24,814 Matching Annotations
  1. Aug 2021
  2. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.11.455959
    1
    1. sciscore 19 Aug 2021

      SciScore for 10.1101/2021.08.11.455959: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All work with SARS-CoV-2 was performed in a biosafety level 3 laboratory using appropriate personal protective equipment and protocols approved by the Institutional Biosafety Committee and Environmental Health and Safety at the University of Pennsylvania.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines and infection: We cultured A549ACE2 cells at 37°C and 5% CO2 in RPMI 1640 supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We cultured Huh7.5 cells at 37°C and 5% CO2 in DMEM supplemented with 10% fetal bovine serum, 1% penicillin/streptomycin, and 1% L-Glutamax.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7.5</div><div>suggested: RRID:CVCL_7927)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We divided each 52-mer oligo into two non-overlapping 25-mer sequences (removing the middle two nucleotides) and appended split-initiator HCR sequences using a custom matlab script (see Supp.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>matlab</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To target SARS-CoV-2 subgenomic RNAs, we referenced the UCSC Genome Browser for SARS-CoV-2 genome datasets (https://genome.ucsc.edu/covid19.html) and RNA-sequencing datasets44 to identify the most frequent junction locations and peri-junction sequences based on the most abundant sgRNA junction spanning reads.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UCSC Genome Browser</div><div>suggested: (UCSC Genome Browser, RRID:SCR_005780)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We then used CellProfiler to segment cells using 4’,6-diamidino-2-phenylindole (DAPI) to identify nuclei.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CellProfiler</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.11.455959
  3. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.11.455942
    1
    1. sciscore 19 Aug 2021

