delta in experiments with shorter incubation time. Overall, the proposed working model needs to be solidified as important questions remain open, including: is the endo-lysosomal system, i.e. steady-state distribution of endo-lysosomal markers, affected by the Mac-Cer deficiency? Is the trafficking of Notch also affected by the Mac-Cer deficiency? is the rate of Delta endocytosis also affected by the Mac-Cer deficiency? are the levels of cell-surface Delta reduced upon the loss of Mac-Cer?

Third, while the mouse results are potentially interesting, they seem to be relatively preliminary, and future studies are needed to test whether the level of Notch receptor activation is reduced in this model.

Reviewer #2 (Public review):

Summary:

The authors present a transformer-based model, TrASPr, for the task of tissue-specific splicing prediction (with experiments primarily focused on the case of cassette exon inclusion) as well as an optimization framework (BOS) for the task of designing RNA sequences for desired splicing outcomes.

For the first task, the main methodological contribution is to train four transformer-based models on the 400bp regions surrounding each splice site, the rationale being that this is where most splicing regulatory information is. In contrast, previous work trained one model on a long genomic region. This new design should help the model capture more easily interactions between splice sites. It should also help in cases of very long introns, which are relatively common in the human genome.

TrASPr's performance is evaluated in comparison to previous models (SpliceAI, Pangolin, and SpliceTransformer) on numerous tasks including splicing predictions on GTEx tissues, ENCODE cell lines, RBP KD data, and mutagenesis data. The scope of these evaluations is ambitious; however, significant details on most of the analyses are missing, making it difficult to evaluate the strength of the evidence. Additionally, state-of-the-art models (SpliceAI and Pangolin) are reported to perform extremely poorly in some tasks, which is surprising in light of previous reports of their overall good prediction accuracy; the reasoning for this lack of performance compared to TrASPr is not explored.

In the second task, the authors combine Latent Space Bayesian Optimization (LSBO) with a Transformer-based variational autoencoder to optimize RNA sequences for a given splicing-related objective function. This method (BOS) appears to be a novel application of LSBO, with promising results on several computational evaluations and the potential to be impactful on sequence design for both splicing-related objectives and other tasks.

Strengths:

(1) A novel machine learning model for an important problem in RNA biology with excellent prediction accuracy.

(2) Instead of being based on a generic design as in previous work, the proposed model incorporates biological domain knowledge (that regulatory information is concentrated around splice sites). This way of using inductive bias can be important to future work on other sequence-based prediction tasks.

Weaknesses:

(1) Most of the analyses presented in the manuscript are described in broad strokes and are often confusing. As a result, it is difficult to assess the significance of the contribution.

(2) As more and more models are being proposed for splicing prediction (SpliceAI, Pangolin, SpliceTransformer, TrASPr), there is a need for establishing standard benchmarks, similar to those in computer vision (ImageNet). Without such benchmarks, it is exceedingly difficult to compare models. For instance, Pangolin was apparently trained on a different dataset (Cardoso-Moreira et al. 2019), and using a different processing pipeline (based on SpliSER) than the ones used in this submission. As a result, the inferior performance of Pangolin reported here could potentially be due to subtle distribution shifts. The authors should add a discussion of the differences in the training set, and whether they affect your comparisons (e.g., in Figure 2). They should also consider adding a table summarizing the various datasets used in their previous work for training and testing. Publishing their training and testing datasets in an easy-to-use format would be a fantastic contribution to the community, establishing a common benchmark to be used by others.

(3) Related to the previous point, as discussed in the manuscript, SpliceAI, and Pangolin are not designed to predict PSI of cassette exons. Instead, they assign a "splice site probability" to each nucleotide. Converting this to a PSI prediction is not obvious, and the method chosen by the authors (averaging the two probabilities (?)) is likely not optimal. It would interesting to see what happens if an MLP is used on top of the four predictions (or the outputs of the top layers) from SpliceAI/Pangolin. This could also indicate where the improvement in TrASPr comes from: is it because TrASPr combines information from all four splice sites? Also, consider fine-tuning Pangolin on cassette exons only (as you do for your model).

(4) L141, "TrASPr can handle cassette exons spanning a wide range of window sizes from 181 to 329,227 bases - thanks to its multi-transformer architecture." This is reported to be one of the primary advantages compared to existing models. Additional analysis should be included on how TrASPr performs across varying exon and intron sizes, with comparison to SpliceAI, etc.

(5) L171, "training it on cassette exons". This seems like an important point: previous models were trained mostly on constitutive exons, whereas here the model is trained specifically on cassette exons. This should be discussed in more detail.

(6) L214, ablations of individual features are missing.

(7) L230, "ENCODE cell lines", it is not clear why other tissues from GTEx were not included.

(8) L239, it is surprising that SpliceAI performs so badly, and might suggest a mistake in the analysis. Additional analysis and possible explanations should be provided to support these claims. Similarly, the complete failure of SpliceAI and Pangolin is shown in Figure 4d.

(9) BOS seems like a separate contribution that belongs in a separate publication. Instead, consider providing more details on TrASPr.

(10) The authors should consider evaluating BOS using Pangolin or SpliceTransformer as the oracle, in order to measure the contribution to the sequence generation task provided by BOS vs TrASPr.

Reviewer #2 (Public review):

Summary:

The manuscript titled "The ALS-associated co-chaperone DNAJC7 mediates neuroprotection against proteotoxic stress by modulating HSF1 activity" describes experiments carried out in iPS cells re-differentiated into motor neurons (iNeuons, MNs) seeking to assess the functions of the J protein DnaJC7 in proteostasis. This study also investigates how an ALS-associated mutant variant (R156X) alters DnaJC7 function.

The proteomic studies identify proteins interacting with DnaJC7. Using mRNA profiling in haplo-insufficient cells (+/R156X) compared to wild-type cells, the study seeks to identify pathways modulated by partial loss of DnaJC7 function. Studies in the DnaJC7 haplo-insufficient cells also indicate changes in the properties of ALS-associated proteins, such as HNRNPU and Matrin3 both of which are involved in the regulation of gene expression. The study also shows data indicating that DnaJC7 haploinsufficiency sensitizes cells to proteostatic stress induced by proteosome inhibition by MG132 and Hsp90 inhibition by Ganetespib. Lastly, the study investigates how DnaJC7 modulates the activity of the heat shock transcription factor (Hsf1) and thus the heat shock response.

Strengths:

The manuscript is well presented and most of the data is of high quality and convincing. The figures and supplementary figures are clear and easy to follow.

This study overall provides important new insights into a mostly underexplored molecular co-chaperone and its role in proteostasis. The proteomic and transcriptomic experiments certainly advance our understanding of DnaJC7. The MN model is well-suited for these studies addressing the role of DnaJC7, particularly regarding ALS. The haplo-insufficient MNs are also a suitable model to study a potential loss of function mechanism caused by (some) fALS-associated mutants in ALS, such as the R156X mutation used here.

Since so little is known about DnaJC7 function, the exploratory approaches applied here are particularly useful.

Weaknesses:

Without follow-up studies, however, e.g., with select interacting proteins, the study provides merely a descriptive list of possible interactions without mechanistic insights. Also, most interactions have not been extensively (only a few examples) validated by other methods or individual experiments.

A major limitation of the study in its current form is that none of the experimental approaches allow for assessing the specific functions of JC7. In the absence of specificity controls, e.g., other J proteins or HOP, which, like DnaJC7, contains TPR domains and can interact with Hsp70 and Hsp90, it remains unclear if the proposed functions of DnaJC7 are specific/unique or shared by other J proteins or molecular chaperones. Accordingly, it would be highly informative to add experiments to assess if some of the reported DnaJC7 protein-protein interactions and the transcriptional alterations in haplo-insufficient cells are DnaJC7specific or also occur with other J proteins or molecular chaperones. This seems particularly important to discern specific DnaJC7 functions from general effects caused by impaired proteostasis.

It would be informative to explore how cellular stress (e.g., MG132 treatment) alters DnaJC7 interactions with other proteins (J proteins, HOP), ideally in additional/comparative proteomic studies.<br /> The mechanism underlying the proposed regulation of Hsf1 by DnaJC7 is not quite clear to me (Figures 4 A-I). There is no evidence of a direct physical interaction between DnJC7 and Hsf1 in the proteomic data or elsewhere. It seems plausible that Hsf1/HSR dysregulation in the haplo-insufficient cells might be due to rather indirect effects, e.g., increased protein misfolding. Also, additional data showing differential activation of Hsf1 in +/+ versus +/- cells would strengthen this part, e.g. showing differences in Hsf1 trimerization, Hsp70 interactions, nuclear localization, etc.

The manuscript might also benefit from considering the literature showing an unusually inactive HSR and Hsf1 activity in motor neurons (e.g. published by the Durham lab).

The correlation with transcriptomic data from ALS patients compared to neurotypical controls (Figures 4 L, M) suggesting a direct role of Hsf1/HSR seems unlikely at this point. In my view, the transcriptional dysregulation in ALS patients could be unrelated to Hsf1 dysregulation and caused by rather non-specific effects of neuronal decay in ALS.

Reviewer #2 (Public review):

Summary:

The authors studied the effects of hot water extract, extraction residue, and non-extracted simple crush powder of ZSS in diseased or aged mice. It was found that ZSS played an anti-neurodegenerative role by removing toxic proteins, repairing damaged neurons, and inhibiting cell senescence.

Strengths:

The authors studied the effects of ZSS in different transgenic mice and analyzed the different states of ZSS and the effects of different components.

Weaknesses:

The authors' study lacked an in-depth exploration of mechanisms, including changes in intracellular signal transduction, drug targets, and drug toxicity detection.

Reviewer #2 (Public review):

This study developed a setup for laminar fMRI at 3T that aimed to get the best from all worlds in terms of brain coverage, temporal resolution, sensitivity to detect functional responses and spatial specificity. They used a gradient-echo EPI readout to facilitate sensitivity, brain coverage and temporal resolution. The former was additionally boosted by NORDIC denoising and the latter two were further supported by acceleration both in-plane and across slices. The authors evaluated whether the implementation of velocity-nulling (VN) gradients could mitigate macrovascular bias, known to hamper laminar specificity of gradient-echo BOLD.

Strengths:

The setup includes 0.9 mm isotropic acquisitions with large coverage at a reasonable TR. These parameters are hard to optimize simultaneously, and I applaud the ambitious attempt to get "the best from all worlds" (large coverage, high spatio/temporal resolution, spatial specificity, sensitivity), which is sought after in the field. Also, in terms of the availability of the method, it is favorable that it benefits from lower field strength (additional time for VN-gradient implementation, afforded by longer gray matter T2*). Furthermore, I like that the authors took steps to improve the original manuscript by e.g., collecting more data, adjusting the VN implementation to include flow-suppression along three rather than a single dimension, and adjusting the ROI-definition procedure to avoid circularity issues.

That being said, I still find the evidence weak in terms of this sequence achieving high spatial specificity and sensitivity. The results feel oversold and further validation is needed to make a case for the authors' conclusion that "[...] the potential impact of this development is expected to be extensive across various domains of neuroscience research". This is elaborated in the comments below:

The authors acknowledge that the VN setup in its current form probably does not suppress the impact of most ascending veins (these are also not targeted by phase regression, as most are probably too small to produce sufficiently large phase responses). This seems to limit the theoretical support for the author's claim of reduced inter-layer blurring (e.g. the claim that deep and superficial signals are less coupled with VN gradients than without based on Fig 6-7). This limitation withstanding, the method may still be helpful for limiting laminar dependencies by suppressing pial vein responses (which may carry signal from distant regions and layers that blur into superficial layers if left unsuppressed). Unfortunately, the empirical support of VN gradients suppressing superficial bias seems quite weak and is hard to evaluate. For example, the profiles in Figure 4 does not consistently show clearly less superficial bias when VN gradients are on - this might partly be due to the fact that clear bias was not always present in the profiles even without VN. I suspect this is largely explained by the selection of very small and quite unrepresentative ROIs. The corresponding activation maps appear strongly weighted towards CSF which is not always captured in the profile. I recommend sampling a much larger patch of cortex to more accurately capture the actual underlying bias. In this way, all non-VN profiles should have clear bias which should be clearly suppressed for VN if the method is effective. The authors do evaluate the effect of VN/phase regression based on a large activated region in visual cortex (Fig 5) - why not show laminar profiles from here, which is an obvious way to show the effect on superficial bias? I think such evaluations would be a more direct way of evaluating the methods impact on specificity, and are necessary for subsequent FC evaluations to be convincing.

The phase regression results are described inconsistently. In the results section, the authors, in my opinion, "correctly" acknowledge that phase regression seemed to have a very minor impact. However, in the discussion section it is described as if phase regression was effective in suppressing macrovascular responses (L 553-558), which the results do not support (especially based on profiles in Fig 4). There is barely any difference with/without phase regression, which may be due to the fact that ordinary least squares regression was chosen over a deming model which accounts for noise on the phase regressor. Although the authors correctly mentioned in their "answers to reviewers" that the required noise-ratio between magnitude and phase data can be hard to estimate, attempts of that has been described in previous phase regression studies which showed much larger effects (see e.g. Stanley et al. 2020, Knudsen et al. 2023).

I like that the authors put in additional efforts to provide analyses to validate their NORDIC implementation. However, this needs to be done on the VN setup directly, not the "regular BOLD setup" with b=0, since the ability of NORDIC to distinguish signal and noise components depends on CNR which is expected to deviate for these setups. Also, it seems z-scores and confidence intervals were computed based on GLM residuals which may lead to inflated z-values and overly narrow CI's due to reduced degrees of freedom following denoising. The denoised z-maps from Fig 3 indeed look somewhat strange, i.e. seemingly increased false positives (more salt/pepper and a bunch of white matter activation) with very weak hand knob activation. Also, something must be wrong with the CIs on the laminar profiles - they seem extremely narrow despite noise levels obviously being high for highly accelerated 3T submillimeter results extracted from a very small ROI. The authors may consider computing these statistics from variance across trials instead.

Given that the idea of the setup is to take advantage in terms of sensitivity by using GE-BOLD contrast relative to e.g. SE-EPI or CBV-weighted setups, they need to carefully demonstrate the sensitivity of their setup, which could be limited by high acceleration factors, the VN gradients, low field strength, etc. I like that they now put more emphasis on non-masked activation maps, but further comparison could be made through tSNR maps, raw single-volume images, raw timeseries, CNR based on across-trial variance, etc.

The major rationale for the setup is to achieve functional connectivity (FC) with brain-wide coverage at laminar resolutions, but it is framed as if this is something that has not been possible in the past with existing setups (statements such as: "Despite advancements in acquisition speed, current CBV/CBF-based fMRI techniques remain inadequate for layer-dependent resting-state fMRI" (L138-140). To me, the functional connectivity results presented here with the VN setup are clearly less convincing than what has been shown with e.g. CBV-weighted acquisitions (e.g. Huber et al. 2021, Chai et al. 2024). The VN setup might also have advantages such as larger coverage as mentioned by the authors, but they fail to balance the comparison by highlighting where previous studies had clear edges. Thus, the impact of the results needs to be down-stated and a more balanced comparison with existing laminar FC studies is warranted. For example, acknowledging that the CBV-weighted studies demonstrate much higher spatial specificity.

Overall I would recommend a stronger emphasis on validating the claims about the sequence on task-based data for which there is a large body of literature to benchmark against (e.g. laminar fMRI studies in V1 and M1), before going to FC where the base for comparison and reference is much more limited in humans at laminar scales.

Reviewer #2 (Public review):

Summary:

The study by Millard et al. investigates the effect of nicotine on alpha peak frequency and pain in a very elaborate experimental design. According to the statistical analysis, the authors found a factor-corrected significant effect for prolonged heat pain but not for alpha peak frequency in response to the nicotine treatment.

Strengths:

I very much like the study design and that the authors followed their research line by aiming to provide a complete picture of the pain-related cortical impact of alpha peak frequency. This is very important work, even in the absence of any statistical significance. I also appreciate the preregistration of the study and the well-written and balanced introduction.

Weaknesses:

The weakness of the study revolves around two aspects:

(1) Source separation (ICA or similar) would have been more appropriate than electrode ROIs to extract the alpha signal. By using a source separation approach, different sources of alpha (mu, occipital alpha, laterality) could be disentangled.

(2) There is also a suggestion in the literature in the manuscript) that nicotine treatment may not work as intended. Instead, the authors' decision to use nicotine to modulate peak alpha frequency and pain was based on other, inappropriate work on chronic pain and chronic smokers. In the present study, the authors use nicotine treatment and transient painful stimulation in nonsmokers. The unfortunate decision to use nicotine severely hampered the authors' goal of the study.

Impact: The impact of the study could be to show what did not work to answer the authors' research questions. The study would have more impact with a more appropriate pain intervention model and an analysis strategy that untangles the different alpha sources.

Reviewer #2 (Public review):

FOXP3 has been known to form diverse complexes with different transcription factors and enzymes responsible for epigenetic modifications, but how extracellular signals timely regulate FOXP3 complex dynamics remains to be fully understood. Histone H3K4 tri-methylation (H3K4me3) and CXXC finger protein 1 (CXXC1), which is required to regulate H3K4me3, also remain to be fully investigated in Treg cells. Here, Meng et al. performed a comprehensive analysis of H3K4me3 CUT&Tag assay on Treg cells and a comparison of the dataset with the FOXP3 ChIP-seq dataset revealed that FOXP3 could facilitate the regulation of target genes by promoting H3K4me3 deposition. Moreover, CXXC1-FOXP3 interaction is required for this regulation. They found that specific knockdown of Cxxc1 in Treg leads to spontaneous severe multi-organ inflammation in mice and that Cxxc1-deficient Treg exhibits enhanced activation and impaired suppression activity. In addition, they have also found that CXXC1 shares several binding sites with FOXP3 especially on Treg signature gene loci, which are necessary for maintaining homeostasis and identity of Treg cells.

Comments on revisions:

The authors have fully addressed the reviewers' comments and questions.

Reviewer #3 (Public review):

Summary:

In this manuscript Bohra et al. measure the effects of estrogen responsive gene expression upon induction on nearby target genes using a TAD containing the genes TFF1 and TFF3 as a model. The authors propose that there is a sort competition for transcriptional machinery between TFF1 (estrogen responsive) and TFF3 (not responsive) such that when TFF1 is activated and machinery is recruited, TFF3 is activated after a time delay. The authors attribute this time delay to transcriptional machinery that was being sequestered at TFF1 becomes available to the proximal TFF3 locus. The authors demonstrate that this activation is not dependent on contact with the TFF1 enhancer through deletion, instead they conclude that it is dependent on a phase-separated condensate which can sequester transcriptional machinery. Although the manuscript reports an interesting observation that there is a dose dependence and time delay on the expression of TFF1 relative to TFF3, there is much room for improvement in the analysis and reporting of the data. Most importantly there is no direct test of condensate formation at the locus in the context of this study: i.e. dissolution upon the enhancer deletion, decay in a temporal manner, and dependence of TFF1 expression on condensate formation. Using 1,6' hexanediol to draw conclusion on this matter is not adequate to draw conclusions on the effect of condensates on a specific genes activity given current knowledge on its non-specificity and multitude of indirect effects. Thus, in my opinion the major claim that this effect of a time delayed expression of TFF3 being dependent on condensates in not supported by the current data.

Strengths:

The depends of TFF1 expression on a single enhancer and the temporal delay in TFF3 is a very interesting finding.

The non-linear dependence of TFF1 and TTF3 expression on ER concentration is very interesting with potentially broader implications.

The combined use of smFISH, enhancer deletion, and 4C to build a coherent model is a good approach.

Weaknesses:

There is no direct observation of a condensate at the TFF1 and TFF3 locus and how this condensate changes over time after E2 treatment, upon enhancer deletion, whether transcriptional machinery is indeed concentrated within it, and other claims on condensate function and formation made in the manuscript. The use of 1,6' HD is not appropriate to test this idea given how broadly it acts.

Comments on latest version:

I don't think the response to Reviewer 2's comment on LLPS condensates on TFF1 are adequate and given this point is essential to the claims of the manuscript they must be addressed. Namely, the data from Saravavanan, 2020 actually suggest that condensate formation at the locus is not very predictive and barely enriched over random spots. The claims in the manuscript on the dependence of the condensate being responsible for sequestering transcriptional machinery are quite strong and the crux of the current model. To continue to make this claim (which I don't think is necessary since there are other possible models) the authors must test if the condensate at his locus (1) shows time dependent behavior, (2) is not present or weakened at the locus in cells that show high TFF3 expression, (3) is indeed enriched for transcriptional machinery when TFF1 peaks. The use of 1,6 hexanediol is not appropriate as pointed out by reviewer 2 and is no longer considered as an appropriate experiment by many as the whole notion of LLPS forming nuclear condensates is now under question. Such condensates can form through a variety of mechanisms as reviewed for example by Mittaj and Pappu (A conceptual framework for understanding phase separation and addressing open questions and challenges, Molecular Cell, 2022). Furthermore, given the distance between TFF1 and TFF3 it is hard to imagine that if a condensate that concentrates machinery in a non-stoichiometric manner was forming how it would not boost expression on both genes and be just specific to one. There must be another mechanism in my opinion.

I would recommend the authors remove this aspect of their manuscript/model and simply report their interesting findings that are actually supported by data: The temporal delay of TFF3 expression, the dependence on ER concentration, and the enhancer dependence.

for - carbon inequality - stats - carbon inequality - 2 days of our carbon budget - if everyone emitted transportation emissions of 50 richest billionaires - source - Oxfam - Carbon Inequality kills - 2024

Reviewer #2 (Public review):

Summary:

The manuscript presents a valuable finding on the impact of FRMD8 loss on tumor progression and the resistance to tamoxifen therapy. The author conducted systematic experiments to explore the role of FRMD8 in breast cancer and its potential regulatory mechanisms, confirming that FRMD8 could serve as a potential target to revere tamoxifen resistance.

The research is logically coherent and persuasive. The results support their conclusions and have achieved the research objectives.

Reviewer #2 (Public review):

Summary:

In the presented work by Wu et al, the authors investigate the role of the transcription factor Pu.1 in the survival and maintenance of microglia, the tissue-resident macrophage population in the brain. To this end, they generated a sophisticated new conditional pu.1 allele in zebrafish using CRISPR-mediated genome editing which allows visual detection of expression of the mutant allele through a switch from GFP to dsRed after Cre-mediated recombination. Using EdU pulse-chase labelling, they first estimated the daily turnover rate of microglia in the adult zebrafish brain which was found to be higher than rates previously estimated for mice and humans. After conditional deletion of pu.1 in coro1a positive cells, they do not find a difference in microglia number at 2 and 8 days or 1-month post-injection of Tamoxifen. However, at 3 months post-injection, a strong decrease in mutant microglia could be detected. While no change in microglia number was detected at 1mpi, an increase in apoptotic cells and decreased proliferation as observed. RNA-seq analysis of WT and mutant microglia revealed an upregulation of tp53, which was shown to play a role in the depletion of pu.1 mutant microglia as deletion in tp53-/- mutants did not lead to a decrease in microglia number at 3mpi. Through analysis of microglia number in pU.1 mutants, the authors further show that the depletion of microglia in the conditional mutants is dependent on the presence of WT microglia. To show that the phenomenon is conserved between species, similar experiments were also performed in mice.

