PatientID: 138

KindredID: 52

Case: M, 28Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 138) had multiple family members affected with the mutation. Their daughter (pt 139) was asymptomatic at the time of assessment; their son (pt 140) was also asymptomatic at the time of assessment; their mother (pt 141) presented with a CNS hemangioblastoma at 66, renal cell carcinoma at 69, and multiple pancreatic cysts/tumors at 66; their sister 1 (pt 142) presented with a CNS hemangioblastoma at 32, renal cell carcinoma at 36, and multiple pancreatic cysts/tumors at 36; the son of sister 1 was asymptomatic at the time of analysis; the daughter of sister 1 was asymptomatic at the time of analysis; the proband's sister 2 presented at age 39 with CNS hemangioblastoma, renal cell carcinoma, and multiple pancreatic cysts/tumors; and the son of sister 2 was asymptomatic at the time of analysis. All members of this family were genetically confirmed to have this mutation.

CasePresentingHPOs: HP:0010797, HP:0001737; HP:0001732; HP:0005584 (Hemangioblastoma, Pancreatic cysts, Abnormality of the pancreas, Renal cell carcinoma)

CaseHPOFreeText: The proband presented at age 28 with a CNS hemangioblastoma, renal cell carcinoma, and multiple pancreatic cysts/tumors.

CaseNotHPOs: HP:0002666; HP:0009711 (Pheochromocytoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: c.464-1G>C

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223220; https://www.ncbi.nlm.nih.gov/clinvar/variation/223220/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: splice_site_variant

CivicName: Splice Site (c.464-1G>C)

MultipleGeneVariants: N/A

PatientID: 277

KindredID: 108

Case: M, 28Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband, patient 277, presented with a CNS hemangioblastoma at age 16, retinal angioma a 20, and renal cell carcinoma at 28. Their father who passed away before diagnosis presented with a CNS hemangioblastoma at 48.

CasePresentingHPOs: HP:0010797; HP:0009711; HP:0005584 (Hemangioblastoma, Retinal capillary hemangioma, Renal cell carcinoma)

CaseHPOFreeText: The proband, patient 277, presented with a CNS hemangioblastoma at age 16, retinal angioma a 20, and renal cell carcinoma at 28.

CaseNotHPOs: HP:0002666; HP:0001737; HP:0001732 (Pheochromocytoma, Pancreatic cysts, Abnormality of the pancreas)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This cohort was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: Exon 2-3 Deletion (c.341-?_642+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: Exon 2-3 Deletion

MultipleGeneVariants: N/A

PatientID: 30

KindredID: 11

Case: F, 37Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 30) has a son (patient 31) who was genetically confirmed with the mutation, who was asymptomatic at the time of analysis. She also has a father (patient 32, CNS hemangioblastoma at 42), a brother 1 (patient 33, CNS hemangioblastoma at 28), brother 2 (patient 34, CNS hemangioblastoma at 30), and uncle (patient 35, retinal angioma at 60) who passed away before they could be diagnosed/ genetically confirmed with the mutation.

CasePresentingHPOs: HP:0009711; HP:0001737; HP:0001732; HP:0005584; HP:0010797 (Retinal capillary hemangioma, Pancreatic cysts, Abnormality of the pancreas, Renal cell carcinoma, Hemangioblastoma)

CaseHPOFreeText: The proband presented with CNS hemangioblastoma at 28, retinal angioma at 26, renal cell carcinoma at 37, and multiple pancreatic cysts/tumors at 28.

CaseNotHPOs: HP:0002666 (Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336). This mutation was also published in PMID 32179488 in reference to one patient with VHL disease type 1 in this paper with the c.227_229del variant. However, it is unclear whether patient #27, #28, or #30 is specifically published in PMID 32179488.