      SciScore for 10.1101/2021.08.11.455942: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Mice were maintained under specific pathogen-free conditions at the Institute Leloir animal facility and all experiments were conducted in accordance with animal use guidelines and protocols approved by the Institutional Animal Care and Use Committee (IACUC protocol 69).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mice immunization: Six- to eight-week-old male BALB/c mice (obtained from the animal facility of the Veterinary School, University of La Plata, Argentina) were immunized with 109 or 1010 viral particles (vp) of Ad.C (empty vector), CoroVaxG.5 or CoroVaxG.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA: Sera from all mice were collected at different time points after immunization and evaluated for SARS-CoV-2-S-specific IgG antibodies using ELISA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2-S-specific IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sera collected at week 4 after vaccination were also tested for SARS-CoV-2-S-specific IgG1 and IgG2a antibodies using ELISA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2-S-specific IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG2a</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed and bound specific IgG was detected with a HRP-conjugated goat anti-mouse IgG H&L antibody (ab6789, Abcam) diluted 1: 10,000 in blocking buffer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (Abcam Cat# ab6789, RRID:AB_955439)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization of authentic SARS-CoV-2 virus: Neutralizing antibody (nAb) titers against SARS-CoV2 were defined according to the following protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CRL-3216), Vero cells (CCL-81), Hs 729T (HTB-153) and THP-1 (TIB-202) cells were obtained from the ATCC (Manassas, VA, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>THP-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293 cells were purchased from Microbix Biosystems Inc (Mississauga, Canada) and 911 cells were already described63.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T-hACE2 cells were already described64.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-hACE2</div><div>suggested: RRID:CVCL_A7UK)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the selection of the most appropriate promoter, HEK293T cells grown in 24-well plates were co-transfected with 1 μg of the different plasmids and 100 ng of pS-CMV-Renilla, using Lipofectamine 2000 (Thermo Fisher Scientific, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The viruses were propagated in HEK-293 cells in CellSTACK® cell culture chambers (Corning, Arizona, USA), purified by double CsCl density gradient centrifugation and stored in 10% glycerol in single-use aliquots at –80°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK-293T cells growing in Optimem media (Gibco, MD, USA) with 2% of FBS were transduced with G*ΔG-VSV at a multiplicity of infection of four.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, 100 μl of 5×105/mL HEK293T-ACE2 cells were added to the pseudovirus-serum mixture and incubated at 37 °C, 5% CO2 for 20-24 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For RBD inoculations eight-week-old male BALB/c mice were immunized with 7.5 μg of the receptor binding domain of Spike protein (kindly gifted by Andrea Gamarnik, Argentina) in 75 μL Complete Freund’s Adjuvant (CFA, Sigma, St. Louis, MO) via subcutaneous injection and boosted 2 weeks later with 5 μg of RBD in 100 μL Incomplete Freund’s Adjuvant (IFA, Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Promoter and fiber selection: Promoters were synthesized by Genscript (NJ, USA) with NotI / (XhoI-StuI) flanking restriction sites and cloned in the NotI / StuI sites of the vector pShuttle-I-XP-Luc63 to obtain pShuttle-Pr1-Luc and pShuttle-Pr2-Luc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pShuttle-I-XP-Luc63</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pShuttle-Pr1-Luc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The vectors pAd-SV40-Luc, and pS-CMV-Renilla were previously described63.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pAd-SV40-Luc</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pS-CMV-Renilla</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The synthesized 4,650 bp fragment was cloned into the pShuttle-Pr2-Luc vector digested with StuI / SalI to exchange the luciferase ORF by the designed Spike cassette, downstream of Pr2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pShuttle-Pr2-Luc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sequence of the resulting plasmid pS-Spike(D614G)-PP was confirmed by sequencing (Macrogen, Seul, Korea).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pS-Spike(D614G)-PP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To construct the non-replicating adenoviruses, the plasmid pS-Spike(D614G)-PP was linearized with PmeI and co-transformed with E1/E3 (pCoroVaxG.5) or E1 (pCoroVaxG.3) deleted adenoviral backbone vectors in electrocompetent BJ5183 bacteria.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCoroVaxG.5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCoroVaxG.3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the full length cDNA of Spike-D614G, and the Spike variants B.1.1.7 (alpha, first identified in the UK) and P.1 (gamma, first identified in Manaos, Brazil), were cloned into the eukaryotic expression vector pcDNA3.1, using the EcoRV restriction site and blunt-end ligation strategy, to generate the recombinant plasmids pcDNA-3.1-Spike-D614G, pcDNA-3.1-Spike-B,1,1,7 and pcDNA-3.1-Spike-P.1..</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div><div style="margin-bottom:8px"><div>pcDNA-3.1-Spike-D614G</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pcDNA-3.1-Spike-B,1,1,7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pcDNA-3.1-Spike-P.1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein extracts were separated by SDS-PAGE with a 10% gel and transferred to nitrocellulose membranes (Bio-Rad Laboratories).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bio-Rad Laboratories</div><div>suggested: (Bio-Rad Laboratories, RRID:SCR_008426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Semi-quantifications of WB assays were performed by densitometry using the ImageJ software 1.53 (Wayne Rasband, NIH, USA), normalizing by β-actin expression.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For each IgG subclass reference, a standard curve was plotted using GraphPad Prism 8.0 generating a four-parameter logistical (4PL) fit of the OD 450 nm at each serial antibody dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were acquired on a FACSAria Fussion cytometer and analysis was performed using Flow Jo version 10.7.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flow Jo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.11.455942
  4. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.10.455874
    1
    1. sciscore 19 Aug 2021

      SciScore for 10.1101/2021.08.10.455874: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To achieve a broad coverage of cytokines, all cytokines listed in the ImmuneXpresso and ImmunoGlobe systems immunology databases were selected.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImmuneXpresso</div><div>suggested: (immuneXpresso, RRID:SCR_017578)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The metanetworks were created by generating all shortest paths of length five in the base network, with the get_simple_paths() function of the NetworkX (version: 2.5) python library (python version: 3.8.6).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The curated cell - cytokine and cytokine - cell interaction annotations from immuneXpresso and ImmunoGlobe were included in CytokineLink, assigning literature enrichment to the cell - cytokine associations to the underlying edges in the general network the metaedges were created from.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CytokineLink</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression data was downloaded from GEO and analysed using GEO2R.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GEO2R</div><div>suggested: (GEO2R, RRID:SCR_016569)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.10.455874
  5. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.10.21261849
    1
    1. sciscore 19 Aug 2021