This work expands on previous in vitro studies using primary human microglia. The majority of conclusions are well supported by the data, addition of controls and experimental details would strengthen the conclusions and rigor of the paper.

Strengths:

Generation of an elegantly designed conditional pu.1 allele in zebrafish that allows for the visual detection of expression of the knockout allele.

The combination of analysis of pu.1 function in two model systems, zebrafish and mouse, strengthens the conclusions of the paper.

Confirmation of the functional significance of the observed upregulation of tp53 in mutant microglia through double mutant analysis provides some mechanistic insight.

Weaknesses:

(1) The presented RNA-Seq analysis of mutant microglia is underpowered and details on how the data was analyzed are missing. Only 9-15 cells were analyzed in total (3 pools of 3-5 cells each). Further, the variability in relative gene expression of ccl35b.1, which was used as a quality control and inclusion criterion to define pools consisting of microglia, is extremely high (between ~4 and ~1600, Figure S7A).

(2) The authors conclude that the reduction of microglia observed in the adult brain after cKO of pu.1 in the spi-b mutant background is due to apoptosis (Lines 213-215). However, they only provide evidence of apoptosis in 3-5 dpf embryos, a stage at which loss of pu.1 alone does lead to a complete loss of microglia (Figure 2E). A control of pu.1 KI/d839 mutants treated with 4-OHT should be added to show that this effect is indeed dependent on the loss of spi-b. In addition, experiments should be performed to show apoptosis in the adult brain after cKO of pu.1 in spi-b mutants as there seems to be a difference in the requirement of pu.1 in embryonic and adult stages.

(3) The number of microglia after pu.1 knockout in zebrafish did only show a significant decrease 3 months after 4-OHT injection, whereas microglia were almost completely depleted already 7 days after injection in mice. This major difference is not discussed in the paper.

(4) Data is represented as mean +/-.SEM. Instead of SEM, standard deviation should be shown in all graphs to show the variability of the data. This is especially important for all graphs where individual data points are not shown. It should also be stated in the figure legend if SEM or SD is shown.

Reviewer #2 (Public review):

Summary:

The goal of this proposal was to understand how two separate projection neurons from the medial prefrontal cortex, those innervating the basolateral amygdala (BLA ) and nucleus accumbens (NAc), contribute to the encoding of emotional behaviors. The authors record the activity of these different neuron classes across three different behavioral environments. They propose that, although both populations are involved in emotional behavior, the two populations have diverging activity patterns in certain contexts. A subset of projections to the NAc appears particularly important for social behavior. They then attempt to link these changes to the emotional state of the animal and changes in synaptic connectivity.

Strengths:

The behavioral data builds on previous studies of these projection neurons supporting distinct roles in behavior and extend upon previous work by looking at the heterogeneity within different projection neurons across contexts.

Weaknesses:

The diversity of neurons mediating these projections and their targeting within the BLA and NAc is not explored. These are not homogeneous structures and so one possibility is that some of the diversity within their findings may relate to targeting of different sub-structures within each region. The electrophysiological data have significant experimental confounds and more methodological information is required to support other conclusions related to these data.

Reviewer #2 (Public review):

Summary:

Telomeres are key genomic structures linked to everything from aging to cancer. These key structures at the end of chromosomes protect them from degradation during replication and rely on a complex made up of human telomerase RNA gene (hTERC) and human telomerase reverse transcriptase (hTERT). While hTERC is expressed in all cells, the amount of hTERT is tightly controlled. The main hypothesis being tested is whether telomere length itself could regulate the hTERT enzyme. The authors conducted several experiments with different methods to alter telomere length and measured the binding of key regulatory proteins to this gene. It was generally observed that the shortening of telomere length leads to the recruitment of factors that reduce hTERT expression and lengthening of telomeres has the opposite effect. To rule out direct chromatin looping between telomeres and hTERT as driving this effect artificial constructs were designed and inserted a significant distance away and similar results were obtained.

Overall, the claims of telomere length-dependent regulation of hTERT are supported throughout the manuscript.

Strengths:

The paper has several important strengths. Firstly, it uses several methods and cell lines that consistently demonstrate the same directionality of the findings. Secondly, it builds on established findings in the field but still demonstrates how this mechanism is separate from that which has been observed. Specifically, designing and implementing luciferase assays in the CCR5 locus supports that direct chromatin looping isn't necessary to drive this effect with TRF2 binding. Another strength of this paper is that it has been built on a variety of other studies that have established principles such as G4-DNA in the hTERT locus and TRF2 binding to these G4 sites.

Weaknesses:

The largest technical weakness of the paper is that minimal replicates are used for each experiment. I understand that these kinds of experiments are quite costly, and many of the effects are quite large, however, experiments such as the flow cytometry or the IPSC telomere length and activity assays appear to be based on a single sample, and several are based upon two maximum three biological replicates. If samples were added the main effects would likely hold, and many of the assays using GAPDH as a control would result in significant differences between the groups. This unnecessarily weakens the strength of the claims.

Another detail that weakens the confidence in the claims is that throughout the manuscript there are several examples of the control group with zero variance between any of the samples: e.g. Figure 2K, Figure 3N, and Figure 6G. It is my understanding that a delta delta method has been used for calculation (though no exact formula is reported and would assist in understanding). If this is the case, then an average of the control group would be used to calculate that fold change and variance would exist in the group. The only way I could understand those control group samples always set to 1 is if a tube of cells was divided into conditions and therefore normalized to the control group in each case. A clearer description in the figure legend and methods would be required if this is what was done and repeated measures ANOVA and other statistics should accompany this.

A final technical weakness of the paper is the data in Figure 5 where the modified hTERT promoter was inserted upstream of the luciferase gene. Specifically, it is unclear why data was not directly compared between the constructs that could and could not form G4s to make this point. For this reason, the large variance in several samples, and minimal biological replicates, this data was the least convincing in the manuscript (though other papers from this laboratory and others support the claim, it is not convincing standalone data).

The second largest weakness of the paper is formatting.

When I initially read the paper without a careful reading of the methods, I thought that the authors did not have appropriate controls meaning that if a method is applied to lengthen, there should be one that is not lengthened, and when a method is applied to shorten, one which is not shortened should be analysed as well. In fact, this is what the authors have done with isogenic controls. However, by describing all samples as either telomere short or telomere long, while this simplifies the writing and the colour scheme, it makes it less clear that each experiment is performed relative to an unmodified. I would suggest putting the isogenic control in one colour, the artificially shortened in another, and the artificially lengthened in another.

Similarly, the graphs, in general, should be consistent with labelling. Figure 2 was the most confusing. I would suggest one dotted line with cell lines above it, and then the method of either elongation or shortening below it. I.e. HT1080 above, hTERC overexpression below, MDAMB-231 above guanine terminal repeats below, like was done on the right. Figure 2 readability would also be improved by putting hTERT promoter GAPDH (-ve control) under each graph that uses this (Panel B and Panel C not just Panel C). All information is contained in the manuscript but one must currently flip between figure legends, methods, and figures to understand what was done and this reduces clarity for the reader.

for - Christine Wamsler - Lund University - homepage - from - youtube - Mindfulness World Community - Awareness, Care and Sustainability for Our Earth - https://hyp.is/GCUJ1APHEfCcr_vvv3lAFw/www.youtube.com/watch?v=CTUc_0GroGM

• to - paper - An Interdisciplinary Model to Foster Existential Resilience and Transformation

  • https://hyp.is/iKxTmgPJEfCkN2PkMDmg1g/www.mdpi.com/2078-1547/16/1/5

• to - paper - Engaging high-income earners in climate action : Policy insights from survey experiments

  • for Deep Humanity Wealth 2 Wellth program
  • https://hyp.is/MIc0DgPKEfC_Z5v_n8P8mA/www.sciencedirect.com/science/article/pii/S0921800924002842

• to - paper - Revolutionising sustainability leadership and education : addressing the human dimension to support flourishing, culture and system transformation

  • for - LCE leadership academy
  • https://hyp.is/nLBHtAPLEfCvUUNZrc_uqw/link.springer.com/article/10.1007/s10584-023-03636-8

• to - The System Within : Addressing the inner dimensions of sustainability and systems change

  • https://hyp.is/VDAcFgPMEfCBPkvnTCjp8w/www.clubofrome.org/wp-content/uploads/2024/05/Earth4All_Deep_Dive_Jamie_Bristow.pdf
• to - paper - Transformative Climate Resilience Education for Children and Youth: From Climate Anxiety to Resilience, Creativity and Regeneration, Literature review conducted for the ERASMUS+ Project 2023-1-SE01-KA220-SCH-000158705

  - for - SRG/TPF/LCE ward-level afterschool outreach program but it's currently a dead link and inaccessible

• to - IMAGINE sustainability : integrated inner-outer transformation in research, education and practice
  • for - Deep Humanity open source praxis
  • Human Interior Transformation (HIT) and
  • Social Exterior Transformation (SET) //
  • https://hyp.is/5_GsSAPNEfC82DMDillDTw/link.springer.com/article/10.1007/s11625-023-01368-3

research areas - sustainable cities - collaborative governance - city-citizen collaboration - citizen participation - sustainability and wellbeing - sustainability transformation - inner development goals - inner transformation - inner transition - existential sustainability

Reviewer #2 (Public review):

This work offers an insightful contribution for researchers in computational biology, immunology, and machine learning. By employing a 3-mer embedding and CNN architecture, the authors demonstrate that it is possible to extend sequence context without exponentially increasing the model's complexity.

Key findings include:

(1) Efficiency and Performance: Thrifty CNNs outperform traditional 5-mer models and match the performance of significantly larger models like DeepSHM.

(2) Neutral Mutation Data: A distinction is made between using synonymous mutations and out-of-frame sequences for model training, with evidence suggesting these methods capture different aspects of SHM, or different biases in the type of data.

(3) Open Source Contributions: The release of a Python package and pre-trained models adds practical value for the community.

However, readers should be aware of the limitations. The improvements over existing models are modest, and the work is constrained by the availability of high-quality out-of-frame sequence data. The study also highlights that more complex modeling techniques, like transformers, did not enhance predictive performance, which underscores the role of data availability in such studies.

Reviewer #2 (Public review):

Summary:

This study used an unbiased approach to evaluate epigenetic dynamics during the differentiation of granule neuron precursors, the cell of origin for Shh-MB. These profiling findings led to the focus on H3K27me3 dynamics, which correlate with the remodeling of epigenetic landscape associated with neuronal differentiation gene activation.

Strengths:

Depletion of EZH2, an enzymatic subunit of PRC2, resulted in premature neuronal differentiation in the developing cerebellum.

Weaknesses:

Little information is shown about the specific genetic programs disrupted by EZH2 depletion. This is a crucial weakness as existing PRC2 inhibitors do not effectively cross the blood-brain barrier. Further studies are necessary to identify downstream targets of PRC2 that could be targeted to induce neuronal differentiation in MB cells.

Reviewer #3 (Public review):

Summary:

This study attempts to reconstruct the history of the COVID-19 epidemic, with its successive waves of viral variants from SARS-CoV-2 seroprevalence during 2021 and 2022 among blood donors in different regions of Bolivia. By using serological tests "specific" for the various variants the authors try to achieve a "colour" vision that is not provided by standard "black-and-white" serology.

Strengths and Weaknesses:<br /> I am not an expert on the performance of SARS-CoV-2 serological tests, so may overlook certain weaknesses. Instead I tried to assess whether the authors, in this manuscript, have managed to substantiate their claims that "seroprevalence studies are a valuable adjunct to active surveillance because they allow analysis of the level of immunity of a population to a specific pathogen without the need for prospective testing" , and that "genomic surveillance and serology offer distinct yet complementary insights thus far." I think they succeeded, as they paint a credible and interesting history of the epidemic in Bolivia using (to me) novel methodology that certainly will stimulate extensive discussion, controversies, and follow-up studies (for which the authors might make some suggestions).

Reviewer #2 (Public review):

Summary:

This manuscript by Yu and coworkers investigates the potential role of Secretory leukocyte protease inhibitor (SLPI) in Lyme arthritis. They show that, after needle inoculation of the Lyme disease (LD) agent, B. burgdorferi, compared to wild type mice, a SLPI-deficient mouse suffers elevated bacterial burden, joint swelling and inflammation, pro-inflammatory cytokines in the joint, and levels of serum neutrophil elastase (NE). They suggest that SLPI levels of Lyme disease patients are diminished relative to healthy controls. Finally, they find that SLPI may interact directly the B. burgdorferi.

Strengths:

Many of these observations are interesting and the use of SLPI-deficient mice is useful (and has not previously been done).

Weaknesses:

(a) The known role of SLPI in dampening inflammation and inflammatory damage by inhibition of NE makes the enhanced inflammation in the joint of B. burgdorferi-infected mice a predicted result; (b) The potential contribution of the greater bacterial burden to the enhanced inflammation is acknowledged but not experimentally addressed; (c) The relationship of SLPI binding by B. burgdorferi to the enhanced disease of SLPI-deficient mice is not addressed in this study, making the inclusion of this observation in this manuscript incomplete; and (d) assessment of SLPI levels in healthy controls vs. Lyme disease patients is inadequate.

Comments on revised verson:

Several of the points were addressed in the revised manuscript, but the following issues remain:

Previous point that the relationship of SLPI binding to B. burgdorferi to the enhanced disease of SLPI-deficient mice is not investigated: The authors indicate that such investigations are ongoing. In the absence of any findings, I recommend that their interesting BASEHIT and subsequent studies be presented in a future study, which would have high impact.

Previous recommendation 1: (The authors added lines 267-68, not 287-68). This ambiguity is acknowledged but remains. In addition, in the revised manuscript, the authors state "However, these data also emphasize the importance of SLPI in controlling the development of inflammation in periarticular tissues of B. burgdorferi-infected mice." Given acknowledged limitations of interpretation, "suggest" would be more appropriate than "emphasize".

Previous recommendation 5: The lack of clinical samples can be a challenge. Nevertheless, 4 of the 7 samples from LD patients are from individuals suffering from EM rather than arthritis (i.e., the manifestation that is the topic of the study) and some who are sampled multiple times, make an objective statistical comparison difficult. I don't have a suggestion as to how to address the difference in number of samples from a given subject. However, the authors could consider segregating EM vs. LA in their analysis (although it appears that limiting the comparison between HC and LA patients would not reveal a statistical difference).

Previous recommendation 6: Given that binding of SLPI to the bacterial surface is an essential aspect of the authors' model, and that the ELISA assay to indicate SLPI binding used cell lysates rather than intact bacteria, a control PI staining to validate the integrity of bacteria seems reasonable.

Previous recommendation 8: The inclusion of a no serum control (that presumably shows 100% viability) would validate the authors' assertion that 20% serum has bactericidal activity.

Reviewer #3 (Public review):

Summary:

The authors aim to establish that cipargamin can be used for the treatment of infection caused by Babesia organisms.

Strengths:

The study provides strong evidence that cipargamin is effective against various Babesia species. In vitro growth assays were used to establish that cipargamin is effective against Babesia bovis and Babesia gibsoni. Infection of mice with Babesia microti demonstrated that cipargamin is as effective as the combination of atovaquone plus azithromycin. Cipargamin protected mice from lethal infection with Babesia rodhaini. Mutations that confer resistance to cipargamin were identified in the gene encoding ATP4, a P-type Na ATPase that is found in other apicomplexan parasites, thereby validating ATP4 as the target of cipargamin. A 7-day treatment of cipagarmin, when combined with a single dose of tafenoquine, was sufficient to eradicate Babesia microti in a mouse model of severe babesiosis caused by lack of adaptive immunity.

Weaknesses:

Cipargamin was tested in vivo at a single dose administered daily for 7 days. Despite the prospect of using cipargamin for the treatment of human babesiosis, there was no attempt to identify the lowest dose of cipagarmin that protects mice from Babesia microti infection. In the SCID mouse model, cipargamin was tested in combination with tafenoquine but not with atovaquone and/or azithromycin, although the latter combination is often used as first-line therapy for human babesiosis caused by Babesia microti.

Reviewer #2 (Public review):

Summary:

Humanized mice, developed by transplanting human cells into immunodeficient NSG mice to recapitulate the human immune system, are utilized in basic life science research and preclinical trials of pharmaceuticals in fields such as oncology, immunology, and regenerative medicine. However, there are limitations to use humanized mice for mechanistic analysis as models of autoimmune diseases due to the unnatural T cell selection, antigen presentation/recognition process, and immune system disruption due to xenogeneic GVHD onset.

In the present study, Vecchione et al. detailed the mechanisms of autoimmune disease-like pathologies observed in a humanized mouse (Human immune system; HIS mouse) model, demonstrating the importance of CD4+ Tfh and Tph cells for the disease onset. They clarified the conditions under which these T cells become reactive using techniques involving the human thymus engraftment and mouse thymectomy, showing their ability to trigger B cell responses, although this was not a major factor in the mouse pathology. These valuable findings provide an essential basis for interpreting past and future autoimmune disease research conducted using HIS mice.

Strengths:

(1) Mice transplanted with human thymus and HSCs were repeatedly executed with sufficient reproducibility, with each experiment sometimes taking over 30 weeks and requiring desperate efforts. While the interpretation of the results is still debateble, these description is valuable knowledge for this field of research.

(2) Mechanistic analysis of T-B interaction in humanized mice, which has not been extensively addressed before, suggests part of the activation mechanism of autoreactive B cells. Additionally, the differences in pathogenicity due to T cell selection by either the mouse or human thymus are emphasized, which encompasses the essential mechanisms of immune tolerance and activation in both central and peripheral systems.

Weaknesses:

(1) In this manuscript, such as Fig. 2, the proportion of suppressive cells like regulatory T cells is not clarified, making it unclear to what extent the percentages of Tph or Tfh cells reflect immune activation. It would have been preferable to distinguish follicular regulatory T cells, at least. While Figure 3 shows Tregs are gated out using CD25- cells, it is unclear how the presence of Treg cells affects the overall cell population immunogenic functionally.

The authors added the data about FOXP3 expression among Tfh/Tph cells in the revised manuscript. This improved our data interpretation.

(2) The definition of "Disease" discussed after Fig. 6 should be explicitly described in the Methods section. It seems to follow Khosravi-Maharlooei et al. 2021. If the disease onset determination aligns with GVHD scoring, generally an indicator of T cell response, it is unsurprising that B cell contribution is negligible. The accelerated disease onset by B cell depletion likely results from lymphopenia-induced T cell activation. However, this result does not prove that these mice avoid organ-specific autoimmune diseases mediated by auto-antibodies and the current conclusion by the authors may overlook significant changes. For instance, would defining Disease Onset by the appearance of circulating autoantibodies alter the result of Disease-Free curve? Are there possibly histological findings at the endpoint of the experiment suggesting tissue damage by autoantibodies?

The authors appropriately modified the manuscript and provided sufficient information about the definition of diseases.

(3) Helper functions, such as differentiating B cells into CXCR5+, were demonstrated for both Hu/Hu and Mu/Hu-derived T cells. This function seemed higher in Hu/Hu than in Mu/Hu. From the results in Fig. 7-8, Hu/Hu Tph/Tfh cells have a stronger T cell identity and higher activation capacity in vivo on a per-cell basis than Mu/Hu's ones. However, Hu/Hu-T cells lacked an ability to induce class-switching in contrast to Mu/Hu's. The mechanisms causing these functional differences were not fully discussed. Discussions touching on possible changes in TCR repertoire diversity between Mu/Hu- and Hu/Hu- T cells would have been beneficial.

The authors correctly cited their previous findings about the TCR repertoire variation. This strengthened the discussion of this study.

Reviewer #2 (Public review):

Summary:

The article aims to describe a novel methodology for the study of brain organization, in comparison to fMRI functional connectivity, under rest vs. controlled pharmacological stimulation.

Strengths:

Solid study design with pharmacological stimulation applied to assess the biological significance of functional and (novel) molecular connectivity estimates.

Provides relevant information on the multivariate organization of serotoninergic system in the brain.

Provides relevant information on the sensitivity of traditional (univariate PET analysis, fMRI functional connectivity) and novel (molecular connectivity) methods in measuring pharmacological effects on brain function.

Comments on revisions:

I thank the authors for carefully addressing my comments and in particular for the interesting insights added to the discussion.

I have just one last remark pertaining to the point of the sample size: rats undergoing the MDMA acute challenge constitute a relatively small sample (N=11); I feel there is a certain risk the results presented might not be particularly replicable. Could the authors prove the stability of their (main) results by randomly iterating the individuals included in their sample (e.g. via permutation tests)? Alternatively, including at least a justification of the sample size in the context of the available evidence would be valuable.

Reviewer #2 (Public review):

In this manuscript, the authors seek to demonstrate that it is possible to sequence antibody variable domains from cryoEM reconstructions in combination with bottom-up LC-MSMS. In particular, they extract de novo sequences from single particle-cryo-EM-derived maps of antibodies using the "deep-learning tool ModelAngelo", which are run through the program Stitch to try to select the top scoring V-gene and construct a placeholder sequence for the CDR3 of both the heavy and light chain of the antibody under investigation. These reconstructed variable domains are then used as templates to guide the assembly of de novo peptides from LC-MS/MS data to improve the accuracy of the candidate sequence.

Using this approach the authors claim to have demonstrated that "cryoEM reconstructions of monoclonal antigen-antibody complexes may contain sufficient information to accurately narrow down candidate V-genes and that this can be integrated with proteomics data to improve the accuracy of candidate sequences".

Reviewer #3 (Public review):

Summary:

This study by Mehta et al. describes the mechanisms behind the observation that putrescine biosynthesis mutants in Escherichia coli strain W3110 are affected in surface motility. The manuscript shows that the surface motility phenotype is dependent on Type I fimbriae and that putrescine levels affect the expression level of fimbriae. The results further suggest that without putrescine, the metabolism of the cell is shifted towards production of putrescine and away from energy metabolism.

Strengths:

The authors show the effect of putrescine on the regulation of type I fimbriae using various strategies (mutants, addition of exogenous, RNA seq, etc.). All experiments converge to the same conclusion that an optimal level of putrescine is needed.

Weakness:

The authors use one isolate of E. coli strain W3110, that contains an insertion in fimE which controls the expression of type I fimbriae. The insertion in fimE likely modifies the ratio of cells expressing fimbriae in the population, and it would be important to confirm the results in other isolates or other strains.

Reviewer #2 (Public review):

Summary:

An initial screening of pretreatment with different stress treatments of K. pneumoniae allowed the identification of heat stress as a protection factor against the infection of the lytic phage Kp11. Then experiments prove that this is mediated not by an increase of phage-resistant bacteria but due to an increase in phage transient tolerant population, which the authors identified as bacteriophage persistence in analogy to antibiotic persistence. Then they proved that phage persistence mediated by heat shock enhanced the evolution of bacterial resistance against the phage. The same trait was observed using other lytic phages, their combinations, and two clinical strains, as well as E. coli and two T phages, hence the phenomenon may be widespread in enterobacteria.

Next, the elucidation of heat-induced phage persistence was done, determining that phage adsorption was not affected but phage DNA internalization was impaired by the heat pretreatment, likely due to alterations in the bacterial envelope, including the downregulation of envelope proteins and of LPS; furthermore, heat treated bacteria were less sensitive to polymyxins due to the decrease in LPS.