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.F76del (c.227_229del)

LegacyVariant: F76del (c.224_226delTCT)

CaseProblemVariantFreeText: The protein coding change for this variant is listed in this paper as p.F76Cfs*138. However the DNA change listed in this paper (c.224_226delTCT) is equivalent to c.227_229delTCT, and results in p.F76del. This variant is entered on CIViC with p.F76del. As a note the latter c. nomenclature is preferred due to the 3' rule.

ClinVarID: N/A

CAID: CA357012; https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.224_226del

gnomAD: N/A

VariantEvidence: N/A

MutationType: inframe_deletion

CivicName: F76del (c.224_226delTCT)

MultipleGeneVariants: N/A

PatientID: 5

KindredID: 5

Case: 28Y0M, Sex unknown, Chinese

DiseaseAssertion: VHL

FamilyInfo: None

CasePresentingHPOs:  HP:0010797; HP:0005584 (hemangioblastoma, renal cell carcinoma)

CaseHPOFreeText: CNS hemangioblastoma first presenting at age 28Y and RCC at age 28Y

CaseNotHPOs: HP:0009715; HP:0002666 (Papillary cystadenoma of the epididymis, pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.N78S (c.233A>G)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 93326 https://www.ncbi.nlm.nih.gov/clinvar/variation/93326/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: N78S (c.233A>G)

MultipleGeneVariants: N/A

PatientID: 3

KindredID: 3

Case: Sex Unknown, 38Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: Patient had family history of VHL disease. The patient’s aunt and her son had the same mutation, but no clinical manifestations. The patient’s mother, another aunt and her son had hemangioblastomas at age 30, 33, and 32, respectively, but died prior to genetic testing could be performed.

CohortInfo: 16 Chinese patients clinically diagnosed with VHL disease.

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0001732 (hemangioblastoma; renal cell carcinoma; abnormality of the pancreas)

CaseHPOFreeText: The patient presented with a hemangioblastoma at age 28, as well as renal cell carcinoma at age and abnormality of the pancreas at age 38.

CaseNotHPOs: HP:0009711, HP:0002666, HP:0030393, (retinal capillary hemangioma, pheochromocytoma, endolymphatic sac tumor)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.N90I (c.269A>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223172, https://www.ncbi.nlm.nih.gov/clinvar/variation/223172/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: N90I (c.269A>T)

MultipleGeneVariants: N/A

PatientID: 81

KindredID: 27

Case: M, 38Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 81) had 3 family members confirmed with the mutation: his aunt 2 (patient 85) had pancreatic cysts and/or tumors at age 50, his cousin/ the son of Aunt 2 was asymptomatic at the time of assessment, and the granddaughter of aunt 2 was also asymptomatic at the time of assessment. The proband also had 3 family members who passed away before diagnosis/ before confirming the mutation: his mother (patient 82) had a CNS hemangioblastoma at 33, his Aunt 1 (patient 83) had a CNS hemangioblastoma at 32, and his cousin/ the son of Aunt 1 (patient 84) had a CNS hemangioblastoma at 30.

CasePresentingHPOs: HP:0010797; HP:0001732; HP:0001737; HP:0005584; HP:0002666 (Hemangioblastoma, Abnormality of the pancreas, Pancreatic cysts, Renal cell carcinoma, Pheochromocytoma)

CaseHPOFreeText: The proband presented with CNS hemangioblastoma at age 28, and renal cell carcinoma, multiple pancreatic cysts/tumors, and pheochromocytoma at age 38.

CaseNotHPOs: HP:0009711(Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.N90I (c.269A>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223172; https://www.ncbi.nlm.nih.gov/clinvar/variation/223172/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: N90I (c.269A>T)

MultipleGeneVariants: N/A

PatientID: 71

KindredID: 25

Case: F, 30Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband has the same mutation as her son (patient no.72). Her son did not present with hemangioblastoma, multiple pancreatic cysts/tumors, retinal angioma, renal cell carcinoma, or pheochromocytoma, and is apparently asymptomatic.