      SciScore for 10.1101/2021.08.10.21261849: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The Chesapeake/Advarra Institutional Review Board served as the central IRB for five sites, and the University of Florida Institutional Review Board served as the IRB of record for the Jacksonsville, FL site.<br>Consent: De-identified samples and other data were included in the study under IRB-approved waivers of consent and authorization.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, goat anti-human IgA, IgM, and IgG horseradish peroxidase (HRP) secondary antibodies (ThermoFisher) were diluted at 1:4000 in blocking buffer and 100 μL of each secondary antibody solution was added to each well for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgA, IgM</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.10.21261849
  6. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.10.21261868
    1
    1. sciscore 19 Aug 2021

      SciScore for 10.1101/2021.08.10.21261868: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical considerations: The study was reviewed by the Institutional Ethics Committee at the Public Health Foundation of India and by the Johns Hopkins Bloomberg School of Public Health (JHSPH) Institutional Review Board (IRB) and determined to be exempt from human subjects research oversight.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our study has some limitations that are worth noting. The survey was initiated one week after the initial rollout of the COVID-19 vaccines in India when information, options, and perceptions were rapidly changing. We acknowledge the possibility of selection bias; those who were respondents to our survey may have had strong opinions, whether positive or negative, about vaccination. Responses by the HCWs may have been affected by social desirability bias. Further, this was a cross-sectional survey administered at a single time-point, with no longitudinal follow-up; willingness to get vaccinated may change over time and be influenced by factors such as newer knowledge and the emergence of variants. This survey was conducted during a time when COVID-19 cases were on the decline in India, prior to the second surge, which could have impacted perceptions of individuals responding to our survey. Despite these limitations, our cross-sectional study is strengthened by the fact that we received responses from a diverse group of HCWs from across India. In conclusion, in this cross-sectional survey conducted at the onset of the COVID-19 vaccination rollout in India, we found that amongst a representative group of HCWs in India, overall attitudes towards COVID-19 vaccination and preparedness were positive, with the majority willing to accept a vaccine. Favorable vaccine efficacy and provision of vaccination free of cost were significantly associated with acceptance. As HCWs serve as ambass...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.10.21261868
  7. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.09.21261704
    1
    1. sciscore 19 Aug 2021

      SciScore for 10.1101/2021.08.09.21261704: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.1 Cell culture and virus propagation: Caco2 and A549-AT cells [20] were cultured in Minimum Essential Medium (MEM) supplemented with 10% fetal calf serum (FCS), 4 mM L-glutamine, 100 IU/ml of penicillin and 100 μg/ml of streptomycin at 37°C and 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-AT</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 isolates were grown using Caco2 cells as described previously [7].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco2</div><div>suggested: CLS Cat# 300137/p1665_CaCo-2, RRID:CVCL_0025)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.2 SARS-CoV-2 Neutralization Assay: SARS-CoV-2 antibody concentrations of this cohort were tested previously [14] with the SARS-CoV-2 IgG II Quant assay (Abbott Diagnostics) performed on the Alinity I with an analytical measurement range from 2.98–5680 binding antibody units per mL (BAU/mL)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.3 Statistical analysis: Data analysis was performed in Microsoft Excel and GraphPad Prism 8 (GraphPad Software, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.09.21261704
  8. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.11.456012
    1
    1. sciscore 19 Aug 2021