Finally, cyclic exposure to heat stress allowed the isolation of a mutant that was both resistant to heat treatment, polymyxins, and lytic phage, that mutant had alterations in PspA protein that allowed a gain of function and that promoted the reduction of capsule production and loss of its structure; nevertheless this mutant was severely impaired in immune evasion as it was easily cleared from mice blood, evidencing the tradeoffs between phage/heat and antibiotic resistance and the ability to counteract the immune response.

Strengths:

The experimental design and the sequence in which they are presented are ideal for the understanding of their study and the conclusions are supported by the findings, also the discussion points out the relevance of their work particularly in the effectiveness of phage therapy, and allows the design of strategies to improve their effectiveness.

Weaknesses:

In its present form, it lacks the incorporation of some relevant previous work that explored the role of heat stress in phage susceptibility, antibiotic susceptibility, tradeoffs between phage resistance and resistance against other kinds of stress, virulence, etc., and the fact that exposure to lytic phages induces antibiotic persistence.

Reviewer #2 (Public review):

Summary:

The authors study a panel of sparsely labeled neuronal lines in Drosophila that each form multiple synapses. Critically, each axonal branch can be injured without affecting the others, allowing the authors to differentiate between injuries that affect all axonal branches versus those that do not, creating spared branches. This is a highly powerful model. Axonal injuries are known to cause Wnd (mammalian DLK)-dependent retrograde signals to the cell body, culminating in a transcriptional response. This work identifies a fascinating new phenomenon that this injury response is not all-or-none. If even a single branch remains uninjured, the injury signal is not activated in the cell body. The authors rule out that this could be due to changes in the abundance of Wnd (perhaps if incrementally activated at each injured branch) by Wnd, Hiw's known negative regulator. Thus there is both a yet-undiscovered mechanism to regulate Wnd signaling, and more broadly a mechanism by which the neuron can integrate the degree of injury it has sustained. It will now be important to tease apart the mechanism(s) of this fascinating phenomenon. But even absent a clear mechanism, this is a new biology that will inform the interpretation of injury signaling studies across species.

Strengths:

- A conceptually beautiful series of experiments that reveal a fascinating new phenomenon is described, with clear implications (as the authors discuss in their Discussion) for injury signaling in mammals.<br /> - Suggests a new mode of Wnd regulation, independent of Hiw.

Weaknesses:

-The use of a somatic transcriptional reporter for Wnd activity is powerful, however, the reporter indicates whether the transcriptional response was activated, not whether the injury signal was received. It remains possible that Wnd is still activated in the case of a spared branch, but that this activation is either local within the axons (impossible determine in the absence of a local reporter) or that the retrograde signal was indeed generated but it was somehow insufficient to activate transcription when it entered the cell body. This is more of a mechanistic detail (and likely an extreme technical challenge to assess) and should not detract from the overall importance of the study

-That the protective effect of a spared branch is independent of Hiw, the known negative regulator of Wnd, is fascinating. But this leaves open a key question: what is the signal?

Comments on revisions:

I appreciate your discussion about the potential bi-modal regulation of the puckered transcriptional reporter and think that readers would benefit from a short discussion of this.

Reviewer #2 (Public review):

Summary:

The group around Prof. Scheiffele has made seminal discoveries reg. alternative splicing that is reflected by a current ERC advanced grant and landmark papers in eLife (2015), Science (2016), and Nature Neuroscience (2019). Recently, the group investigated proteins that contain an RRM motif in the mouse cortex. One of them, termed RBM20, was originally thought be muscle-specific and involved in alternative splicing in cardiomyocytes. However, upon close inspection, RBP20 is expressed in a particular set of interneurons (PV positive cells of the somatosensory cortex) in the cortex as well as in mitral cells of the olfactory bulb (OB). Importantly, they used CLIP to identify targets in the OB and heart. Next and quite importantly, they generated a knock-in mouse line with a His-biotin acceptor peptide and a HA epitope to perform specific biochemistry. Not surprisingly, this allowed them to specifically identify transcripts with long introns, however, most of the intronic binding sites were very distant to the splice sites. Closer GO term inspection revealed that RBM20 specifically regulates synapse-related transcripts. In order to get in vivo insight into its function in the brain, the authors generated both global as well as conditional KO mice. Surprisingly, there were no significant differences in in RBM20 PV interneurons, however, 409 transcripts were deregulated in in OB glutamatergic neurons. Here, CLIP sites were mostly found to be very distant from differentially expressed exons. Furthermore, loss-of-function RBM20 primarily yields loss of transcripts, whereas upregulation appears to be indirect. Together, these results strongly suggest a role of RBM20 in the inclusion of cryptic exons thereby promoting target degradation.

Strengths:

The quality of the data and the figures is high, impressive and convincing. The reported results strongly suggest a role of RBM20 in the inclusion of cryptic exons thereby promoting target degradation.

Weaknesses:

In their revised manuscript, the authors significantly improved the intro and results section, which is now much better suited for the general public and allows better to follow the logic of the experiments. Also, the discussion has now been expanded doing better justice to the importance of the findings presented.

In my opinion, the revised manuscript clearly improved and represents a timely and important study, which provides major new insight into the expression and possible function of RBM20 in tissues outside of muscle.

Reviewer #2 (Public review):

Summary:

The authors present a combined experimental and theoretical workflow to study partitioning noise arising during cell division. Such quantifications usually require time-lapse experiments, which are limited in throughput. To bypass these limitations, the authors propose to use flow-cytometry measurements instead and analyse them using a theoretical model of partitioning noise. The problem considered by the authors is relevant and the idea to use statistical models in combination with flow cytometry to boost statistical power is elegant. The authors demonstrate their approach using experimental flow cytometry measurements and validate their results using time-lapse microscopy. However, while I appreciate the overall goal and motivation of this work, I was not entirely convinced by the strength of this contribution. The approach focuses on a quite specific case, where the dynamics of the labelled component depend purely on partitioning. As such it seems incompatible with studying the partitioning noise of endogenous components that exhibit production/turnover. The description of the methods was partly hard to follow and should be improved. In addition, I have several technical comments, which I hope will be helpful to the authors.

Comments:

(1) In the theoretical model, copy numbers are considered to be conserved across generations. As a consequence, concentrations will decrease over generations due to dilution. While this consideration seems plausible for the considered experimental system, it seems incompatible with components that exhibit production and turnover dynamics. I am therefore wondering about the applicability/scope of the presented approach and to what extent it can be used to study partitioning noise for endogenous components. As presented, the approach seems to be limited to a fairly small class of experiments/situations.

(2) Similar to the previous comment, I am wondering what would happen in situations where the generations could not be as clearly identified as in the presented experimental system (e.g., due to variability in cell-cycle length/stage). In this case, it seems to be challenging to identify generations using a Gaussian Mixture Model. Can the authors comment on how to deal with such situations? In the abstract, the authors motivate their work by arguing that detecting cell divisions from microscopy is difficult, but doesn't their flow cytometry-based approach have a similar problem?

(3) I could not find any formal definition of division asymmetry. Since this is the most important quantity of this paper, it should be defined clearly.

(4) The description of the model is unclear/imprecise in several parts. For instance, it seems to me that the index "i" does not really refer to a cell in the population, but rather a subpopulation of cells that has undergone a certain number of divisions. Furthermore, why is the argument of Equation 11 suddenly the fraction f as opposed to the component number? I strongly recommend carefully rewriting and streamlining the model description and clearly defining all quantities and how they relate to each other.

(5) Similarly, I was not able to follow the logic of Section D. I recommend carefully rewriting this section to make the rationale, logic, and conclusions clear to the reader.

(6) Much theoretical work has been done recently to couple cell-cycle variability to intracellular dynamics. While the authors neglect the latter for simplicity, it would be important to further discuss these approaches and why their simplified model is suitable for their particular experiments.

(7) In the discussion the authors note that the microscopy-based estimates may lead to an overestimation of the fluctuations due to limited statistics. I could not follow that reasoning. Due to the gating in the flow cytometry measurements, I could imagine that the resulting populations are more stringently selected as compared to microscopy. Could that also be an explanation? More generally, it would be interesting to see how robust the results are in terms of different gating diameters.

(8) It would be helpful to show flow cytometry plots including the identified subpopulations for all cell lines, currently, they are shown only for HCT116 cells. More generally, very little raw data is shown.

(9) The title of the manuscript could be tailored more to the considered problem. At the moment it is very generic.

Reviewer #2 (Public review):

Summary:

This paper investigates the idea that the protracted maturation of the prefrontal cortex - often viewed as a developmental limitation - may actually confer advantages for conceptual learning in children. The authors focus on semantic control processes, which govern the context-sensitive application of conceptual knowledge, and are closely associated with late-developing regions of the prefrontal cortex.

Drawing on a computational model, the paper formally tests whether delayed maturation of semantic control promotes the acquisition of conceptual knowledge. The simulations demonstrate that when semantic control and anatomical connectivity mature later, conceptual learning is accelerated without compromising the integrity of the learned representations. Notably, the benefit is most apparent when control connections target intermediate layers in the computational model, suggesting a nuanced interplay between control processes and the underlying conceptual network.

To validate these computational insights in a human developmental context, the authors conduct a meta-analysis of the classic triadic matching task - a paradigm where participants decide which of two choices best matches a reference concept based on either taxonomic or thematic relations. Critically, when these relations conflict, semantic control is required to select the context-appropriate match. Results indicate that context-sensitive semantic control develops more slowly than basic conceptual knowledge, showing marked improvements between 3 and 6 years of age.

Overall, the paper argues that the delayed development of prefrontal cortex-based control processes allows for a period of less constrained learning, ultimately enhancing conceptual acquisition. The findings challenge the traditional view of late PFC maturation as solely disadvantageous and instead position it as an adaptive feature for building robust conceptual frameworks in early childhood.

Strengths:

(1) Novel Theoretical Contribution<br /> The paper offers a compelling, counterintuitive argument that a developmental lag in the maturation of control processes might be beneficial for semantic learning. This stands in contrast to the conventional framing of late prefrontal cortex (PFC) development as purely disadvantageous (e.g., a "necessary but unfortunate" constraint).

(2) Well-Grounded Computational Approach<br /> The authors propose a neural network model that is both theoretically driven (hub-and-spoke framework) and systematically tested under various conditions (different timelines for control onset, and different connectivity patterns). Their simulations replicate and extend previous findings about how insulating the multimodal hub from direct control inputs helps preserve abstract conceptual representations.

(3) Neuro-anatomical basis<br /> The paper connects its computational claims to empirical neuroanatomy, particularly the lack of direct structural connectivity between ventral ATL (the "hub") and the PFC in humans. This lends biological plausibility to the argument that control signals likely reach the ATL via intermediate regions (e.g., posterior temporal cortex).

(4) Meta-Analysis of Triadic Match-to-Sample<br /> The authors leverage decades of developmental data on conceptual matching tasks, reframing them in terms of semantic control vs. semantic representation. Their analysis nicely illustrates that children can identify semantic relationships (taxonomic or thematic) at age 2 if the task does not require them to select between conflicting semantic relations. In contrast, the ability to choose a task-relevant relation only emerges more robustly in 3-6 years. This developmental pattern aligns with the computational model's predictions.

Weaknesses:

The contribution of the paper might be considered rather specialist, and might not appeal to a broad public, which should be typical of a generalist journal. Moreover, the scope of the model is fairly narrow - its relatively small, controlled training environment raises questions about scalability to more naturalistic, high-dimensional data. Finally, the meta-analysis does not test directly the model predictions in terms of specific outcomes of the task, error patterns, or model fit, but only the developmental pattern which was an already observed phenomenon that in part motivated the hypothesis and the model itself.

Reviewer #2 (Public review):

Summary:

The authors present data from a single-center cohort of African-American and Hispanic/Latinx individuals with atrial fibrillation (AF). This study provides insight into the incidences and clinical impact of missense variants in the Titin (TTN) gene in this population. In addition, the authors identified a single amino acid TTN missense variant (TTN-T32756I) that was further studied using human induced pluripotent stem cell-derived atrial cardiomyocytes (iPSC-aCMs). These studies demonstrated that the Four-and-a-Half Lim domains 2 (FHL2), has increased binding with KCNQ1 and its modulatory subunit KCNE1 in the TTN-T32756I-iPSC-aCMs, enhancing the slow delayed rectifier potassium current (Iks) and is a potential mechanism for atrial fibrillation. Finally, the authors demonstrate that suppression of FHL2 could normalize the Iks current.

Strengths:

The strengths of this manuscript/study are listed below:

(1) This study includes a previously underrepresented population in the study of the genetic and mechanistic basis of AF.<br /> (2) The authors utilize current state-of-the-art methods to investigate the pathogenicity of a specific TTN missense variant identified in this underrepresented patient population.<br /> (3) The findings of this study identify a potential therapeutic for treating atrial fibrillation.

Weaknesses:

(1) The authors do not include a non-AF group when evaluating the incidence and clinical significance of TTN missense variants in AF patients.

(2) The authors do not provide evidence that TTN-T32756I-iPSC-aCMs are arrhythmogenic only that there is an increase in the Iks current and associated action potential changes. More specifically, the authors report "compared to the WT, TTN-T32756I-iPSC-aCMs exhibited increased arrhythmic frequency" yet is it is unclear what they are referring to by "arrhythmic frequency".

(3) There seem to be discrepancies regarding the impact of the TTN-T32756I variant on mechanical function. Specifically, the authors report "both reduced contraction and abnormal relaxation in TTN-T32756I-iPSC-aCMs" yet, separately report "the contraction amplitude of the mutant was also increased . . . suggesting an increased contractile force by the TTN-T32756I-iPSC-aCMs and TTN-T32756I-iPSC-CMs exhibited similar calcium transient amplitudes as the WT."

Reviewer #2 (Public review):

Summary:

The authors of this paper note that although polyphosphate (polyP) is found throughout biology, the biological roles of polyP have been under-explored, especially in multicellular organisms. The authors created transgenic Drosophila that expressed a yeast enzyme that degrades polyP, targeting the enzyme to different subcellular compartments (cytosol, mitochondria, ER, and nucleus, terming these altered flies Cyto-FLYX, Mito-FLYX, etc.). The authors show the localization of polyP in various wild-type fruit fly cell types and demonstrate that the targeting vectors did indeed result in the expression of the polyP degrading enzyme in the cells of the flies. They then go on to examine the effects of polyP depletion using just one of these targeting systems (the Cyto-FLYX). The primary findings from the depletion of cytosolic polyP levels in these flies are that it accelerates eclosion and also appears to participate in hemolymph clotting. Perhaps surprisingly, the flies seemed otherwise healthy and appeared to have little other noticeable defects. The authors use transcriptomics to try to identify pathways altered by the cyto-FLYX construct degrading cytosolic polyP, and it seems likely that their findings in this regard will provide avenues for future investigation. And finally, although the authors found that eclosion is accelerated in pupae of Drosophila expressing the Cyto-FLYX construct, the reason why this happens remains unexplained.

Strengths:

The authors capitalize on the work of other investigators who had previously shown that expression of recombinant yeast exopolyphosphatase could be targeted to specific subcellular compartments to locally deplete polyP, and they also use a recombinant polyP binding protein (PPBD) developed by others to localize polyP. They combine this with the considerable power of Drosophila genetics to explore the roles of polyP by depleting it in specific compartments and cell types to tease out novel biological roles for polyP in a whole organism. This is a substantial advance.

Weaknesses:

Page 4 of the Results (paragraph 1): I'm a bit concerned about the specificity of PPBD as a probe for polyP. The authors show that the fusion partner (GST) isn't responsible for the signal, but I don't think they directly demonstrate that PPBD is binding only to polyP. Could it also bind to other anionic substances? A useful control might be to digest the permeabilized cells and tissues with polyphosphatase prior to PPBD staining and show that the staining is lost.

In the hemolymph clotting experiments, the authors collected 2 ul of hemolymph and then added 1 ul of their test substance (water or a polyP solution). They state that they added either 0.8 or 1.6 nmol polyP in these experiments (the description in the Results differs from that of the Methods). I calculate this will give a polyP concentration of 0.3 or 0.6 mM. This is an extraordinarily high polyP concentration and is much in excess of the polyP concentrations used in most of the experiments testing the effects of polyP on clotting of mammalian plasma. Why did the authors choose this high polyP concentration? Did they try lower concentrations? It seems possible that too high a polyP concentration would actually have less clotting activity than the optimal polyP concentration.

Reviewer #2 (Public review):

Summary:

The study by Chaguza et al. presents a novel perspective on pneumococcal growth kinetics, suggesting that the overall genetic background of Streptococcus pneumoniae, rather than specific loci, plays a more dominant role in determining growth dynamics. Through a genome-wide association study (GWAS) approach, the authors propose a shift in how we understand growth regulation, differing from earlier findings that pinpointed individual genes, such as wchA or cpsE, as key regulators of growth kinetics. This study highlights the importance of considering the cumulative impact of the entire genetic background rather than focusing solely on individual genetic loci.

The study emphasizes the cumulative effects of genetic variants, each contributing small individual impacts, as the key drivers of pneumococcal growth. This polygenic model moves away from the traditional focus on single-gene influences. Through rigorous statistical analyses, the authors persuasively advocate for a more holistic approach to understanding bacterial growth regulation, highlighting the complex interplay of genetic factors across the entire genome. Their findings open new avenues for investigating the intricate mechanisms underlying bacterial growth and adaptation, providing fresh insights into bacterial pathogenesis.

Strengths:

This study exemplifies a holistic approach to unraveling key factors in bacterial pathogenesis. By analyzing a large dataset of whole-genome sequences and employing robust statistical methodologies, the authors provide strong evidence to support their main findings. Which is a leap forward from previous studies focused on a relatively smaller number of strains. Their integration of genome-wide association studies (GWAS) highlights the cumulative, polygenic influences on pneumococcal growth kinetics, challenging the traditional focus on individual loci. This comprehensive strategy not only advances our understanding of bacterial growth regulation but also establishes a foundation for future research into the genetic underpinnings of bacterial pathogenesis and adaptation. The amount of data generated and corresponding approaches to analyze the data are impressive as well as convincing. The figures are convincing and comprehensible too.

Weaknesses:

Despite the strong outcomes of the GWAS approach, this study leaves room for differing interpretations. A key point of contention lies in the title, which initially gives the impression that the research addresses growth kinetics under both in vitro and in vivo conditions. However, the study is limited to in vitro growth kinetics, with the assumption that these findings are equally applicable to in vivo scenarios-a premise that is not universally valid. To more accurately reflect the study's scope and avoid potential misrepresentation, the title should explicitly specify "in vitro" growth kinetics. This clarification would better align the title with the study's actual focus and findings.

This study suggests that the entire genetic background significantly influences bacterial growth kinetics. However, to transform these predictions into established facts, extensive experimental validation is necessary. This would involve "bench experiments" focusing on generating and studying mutant variants of serotypes or strains with diverse genomic variations, such as targeted deletions. The growth phenotypes of these mutants should be analyzed, complemented by complementation assays to confirm the specific roles of the deleted regions. These efforts would provide critical empirical evidence to support the findings from the GWAS approach and enhance understanding of the genetic basis of bacterial growth kinetics.

In the discussion section, the authors state that "the influence of serotype appeared to be higher than the genetic background for the average growth rate" (lines 296-298). Alongside references 13-15, this emphasizes the important role of capsular variability, which is a key determinant of serotypes, in influencing growth kinetics. However, this raises the question: why isn't a specific locus like cps, which is central to capsule biogenesis, considered a strong influencer of growth kinetics in this study?

One plausible explanation could be the absence of "elevated signals" for cps in the GWAS analysis. GWAS relies on identifying loci with statistically significant associations to phenotypes. The lack of such signals for cps may indicate that its contribution, while biologically important, does not stand out genome-wide. This might be due to the polygenic nature of growth kinetics, where the overall genetic background exerts a cumulative effect, potentially diluting the apparent influence of individual loci like cps in statistical analyses.

Reviewer #2 (Public review):

Summary:

This paper by Wang et al. uses rich brain, behaviour, and genetics data from the ABCD cohort to ask how well cognitive abilities can be predicted from mental-health-related measures, and how brain and genetics influence that prediction. They obtain an out-of-sample correlation of 0.4, with neuroimaging (in particular task fMRI) proving the key mediator. Polygenic scores contributed less.

Strengths:

This paper is characterized by the intelligent use of a superb sample (ABCD) alongside strong statistical learning methods and a clear set of questions. The outcome - the moderate level of prediction between the brain, cognition, genetics, and mental health - is interesting. Particularly important is the dissection of which features best mediate that prediction and how developmental and lifestyle factors play a role.

Weaknesses:

There are relatively few weaknesses to this paper. It has already undergone review at a different journal, and the authors clearly took the original set of comments into account in revising their paper. Overall, while the ABCD sample is superb for the questions asked, it would have been highly informative to extend the analyses to datasets containing more participants with neurological/psychiatric diagnoses (e.g. HBN, POND) or extend it into adolescent/early adult onset psychopathology cohorts. But it is fair enough that the authors want to leave that for future work.

In terms of more practical concerns, much of the paper relies on comparing r or R2 measures between different tests. These are always presented as point estimates without uncertainty. There would be some value, I think, in incorporating uncertainty from repeated sampling to better understand the improvements/differences between the reported correlations.

The focus on mental health in a largely normative sample leads to the predictions being largely based on the normal range. It would be interesting to subsample the data and ask how well the extremes are predicted.

A minor query - why are only cortical features shown in Figure 3?

Reviewer #2 (Public review):

Summary:

The manuscript describes novel technique development and experiments to track the social gaze of marmosets. The authors used video tracking of multiple cameras in pairs of marmosets to infer head orientation and gaze and then studied gaze direction as a function of distance between animals, relationships, and social conditions/stimuli.

Strengths:

Overall the work is interesting and well done. It addresses an area of growing interest in animal social behavior, an area that has largely been dominated by research in rodents and other non-primate species. In particular, this work addresses something that is uniquely primate (perhaps not unique, but not studied much in other laboratory model organisms), which is that primates, like humans, look at each other, and this gaze is an important social cue of their interactions. As such, the presented work is an important advance and addition to the literature that will allow more sophisticated quantification of animal behaviors. I am particularly enthusiastic with how the authors approach the cone of uncertainty in gaze, which can be both due to some error in head orientation measurements as well as variable eye position.

Weaknesses:

There are a few technical points in need of clarification, both in terms of the robustness of the gaze estimate, and possible confounds by gaze to non-face targets which may have relevance but are not discussed. These are relatively minor, and more suggestions than anything else.

Reviewer #2 (Public review):

The authors introduce MorphCellSorter, an open-source tool available on GitHub, designed for automated morphometric analysis of microglia. Current understanding suggests that microglia represent a heterogeneous population, especially in non-steady adult states, better characterized as a continuum rather than distinct cell groups.

This tool was developed to classify microglia along this continuum. Using stained brain sections and microscope imaging, individual microglia are binarized and processed with MorphCellSorter, which categorizes them based on 20 morphological parameters. Notably, the tool is versatile, as it can be applied to both fluorescent and brightfield brain sections, as demonstrated by the authors. Additionally, it has been tested across various setups (both fixed and live tissues) and biological contexts (including embryonic stages, Alzheimer's disease models, stroke, and primary cell cultures), showcasing its versatility and adaptability. Overall, the study is well-conceived and could have some value in the field.