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0001737; HP:0001732 (Hemangioblastoma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas)

CaseHPOFreeText: The patient presented with renal cell carcinoma at age 28, multiple pancreatic cysts/tumors at age 28, and hemangioblastoma at age 30.

CaseNotHPOs: HP:0009711; HP:0002666 (Retinal capillary hemangioma, Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This cohort was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.W88* (c.263G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 182978, https://www.ncbi.nlm.nih.gov/clinvar/variation/182978/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: W88* (c.263G>A)

MultipleGeneVariants: N/A

GroupID: 8

Case: 37Y0M, Sex Unknown, Ethnicity Unknown

DiseaseAssertion: assumed VHL

FamilyInfo: 1 of the 573 patients discussed in this paper were found to have this variant. This mutation was found in 1 VHL family with a single patient.

CasePresentingHPOs: HP:0005584; HP:0009711; HP:0006880 (renal cell carcinoma; retinal capillary hemangioma; cerebellar hemangioblastoma)

CaseHPOFreeText: patient had retinal angiomas diagnosed at 28Y, cerebellar hemangioblastomas diagnosed at 22Y, and renal cell carcinoma diagnosed at 37Y.

CaseNotHPOs: HP:0002666 (pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplementary Table S1.

Variant: p.R177* (c.529A>T)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 625258 https://www.ncbi.nlm.nih.gov/clinvar/variation/625258/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: R177* (c.529A>T)

MultipleGeneVariants: N/A

PatientID: 127

KindredID: 47

Case: F, 28Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0001737; HP:0001732; HP:0009711 (Hemangioblastoma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas, Retinal capillary hemangioma)

CaseHPOFreeText: The proband presented at age 25 with a CNS hemangioblastoma, retinal angioma, and renal cell carcinoma, and presented with multiple pancreatic cysts/tumors at age 28.

CaseNotHPOs: HP:0002666 (Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This kindred was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.E134_V142del (c.402_428del)

LegacyVariant: N/A

CaseProblemVariantFreeText: Variant listed in the paper as c.402-428delATTATTTGTGCCATCTCTCAATGTTGA, p.Glu134Aspfs*72. Listed protein change does not match deletion. Deletion is in-frame and should not lead to a frame shift. Variant updated in this annotation based on protein change listed in ClinGen/ listed on Variant Validator for c.402-428del.

ClinVarID: N/A

CAID: CA2573320387, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2573320387

gnomAD: N/A

VariantEvidence: N/A

MutationType: inframe_deletion

CivicName: E134_V142del (c.402_428del)

MultipleGeneVariants: N/A

PatientID: 175

KindredID: 69

Case: F, 35Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The male proband, patient 143, was diagnosed with renal cell carcinoma and multiple pancreatic cysts/tumors at age 33. His mother, who was not confirmed with the mutation, had a CNS hemangioblastoma at 30, retinal angioma at 54, and renal cell carcinoma at 50. His sister had a CNS hemangioblastoma at 28, and renal cell carcinoma/ multiple pancreatic cysts/tumors at 35. His niece, who was not confirmed with the mutation, had a CNS hemangioblastoma at age 12. His aunt had a CNS hemangioblastoma at 37, retinal angioma at 45, and renal cell carcinoma at 53. The son of his aunt was asymptomatic at the time of analysis.

CasePresentingHPOs: HP:0005584; HP:0001737; HP:0001732; HP:0010797 (Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas, Hemangioblastoma)

CaseHPOFreeText: The proband's sister presented with a CNS hemangioblastoma at age 28 and renal cell carcinoma and multiple pancreatic cysts/tumors at age 35.

CaseNotHPOs: HP:0002666; HP:0009711 (Pheochromocytoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.C162W (c.486C>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223227; https://www.ncbi.nlm.nih.gov/clinvar/variation/223227/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: C162W (c.486C>G)

MultipleGeneVariants: N/A