      SciScore for 10.1101/2021.08.11.456012: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">From these the relative parameters of viral inhibition were calculated compared to the viral effect in an infected, untreated cell culture free of TA. 2.2. Cell culture VeroE6 cell line (ATCC® CRL-1586™) was maintained in DMEM cell culture medium with the addition of 10% m/m Fetal Bovine Serum (FBS, Gibco/ThermoFisher, CA, USA) supplemented with 50 U/ml penicillin and 5 µl/mL streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, this dilution value would serve as the basis to calculate the 50% inhibitory ”dose”: the molar concentration for each ingredient (ID50) The copy numbers were the input for a sigmoidal curve fit using our own in-house developed algorithm and software in Octave mathematical environment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Octave</div><div>suggested: (GNU Octave, RRID:SCR_014398)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.11.456012
  9. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.12.21261951
    1
    1. sciscore 19 Aug 2021

      SciScore for 10.1101/2021.08.12.21261951: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: The study was approved by the Swedish Ethical Review Authority (dnr 2020-01653), and written informed consent was obtained from all study participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations of this study include the observational and single-center design and the large portion of women. Strengths include the long follow-up and different vaccine regimes within the same study protocol along with the baseline sample opportunity against the wild-type and VOC strains. Our findings of long-lasting neutralization of the widely spreading B.1.1.7 (Alpha) and B.1.617.2 (Delta) variants one year after wild type infection may aid vaccine policy makers in low-resource settings when prioritizing limited vaccine supply. Furthermore, the globally reduced capacity of neutralizing B.1.351 (Beta) and P.1 (Gamma) strains, but not the B.1.1.7 (Alpha) and B.1.617.2 (Delta) strains following both infection and three different vaccine regimens argues for caution against B.1.351 (Beta) and P.1 (Gamma)-exclusive spike protein mutations in the efforts to optimize next generation SARS-CoV-2 vaccines.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.12.21261951
  10. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.10.21261847
    1
    1. sciscore 19 Aug 2021

      SciScore for 10.1101/2021.08.10.21261847: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Samples: For this study a total of 905 SARS-CoV-2 positive samples were collected from Lebanon, selected at random from clinical diagnostic samples, to provide a representative view of regions within Lebanon as shown in Supplementary Figure 1.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The raw reads were demultiplexed using bcl2fastq (v2.20).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>bcl2fastq</div><div>suggested: (bcl2fastq , RRID:SCR_015058)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the reads had adapters trimmed with TrimGalore (Krueger [2016] 2020) and were aligned to the WuhanHu-1 reference genome (accession MN908947.3) using BWA-MEM (v0.7.17) (Li 2013); the ARTIC amplicons were trimmed and a consensus built using iVAR (v.1.3.0) (Grubaugh et al. 2019).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA-MEM</div><div>suggested: (Sniffles, RRID:SCR_017619)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.10.21261847
  11. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.11.21261885
    1
    1. sciscore 19 Aug 2021

      SciScore for 10.1101/2021.08.11.21261885: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the Hamad Medical Corporation and Weill Cornell Medicine-Qatar Institutional Review Boards with waiver of informed consent.<br>Consent: The study was approved by the Hamad Medical Corporation and Weill Cornell Medicine-Qatar Institutional Review Boards with waiver of informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Classification of infections by variant type: Surveillance for SARS-CoV-2 variants in Qatar is based on viral genome sequencing and multiplex, real-time reverse-transcription PCR (RT-qPCR) variant screening44 of random positive clinical samples2-6, and complemented by deep sequencing of wastewater samples2.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vaccine effectiveness at different time frames and its associated 95% CI were then calculated by applying the following equation35,36: Statistical analyses were conducted in STATA/SE version 17.045.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA/SE</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This study has limitations. Estimated effectiveness against severe, critical, or fatal COVID-19 disease had wider 95% confidence intervals than that against infection, as a consequence of the smaller number of such cases in the young population of Qatar10,34. Data on co-morbid conditions were not available; therefore, they could not be factored explicitly in our analysis. However, adjusting for age may have served as a proxy given that co-morbidities are associated with older age. Furthermore, with the young population of Qatar10,11, we anticipate that only a small proportion of the study population may have had serious co-morbid conditions. Accordingly, our findings may not be generalizable to other settings where the elderly population constitutes a sizable proportion of the population. Effectiveness was assessed using an observational test-negative case-control study design35,36, rather than a randomized clinical trial design where cohorts of vaccinated and unvaccinated individuals were being followed up. However, the cohort study design applied to the same population of Qatar yielded earlier similar findings to the test-negative case-control study design5,6, supporting the validity of this standard approach in assessing vaccine effectiveness for respiratory tract infections35,36. In conclusion, both the BNT162b2 and mRNA-1273 vaccines are highly effective in preventing hospitalization and death due to infection with the Delta variant. However, effectiveness against infect...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.11.21261885
  12. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.10.455799
    1
    1. sciscore 19 Aug 2021