Numerous similar tools already exist, and the number is likely to grow, especially with advancements in AI. These tools have limited scientific utility as they provide descriptive rather than informative outputs. Microglial morphology varies due to external influences (such as developmental stages and injuries), but the significance of these variations remains largely hypothetical.

Reviewer #2 (Public review):

Summary:

In this article, Ruyle and colleagues assessed the contribution of central and peripheral mu opioid receptors in mediating fentanyl-induced respiratory depression using both nalaxone and nalaxone methiodide, which does not cross the blood brain barrier. Both compounds prevented and reversed fentanyl-induced respiratory depression to a comparable degree. The advantage of peripheral treatments is that they circumvent the withdrawal-like effects of nalaxone. Moreover, neurons located in the nucleus of the solitary tract are no longer activated by fentanyl when nalaxone methiodide is administered, suggesting that these responses are mediated by peripheral mu opioid receptors. The results delineate a role for peripheral mu opioid receptors in fentanyl-derived respiratory depression and identify a potentially advantageous approach to treating overdoses without inflicting withdrawal on the patients.

Strengths:

The strengths of the article include the intravenous delivery of all compounds, which increases the translational value of the article. The authors address both prevention and reversal of fentanyl-derived respiratory depression. The experimental design and data interpretation are rigorous and appropriate controls were used in the study. Multiple doses were screened in the study and the approaches were multipronged. The authors demonstrated activation of NTS cells using multiple techniques and the study links peripheral activation of mu opioid receptors to central activation of NTS cells. Both males and females were used in the experiments. The authors demonstrate the peripheral restriction of nalaxone methiodide.

Weaknesses:

Nalaxone is already broadly used to prevent overdoses from opioids so in some respects, the effects reported here are somewhat incremental.

Comments on the latest version:

I think the authors have adequately addressed previous critiques and I don't have any additional comments.

Reviewer #2 (Public review):

Summary:

In this study, Barzo and colleagues aim to establish an appraisal for the development of basal electrophysiology of human layer 2/3 pyramidal cells across life and compare their morphological features at the same ages.

Strengths:

The authors have generates recordings from an impressive array of patient samples, allowing them to directly compare the same electrophysiological features as a function of age and other biological features. These data are extremely robust and well organised.

The authors group patient ages into developmentally organised bins, which are elaborated on in supplementary analysis - exemplifying the importance of determining early postnatal development on human neuron function

Weaknesses:

The author's use of (perhaps) arbitrary categorisation of spine morphology could limit the full usefulness of these data.

Overall, the authors achieve their aims by assessing the physiological and morphological properties of human L2/3 pyramidal neurons across life. Their findings have extremely important ramifications for our understanding of human brain development and implications for how different neuronal properties may influence life and disease associated with neurological conditions.

Comments on revisions:

Overall, the authors have satisfied my concerns. I fully appreciate their candour with their data and the potential limitations. I especially appreciate their supplementary data inclusions which I believe truly strengthen their conclusions and are a valuable resource for the field,

I agree whole-heartedly with the authors assertion that it is perhaps better to use the most sophisticated equipment, not always being most appropriate. However, statistical rigour should still be standard. As such, my one remaining concern relates to inappropriate replicate choice of spine morphology data in figure 6. I commend the authors inclusion of additional reconstructions and morphology data from further cells in this data set. However, to me, these still represent data from 3 cells and 1 patient/age - as to the best of my interpretation. I feel it would be more helpful to plot cell averages +/- SD for each cell - even if side-by-side with data from all spines. Likewise, it is unclear what statistical test was performed on these data and did it take into account the fact that these values are a) from 3 technical replicates per group, or b) that many of the data sets consist of many zero-values (would a categorical test be more appropriate?).

Reviewer #2 (Public Review):

Summary:

This work presents new genetic tools for enhanced Cre-mediated gene deletion and genetic lineage tracing. The authors optimise and generate mouse models that convert temporally controlled CreER or DreER activity to constitutive Cre expression, coupled with the expression of tdT reporter for the visualizing and tracing of gene-deleted cells. This was achieved by inserting a stop cassette into the coding region of Cre, splitting it into N- and C-terminal segments. Removal of the stop cassette by Cre-lox or Dre-rox recombination results in the generation of modified Cre that is shown to exhibit similar activity to native Cre. The authors further demonstrate efficient gene knockout in cells marked by the reporter using these tools, including intersectional genetic targeting of pericentral hepatocytes.

Strengths:

The new models offer several important advantages. They enable tightly controlled and highly effective genetic deletion of even alleles that are difficult to recombine. By coupling Cre expression to reporter expression, these models reliably report Cre-expressing i.e. gene-targeted cells, and circumvent false positives that can complicate analyses in genetic mutants relying on separate reporter alleles. Moreover, the combinatorial use of Dre/Cre permits intersectional genetic targeting, allowing for more precise fate mapping.

Weaknesses:

The scenario where the lines would demonstrate their full potential compared to existing models has not been tested. Mosaic genetics is increasingly recognized as a key methodology for assessing cell-autonomous gene functions. The challenge lies in performing such experiments, as low doses of tamoxifen needed for inducing mosaic gene deletion may not be sufficient to efficiently recombine multiple alleles in individual cells while at the same time accurately reporting gene deletion. Therefore, a demonstration of the efficient deletion of multiple floxed alleles in a mosaic fashion would be a valuable addition.

In addition, a drawback of this line is the constitutive expression of Cre. When combined with the confetti line, the reporter cassette will continue flipping, potentially leading to misleading lineage tracing results. Constitutive expression of Cre is also associated with toxicity, as discussed by the authors in the introduction. These drawbacks should be acknowledged.

Reviewer #2 (Public review):

The authors provide valuable findings characterizing a Prosapip1 conditional knockout mouse and the effects of knockout on hippocampal excitatory transmission, NMDAR transmission, and several learning behaviors. Furthermore, the authors selectively and conditionally knockout Prosapip1 in the dorsal hippocampus and show that it is required for the same spatial learning and memory assessed in the conditional knockout mice. The study uncovers how Prosapip1 is involved PSD organization and is a functional and critical player in dorsal Hippocampal LTP via its interaction with GluN2B subunits. The study is well controlled, detailed, and data in the paper match the conclusions.

Comments on revisions:

The authors have addressed all concerns.

Reviewer #2 (Public review):

Summary:

The current paper consists of two parts. The first part is the rigorous feature optimization of the MEG signal to decode individual finger identity performed in a sequence (4-1-3-2-4; 1~4 corresponds to little~index fingers of the left hand). By optimizing various parameters for the MEG signal, in terms of (i) reconstructed source activity in voxel- and parcel-level resolution and their combination, (ii) frequency bands, and (iii) time window relative to press onset for each finger movement, as well as the choice of decoders, the resultant "hybrid decoder" achieved extremely high decoding accuracy (~95%). This part seems driven almost by pure engineering interest in gaining as high decoding accuracy as possible.<br /> In the second part of the paper, armed with the successful 'hybrid decoder,' the authors asked more scientific questions about how neural representation of individual finger movement that is embedded in a sequence, changes during a very early period of skill learning and whether and how such representational change can predict skill learning. They assessed the difference in MEG feature patterns between the first and the last press 4 in sequence 41324 at each training trial and found that the pattern differentiation progressively increased over the course of early learning trials. Additionally, they found that this pattern differentiation specifically occurred during the rest period rather than during the practice trial. With a significant correlation between the trial-by-trial profile of this pattern differentiation and that for accumulation of offline learning, the authors argue that such "contextualization" of finger movement in a sequence (e.g., what-where association) underlies the early improvement of sequential skill. This is an important and timely topic for the field of motor learning and beyond.

Strengths:

Each part has its own strength. For the first part, the use of temporally rich neural information (MEG signal) has a significant advantage over previous studies testing sequential representations using fMRI. This allowed the authors to examine the earliest period (= the first few minutes of training) of skill learning with finer temporal resolution. Through the optimization of MEG feature extraction, the current study achieved extremely high decoding accuracy (approx. 94%) compared to previous works. For the second part, the finding of the early "contextualization" of the finger movement in a sequence and its correlation to early (offline) skill improvement is interesting and important. The comparison between "online" and "offline" pattern distance is a neat idea.

Weaknesses:

Despite the strengths raised, the specific goal for each part of the current paper, i.e., achieving high decoding accuracy and answering the scientific question of early skill learning, seems not to harmonize with each other very well. In short, the current approach, which is solely optimized for achieving high decoding accuracy, does not provide enough support and interpretability for the paper's interesting scientific claim. This reminds me of the accuracy-explainability tradeoff in machine learning studies (e.g., Linardatos et al., 2020). More details follow.

There are a number of different neural processes occurring before and after a key press, such as planning of upcoming movement and ahead around premotor/parietal cortices, motor command generation in primary motor cortex, sensory feedback related processes in sensory cortices, and performance monitoring/evaluation around the prefrontal area. Some of these may show learning-dependent change and others may not.

Given the use of whole-brain MEG features with a wide time window (up to ~200 ms after each key press) under the situation of 3~4 Hz (i.e., 250~330 ms press interval) typing speed, these different processes in different brain regions could have contributed to the expression of the "contextualization," making it difficult to interpret what really contributed to the "contextualization" and whether it is learning related. Critically, the majority of data used for decoder training has the chance of such potential overlap of signal, as the typing speed almost reached a plateau already at the end of the 11th trial and stayed until the 36th trial. Thus, the decoder could have relied on such overlapping features related to the future presses. If that is the case, a gradual increase in "contextualization" (pattern separation) during earlier trials makes sense, simply because the temporal overlap of the MEG feature was insufficient for the earlier trials due to slower typing speed.

Several direct ways to address the above concern, at the cost of decoding accuracy to some degree, would be either using the shorter temporal window for the MEG feature or training the model with the early learning period data only (trials 1 through 11) to see if the main results are unaffected would be some example.

Reviewer #2 (Public review):

Summary:

In this study, Catani et al. have immunized mice with 17 recombinant N1 neuraminidases (NAs) from human isolates circulating between 2009-2020 to investigate antigenic diversity. NA inhibition (NAI) titers revealed two groups that were antigenically and phylogenetically distinct. Machine learning was used to estimate the antigenic distances between the N1 NAs and mutations at residues K432E and I321V were identified as key determinants of N1 NA antigenicity.

Strengths:

Observation of mutations associated with N1 antigenic drift.

Weaknesses:

Validation that K432E and I321V are responsible for antigenic drift was not determined in a background strain with native K432 and I321 or the restitution of antibody binding by reversion to K432 and I321 in strains that evaded sera.

Reviewer #2 (Public review):

This work present new genetic tools for enhanced Cre-mediated gene deletion and genetic lineage tracing. The authors optimise and generate mouse models that convert temporally controlled CreER or DreER activity to constitutive Cre expression, coupled with the expression of tdT reporter for the visualizing and tracing of gene-deleted cells. This was achieved by inserting a stop cassette into the coding region of Cre, splitting it into N- and C-terminal segments. Removal of the stop cassette by Cre-lox or Dre-rox recombination results in the generation of modified Cre that is shown to exhibit similar activity to native Cre. The authors further demonstrate efficient gene knockout in cells marked by the reporter using these tools, including intersectional genetic targeting of pericentral hepatocytes.

The new models offer several important advantages. They enable tightly controlled and highly effective genetic deletion of even alleles that are difficult to recombine. By coupling Cre expression to reporter expression, these models reliably report Cre-expressing i.e. gene-targeted cells and circumvent false positives that can complicate analyses in genetic mutants relying on separate reporter alleles. Moreover, the combinatorial use of Dre/Cre permits intersectional genetic targeting, allowing for more precise fate mapping.

The study and the new models have also some limitations. The demonstration of efficient deletion of multiple floxed alleles in a mosaic fashion, a scenario where the lines would demonstrate their full potential compared to existing models, has not been tested in the current study. Mosaic genetics is increasingly recognized as a key methodology for assessing cell-autonomous gene functions. The challenge lies in performing such experiments, as low doses of tamoxifen needed for inducing mosaic gene deletion may not be sufficient to efficiently recombine multiple alleles in individual cells while at the same time accurately reporting gene deletion. In addition, as discussed by the authors, a limitation of this line is the constitutive expression of Cre, which is associated with toxicity in some cases.

Reviewer #2 (Public review):

Summary:

In this manuscript, the authors examined the representational geometry of orientation representations during visual perception and working memory along the visual hierarchy. Using representational similarity analysis, they found that similarity was relatively evenly distributed among all orientations during perception, while higher around oblique orientations during WM. There were some noticeable differences along the visual hierarchy. IPS showed the most pronounced oblique orientation preferences during WM but no clear patterns during perception, likely due to the different task demands for the WM orientation task and the perception contrast discrimination task. The authors proposed two models to capture the differences. The veridical model estimated the representational geometry in perception by assuming an efficient coding framework, while the categorical model estimated the pattern in WM using psychological distances to measure the differences among orientations (including estimates from a separate psychophysical study performed outside the scanner). Therefore, I think this work is valuable and advances our understanding of the transition from perception to memory.

Strengths:

The use of RSA to identify representational biases goes beyond simply relying on response patterns and helps identify how representational formats change from perception to WM. The study nicely leverages ideas about efficient coding to explain perceptual representations that are more veridical, while leaning on ideas about abstractions of percepts that are more categorical-psychological in nature (but see (1) below). Moreover, the match between memory biases of orientation and the patterns estimated with RSA were compelling (but see (2) below). I found the analyses showing how RSA and decoding (eg, cross-generalization) are associated and how/why they may differ to be particularly interesting.

Weaknesses:

(1) The idea that later visual maps (ie, IPS0) encode perceptions of orientation in a veridical form and then in a categorical form during WM is an attractive idea. However, the support is somewhat weakened by a few issues. The RSA plots in Figure 1C for IPS0 appear to show a similar pattern, but just of lower amplitude during perception. But in the model fits either for orientation statistics or estimated from the psychophysics task, the Veridical model fits best for perception and the Categorical model fits best for memory in IPS0. By my eye, the modeled RSMs in Figures 2 & 3 do not look like the observed ones in Figure 1C. Those modeled RSMs look way more categorical than the observed IPS0. They look like something in between.

(2) My biggest concern is the omission of the in-scanner behavioral data. Yes, on the one hand, they used the N=17 outside the scanner psychophysics dataset for the analyses in Figure 3. On the other hand, they do not even mention the behavioral data collected in the scanner along with the BOLD data. Those data had clear oblique effects if I recall correctly. Why use the data from the psychophysics experiment? Also, perhaps a missed opportunity; I wonder if the Veridical/Categorical models fit a single subject's RSA data matches that subject's behavioral biases. That would really be compelling if found.

The data were collected (reanalysis of published study) without consideration for the aims of the current study, and are therefore not optimized to test their goals. The biggest issue is that "The distractors are really distracting me." I'm somewhat concerned about how the distractors may have impacted the results. I honestly did not notice that the authors were using delay periods that had 11s of distractor stimuli until way into the paper. On the one hand, the "patterns" of the model fits across the ROIs appear to be qualitatively similar. That's good if you want to pool data like the authors did. But, while the authors state on line 350 "..we also confirmed that the presence of distractors during the delay did not impact the pattern of results in the memory task (Supplementary Figure 5)." When looking at Supplementary Figure 5, I noticed that there are a couple of exceptions to this. In the Gratings distractor data, V1 shows a better fit to the Veridical model, while V4 and IPS0 shows no better fit to either model. And in the Noise distractor data, neither model fits better for any ROI. At first glance, I was concerned, but then looking at the No distractor data, the pattern is identical to that of the combined data. Thus, this can be seen as a glass half full/empty issue as almost all of the ROIs show a similar pattern, but still it would concern me if I were leading this study. This gets me to my key question, why even use the distractor trials at all, where the interpretation can get dicey? For instance, the authors have shown in this exact data that the impact of distraction affects the fidelity of representations differently along the visual hierarchy (Rademaker, 2019), consistent with several other studies (eg., Bettencourt & Xu, 2016; Lorenc, 2018; Hallenbeck et al., 2022) and with one of the author's preprints (Rademaker & Serences, 2024). My guess is that without the full dataset, some of the RSA analyses are underpowered. If that is the case, I'm fine with it, but it might be nice to state that.

Reviewer #2 (Public review):

Summary:

The manuscript describes synaptic connectivity in the Songbird cortex's four main classes of sensory neuron afferents onto three known classes of projection neurons of the pre-motor cortical region HVC. HVC is a region associated with the generation of learned bird songs. Investigators here use all male zebra finches to examine the functional anatomy of this region using patch clamp methods combined with optogenetic activation of select neuronal groups.

Strengths:

The quality of the recordings is extremely high and the quantity of data is on a very significant scale, this will certainly aid the field.

Weaknesses:

The authors could make the figures a little easier to navigate. Most of the figures use actual anatomical images but it would be nice to have this linked with a zebra finch atlas in more of a cartoon format that accompanied each fluro image. Additionally, for the most part, figures showing the labeling lack scale bar values (in um). These should be added not just shown in the legends.

The authors could make it clear in the abstract that this is all male zebra finches - perhaps this is obvious given the bird song focus, but it should be stated. The number of recordings from each neuron class and the overall number of birds employed should be clearly stated in the methods (this is in the figures, but it should say n=birds or cells as appropriate).

The authors should consider sharing the actual electrophysiology records as data.

Reviewer #2 (Public review):

Summary:

The author provide evidence that helps resolve long-standing questions about the differential involvement of frontal and posterior cortex in working memory. They show that whereas early visual cortex shows stronger decoding of memory content in a memorization task vs a more complex categorization task, frontal cortex shows stronger decoding during categorization tasks than memorization tasks. They find that task-optimized RNNs trained to reproduce the memorized orientations show some similarities in neural decoding to people. Together, this paper presents interesting evidence for differential responsibilities of brain areas in working memory.

Strengths:

This paper was overall strong. It had a well-designed task, best-practice decoding methods, and careful control analyses. The neural network modeling adds additional insight into the potential computational roles of different regions.

Weaknesses:

Few. The RNN-fMRI correspondence could be a little more comprehensive, but the paper contributes a compelling set of empirical findings and interpretations that can inform future research.

Reviewer #2 (Public review):

Dierks et al. investigate the impact of m6A RNA modifications on the mRNA life cycle, exploring the links between transcription, cytoplasmic RNA degradation and subcellular RNA localization. Using transcriptome-wide data and mechanistic modelling of RNA metabolism, the authors demonstrate that a simplified model of m6A primarily affecting cytoplasmic RNA stability is sufficient to explain the nuclear-cytoplasmic distribution of methylated RNAs and the dynamic changes in m6A levels upon perturbation. Based on multiple lines of evidence, they propose that passive mechanisms based on the restricted decay of methylated transcripts in the cytoplasm play a primary role in shaping condition-specific m6A patterns and m6A dynamics. The authors support their hypothesis with multiple large-scale datasets and targeted perturbation experiments. Overall, the authors present compelling evidence for their model which has the potential to explain and consolidate previous observations on different m6A functions, including m6A-mediated RNA export.

Reviewer #2 (Public review):

In this manuscript, the authors present an approach to correct GRIN lens aberrations, which primarily cause a decrease in signal-to-noise ratio (SNR), particularly in the lateral regions of the field-of-view (FOV), thereby limiting the usable FOV. The authors propose to mitigate these aberrations by designing and fabricating aspherical corrective lenses using ray trace simulations and two-photon lithography, respectively; the corrective lenses are then mounted on the back aperture of the GRIN lens.

This approach was previously demonstrated by the same lab for GRIN lenses shorter than 4.1 mm (Antonini et al., eLife, 2020). In the current work, the authors extend their method to a new class of GRIN lenses with lengths exceeding 6 mm, enabling access to deeper brain regions as most ventral region of the mouse brain. Specifically, they designed and characterized corrective lenses for GRIN lenses measuring 6.4 mm and 8.8 mm in length. Finally, they applied these corrected long micro-endoscopes to perform high-precision calcium signal recordings in the olfactory cortex.

Compared with alternative approaches using adaptive optics, the main strength of this method is that it does not require hardware or software modifications, nor does it limit the system's temporal resolution. The manuscript is well-written, the data are clearly presented, and the experiments convincingly demonstrate the advantages of the corrective lenses.

The implementation of these long corrected micro-endoscopes, demonstrated here for deep imaging in the mouse olfactory bulb, will also enable deep imaging in larger mammals such as rats or marmosets.

Comments on revisions:

The authors have clearly addressed all my comments.

Reviewer #2 (Public review):

Summary:

The authors sought to evaluate whether analyses of large-scale electrophysiology data obtained from 10 different individual laboratories are reproducible when they use standardized procedures and quality control measures. They were able to reproduce most of their experimental findings across all labs. Despite attempting to target the same brain areas in each recording, variability in electrode targeting was a source of some differences between datasets.

Strengths:

This paper gathered a standardized dataset across 10 labs and performed a host of state-of-the-art analyses on it. Their ability to assess the reproducibility of each analysis across this kind of data is an important contribution to the field.

Comments on revisions:

The authors have addressed almost all of the concerns that I raised in this revised version. The new RIGOR notebook is helpful, as are the new analyses.

This paper attributes much error in probe insertion trajectory planning to the fact that the Allen CCF and standard stereotaxic coordinate systems are not aligned. Consequently, it would be very helpful for the community if this paper could recommend software tools, procedures, or code to do trajectory planning that accounts for this.

I think it would still be helpful for the paper to have some discussion comparing/contrasting the use of the RIGOR framework with existing spike sorting statistics. They mention in their response to reviewers that this is indeed a large space of existing approaches. Most labs performing Neuropixels recordings already do some type of quality control, but these approaches are not standardized. This work is well-positioned to discuss the advantages and disadvantages of these alternative approaches (even briefly) but does not currently do so-it does not need to run any of these competing approaches to helpfully mention ideas for what a reader of the paper should do for quality control with their own data.

Reviewer #2 (Public review):

This is a comprehensive analysis of Salmonella Dublin genomes that offers insights into the global spread of this pathogen and region-specific traits that are important to understand its evolution. The phenotyping of isolates of ST10 and ST74 also offer insights into the variability that can be seen in S. Dublin, which is also seen in other Salmonella serovars, and reminds the field that it is important to look beyond lab-adapted strains to truly understand these pathogens. This is a valuable contribution to the field. The only limitation, which the authors also acknowledge, is the bias towards S. Dublin genomes from high income settings. However, there is no selection bias; this is simply a consequence of publicly available sequences.

Reviewer #2 (Public review):

Summary:

The study highlights the role of CRISP1 and CRISP3, two epididymal proteins, in early embryo development through DNA integrity. The authors demonstrate that C1/C3 DKO sperm exhibit defects in the DNA integrity, probably due to Ca2+ dysregulation in the epididymis. However, direct evidence for this mechanism requires further experiments. The finding of the involvement of the epididymal environment in embryogenesis is significant, but some results on sperm fertilizing ability of C1/C3 DKO mice were similar to the previous report. Thus, this point raises concern about the perspective of novelty.

Strengths:

The authors demonstrate that CRISP1 and CRISP3 regulate Ca2+ in the epididymal fluid, and loss of CRISP1 and CRISP3 disrupts Ca2+ regulation in the epididymal fluid, leading to sperm DNA fragmentation and impaired embryonic development after fertilization. This proposed mechanism is both novel and intriguing, offering valuable insights into the epididymal control of sperm quality.

Weaknesses:

The evidence supporting the mechanism of CRISP1 and CRISP3 in calcium regulation within epididymis and its contribution to the sperm DNA damage remains limited.

Major comments:

The data provided in this manuscript (Figure 2A and B) appear to overlap with data in previously published paper (PMID:33037689), despite differences in the duration of in vivo fertilization after mating. The results in both studies show similar findings, raising concerns about potential data redundancy.

As shown in Figure 6A, while wild-type sperm were exposed to the epididymal fluid of C1/C3 DKO mice, the wild-type sperm exhibited DNA fragmentation. Additionally, when wild-type sperm were exposed to the epididymal fluid of wild-type mice with 10 mM Ca2+, DNA fragmentation is still observed. Therefore, the authors conclude that the DNA fragmentation in C1/C3 DKO sperm is due to the increased level of the Ca2+. However, the connection between the DNA damage in wild-type sperm exposed to the epididymal fluid of C1/C3 DKO mice and the increased levels of Ca2+ remains unclear. To clarify this, it is suggested that intracellular calcium levels in the wild type sperm should be analyzed before and after exposure to the epididymal fluid of C1/C3 DKO mice (or before and after adding 10 mM Ca2+ into wild-type fluid). Furthermore, the author should explain detailed information on epididymal fluid collection, because Ca2+ levels vary between different sections of the epididymis.

In lines 321-323, the authors mention the selection system of the female reproductive tract that only allows high-quality sperm to reach the eggs (Cummins and Yanagimachi 1982), but this paper is not listed in the bibliography. It is important to ensure proper referencing.

The discussion section is too long and difficult to follow well because there is redundancy of the results in many parts. It is recommended to shorten it by focusing only on relevant and important information.

Reviewer #2 (Public review):

In their manuscript entitled "BEND2 is a crucial player in oogenesis and reproductive aging", the authors present their findings that full-length BEND2 is important for repair of meiotic double strand break repair in spermatocytes, regulation of LINE-1 elements in spermatocytes, and proper oocyte meiosis and folliculogenesis in females. The manuscript utilizes an elegant system to specifically ablate the full-length form of BEND2 which has been historically difficult to study due to its location on the X chromosome and male sterility of global knockout animals.

The authors have been extremely responsive to reviewer critiques and have presented strong data and appropriate conclusions, making it an excellent addition to the field.

Reviewer #2 (Public review):

Summary:

The authors investigated DG neuronal activity at the population and single cell level across sleep/wake periods. They found an infraslow oscillation (0.01-0.03 Hz) in both granule cells (GC) and mossy cells (MC) during NREM sleep. The important findings are:

(1) The antiparallel temporal dynamics of DG neuron activities and serotonin neuron activities/extracellular serotonin levels during NREM sleep<br /> (2) The GC Htr1a-mediated GC infraslow oscillation.

Strengths:

(1) The combination of polysomnography, Ca-fiber photometry, two-photon microscopy and gene depletion is technically sound. The coincidence of microarousals and dips in DG population activity is convincing. The dip in activity in upregulated cells is responsible for the dip at the population level.

(2) DG GCs express excitatory Htr4 and Htr7 in addition to inhibitory Htr1a, but deletion of Htr1a is sufficient to disrupt DG GC infraslow oscillation, supporting the importance of Htr1a in DG activity during NREM sleep.

Weaknesses from the original round of review:

(1) The current data set and analysis are insufficient to interpret the observation correctly [...].

(2) It is acceptable that DG Htr1a KO induces the reduced freezing in the CFC test (Fig. 6E, F), but it is too much of a stretch that the disruption of DG ISO causes impaired fear memory. There should be a correlation.

(3) It is necessary to describe the extent of AAV-Cre infection. The authors injected AAV into the dorsal DG (AP -1.9 mm), but the histology shows the ventral DG (Supplementary Fig. 4), which reduces the reliability of this study.

Comments on revisions:

Thank you for the clarification of the detection criteria and the quantification of the specific events. This reviewer can now follow the authors' interpretation.

Reviewer #2 (Public review):

Summary:

In this well-conceived and timely study, the authors assess the controllability of emotions in a quantitative way using the framework of control theory. They use a controlled distancing intervention halfway through an emotion rating task where emotion-inducing short videos from a validated database are shown and find that the intervention enables a better controllability of externally induced emotions in the experimental group.

Strengths:

It is a highly original idea to address the external controllability of emotions using the formal framework of control theory. It is also a very propitious approach to take what could be called a 'micro-therapeutic' perspective which looks at the immediate effect of an intervention instead of the 'macro-therapeutic' mid- or long-term effect of a whole course of therapy.

Weaknesses:

Acquiring data online inevitably gives rise to selection and self-selection effects. This needs to be acknowledged clearly. Exacerbating this, participant remuneration seems low at an amount below the minimum or living wage in Western countries (do the authors know where their participants came from?).

Another concern is that the intervention does not simply take place before the second block begins but is ongoing during the whole of the second block in that it is integrated into the phrasing of the task on each trial. It is therefore somewhat misleading to speak of a period 'after the intervention', and it would have been interesting to assess the effect of this by including a third group where the phrasing does not change, but the floating leaves intervention takes place.

As mentioned in the Limitations section, observation noise was assumed and not estimated. While this is understandable in this case, the effect of this assumption could have been assessed by simulation with varying levels of observation (and process) noise.

Relatedly, the reliance on formal model comparison is unfortunate since the outcome of such comparisons is easily influenced by slight changes to assumptions such as noise levels. An alternative approach would have been to develop a favoured model based on its suitability to address the research question and its ability, established by simulation, to distill relevant changes of behaviour into reliable parameter estimates.

The statistical analyses clearly show the limitations of classical statistical testing with highly complex models of the kind the authors (commendably) use. Hunting for statistically significant interactions in a multivariate repeated-measures design relying on inputs from time series-derived point estimates is a difficult proposition. While the authors make the best of the bad situation they create by using null-hypothesis significance testing, a more promising approach would have been to estimate parameters using a sampler like Stan or PyMC and then draw conclusions based on posterior predictive simulations.

Reviewer #2 (Public review):

Summary:

The report by Kohwi-Shigematsu et al. describes the key observation that SATB1 binds directly to so-called BUR elements. This is in contrast to several other reports describing SATB1 binding to promoters and enhancers. This discrepancy is explained by the authors to depend on the features of the ChIP technique being used. Urea-ChIP, innovated by the authors, strips off protein-protein interactions that are maintained in conventional ChIP. The authors convincingly make the case that SATB1 and the key genome organiser CTCF co-localize by conventional ChIP but not urea ChIP, as particularly evident in Figure 2A. SATB1 controls long-range interactions in thymocytes and the expression of gene clusters. This feature is independent of TADs, as the knockdown of SATB1 expression does not affect the TAD patterns.

Strengths:

A new and innovative adaptation of the urea ChIP-seq technique has enabled the authors to reveal a new aspect of SATB1 binding to the genome. The authors provide a wealth of data to reinforce their claims. This report thus sheds new light on SATB1 function, which is particularly important given its role in metastasising cancer cells.

Weaknesses:

No weaknesses were identified by this reviewer.

Reviewer #2 (Public review):

Summary:

This study identifies a key role for bodywide canonical Wnt gradients in controlling the outcome of regeneration within planarians, likely acting in parallel to injury-induced cues that also use tissue asymmetry to control this process. In S. Mediterranea a central part of this decision process is the asymmetric expression of the Wnt inhibitor notum specifically at injury sites facing in the anterior direction to promote head formation and inhibit tail formation through regulation of canonical Wnt signaling pathways. Leveraging classic studies by T.H. Morgan over a century ago, which found that amputated thin transverse fragments occasionally incorrectly regenerate 2 heads rather than a head and a tail in a species of Girardia planarians, this study identifies a closely related species G. Sinensis which undergoes errors to regeneration specificity under similar challenges. Morgan had proposed that his results might arise from the use of a "gradient of materials" providing axis information across the body axis such that small tissue fragments are too narrow to interpret gradient differences, leading to head/tail polarity defects in regeneration. The authors show very convincingly that this species of planaria undergoes notum expression after injury, but unlike in S. Mediterranea, this occurs symmetrically at the onset of regeneration. Using RNAi, they show notum participates in the regeneration of mispolarized heads (though interestingly apparently not in normal head regeneration unlike in Smeds, at least under these conditions). G. Sinensis planarians, like many organisms, have abundant expression of Wnt genes posteriorly. To test whether this gradient of Wnts may participate in the regeneration distinct from any Wnt signals activated after injury, the authors use chemical inhibition to reduce Wnt signaling prior to injury and then alleviate inhibition following injury by removal of the drug and confirming successful washout of the drug using mass spec. They also raise a new antibody that can detect beta-catenin-1 in this species in order to monitor the body-wide cWnt gradient after these treatments, and correlate this with outcomes on the head/tail regeneration decision. Using this approach, they find that homeostatic inhibition of porcupine (required for Wnt secretion) could dampen the cWnt/beta-catenin gradient and increase the incidence of inappropriate head regeneration at posterior-facing wounds. In addition, they find that the cWnt gradient is less steep in larger animals that also concurrently have a higher incidence of mistakes in regeneration specificity. Together, the paper presents compelling experiments and analysis to support the conclusion that cWnt gradients are an important determinant of head/tail identity determination decisions in G. Sinensis, and thereby proposes a plausible model that the notum asymmetry present in S. Mediterranea could act in parallel to support the higher regeneration robustness observed in that species.

Strengths:

This is a great paper, an instant classic. It addresses an enduring problem that Morgan and others initiated more than a century ago and brings a new synthesis of ideas to clarify an important mechanism. I also like the term "regeneration specificity" which can provide a nice unification and generalization of ideas that other authors have variously described as regeneration patterning or regeneration polarity. The work is a tour de force that creatively builds new tools and observations to leverage a new model of planarian species for unraveling general mechanisms of regeneration decision-making. The experiments are rigorously conducted and I find the overall data to be quite compelling. I have some comments for the authors to consider below for drawing out the interpretation and also clarifying the underlying mechanism.

Comments:

(1) The G. Sinesis species showed accurate head/tail specificity in 2mm thick fragments but was strongly impaired at 1 mm thick. I am assuming that outcomes of pieces greater than 2mm would make similarly robust head/tail choices, implying a rather sharp transition occurring between 1 and 2 mm. In that case, in the gradient model, are there theoretical reasons to predict that polarity outcomes would decline sharply rather than gradually as size thickness decreases? I think the muscle fibers themselves are thought to have lengths on the order of 200 microns, so I wonder what could account for the characteristic length of less than 1mm here? From the lab's prior analysis of beta-cat gradient, is this perhaps the minimal length where a difference in bcat protein levels can be detected? This is not essential to resolve in this draft (in my view), just a very interesting question arising from the present study. Relatedly, it seems that the slope of cWnt at the wound site itself might not be enough information for polarity because at a highly granular level, this should be identical at posterior-facing wounds from trunk fragments versus thin transverse fragments obtained at the same AP position, yet trunk fragments succeed at regeneration specificity whereas thin transverse fragments fail.

(2) The paper nicely shows strong evidence that notum expression is definitely symmetric at the first occurrence of its expression by 6 hours in D. Sinensis, and this is a really important result of the paper. At 12 hours, it does look to me in the FISH experiments that there is more persistence of expression at the anterior-facing wound versus the posterior-facing wounds (Fig 2D), although the methods for quantification in Fig2E/F do not show a difference in expression at the two wound sites at this time point. Could this difference arise from differences in the perdurance or timing of early wound-induced signaling at the two wound sites that was perhaps too subtle to detect in the quantification methods used? Or perhaps these images do not represent the population? On a related note, the quantification method seems to fail to show that in 6h Smeds, notum expression is indeed asymmetric. Probably the issue here is not the data in the FISH images themselves which strongly support the author's interpretations, but rather a deficiency or limitation of the quantification method used, which should be resolved so that the conclusions from the single FISH images can be interpreted robustly. For example, some authors have used a method of counting notum+ cells and I wonder if this could provide better quantitative information here.

(3) Given that the double-headed phenotype is observed from thin transverse fragments, ideally, the symmetry of notum could be established to occur in those types of fragments as well. This experiment would clarify that notum is expressed at posterior-facing wounds in the very same types of fragments that undergo the highest levels of mistakes in regeneration specificity.

(4) Is wnt1 expressed symmetrically at wound sites in this species? It seems there are cases like acoels where wound-induced Wnt activation can occur asymmetrically but through preferential expression of Wnts at posterior-facing wounds, rather than notum. It would be interesting to know although I also think the work the authors already have done in this study itself already constitutes a very comprehensive advance and could be the subject of future work.

(5) I agree that notum is relatively much more strongly expressed at the far posterior region in D. Senesis than in Smeds, but it does seem from the RNAseq data it also has some locally enriched expression at the anterior pole. Because the RNAseq analysis involves scaling expression across the regions for each gene, it is difficult to know if the anterior expression is relatively lower or perhaps even about the same level of expression as the anterior pole expression of this gene in Smeds. Though not essential to make the desired arguments, in situs on notum in the intact animals would be helpful to clarify this. Relatedly it would be fascinating to know whether D. Senesis notum undergoes anterior-pole expression around the 72 hour or similar timepoint as in Smeds.

(6) The assessment of beta-catenin gradients was done through protein extractions from whole tissue fragments. However, it has been shown in other planarian species that beta-catenin can have strong tissue-specific expression in, for example, the pharynx, brain, and reproductive systems. Some supporting evidence or argument should be presented to clarify the interpretation that the graded expression observed by western blotting cannot be fully explained by this kind of tissue-specific expression of beta-catenin rather than representing a true signaling gradient as interpreted by the authors. For example, if this antibody could be used in immunostaining, this could support the beta-catenin signaling gradient. Alternatively, information about the location of the pharynx or any other posterior reproductive tissues in D. Sinensis could be calibrated with respect to the fragment bins used for the gradient--perhaps a portion of the C59-dependent body-wide gradient measured here occurs fully within tail tissue that lacks other regionalized tissue that could be a potential additional source of beta-catenin. Further discussion and interpretation, or additional experiments, should be included to rule out alternative confounding sources of beta-catenin in order to clarify the interpretation of the western blot as representing a beta-catenin signaling gradient.

(7) I find the analysis in Figure 5 to be quite compelling for showing the importance of cWnt/Bcat gradients in contributing to head/tail determination, and I also think that the author's discussion of the limitations of the approach are well articulated and considered. Based on prior literature, it also seems very likely that there is a third redundantly acting component to regeneration specificity, which is the amplification of small differences in cWnt in a directional-dependent manner early in the regeneration process (24-72 hours in Smeds). This would explain why post-amputation with porcupine inhibitor in D. Sinensis caused 100% penetrant defects in regeneration specificity while the pre-treatment paradigm caused a weaker effect (25-40% for larger animals). In Smeds, it is known already that delivery of dsRNAs against beta-catenin-1, wnt1, and notum only after injury caused polarity defects, and thus all three genes certainly have a function relevant for head/tail after injury (Petersen and Reddien 2008, 2009, 2011- please note these experiments were reported in the text of these studies and not in individual figures). This evidence, combined with extensive FISH and complementary RNAi studies in the field, strongly suggests that some combination of the 6-18h injury-induced phase but also very likely the subsequent "pole-specific phase" of wnt1 expression is likely to be important for driving or enacting the tail fate program and is therefore a component of the regeneration specificity mechanism described here.

(8) Prior work has also demonstrated roles for Wnt genes expressed in gradients to participate in regeneration specificity. In particular, inhibition of the wntP-2/wnt11-5 gene, which is expressed in an animal-wide gradient, strongly enhanced the effects of inhibition of wnt1, which is the earliest wound-activated Wnt gene, to cause 100% penetrant posterior head regeneration phenotypes in S. mediterranea (Petersen and Reddien 2009). These observations are complementary to the present study by implicating Wnts expressed in bodywide gradients in the process of regeneration decision-making. Given that this study also showed that wnt1 is necessary for new wntP-2 expression during the wound-induced early phase and that wnt1 activation does not require beta-catenin for its expression, collectively suggest a more complex process involved in gradient detection and the involvement of wound signals likely beyond only autoregulation of the cWnt gradient or notum asymmetry mechanisms. Although this paper is cited already, framing the present study more fully in context with this and other relevant prior work would be helpful to contextualize the advance for the field.

Reviewer #2 (Public review):

Summary:

This study introduces a set of genetically encoded tools for the selective and reversible ablation of excitatory and inhibitory synapses. Previously, the authors developed GFE3, a tool that efficiently ablates inhibitory synapses by targeting an E3 ligase to the inhibitory scaffolding protein Gephyrin via GPHN.FingR, a recombinant, antibody-like protein (Gross et al., 2016). Building on this work, they now present three new ablation tools: PFE3, which targets excitatory synapses, and two new versions of GFE3-paGFE3 and chGFE3-that are photoactivatable and chemically inducible, respectively. These tools enable selective and efficient synapse ablation in specific cell types, providing valuable methods for disrupting neural circuits. This approach holds broad potential for investigating the roles of specific synaptic input onto genetically determined cells.

Strengths:

The primary strength of this study lies in the rational design and robust validation of each tool's effectiveness, building on previous work by the authors' group (Gross et al., 2016). Each tool serves distinct research needs: PFE3 enables efficient degradation of PSD-95 at excitatory synapses, while paGFE3 and chGFE3 allow for targeted degradation of Gephyrin, offering spatiotemporal control over inhibitory synapses via light or chemical activation. These tools are efficiently validated through robust experiments demonstrating reductions in synaptic markers (PSD-95 and Gephyrin) and confirming reversibility, which is crucial for transient ablation. By providing tools with both optogenetic and chemical control options, this study broadens the applicability of synapse manipulation across varied experimental conditions, enhancing the utility of E3 ligase-based approaches for synapse ablation.

Weaknesses:

While this study provides valuable tools and addresses many critical points for varidation, examining potential issues with specificity and background ubiquitination in further detail could strengthen the paper. For PFE3, the study demonstrates reductions in both PSD-95 and GluA1. In their previous work, GFE3 selectively reduced Gephyrin without affecting major Gephyrin interactors or other PSD proteins. Clarifying whether PFE3 affects additional PSD proteins beyond GluA1 would be important for accurately interpreting results in experiments using PFE3. Additionally, further insight into PFE3's impact on inhibitory synapses would be valuable to assess the excitatory specificity and potential for circuit-level applications. For paGFE3 and chGFE3, the E3 ligase (RING domain of Mdm2) is overexpressed and thus freely diffusible within the cell as a separate construct. Although the authors show that Gephyrin is not significantly reduced without light or chemical activation, it remains possible that other proteins, particularly non-synaptic proteins, could be ubiquitinated due to the presence of freely diffusing E3 ligase in cytosol. Addressing these points would clarify the strengths and limitations of tools, providing users with valuable information.

Reviewer #2 (Public review):

Summary:

By measuring intracellular changes in membrane voltage from a single neuron of the medulla the authors describe a method for determining the balance of excitatory and inhibitory synaptic drive onto a single neuron within this important brain region.

Strengths:

This data-driven approach to exploring neural circuits is well described and could be valuable in identifying microcircuits that generate rhythms. Importantly, perhaps, this inference method could enable microcircuits to be studied without the need for time consuming anatomical tracing or other more involved electrophysiological techniques. Therefore, I definitely can see the value in developing an approach of this type.

Weaknesses:

There are many assumptions that need to be accepted in order to successfully apply this technique and I was pleased to see that several of these assumption have been explored by the authors in this study.

For example, this approach involves assuming the reversal potential that is associated with the different permeant ions that underlie the excitation and inhibition as well as the application of Ohms law to estimate the contribution of excitation and inhibitory conductance. My first concern was that this approach relies on a linear I-V relationship between the measured voltage and the estimated reversal potential. However, open rectification is a feature of any I-V relationship generated by asymmetric distributions of ions (see the GHK current equation) and will therefore be a particular issue for the inhibition resulting from asymmetrical Cl- ion gradients across GABA-A receptors. The mixed cation conductance that underlies most synaptic excitation will also generate a non-linear I-V relationship due to the inward rectification associated with polyamine block of AMPA receptors. The authors present evidence that over most of the voltage range examined the I-V relationship is linear and this is a helpful addition.

This approach has similarities to earlier studies undertaken in the visual cortex that estimated the excitatory and inhibitory synaptic conductance changes that contributed to membrane voltage changes during receptive field stimulation. However, these approaches also involved the recording of transmembrane current changes during visual stimulation that were undertaken in voltage-clamp at various command voltages to estimate the underlying conductance changes. Molkov et al have attempted to essentially deconvolve the underlying conductance changes without this information and I am concerned that this simply may not be possible.

The current balance equation (1) cited in this study is based upon the parallel conductance model developed by Hodgkin & Huxley. One key element of the HH equations is the inclusion of an estimate of the capacitive current generated due to the change in voltage across the membrane capacitance. While the present study takes into account the impact of membrane capacitance, a deeper discussion on how variations in capacitance across different neuron types might affect inference accuracy would be useful. Differences in capacitance could introduce variability in inferred conductances, potentially influencing model predictions.

Studies using acute slicing preparations to examine circuit effects have often been limited to the study of small microcircuits - especially feedforward and feedback interneuron circuits. It is widely accepted that any information gained from this approach will always be compromised by the absence of patterned afferent input from outside the brain region being studied. In this study, descending control from the Pons and the neocortex will not be contributing much to the synaptic drive and ascending information from respiratory muscles will also be absent completely. This may not have been such a major concern if this study was limited to demonstrating the feasibility of a methodological approach. However, this limitation does need to be considered when using an approach of this type to speculate on the prevalence of specific circuit motifs within the medulla (Figure 4). Therefore, I would argue that some discussion of this limitation should be included in this manuscript.

Reviewer #2 (Public review):

Summary:

The study examined 10 congenitally blind patients who recovered vision through the surgical removal of bilateral dense cataracts, measuring neural activity and neuro chemical profiles from the visual cortex. The declared aim is to test whether restoring visual function after years of complete blindness impacts excitation/inhibition balance in the visual cortex. The manuscript reports precious behavioural, electrophysiological and magnetic resonance data from a rare population. Although the findings are useful for stimulating further research in the field, they only provide incomplete support to the authors' claims.

The main claim is that sight recovery impacts the excitation/inhibition balance in the visual cortex; however, the paradigm does not allow to distinguish the effects of sight recovery from those of visual deprivation (i.e. in patients who were born blind but recovered vision after several months/years vs. patients who were born blind and never recovered vision); moreover, the link between electrophysiological findings and cortical excitation/inhibition is tentative and its interpretation remains speculative.

Strengths:

The findings are undoubtedly useful for the community, as they contribute towards characterising the many ways in which this special population differs from normally sighted individuals. The combination of MRS and EEG measures is a promising strategy to estimate a fundamental physiological parameter - the balance between excitation and inhibition in the visual cortex, which animal studies show to be heavily dependent upon early visual experience. Thus, the reported results pave the way for further studies, which may use a similar approach to evaluate more patients and control groups.

Weaknesses:

The main methodological limitation is the lack of an appropriate comparison group or condition to delineate the effect of sight recovery (as opposed to the effect of congenital blindness). Few previous studies suggested that Excitation/Inhibition ratio in the visual cortex is increased in congenitally blind patients; the present study reports that E/I ratio decreases instead. The authors claim that this implies a change of E/I ratio following sight recovery. However, supporting this claim would require showing a shift of E/I after vs. before the sight-recovery surgery, or at least it would require comparing patients who did and did not undergo the sight-recovery surgery (as common in the field).

There are also more technical limitations related to the correlation analyses, which are partly acknowledged in the manuscript. A bland correlation between GLX/GABA and the visual impairment is reported, but this is specific to the patients group (N=10) and would not hold across groups (the correlation is positive, predicting the lowest GLX/GABA ratio values for the sighted controls - opposite of what is found). There is also a strong correlation between GLX concentrations and the EEG power at the lowest temporal frequencies. Although this relation is intriguing, it only holds for a very specific combination of parameters (of the many tested): only with eyes open, only in the patients group.

Conclusions:

The main claim of the study is that sight recovery impacts the excitation/inhibition balance in the visual cortex, estimated with MRS or through indirect EEG indices. However, due to the weaknesses outlined above, the study cannot distinguish the effects of sight recovery from those of visual deprivation. Moreover, many aspects of the results are interesting but their validation and interpretation require additional experimental work.

Comments on revisions:

The authors' revisions did not substantially alter the manuscript. As such, my assessment above remains unaltered.

Reviewer #3 (Public review):

Summary:

The authors investigate the extent to which the responses of different layers of a vision model (VGG-11) can be linked to the cascade of responses (namely, type-I, type-II and N400) in the human brain when reading words. To achieve maximal consistency between, they add noisy-activations to VGG and finetune it on a character recognition task. In this setup, they observe various similarities between the behavior of VGG and the brain when presented with various transformations of the words (added noise, font modification etc).

Strengths:<br /> - The paper is well written and well presented<br /> - The topic studied is interesting.<br /> - The fact that the response of the CNN on unseen experimental contrasts such as adding noise correlated with previous results on the brain is compelling.

Weaknesses:<br /> - The paper is rather qualitative in nature. In particular, the authors show that some resemblance exists between the behavior of some layers and some parts of the brain, but it is hard to quantitively understand how strong the resemblences are in each layer, and the exact impact of experimental settings such as the frequency balancing (which seems to only have a very moderate effect according to figure 5)<br /> - The experiments only consider a rather outdated vision model (VGG)

Comments on revisions:

After rebuttal, the authors significantly strengthened their results. I now find the paper much more convincing, and thank the author for their careful consideration of the reviewers' suggestions.

Reviewer #2 (Public review):

Wolbachia are maternally transmitted bacteria that can manipulate host reproduction in various ways. Some Wolbachia induce male killing (MK), where the sons of infected mothers are killed during development. Several MK-associated genes have been identified in Homona magnanima, including Hm-oscar and wmk-1-4, but the mechanistic links between these Wolbachia genes and MK in the native host are still unclear.

In this manuscript, Arai et al. show that Hm-oscar is the gene responsible for Wolbachia-induced MK in Homona magnanima. They provide evidence that Hm-Oscar functions through interactions with the sex determination system. They also found that Hm-Oscar disrupts sex determination in male embryos by inducing female-type dsx splicing and impairing dosage compensation. Additionally, Hm-Oscar suppresses the function of Masc. The manuscript is well-written and presents intriguing findings. The results support their conclusions regarding the diversity and commonality of MK mechanisms, contributing to our understanding of the mechanisms and evolutionary aspects of Wolbachia-induced MK.

Reviewer #2 (Public review):

This paper examines the reproducibility of results reported by the Murphy lab regarding transgenerational inheritance of a learned avoidance behavior in C. elegans. It has been well established by multiple labs that worms can learn to avoid the pathogen pseudomonas aeruginosa (PA14) after a single exposure. The Murphy lab has reported that learned avoidance is transmittable to 4 generations and dependent on a small RNA expressed by PA14 that elicits the transgenerational silencing of a gene in C. elegans. The Hunter lab now reports that although they can reproduce inheritance of the learned behavior by the first generation (F1), they cannot reproduce inheritance in subsequent generations.

This is an important study that will be useful for the community. Although they fail to identify a "smoking gun", the study examine several possible sources for the discrepancy, and their findings will be useful to others interested in using these assays. The preference assay appears to work in their hands in as much as they are able to detect the learned behavior in the P0 and F1 generations, suggesting that the failure to reproduce the transgenerational effect is not due to trivial mistakes in the protocol. The authors provide a full protocol and highlight key deviations from the Murphy lab protocol. The authors provide good evidence that no single protocol modification was sufficient on its own to explain the divergent results. It remains possible that protocol differences affected the assay cumulatively or that other uncontrolled factors were responsible. Nevertheless, the authors provide good evidence that the trans-generational effect reported by the Murphy lab lacks experimental robustness, calling into question its ecological relevance in the wild.

Reviewer #3 (Public review):

Chen et al have identified a new candidate gene for high myopia, ZC3H11A, and using a knock-out mouse model, have attempted to validate it as a myopia gene and explain a potential mechanism. They identified 4 heterozygous missense variants in highly myopic teenagers. These variants are in conserved regions of the protein, and predicted to be damaging, but the only evidence the authors provide that these specific variants affect protein function is a supplement figure showing decreased levels of IκBα after transfection with overexpression plasmids (not specified what type of cells were transfected). This does not prove that these mutations cause loss of function, in fact it implies they have a gain-of-function mechanism. They then created a knock-out mouse. Heterozygotes show myopia at all ages examined but increased axial length only at very early ages. Unfortunately, the authors do not address this point or examine corneal structure in these animals. They show that the mice have decreased B-wave amplitude on electroretinogram (a sign of retinal dysfunction associated with bipolar cells), and decreased expression of a bipolar cell marker, PKCα. On electron microscopy, there are morphologic differences in the outer nuclear layer (where bipolar, amacrine, and horizontal cell bodies reside). Transcriptome analysis identified over 700 differentially expressed genes. The authors chose to focus on the PI3K-AKT and NF-κB signaling pathways and show changes in expression of genes and proteins in those pathways, including PI3K, AKT, IκBα, NF-κB, TGF-β1, MMP-2 and IL-6, although there is very high variability between animals. They propose that myopia may develop in these animals either as a result of visual abnormality (decreased bipolar cell function in the retina) or by alteration of NF-κB signaling. These data provide an interesting new candidate variant for development of high myopia, and provide additional data that MMP2 and IL6 have a role in myopia development. For this revision, none of my previous suggestions have been addressed.

Reviewer #2 (Public review):

Summary:

The authors present a straightforward and convincing demonstration of a reagent and workflow that they collectively term "MagIC-cryo-EM", in which magnetic nanobeads combined with affinity linkers are used to specifically immobilize and locally concentrate complexes that contain a protein-of-interest. As a proof of concept, they localize, image, and reconstruct H1.8-bound nucleosomes reconstructed from frog egg extracts. The authors additionally devised an image-processing workflow termed "DuSTER", which increases the true positive detections of the partially ordered NPM2 complex. The analysis of the NPM2 complex {plus minus} H1.8 was challenging because only ~60 kDa of protein mass was ordered. Overall, single-particle cryo-EM practitioners should find this study useful.

Strengths:

The rationale is very logical and the data are convincing.

Weaknesses:

I have seen an earlier version of this study at a conference. The conference presentation was much easier to follow than the current manuscript. It is as if this manuscript had undergone review at another journal and includes additional experiments to satisfy previous reviewers. Specifically, the NPM2 results don't seem to add much to the main story (MagIC-cryo-EM) and read more like an addendum. The authors could probably publish the NPM2 results separately, which would make the core MagIC results (sans DusTER) easier to read.

Comments on revisions:

The authors have addressed my concerns. Congratulations!

Reviewer #3 (Public review):

Summary:

Previous studies have analyzed the binding of ZapD to FtsZ and provided images of negatively stained toroids and straight bundles, where FtsZ filaments are presumably crosslinked by ZapD dimers. Toroids without ZapD have also been previously formed by treating FtsZ with crowding agents. The present study is the first to apply cryoEM tomography, which can resolve the structure of the toroids in 3D. This shows a complex mixture of filaments and sheets irregularly stacked in the Z direction and spaced radially. The most important interpretation would be to distinguish FtsZ filaments from ZapD crosslinks, This is less convincing. The authors seem aware of the ambiguity: "However, we were unable to obtain detailed structural information about the ZapD connectors due to the heterogeneity and density of the toroidal structures, which showed significant variability in the conformations of the connections between the filaments in all directions." Therefore, the reader may assume that the crosslinks identified and colored red are only suggestions, and look for their own structural interpretations. But readers should also note some inconsistencies in stoichiometry and crosslinking arrangements that are detailed under "weaknesses."

Strengths.

This is the first cryoEM tomography to image toroids and straight bundles of FtsZ filaments bound to ZapD. A strength is the resolution, which. at least for the straight bundles. is sufficient to resolve the ~4.5 nm spacing of ZapD dimers attached to and projecting subunits of an FtsZ filament. Another strength is the pelleting assay to determine the stoichiometry of ZapD:FtsZ (although this also leads to weaknesses of interpretation).

Weaknesses

The stoichiometry presents some problems. Fig. S5 uses pelleting to convincingly establish the stoichiometry of ZapD:FtsZ. Although ZapD is a dimer, the concentration of ZapD is always expressed as that of its subunit monomers. Fig. S5 shows the stoichiometry of ZapD:FtsZ to be 1:1 or 2:1 at equimolar or high concentrations of ZapD. Thus at equimolar ZapD, each ZapD dimer should bridge two FtsZ's, likely forming crosslinks between filaments. At high ZapD, each FtsZ should have it's own ZapD dimer. However, this seems contradicted by later statements in Discussion and Results. (1) "At lower concentrations of ZapD, .. toroids are the most prominent structures, containing one ZapD dimer for every four to six FtsZ molecules." Shouldn't it be one ZapD dimer for every two FtsZ? (2) "at the high ZapD concentration...a ZapD dimer binds two FtsZ molecules connecting two filaments." Doesn't Fig. S5 show that each FtsZ subunit has its own ZapD dimer? And wouldn't this saturate the CTD sites with dimers and thus minimize crosslinking?

A major weakness is the interpretation of the cryoEM tomograms, specifically distinguishing ZapD from FtsZ. The distinction of crosslinks seems based primarily on structure: long continuous filaments (which often appear as sheets) are FtsZ, and small masses between filaments are ZapD. The density of crosslinks seems to vary substantially over different parts of the figures. More important, the density of ZapD's identified and colored red seem much lower than the stoichiometry detailed above. Since the mass of the ZapD monomer is half that of FtsZ, the 1:1 stoichiometry in toroids means that 1/3 of the mass should be ZapD and 2/3 FtsZ. However, the connections identified as ZapD seem much fewer than the expected 1/3 of the mass. The authors conclude that connections run horizontally, diagonally and vertically, which implies no regularity. This seems likely, but as I would suggest that readers need to consider for themselves what they would identify as a crosslink.

In contrast to the toroids formed at equimolar FtsZ and ZapD, thin bundles of straight filaments are assembled in excess ZapD. Here the stoichiometry is 2:1, which would mean that every FtsZ should have a bound ZapD DIMER. The segmentation of a single filament in Fig. 5e seems to agree with this, showing an FtsZ filament with spikes emanating like a picket fence, with a 4.5 nm periodicity. This is consistent with each spike being a ZapD dimer, and every FtsZ subunit along the filament having a bound ZapD dimer. But if each FtsZ has its own dimer, this would seem to eliminate crosslinking. The interpretative diagram in Fig. 6, far right, which shows almost all ZapD dimers bridging two FtsZs on opposite filaments, would be inconsistent with this 2:1 stoichiometry.

In the original review I suggested a control that might help identify the structures of ZapD in the toroids. Popp et al (Biopolymers 2009) generated FtsZ toroids that were identical in size and shape to those here, but lacking ZapD. These toroids of pure FtsZ were generated by adding 8% polyvinyl chloride, a crowding agent. The filamentous substructure of these toroids in negative stain seemed very similar to that of the ZapD toroids here. CryoET of these toroids lacking ZapD might have been helpful in confirming the identification of ZapD crosslinks in the present toroids. However, the authors declined to explore this control.

Finally, it should be noted that the CTD binding sites for ZapD should be on the outside of curved filaments, the side facing the membrane in the cell. All bound ZapD should project radially outward, and if it contacted the back side of the next filament, it should not bind (because the CTD is on the front side). The diagram second to right in Fig. 6 seems to incorporate this abortive contact.

Reviewer #2 (Public review):

Summary:

The authors carry out a careful and rigorous quantitative analysis of RecB transcript and protein levels at baseline and in response to DNA damage. Using single-molecule FISH and Halo-tagging in order to achieve sensitive measurements, they provide evidence that enhanced RecB protein levels in response to DNA damage are achieved through a post-transcriptional mechanism mediated by the La-like RNA binding protein, Hfq. In terms of biological relevance, the authors suggest that this mechanism provides a way to control the optimum level of RecB expression as both deletion and over-expression are deleterious. In addition, the proposed mechanism provides a new framework for understanding how transcriptional noise can be suppressed at the protein level.

Strengths:

Strengths of the manuscript include the rigorous approaches and orthogonal evidence to support the core conclusions, for example, the evidence that altering either Hfq or its recognition sequence on the RNA similarly enhance the protein to RNA ratio of RecB. The writing is clear and the experiments are well-controlled. The modeling approaches provide essential context to interpret the data, particularly given the small numbers of molecules per cell. The interpretations are careful and well supported. The findings

Weaknesses:

Future studies (and possibly new experimental tools) will be needed to provide further insight into the relevance of the findings to more subtle changes in RecB levels than that occurring in response to extensive DNA damage.

Reviewer #2 (Public review):

Summary:

Many aspects of the study are carefully done, and in the grand scheme this is a solid contribution. I have no "big-picture" concerns about the approach or methodology. However, in numerous places the manuscript is unnecessarily vague, ambiguous, or confusing. Tightening up the presentation will magnify their impact.

Strengths:

(1) The study includes urine donors from males of three strains each with three social states, as well as females in two states. This diversity significantly enhances their ability to interpret their results.

(2) Several distinct analyses are used to explore the question of whether AOB MCs are biased towards specific states or different between estrus and non-estrus females. The results of these different analyses are self-reinforcing about the main conclusions of the study.

(3) The presentation maintains a neutral perspective throughout while touching on topics of widespread interest.

Weaknesses:

(1) Introduction:<br /> The discussion of the role of the VNS and preferences for different male stimuli should perhaps include Wysocki and Lepri 1991

(2) Results:<br /> a) Given the 20s gap between them, the distinction between sample application and sympathetic nerve trunk stimulation needs to be made crystal clear; in many places, "stimulus application" is used in places where this reviewer suspects they actually mean sympathetic nerve trunk stimulation.<br /> b) There appears to be a mismatch between the discussion of Figure 3 and its contents. Specifically, there is an example of an "adjusted" pattern in 3A, not 3B.<br /> c) The discussion of patterns neglects to mention whether it's possible for a neuron to belong to more than one pattern. For example, it would seem possible for a neuron to simultaneously fit the "ICR pattern" and the "dominant adjusted pattern" if, e.g., all ICR responses are stronger than all others, but if simultaneously within each strain the dominant male causes the largest response.

(3) Discussion:<br /> a) The discussion of chemical specificity in urine focuses on volatiles and MUPs (citation #47), but many important molecules for the VNS are small, nonvolatile ligands. For such molecules, the corresponding study is Fu et al 2015.<br /> b) "Following our line of reasoning, this scarcity may represent an optimal allocation of resources to separate dominant from naïve males": 1 unit out of 215 is roughly consistent with a single receptor. Surely little would be lost if there could be more computational capacity devoted to this important axis than that? It seems more likely that dominance is computed from multiple neuronal types with mixed encoding.

(4) Methods:<br /> a) Male status, "were unambiguous in most cases": is it possible to put numerical estimates on this? 55% and 99% are both "most," yet they differ substantially in interpretive uncertainty.<br /> b) Surgical procedures and electrode positioning: important details of probes are missing (electrode recording area, spacing, etc).<br /> c) Stimulus presentation procedure: Are stimuli manually pipetted or delivered by apparatus with precise timing?<br /> d) Data analysis, "we applied more permissive criteria involving response magnitude": it's not clear whether this is what's spelled out in the next paragraph, or whether that's left unspecified. In either case, the next paragraph appears to be about establishing a noise floor on pattern membership, not a "permissive criterion."<br /> e) Data analysis, method for assessing significance: there's a lot to like about the use of pooling to estimate the baseline and the use of an ANOVA-like test to assess unit responsiveness.<br /> But:<br /> i) for a specific stimulus, at 4 trials (the minimum specified in "Stimulus presentation procedure") kruskalwallis is questionable. They state that most trials use 5, however, and that should be okay.<br /> ii) the methods statement suggests they are running kruskalwallis individually for each neuron/stimulus, rather than once per neuron across all stimuli. With 11 stimuli, there is a substantial chance of a false-positive if they used p < 0.05 to assess significance. (The actual threshold was unstated.) Were there any multiple comparison corrections performed? Or did they run kruskalwallis on the neuron, and then if significant assess individual stimuli? (Which is a form of multiple-comparisons correction.)

Reviewer #2 (Public review):

Summary:

Pinho et al. developed a new auditory-visual sensory preconditioning procedure in mice and examined the contribution of the dorsal and ventral hippocampus to learning in this task. Using photometry they observed activation of the dorsal and ventral hippocampus during sensory preconditioning and conditioning. Finally, the authors combined their sensory preconditioning task with DREADDs to examine the effect of inhibiting specific cell populations (CaMKII and PV) in the DH on the formation and retrieval/expression of mediated learning.

Strengths:

The authors provide one of the first demonstrations of auditory-visual sensory preconditioning in male mice. Research on the neurobiology of sensory preconditioning has primarily used rats as subjects. The development of a robust protocol in mice will be beneficial to the field, allowing researchers to take advantage of the many transgenic mouse lines. Indeed, in this study, the authors take advantage of a PV-Cre mouse line to examine the role of hippocampal PV cells in sensory preconditioning.

Weaknesses:

(1) The authors report that sensory preconditioning was observed in both male and female mice. However, their data only supports sensory preconditioning in male mice. In female mice, both paired and unpaired presentations of the light and tone in stage 1 led to increased freezing to the tone at test. In this case, fear to the tone could be attributed to factors other than sensory preconditioning, for example, generalization of fear between the auditory and visual stimulus.

(2) In the photometry experiment, the authors report an increase in neural activity in the hippocampus during both phase 1 (sensory preconditioning) and phase 2 (conditioning). In the subsequent experiment, they inhibit neural activity in the DH during phase 1 (sensory preconditioning) and the probe test, but do not include inhibition during phase 2 (conditioning). It was not clear why they didn't carry forward investigating the role of the hippocampus during phase 2 conditioning. Sensory preconditioning could occur due to the integration of the tone and shock during phase two, or retrieval and chaining of the tone-light-shock memories at test. These two possibilities cannot be differentiated based on the data. Given that we do not know at which stage the mediate learning is occurring, it would have been beneficial to additionally include inhibition of the DH during phase 2.

(3) In the final experiment, the authors report that inhibition of the dorsal hippocampus during the sensory preconditioning phase blocked mediated learning. While this may be the case, the failure to observe sensory preconditioning at test appears to be due more to an increase in baseline freezing (during the stimulus off period), rather than a decrease in freezing to the conditioned stimulus. Given the small effect, this study would benefit from an experiment validating that administration of J60 inhibited DH cells. Further, given that the authors did not observe any effect of DREADD inhibition in PV cells, it would also be important to validate successful cellular silencing in this protocol.

Reviewer #2 (Public review):

Streptococcus pyogenes, or group A streptococci (GAS) can cause diseases ranging from skin and mucosal infections, to plasma invasion, and post-infection autoimmune syndromes. M proteins are essential GAS virulence factors that include an N-terminal hypervariable region (HVR). M proteins are known to bind to numerous human proteins; a small subset of M proteins were reported to bind collagen, which is thought to promote tissue adherence. In this paper, the authors characterize M3 interactions with collagen and its role in biofilm formation. Specifically, they screened different collagen type II and III variants for full-length M3 protein binding using an ELISA-like method, detecting anti-GST antibody signal. By statistical analysis, hydrophobic amino acids and hydroxyproline were found to positively support binding, whereas acidic residues and proline negatively impacted binding (Table 1). The authors applied X-ray crystallography to determine the structure of the N-terminal domain (42-151 amino acids) of M3 protein (M3-NTD). M3-NTD dimmer (PDB 8P6K) forms a T-shaped structure with three helices (H1, H2, H3), which are stabilized by a hydrophobic core, inter-chain salt bridges and hydrogen bonds on H1, H2 helices, and H3 coiled coil. The conserved Gly113 serves as the turning point between H2 and H3 (Figure 5). The M3-NTD is co-crystalized with a 24-residue peptide, JDM238, to determine the structure of M3-collagen binding. The structure (PDB 8P6J) shows that two copies of collagen in parallel bind to H1 and H2 of M3-NTD. Among the residues involved in binding, conserved Try96 is shown to play a critical role supported by structure and isothermal titration calorimetry (ITC). The authors also apply a crystal-violet assay and fluorescence microscopy to determine that M3 is involved in collagen type I binding, but not M1 or M28 (Figure 9). Tissue biopsy staining indicates that M3 strains co-localize with collagen IV-containing tissue, while M1 strains do not. The authors provide generally compelling evidence to show that GAS M3 protein binds to collagen, and plays a critical role in forming biofilms, which contribute to disease pathology. This is a very well-executed study and a well-written report relevant to understanding GAS pathogenesis and approaches to combatting disease; data are also applicable to emerging human pathogen Streptococcus dysgalactiae. One caveat that was not entirely resolved is if/how different collagen types might impact M3 binding and function. Due to the technical constraints, the in vitro structure and other binding assays use type II collagen whereas in vivo, biofilm formation assays and tissue biopsy staining use type I and IV collagen; it was unclear if this difference is significant. One possibility is that M3 has an unbiased binding to all types of collagens, only the distribution of collagens leads to the finding that M3 binds to type IV (basement membrane) and type I (varies of tissue including skin), rather than type II (cartilage).

Reviewer #2 (Public review):

Summary:

In "Founder effects arising from gathering dynamics systematically bias emerging pathogen surveillance" Bradford and Hang present an extension to the SIR model to account for the role of larger than pairwise interactions in infectious disease dynamics. They explore the impact of accounting for group interactions on the progression of infection through the various sub-populations that make up the population as a whole. Further, they explore the extent to which interaction heterogeneity can bias epidemiological inference from surveillance data in the form of IFR and variant growth rate dynamics. This work advances the theoretical formulation of the SIR model and may allow for more realistic modeling of infectious disease outbreaks in the future.

Strengths:

(1) This work addresses an important limitation of standard SIR models. While this limitation has been addressed previously in the form of network-based models, those are, as the authors argue, difficult to parameterize to real-world scenarios. Further, this work highlights critical biases that may appear in real-world epidemiological surveillance data. Particularly, over-estimation of variant growth rates shortly after emergence has led to a number of "false alarms" about new variants over the past five years (although also to some true alarms).

(2) While the results presented here generally confirm my intuitions on this topic, I think it is really useful for the field to have it presented in such a clear manner with a corresponding mathematical framework. This will be a helpful piece of work to point to to temper concerns about rapid increases in the frequency of rare variants.

(3) The authors provide a succinct derivation of their model that helps the reader understand how they arrived at their formulation starting from the standard SIR model.

(4) The visualizations throughout are generally easy to interpret and communicate the key points of the authors' work.

(5) I thank the authors for providing detailed code to reproduce manuscript figures in the associated GitHub repo.

Weaknesses:

(1) The authors argue that network-based SIR models are difficult to parameterize (line 66), however, the model presented here also has a key parameter, mainly P_n, or the distribution of risk groups in the population. I think it is important to explore the extent to which this parameter can be inferred from real-world data to assess whether this model is, in practice, any easier to parameterize.

(2) The authors explore only up to four different risk groups, accounting for only four-wise interactions. But, clearly, in real-world settings, there can be much larger gatherings that promote transmission. What was the justification for setting such a low limit on the maximum group size? I presume it's due to computational efficiency, which is understandable, but it should be discussed as a limitation.

(3) Another key limitation that isn't addressed by the authors is that there may be population structure beyond just risk heterogeneity. For example, there may be two separate (or, weakly connected) high-risk sub-groups. This will introduce temporal correlation in interactions that are not (and can not easily be) captured in this model. My instinct is that this would dampen the difference between risk groups shown in Figure 2A. While I appreciate the authors's desire to keep their model relatively simple, I think this limitation should be explicitly discussed as it is, in my opinion, relatively significant.

Reviewer #2 (Public review):

Summary:

The study introduces new tools for measuring intracellular Ca2+ concentration gradients around retinal rod bipolar cell (rbc) synaptic ribbons. This is done by comparing the Ca2+ profiles measured with mobile Ca2+ indicator dyes versus ribbon-tethered (immobile) Ca2+ indicator dyes. The Ca2+ imaging results provide a straightforward demonstration of Ca2+ gradients around the ribbon and validate their experimental strategy. This experimental work is complemented by a coherent, open-source, computational model that successfully describes changes in Ca2+ domains as a function of Ca2+ buffering. In addition, the authors try to demonstrate that there is heterogeneity among synaptic ribbons within an individual rbc terminal.

Strengths:

The study introduces a new set of tools for estimating Ca2+ concentration gradients at ribbon AZs, and the experimental results are accompanied by an open-source, computational model that nicely describes Ca2+ buffering at the rbc synaptic ribbon. In addition, the dissociated retinal preparation remains a valuable approach for studying ribbon synapses. Lastly, excellent EM.

Weaknesses:

Heterogeneity in the spatiotemporal dynamics of Ca2+ influx was not convincingly related to ribbon size, nor was the functional relevance of Ca2+ dynamics to rod bipolars demonstrated (e.g., exocytosis to different postsynaptic targets). In addition, the study would benefit from the inclusion of the Ca2+ currents that were recorded in parallel with the Ca2+ imaging.

Reviewer #2 (Public review):

Summary:

The study offers a thorough analysis of the prevalence of pain in women with polycystic ovary syndrome (PCOS) and its associations with health outcomes across various racial groups. Furthermore, the research investigates the prevalence of PCOS and pain among different racial demographics, as well as the increased risk of developing various conditions in comparison to individuals who have PCOS alone.

Strengths:

The study emphasizes pain as a significant comorbidity of PCOS, an area that is critically underexplored in existing literature. The findings regarding the increased prevalence of some of the diseases in the PCOS + pain group provide valuable direction for future research and clinical care. I believe physicians should incorporate pain score assessments into their clinical practice to improve patient's quality of life and raise awareness about pain management. If future research focuses on the mechanisms of pain, it would provide a better understanding of pain and allow for a focus on the underlying causes rather than just symptomatic management. The study also highlights the association between PCOS+pain and various comorbidities, such as obesity, hypertension, and type 2 diabetes, as well as conditions like infertility and ovarian cysts, offering a holistic view of the burden of PCOS.

Weaknesses:

Due to the nature of the retrospective study, some data may not be readily available in the system. Instead of simply categorizing participants based on whether they experience pain, it would be more useful to employ a pain scale or questionnaire to better understand the severity and type of patients' pain. This approach would allow for a more thorough analysis of pain improvement following treatment with the three widely used medications for PCOS. Additionally, it would be beneficial for the authors to specify subtypes of the disease rather than generalizing conditions, such as mentioning specific digestive system disorders or mental health disorders. The lack of detailed analysis of specific disorders limits the depth of the findings. This may cause authors to make incorrect conclusions.

Reviewer #2 (Public review):

The present study, led by Thomas and collaborators, aims to describe the firing activity of individual motor units in mice during locomotion. To achieve this, they implanted small arrays of eight electrodes in two heads of the triceps and performed spike sorting using a custom implementation of Kilosort. Simultaneously, they tracked the positions of the shoulder, elbow, and wrist using a single camera and a markerless motion capture algorithm (DeepLabCut). Repeated one-minute recordings were conducted in six mice at five different speeds, ranging from 10 to 27.5 cm·s⁻¹.

From these data, the authors reported that:

(1) a significant portion of the identified motor units was not consistently recruited across strides,<br /> (2) motor units identified from the lateral head of the triceps tended to be recruited later than those from the long head,<br /> (3) the number of spikes per stride and peak firing rates were correlated in both muscles, and<br /> (4) the probability of motor unit recruitment and firing rates increased with walking speed.

The authors conclude that these differences can be attributed to the distinct functions of the muscles and the constraints of the task (i.e., speed).

Strengths:

The combination of novel electrode arrays to record intramuscular electromyographic signals from a larger muscle volume with an advanced spike sorting pipeline capable of identifying populations of motor units.

Weaknesses:

(1) There is a lack of information on the number of identified motor units per muscle and per animal.

(2) All identified motor units are pooled in the analyses, whereas per-animal analyses would have been valuable, as motor units within an individual likely receive common synaptic inputs. Such analyses would fully leverage the potential of identifying populations of motor units.

(3) The current data do not allow for determining which motor units were sampled from each pool. It remains unclear whether the sample is biased toward high-threshold motor units or representative of the full pool.

(4) The behavioural analysis of the animals relies solely on kinematics (2D estimates of elbow angle and stride timing). Without ground reaction forces or shoulder angle data, drawing functional conclusions from the results is challenging.

Major comments:

(1) Spike sorting

The conclusions of the study rely on the accuracy and robustness of the spike sorting algorithm during a highly dynamic task. Although the pipeline was presented in a previous publication (Chung et al., 2023, eLife), a proper validation of the algorithm for identifying motor unit spikes is still lacking. This is particularly important in the present study, as the experimental conditions involve significant dynamic changes. Under such conditions, muscle geometry is altered due to variations in both fibre pennation angles and lengths.

This issue differs from electrode drift, and it is unclear whether the original implementation of Kilosort includes functions to address it. Could the authors provide more details on the various steps of their pipeline, the strategies they employed to ensure consistent tracking of motor unit action potentials despite potential changes in action potential waveforms, and the methods used for manual inspection of the spike sorting algorithm's output?

(2) Yield of the spike sorting pipeline and analyses per animal/muscle

A total of 33 motor units were identified from two heads of the triceps in six mice (17 from the long head and 16 from the lateral head). However, precise information on the yield per muscle per animal is not provided. This information is crucial to support the novelty of the study, as the authors claim in the introduction that their electrode arrays enable the identification of populations of motor units.

Beyond reporting the number of identified motor units, another way to demonstrate the effectiveness of the spike sorting algorithm would be to compare the recorded EMG signals with the residual signal obtained after subtracting the action potentials of the identified motor units, using a signal-to-residual ratio.

Furthermore, motor units identified from the same muscle and the same animal are likely not independent due to common synaptic inputs. This dependence should be accounted for in the statistical analyses when comparing changes in motor unit properties across speeds and between muscles.

(3) Representativeness of the sample of identified motor units

However, to draw such conclusions, the authors should exclusively compare motor units from the same pool and systematically track violations of the recruitment order. Alternatively, they could demonstrate that the motor units that are intermittently active across strides correspond to the smallest motor units, based on the assumption that these units should always be recruited due to their low activation thresholds.

One way to estimate the size of motor units identified within the same muscle would be to compare the amplitude of their action potentials, assuming that all motor units are relatively close to the electrodes (given the selectivity of the recordings) and that motoneurons innervating more muscle fibres generate larger motor unit action potentials.

Currently, the data seem to support the idea that motor units that are alternately recruited across strides have recruitment thresholds close to the level of activation or force produced during slow walking. The fact that recruitment probability monotonically increases with speed suggests that the force required to propel the mouse forward exceeds the recruitment threshold of these "large" motor units. This pattern would primarily reflect spatial recruitment following the size principle rather than flexible motor unit control.

(4) Analysis of recruitment and firing rates

The authors currently report active duration and peak firing rates based on spike trains convolved with a Gaussian kernel. Why not report the peak of the instantaneous firing rates estimated from the inverse of the inter-spike interval? This approach appears to be more aligned with previous studies conducted to describe motor unit behaviour during fast movements (e.g., Desmedt & Godaux, 1977, J Physiol; Van Cutsem et al., 1998, J Physiol; Del Vecchio et al., 2019, J Physiol).

(5) Additional analyses on behaviour

The authors currently analyse motor unit recruitment in relation to elbow angle. It would be valuable to include a similar analysis using the angular velocity observed during each stride, as higher velocity would place each muscle in a less favourable position on the force-velocity relationship for generating the required force. More broadly, comparing stride-by-stride changes in firing rates with changes in elbow angular velocity would further strengthen the final analyses presented in the results section.

Reviewer #2 (Public review):

Summary:

This study investigates the role of spinal astrocytes in mediating stress-induced pain hypersensitivity, focusing on the LC (locus coeruleus)-to-SDH (spinal dorsal horn) circuit and its mechanisms. The authors aimed to delineate how LC activity contributes to spinal astrocytic activation under stress conditions, explore the role of noradrenaline (NA) signaling in this process, and identify the downstream astrocytic mechanisms that influence pain hypersensitivity.

The authors provide strong evidence that 1-hour restraint stress-induced pain hypersensitivity involves the LC-to-SDH circuit, where NA triggers astrocytic calcium activity via alpha1a adrenoceptors (alpha1aRs). Blockade of alpha1aRs on astrocytes - but not on Vgat-positive SDH neurons - reduced stress-induced pain hypersensitivity. These findings are rigorously supported by well-established behavioral models and advanced genetic techniques, uncovering the critical role of spinal astrocytes in modulating stress-induced pain.

However, the study's third aim - to establish a pathway from astrocyte alpha1aRs to adenosine-mediated inhibition of SDH-Vgat neurons - is less compelling. While pharmacological and behavioral evidence is intriguing, the ex vivo findings are indirect and lack a clear connection to the stress-induced pain model. Despite these limitations, the study advances our understanding of astrocyte-neuron interactions in stress-pain contexts and provides a strong foundation for future research into glial mechanisms in pain hypersensitivity.

Strengths:

The study is built on a robust experimental design using a validated 1-hour restraint stress model, providing a reliable framework to investigate stress-induced pain hypersensitivity. The authors utilized advanced genetic tools, including retrograde AAVs, optogenetics, chemogenetics, and subpopulation-specific knockouts, allowing precise manipulation and interrogation of the LC-SDH circuit and astrocytic roles in pain modulation. Clear evidence demonstrates that NA triggers astrocytic calcium activity via alpha1aRs, and blocking these receptors effectively reduces stress-induced pain hypersensitivity.

Weaknesses:

Despite its strengths, the study presents indirect evidence for the proposed NA-to-astrocyte(alpha1aRs)-to-adenosine-to-SDH-Vgat neurons pathway, as the link between astrocytic adenosine release and stress-induced pain remains unclear. The ex vivo experiments, including NA-induced depolarization of Vgat neurons and chemogenetic stimulation of astrocytes, are challenging to interpret in the stress context, with the high CNO concentration raising concerns about specificity. Additionally, the role of astrocyte-derived D-serine is tangential and lacks clarity regarding its effects on SDH Vgat neurons. The astrocyte calcium signal "dip" after LC optostimulation-induced elevation are presented without any interpretation.

Reviewer #2 (Public review):

Summary:

The study by Yamaguchi et al. provides compelling evidence for the formation of a 3:3 complex between the ectodomain of ADAM22 and LGI1, as demonstrated using single-particle cryo-EM and HS-AFM. This represents the first instance in which the 3:3 complex has been resolved sufficiently to enable molecular modeling, allowing the authors to identify key interfaces mediating ADAM22-LGI1 interactions. HS-AFM revealed weak interactions within the 3:3 complexes, suggesting the dynamic nature of ADAM22-LGI1 interactions, which may play a role in modulating synaptic activity.

Strength:

A strength of this study lies in the novel identification of the 3:3 complexes, captured at an unprecedented level of resolution and validated by HS-AFM. This discovery, together with the authors' previous findings demonstrating a 2:2 stoichiometry, gives rise to an intriguing hypothesis regarding the dynamic nature of the ADAM22-LGI1 complex in regulating both cis- and trans-synaptic interactions.

Weakness:

The functional significance of these two complexes in the context of synapse remains speculative. Additionally, the structural presentations in Figures 1-3 (especially Figures 2-3) lack the clarity needed for general readers to fully understand the authors' key points. Enhancing the quality of these visual representations would greatly improve accessibility and comprehension.

Reviewer #2 (Public review):

Summary:

Autophagy (macroautophagy) is known to be essential for muscle function in flies and mammals. To date, many mitophagy (selective mitochondrial autophagy) receptors have been identified in mammals and other species. While the loss of mitophagy receptors has been shown to impair mitochondrial degradation (e.g., OPTN and NDP52 in Parkin-mediated mitophagy and NIX and BNIP3 in hypoxia-induced mitophagy) at the level of cultured cells, it remains unclear, especially under physiological conditions in vivo. In this study, the authors revealed that one of the receptors BNIP3 plays a critical role in mitochondrial degradation during muscle remodeling in vivo.

Overall, the manuscript provides solid evidence that BNIP3 is involved in mitophagy during muscle remodeling with in vivo analyses performed. In particular, all experiments in this study are well-designed. The text is well written and the figures are very clear.

Strengths:

(1) In each experiment, appropriate positive and negative controls are used to indicate what is responsible for the phenomenon observed by the authors: e.g. FIP200, Atg18, Stx17 siRNAs during DIOM remodeling in Figure 2 and Full, del-LIR, del-MER in Figure 5.

(2) Although the transcriptional dynamics of DIOM remodeling during metamorphosis is autophagy-independent, the transcriptome data obtained by the authors would be valuable for future studies.

(3) In addition to the simple observation that loss of BNIP3 causes mitochondrial accumulation, the authors further observed that, by combining siRNA against STX17, which is required for fusion of autophagosomes with lysosomes, BNIP3 KO abolishes mitophagosome formation, which will provide solid evidence for BNIP3-mediated mitophagy. Furthermore, using a Gal80 temperature-sensitive approach, the authors showed that mitochondria derived from larval muscle, but not those synthesized during hypertrophy, remain in BNIP3 KO fly muscles.

Weaknesses:

(1) Because BNIP3 KO causes mitochondrial accumulation, it is expected that adult flies will have some physiological defects, but this has not been fully analyzed or sufficiently mentioned in the manuscript.

(2) In Figure 5, the authors showed that BNIP3 binds to Atg18a by co-IP, but no data are provided on whether MER-mut or del-MER attenuates the affinity for Atg18a.

Reviewer #2 (Public review):

This manuscript addresses a fundamental problem of immunology - the persistence mechanisms of tissue-resident memory T cells (TRMs). It introduces a novel quantitative methodology, combining the in vivo tracing of T-cell cohorts with rigorous mathematical modeling and inference. Interestingly, the authors show that immigration plays a key role in maintaining CD4+ TRM populations in both skin and lamina propria (LP), with LP TRMs being more dependent on immigration than skin TRMs. This is an original and potentially impactful manuscript. However, several aspects were not clear and would benefit from being explained better or worked out in more detail.

(1) The key observations are as follows:

a) When heritably labeling cells due to CD4 expression, CD4+ TRM labeling frequency declines with time. This implies that CD4+ TRMs are ultimately replenished from a source not labeled, hence not expressing CD4. Most likely, this would be DN thymocytes.

b) After labeling by Ki67 expression, labeled CD4+ TRMs also decline - This is what Figure 1B suggests. Hence they would be replaced by a source that was not in the cell cycle at the time of labeling. However, is this really borne out by the experimental data (Figure 2C, middle row)? Please clarify.

(2) For potential source populations (Figure 2D): Please discuss these data critically. For example, CD4+ CD69- cells in skin and LP start with a much lower initial labeling frequency than the respective TRM populations. Could the former then be precursors of the latter? A similar question applies to LN YFP+ cells. Moreover, is the increase in YFP labeling in naïve T cells a result of their production from proliferative thymocytes? How well does the quantitative interpretation of YFP labeling kinetics in a target population work when populations upstream show opposite trends (e.g., naïve T cells increasing in YFP+ frequency but memory cells in effect decreasing, as, at the time of labeling, non-activated = non-proliferative T cells (and hence YFP-) might later become activated and contribute to memory)?

(3) Please add a measure of variation (e.g., suitable credible intervals) to the "best fits" (solid lines in Figure 2).

(4) Could the authors better explain the motivation for basing their model comparisons on the Leave-One-Out (LOO) cross-validation method? Why not use Bayesian evidence instead?

Reviewer #2 (Public review):

Summary:

Sleep plays a critical role in memory consolidation, but the neural mechanisms underlying this relationship remain poorly understood. The authors present novel findings implicating two small neuronal groups with inhibitory connections, PAM-a1 to DPM, in sleep regulation and LTM consolidation. However, whether the PAM-a1 to DPM microcircuit promotes LTM consolidation through sleep regulation requires further investigation.

Strengths:

The authors report several novel findings. Brief activation or inhibition of PAM-a1 neurons, or brief inhibition of DPM neurons during the first few hours after training, impairs 24-hour LTM. Notably, these brief manipulations disrupt sleep for many hours afterward, particularly at night. Interestingly, disruption of PAM-a1 and DPM neurons impairs sleep and appetitive memory consolidation only under starvation conditions, and pharmacological induction of sleep during the night rescues the LTM defects. These findings suggest that PAM-a1 and DPM neurons are involved in sleep regulation and LTM consolidation under starvation. These are important findings that advance our understanding of the link between sleep and memory consolidation.

Weaknesses:

Some claims lack sufficient evidence or clarity:

(1) All sleep experiments are conducted under the "training" (temperature-change) condition. While genotypic controls are helpful, additional no-training controls are required to confirm that the observed differences are due to training rather than unknown genotype-related factors. The fact that experimental genotypes exhibit significantly altered sleep even before "training" (e.g., Figs. 7H, J, K, 8A, B, D) highlights the necessity of these controls.

(2) Previous studies on disrupted memory due to sleep reduction have primarily examined conditions with severe sleep deprivation. In contrast, this report claims that relatively small decreases in total sleep accompanied by sleep fragmentation are responsible for impaired memory consolidation. It remains unclear whether sleep fragmentation at this level is truly critical for memory consolidation. The authors should cause sleep loss and fragmentation of similar magnitude through other means and determine whether it can impair LTM.

(3) The authors employed a neural activity reporter to show that starvation increases the basal activity of PAM-a1 but not DPM neurons in untrained flies (Figures 9C-E). They observed small increases in the activity of both neuron groups immediately after training but not one hour later. Given the inhibitory connection from PAM-a1 to DPM, it is unclear why both neuron groups show increased activity after training. Additionally, as the authors acknowledge, it is puzzling how the inactivation of PAM-a1 produces similar effects on sleep and memory as DPM inhibition and PAM-a1 activation. Further experiments are needed to clarify these findings, such as manipulating PAM-a1 activity during the one-hour post-training period and evaluating the effect on DPM activity. Including data from training under fed conditions would provide a more comprehensive understanding of state-dependent neural activity. Even if certain experiments are not feasible, these issues warrant further discussion. It is also important to clarify that the term "synchronized" does not imply single-spike-level synchrony.

(4) The authors considered that PAM-a1 and DPM might function in parallel, independent pathways for sleep and LTM. They rejected this possibility based on the lack of additive effects when both neuronal groups were simultaneously inactivated. However, they found that MB299B-labelled neurons exert stronger memory effects than MB043B-labelled neurons, while MB043B neurons have stronger sleep effects. If sleep is a primary driver of memory consolidation, a stronger correlation between memory and sleep effects would be expected. This observation merits further discussion.

(5) Given prior knowledge that PAM neurons are heterogeneous and that the R58E02 driver is broadly expressed, data in Figures 1-5 concerning PAM are outdated. The use of more restricted PAM-a1 drivers from the outset would make the manuscript easier to read and interpret.

(6) Some figures lack relevant data, certain experiments are missing necessary controls, and anomalies are present in some data sets.

Reviewer #3 (Public review):

Summary:

In this manuscript, the authors apply tissue expansion and tiling light sheet microscopy to study allometric growth and regeneration in planaria. They developed image analysis pipelines to help them quantify different neuronal subtypes and muscles in planaria of different sizes and during regeneration. Among the strengths of this work, the authors provide beautiful images that show the potential of the approaches they are taking and their ability to quantify specific cell types in relatively large numbers of whole animal samples. Many of their findings confirm previous results in the literature, which helps validate the techniques and pipelines they have applied here. Among their new observations, they find that the body wall muscles at the anterior and posterior poles of the worm are organized differently and show that the muscle pattern in the posterior head of beta-catenin RNAi worms resembles the anterior muscle pattern. They also show that glial cell processes appear to be altered in beta-catenin or insulin receptor-1 RNAi worms. Weaknesses include some over-interpretation of the data and lack of consideration or citation of relevant previous literature, as discussed below.

Strengths:

This method of tissue expansion will be useful for researchers interested in studying this experimental animal. The authors provide high-quality images that show the utility of this technique. Their analysis pipeline permits them to quantify cell types in relatively large numbers of whole animal samples.

The authors provide convincing data on changes in total neurons and neuronal sub-types in different-sized planaria. They report differences in body wall muscle pattern between the anterior and posterior poles of the planaria, and that these differences are lost when a posterior head forms in beta-catenin RNAi planaria. They also find that glial cell projections are reduced in insulin receptor-1 RNAi planaria.

Comments on revisions:

The authors have satisfactorily addressed the major concerns of the previous reviewers.

Reviewer #2 (Public review):

Summary:

This work reports the discovery of a new rhodopsin from reef-building corals that is characterized experimentally, spectroscopically, and by simulation. This rhodopsin lacks a carboxylate-based counterion, which is typical for this family of proteins. Instead, the authors find that a chloride ion stabilizes the protonated Schiff base and thus serves as a counterion.

Strengths:

This work focuses on the rhodopsin Antho2a, which absorbs in the visible spectrum with a maximum at 503 nm. Spectroscopic studies under different pH conditions, including the mutant E292A and different chloride concentrations, indicate that chloride acts as a counterion in the dark. In the photoproduct, however, the counterion is identified as E292.

These results lead to a computational model of Antho2a in which the chloride is modeled in addition to the Schiff base. This model is improved using the hybrid QM/MM simulations. As a validation, the absorption maximum is calculated using the QM/MM approach for the protonated and deprotonated E292 residue as well as the E292A mutant. The results are in good agreement with the experiment. However, there is a larger deviation for ADC(2) than for sTD-DFT. Nevertheless, the trend is robust since the wt and E292A mutant models have similar excitation energies. The calculations are performed at a high level of theory that includes a large QM region.

Weaknesses:

I have a couple of questions about this study:

(1) I find it suspicious that the absorption maximum is so close to that of rhodopsin when the counterion is very different. Is it possible that the chloride creates an environment for the deprotonated E292, which is the actual counterion?

(2) The computational protocol states that water molecules have been added to the predicted protein structure. Are there water molecules next to the Schiff base, E292, and Cl-? If so, where are they located in the QM region?

(3) If the E292 residue is the counterion in the photoproduct state, I would expect the retinal Schiff base to rotate toward this side chain upon isomerization. Can this be modeled based on the recent XFEL results on rhodopsin?

Reviewer #2 (Public review):

Summary:

Immune assays enable the analysis of immune responses in vitro. These assays generate time series image data across several experimental conditions. The imaging parameters such as the imaging modality and the number of channels can vary across experiments. A challenge in the field is the lack of (open source) tools to process and analyze these data. R. Torro, et. al. developed an open source end-to-end pipeline for the analysis of image data from these immune assays. The pipeline is designed with a GUI and is suited for experimental biologists with no coding experience. The authors have incorporated several existing methods and tools for individual tasks such as for segmentation and cell tracking, and incorporated them with custom methods where necessary such as for tracking cell state transitions.

Strengths:

(1) The tool is extremely well-documented and easy to install.

(2) Applicable to a wide variety of imaging modalities and analysis.

(3) There are several different options for each step, such as segmentation using traditional methods or deep learning methods, and all the analysis steps are integrated in one place with a GUI. The no-coding requirement makes this a very powerful tool for biologists and has the potential to enable a wide variety of analyses.

Weakness:

(1) It would be good to provide documentation on how to make the tool applicable for applications and analysis other than for immune profiling since most methods integrated here are applicable well beyond immune profiling. For example, a user might want to use the tool just for the segmentation of their IF microscopy-images.

(2) They applied Celldetective to two immune assays. The authors present the results from these assays and use the results to validate their assay. However, they have not included data that demonstrates results obtained via this pipeline are comparable to results obtained with other pipelines and/or if these results are consistent with what is expected in the literature.

Reviewer #2 (Public Review):

This is a nice paper illustrating the use of equilibrium/non-equilibrium MD simulations to explore allosteric communication in the Spike protein. The results are described in detail and suggest a complex network of signal transmission patterns. The topic is not completely novel as it has been studied before by the same authors and the impact of glycosylation is moderated and localized at the furin site, so not many new conclusions emerge here. It is suggested that mutations are commonly found in the communication pathway which is interesting, but the authors fail to provide evidence that this is related to a positive selection and not simply to a random effect related to mutations at points that are not crucial for stability or function. One interesting point is the connection of the FA site with an additional site binding heme group. It will be interesting to see reversibility, i.e. removal of the ligand at this site is producing perturbation at the FA site?, does it produce other effects suggesting a cascade of allosteric effects? Finally, the paper lacks details to help reproducibility, in particular, I do not see details on D-NEMD calculations. One interesting point is the connection of the FA site with an additional site binding heme group.

Reviewer #2 (Public review):

Summary

ZFHX3 is a transcription factor expressed in discrete populations of adult SCN and was shown by the authors previously to control circadian behavioral rhythms using either a dominant missense mutation in Zfhx3 or conditional null Zfhx3 mutation using the Ubc-Cre line (Wilcox et al., 2017). In the current manuscript, the authors assess the function of ZFHX3 by using a multi-omics approach including ChIPSeq in wildtype SCNs and RNAseq of SCN tissues from both wildtype and conditional null mice. RNAseq analysis showed a loss of oscillation in Bmal1 and changes in expression levels of other clock output genes. Moreover, a phase advance gene transcriptional profile using the TimeTeller algorithm suggests the presence of a regulatory network that could underlie the observed pattern of advanced activity onset in locomotor behavior in knockout mice.

In Figure 1, the authors identified the ZFHX3 bound sites using ChIPseq and compared the loci with other histone marks that occur at promoters, TSS, enhancers and intergenic regions. And the analysis broadly points to a role for ZFHX3 in transcriptional regulation. The vast majority of nearly 40000 peaks overlapped H3K4me3 and K27ac marks, active promoters which also included genes falling under the GO category circadian rhythms. However, no significant differential ZFHX3 bound peaks were detected between ZT3 and ZT15. In these experiments, it is not clear if and how the different ChIP samples (ZFHX3 and histone PTM ChIPs) were normalized/downsampled for analysis. Moreover, it seems that ZFHX3 binding or recruitment has little to do with whether the promoters are active.

Based on an enrichment of ARNT domains next to K4Me3 and K27ac PTMs, the authors propose a model where the core-clock TFs and ZFHX3 interact. If the authors develop other assays beyond just predictions to test their hypothesis, it would strengthen the argument for a role in circadian transcription in the SCN. It would be important in this context to perform a ChIP-seq experiment for ZFHX3 in the knockout animal (described from Figure 2 onwards) to eliminate the possibility of non-specific enrichment of signal from "open chromatin'. Alternatively, a ChIPseq analysis for BMAL1 or CLOCK could also strengthen this argument to identify the sites co-occupied by ZFHX3 and core-clock TFs.

Next, they compared locomotor activity rhythms in floxed mice with or without tamoxifen treatment. As reported before in Wilcox et al 2017, the loss of ZFHX3 led to a shorter free running period and reduced amplitude and earlier onset of activity. Overall, the behavioral data in Figure 2 and supplementary figure 2 has been reported before and are not novel.

Next, the authors performed RNAseq at 4hr intervals on wildtype and knockout animals maintained in light/dark cycles to determine the impact of loss of ZFHX3. Overall transcriptomic analysis indicated changes in gene expression in nearly 36% of expressed genes, with nearly half being upregulated while an equal fraction was downregulated. Pathways affected included mostly neureopeptide neurotransmitter pathways. Surprisingly, there was no correlation between the direction in change in expression and TF binding since nearly all the sites were bound by ZFHX3 and the active histone PTMs. The ChIP-seq experiment for ZFHX3 in the UBC-Cre+Tam mice again could help resolve the real targets of ZFHX3 and the transcriptional state in knockout animals.

To determine the fraction of rhythmic transcripts, Using dryR, the authors categorise the rhythmic transcriptome (about 7% in all) into modules that include genes that lose rhythmicity in the KO, gain rhythmicity in the KO or remain unaffected or partially affected. The analysis indicates that a large fraction of the rhythmic transcriptome is affected in the KO model. However, among core-clock genes only Bmal1 expression is affected showing a complete loss of rhythm. The authors state a decrease in Clock mRNA expression (line 294) but the panel figure 4A does not show this data. Instead it depicts the loss in Avp expression - {{ misstated in line 321 ( we noted severe loss in 24-h rhythm for crucial SCN neuropeptides such as Avp (Fig. 3a).}}

However, core-clock genes such as Pers and Crys show minor or no change in expression patterns while Per2 and Per3 show a ~2hr phase advance. While these could only weakly account for the behavioral phase advance, the authors used TimeTeller to assess circadian phase in wildtype and ZFHX3 deficient mice. This approach clearly indicated that while the clock is not disrupted in the knockout animals, the phase advance can be correctly predicted from a network of gene expression patterns.

Strengths

The authors use a multiomic strategy in order to reveal the role of the ZFHX3 transcription factor with a combination of TF and histone PTM ChIPseq, time-resolved RNAseq from wildtype and knockout mice and modeling the transcriptomic data using TimeTeller. The RNAseq experiments are nicely controlled and the analysis of the data indicates a clear impact on gene-expression levels in the knockout mice and the presence of a regulatory network that could underlie the advanced activity onset behavior.

Weaknesses

It is not clear whether ZFHX3 has a direct role in any of the processes and seems to be a general factor that marks H3K4me3 and K27ac marked chromatin. Why it would specifically impact the core-clock TTFL clock gene expression or indeed daily gene expression rhythms is not clear either. Details for treatment of different ChIP samples (ZFHX3 and histone PTM ChIPs) on data normalization for analysis are needed. The loss of complete rhythmicity of Avp and other neuropeptides or indeed other TFs could instead account for the transcriptional deregulation noted in the knockout mice.

Comments on revisions:

The authors addressed the majority of my criticisms. They also explained that some requested experiments are beyond the scope of the current manuscript, while others are technically not feasible. I do not have any further concerns.

DOI: 10.1186/s12915-025-02158-2

Resource: Addgene (RRID:SCR_002037)

Curator: @olekpark

SciCrunch record: RRID:SCR_002037

What is this?

DOI: 10.1038/s44319-025-00371-2

Resource: RRID:Addgene_175503

Curator: @olekpark

SciCrunch record: RRID:Addgene_175503

What is this?

DOI: 10.1038/s43018-024-00882-2

Resource: RRID:Addgene_61425

Curator: @olekpark

SciCrunch record: RRID:Addgene_61425

What is this?

DOI: 10.1038/s41467-025-57165-2

Resource: RRID:Addgene_48760

Curator: @olekpark

SciCrunch record: RRID:Addgene_48760

What is this?

DOI: 10.1038/s41467-025-56301-2

Resource: RRID:Addgene_12259

Curator: @olekpark

SciCrunch record: RRID:Addgene_12259

What is this?

DOI: 10.1038/s41421-024-00760-2

Resource: RRID:Addgene_73030

Curator: @olekpark

SciCrunch record: RRID:Addgene_73030

What is this?

Reviewer #2 (Public review):

In their study, Avraham-Davidi et al. combined scRNA-seq and spatial mapping studies to profile two preclinical mouse models of colorectal cancer: Apcfl/fl VilincreERT2 (AV) and Apcfl/fl LSL-KrasG12D Trp53fl/fl Rosa26LSL-tdTomato/+ VillinCreERT2 (AKPV). In the first part of the manuscript, the authors describe the analysis of the normal colon and dysplastic lesions induced in these models following tamoxifen injection. They highlight broad variations in immune and stromal cell composition within dysplastic lesions, emphasizing the infiltration of monocytes and granulocytes, the accumulation of IL-17+gdT cells, and the presence of a distinct group of endothelial cells. A major focus of the study is the remodeling of the epithelial compartment, where the most significant changes are observed. Using non-negative matrix factorization, the authors identify molecular programs of epithelial cell functions, emphasizing stemness, Wnt signaling, angiogenesis, and inflammation as major features associated with dysplastic cells. They conclude that findings from scRNA-seq analyses in mouse models are transposable to human CRC. In the second part of the manuscript, the authors aim to provide the spatial context for their scRNA-seq findings using Slide-seq and TACCO. They demonstrate that dysplastic lesions are disorganized and contain tumor-specific regions, which contextualize the spatial proximity between specific cell states and gene programs. Finally, they claim that these spatial organizations are conserved in human tumors and associate region-based gene signatures with patient outcomes in public datasets. Overall, the data were collected and analyzed using solid and validated methodology to offer a useful resource to the community.

Main comments:

(1) Clarity<br /> The manuscript would benefit from a substantial reorganization to improve clarity and accessibility for a broad readership. The text could be shortened and the number of figure panels reduced to emphasize the novel contributions of this work while minimizing extensive discussions on general and expected findings, such as tissue disorganization in dysplastic lesions. Additionally, figure panels are not consistently introduced in the correct order, and some are not discussed at all (e.g., Figure S1D; Figure 3C is introduced before Figure 3A; several panels in Figure 4 are not discussed). The annotation of scRNA-seq cell states is insufficiently explained, with no corresponding information about associated genes provided in the figures or tables. Multiple annotations are used to describe cell groups (e.g., TKN01 = γδ T and CD8 T, TKN05 = γδT_IL17+), but these are not jointly accessible in the figures, making the manuscript challenging to follow. It is also not clear what is the respective value of the two mouse models and time points of tissue collection in the analysis.

(2) Novelty<br /> While the study is of interest, it does not present major findings that significantly advance the field or motivate new directions and hypotheses. Many conclusions related to tissue composition and patient outcomes, such as the epithelial programs of Wnt signaling, angiogenesis, and stem cells, are well-established and not particularly novel. Greater exploration of the scRNA-seq data beyond cell type composition could enhance the novelty of the findings. For instance, several tumor microenvironment clusters uniquely detected in dysplastic lesions (e.g., Mono2, Mono3, Gran01, Gran02) are identified, but no further investigation is conducted to understand their biological programs, such as applying nNMF as was done for epithelial cells. Additional efforts to explore precise tissue localization and cellular interactions within tissue niches would provide deeper insights and go beyond the limited analyses currently displayed in the manuscript.

(3) Validation<br /> Several statements made by the authors are insufficiently supported by the data presented in the manuscript and should be nuanced in the absence of proper validation. For example:<br /> (a) RNA velocity analyses: The conclusions drawn from these analyses are speculative and need further support.<br /> (b) Annotations of epithelial clusters as dysplastic: These annotations could have been validated through morphological analyses and staining on FFPE slides.<br /> (c) Conservation of mouse epithelial programs in human tumors: The data in Figure S5B does not convincingly demonstrate the enrichment of stem cell program 16 in human samples. This should be more explicitly stated in the text, given the emphasis placed on this program by the authors.<br /> (d) Figure S6E: Cluster Epi06 is significantly overrepresented in spatial data compared to scRNA-seq, yet the authors claim that cell type composition is largely recapitulated without further discussion, which reduces confidence in other conclusions drawn.<br /> Furthermore, stronger validation of key dysplastic regions (regions 6, 8, and 11) in mouse and human tissues using antibody-based imaging with markers identified in the analyses would have considerably strengthened the study. Such validation would better contextualize the distribution, composition, and relative abundance of these regions within human tumors, increasing the significance of the findings and aiding the generation of new pathophysiological hypotheses.

Reviewer #2 (Public review):

In this study, the authors investigate the structure of breathing rhythms in freely moving mice during exploratory behaviour in the absence of explicit cues or tasks. Additionally, they link behavioural states, derived from sniffing frequency and speed movement data, to the neural activity recorded in the olfactory bulb (OB). To further characterize OB neuronal responses, the authors introduce the concept of "sniff fields" which consider the joint distribution of sniff frequency and the latency from inhalation. Lastly, they explore how OB neurons encode spatial information, and they compare this finding with previously known spatially encoding cells in the hippocampus.

The authors successfully establish that breathing in freely moving mice is structured even in the absence of explicit olfactory cues. By simultaneously recording sniffing and movement data, they find that this structure is associated with movement in a non-linear manner and can be modelled using a Hidden Markov Model (HMM). Interestingly, they demonstrate that neuronal activity in the OB tracks this behavioural structure by showing that HMM states can effectively cluster the neural data. Additionally, they describe OB activity using sniff fields, advancing our understanding of how individual neurons encode sniffing properties such as frequency and phase. Furthermore, they report unprecedented findings showing that some OB neurons encode place independently of the sniffing field contribution. Overall, the authors provide valuable insights regarding the contribution of different behavioural variables to OB activity.

However, some of the conclusions presented by the authors are not fully supported by the data provided. Quantitative analysis and statistical tests are missing from the description of the breathing structure. Regarding spatial encoding, the authors claim in the abstract that "at the population level, a mouse's location can be decoded from olfactory bulb with similar accuracy to hippocampus". However, they show that place was significantly decoded in only 18/31 sessions from OB activity, and in 12/13 sessions from hippocampal activity. No further comparison of decoding accuracy between OB and HPC is provided. Moreover, it is unclear whether place contributes independently of movement, which was previously shown in this study to influence neuronal activity.

Additionally, there is a lack of methodological detail regarding the experimental procedures, which could affect the interpretation of the data. Specifically, information is missing on aspects such as head-fixed conditions, the number of mice used per experiment, and the number of sessions per mouse.

Studying mice behaviour in more naturalistic conditions, without explicit tasks, is a very interesting approach that provides new insights into the structure of sniffing and its neuronal representation. The fact that some OB neurons encode spatial information is highly relevant beyond the field of olfaction, even though this information was not as accessible as in the hippocampus. I believe the manuscript would benefit from a revision to ensure the text aligns more closely with the data presented in the figures.

Reviewer #2 (Public review):

This nice study explores the role of phospholipid scramblase 1 (PLSCR1) in regulating antiviral immunity and host morbidity during influenza A virus (IAV) infection. The authors identify PLSCR1 as a critical regulator of interferon-lambda receptor 1 (IFNLR1) expression, acting through enzymatic-independent mechanisms. Using PLSCR1-deficient and conditional overexpression mouse models, the study demonstrates that PLSCR1 enhances antiviral responses and mitigates inflammation, potentially through modulating type III interferon (IFN-λ) signaling. While the findings underline the importance of PLSCR1 in early viral control and tissue homeostasis, they also highlight its cell-specific functions, particularly in ciliated airway epithelial cells. This work contributes to understanding the interplay between host factors and antiviral pathways, paving the way for novel therapeutic strategies targeting host proteins.

Specific Comments:

(1) The statement that type I interferons are expressed by "almost all cells" is inaccurate (line 61). Type I IFN production is also context-dependent and often restricted to specific cell types upon infection or stimulation.

(2) The antiviral response is assessed solely through flu M gene expression. Incorporating infectious virus titers (e.g., TCID50 or plaque assay) would provide a more robust and direct measure of antiviral activity.

(3) While mRNA expression of interferons is measured, protein levels (e.g., through ELISA) should also be quantified to establish the functional relevance of IFN expression changes.

(4) It is unclear whether reduced IFNLR1 expression translates to defective downstream signaling or antiviral responses after IFN-λ treatment in PLSCR1-deficient cells. This is particularly pertinent given the increase in IFN-λ ligand in vivo, which might compensate for receptor downregulation.

(5) Detailed gating strategies for immune cell subsets are absent and should be included for clarity and reproducibility.

(6) The study does not definitively establish that reduced IFN-λ signaling causes the observed in vivo phenotype. Increased morbidity and mortality in PLSCR1-deficient mice could also stem from elevated TNF-α levels and lung damage, as proinflammatory cytokines and/or enhanced lung damage are known contributors to influenza morbidity and mortality. This point warrants detailed discussions.

Reviewer #2 (Public review):

Summary:

Sleep has not only been shown to support the strengthening of memory traces but also their transformation. A special form of such transformation is the abstraction of general rules from the presentation of individual exemplars. The current work used large online experiments with hundreds of participants to shed further light on this question. In the training phase participants saw composite items (scenes) that were made up of pairs of spatially coupled (i.e., they were next to each other) abstract shapes. In the initial training, they saw scenes made up of six horizontally structured pairs and in the second training phase, which took place after a retention phase (2 min awake, 12 hour incl. sleep, 12 h only wake, 24 h incl. sleep), they saw pairs that were horizontally or vertically coupled. After the second training phase, a two-alternatives-forced-choice (2-AFC) paradigm, where participants had to identify true pairs versus randomly assembled foils, was used to measure performance on all pairs. Finally, participants were asked five questions to identify, if they had insight into the pair structure and post-hoc groups were assigned based on this. Mainly the authors find that participants in the 2 minute retention experiment without explicit knowledge of the task structure were at chance level performance for the same structure in the second training phase, but had above chance performance for the vertical structure. The opposite was true for both sleep conditions. In the 12 h wake condition these participants showed no ability to discriminate the pairs from the second training phase at all.

Strengths:

All in all, the study was performed to a high standard and the sample size in the implicit condition was large enough to draw robust conclusions. The authors make several important statistical comparisons and also report an interesting resampling approach. There is also a lot of supplemental data regarding robustness.

Weaknesses:

My main concern regards the small sample size in the explicit group and the lack of experimental control.

Reviewer #2 (Public review):

Summary:

In their study 'AI-Based Discovery and CryoEM Structural Elucidation of a KATP Channel Pharmacochaperone', ElSheikh and colleagues undertake a computational screening approach to identify candidate drugs that may bind to an identified binding pocket in the SUR1 subunit of KATP channels. Other KATP channel inhibitors such as glibenclamide have been previously shown to bind in this pocket, and in addition to inhibition KATP channel function, these inhibitors can very effectively rescue cell surface expression of trafficking deficient KATP mutations that cause excessive insulin secretion (Congenital Hyperinsulinism). However, a challenge for their utility for treatment of hyperinsulinism has been that they are powerful inhibitors of the channels that are rescued to the channel surface. In contrast, successful therapeutic pharmacochaperones (eg. CFTR chaperones) permit function of the channels rescued to the cell membrane. Thus, a key criteria for the authors' approach in this case was to identify relatively low affinity compounds that target the glibenclamide binding site (and be washed off) - these could potentially rescue KATP surface expression, but also permit KATP function.

Strengths:

The main findings of the manuscript include:

(1) Computational screening of a large virtual compound library, followed by functional screening of cell surface expression, which identified several potential candidate pharmacochaperones that target the glibenclamide binding site.

(2) Prioritization and functional characterization of Aekatperone as a low affinity KATP inhibitor which can be readily 'washed off' in patch clamp, and cell based efflux assays. Thus the drug clearly rescues cell surface expression, but can be manipulated experimentally to permit function of rescued channels.

(3) Determination of the binding site and dynamics of this candidate drug by cryo-EM, and functional validation of several residues involved in drug sensitivity using mutagenesis and patch clamp.

The experiments are well-conceived and executed, and the study is clearly described. The results of the experiments are very straightforward and clearly support the conclusions drawn by the authors. I found the study to provide important new information about KATP chaperone effects of certain drugs, with interesting considerations in terms of ion channel biology and human disease.

Context and remaining challenges:

(1) The chaperones can effectively rescue KATP trafficking mutants, but clearly not as strongly as the higher affinity inhibitor glibenclamide. There is likely a challenging relationship between efficacy of trafficking rescue and channel inhibition (ie. rescued channels are inhibited and therefore non-functional) that will need to be overcome in terms of applying drugs of this class. This is recognized and clarified appropriately by the authors both in their experimental approaches and discussion. In experiments it is straightforward to wash off the chaperone, but this would not be the case in an organism.

(2) Recent developments with ion channel trafficking correctors in the CFTR field illustrate the importance of investigating underlying mechanisms. Development of pharmacological tools and approaches in other channel types (such as KATP or other transporters and channels) will build our understanding of pathways involved in regulating maturation of membrane proteins, and ways to manipulate them.

Comments on revised version:

I have no further suggestions, thank you for the detailed response.

Reviewer #2 (Public review):

Summary:

The authors introduced a computational framework, DyNoPy, that integrates residue coevolution analysis with molecular dynamics (MD) simulations to identify functionally important residues in proteins. DyNoPy identifies key residues and residue-residue coupling to generate an interaction graph and attempts to validate using two clinically relevant β-lactamases (SHV-1 and PDC-3).

Strengths:

DyNoPy could not only show clinically relevance of mutations but also predict new potential evolutionary mutations. Authors have provided biologically relevant insights into protein dynamics which can have potential applications in drug discovery and understanding molecular evolution.

Comments on latest version:

I appreciate the efforts of the authors to address my comments.