      SciScore for 10.1101/2021.08.10.455799: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.10.455799
  13. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.10.455702
    1
    1. sciscore 19 Aug 2021

      SciScore for 10.1101/2021.08.10.455702: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Euthanasia Agents: At the termination of studies, or when clinical signs of disease such as 15% weight loss were present, hamsters were euthanized via CO2 inhalation, and bronchoalveolar lavage (BAL) fluid and lung tissue were collected.<br>IACUC: Ethics statement: All animal experiments were approved by the Institutional Biosafety Committee and Institutional Animal Care and Use Committee at Virginia Polytechnic Institute and State University (IACUC protocol 20-184).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viruses and cell lines: Inoculations were performed using SARS-CoV-2 strain USA-WA1/2020 (BEI Resources), which was passaged once in Vero E6 cells followed by once in Vero cells upon receipt.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral quantification: Plaque assays: Infectious virus was quantified via Vero cell plaque assay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistics were performed in GraphPad Prism 9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.10.455702
  14. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.10.21261843
    1
    1. sciscore 19 Aug 2021

      SciScore for 10.1101/2021.08.10.21261843: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">One of the uses of the χ2 statistic is in contingency (dependence) testing where n randomly selected items are classified according to two different criteria, such as when data are classified on the basis of two factors (row factor and column factor), where the row factor has r levels and the column factor has levels.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      On the other hand, the limitation of our study, we can’t include survivor in this study because survivor wasn’t available at that time. Our recommendation to conduct similar studies in different developing countries in the world for more evidence for the management of pandemic because rural people is less advanced in different perspectives than urban people. COVID-19 is now a pandemic and the situation are like time bomb as no medical treatment is too much effective and no proper vaccine yet discovered. Bangladesh become a highest worse condition regarding this infectious disease in the world due to overpopulated and lack of awareness. In this circumstance only people’s awareness in Bangladesh can help to protect us. This cross-sectional study was carried out to identify the awareness and behavioral perspective on COVID-19 between urban and rural people. Awareness regarding COVID-19 was unsatisfactory in rural residents as compared to urban. Based on the results of our study, we can conclude that improvement of COVID-19 knowledge, attitudes and promotion of awareness among residents by effective health education programs is needed especial care needed in rural areas. Our belief this survey will provide valuable information to the legislators regarding the perceptions of urban and rural population for the management of pandemic.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.10.21261843
  15. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.10.21261846
    1
    1. sciscore 19 Aug 2021

      SciScore for 10.1101/2021.08.10.21261846: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Equation [1] was fit to the complete cohort dataset using the fitlme function in Matlab (MathWorks, Cambridge, MA v2019b).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Matlab</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.10.21261846
  16. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.10.21261842
    1
    1. sciscore 19 Aug 2021

      SciScore for 10.1101/2021.08.10.21261842: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Data collection: We obtained written informed consent from all participants prior to recruitment.<br>Field Sample Permit: Sample collection and lab tests: For the reverse transcription-polymerase chain reaction (RT-PCR) test, we collected nasopharyngeal/oropharyngeal swabs.<br>IRB: Ethical Considerations: The Institutional Ethics Committee (IEC) of the Indian Institute of Public Health – Bengaluru campus reviewed and approved the study (vide.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">The low-risk group comprised pregnant women presenting for a regular check-up at the ante-natal care (ANC) clinic and attenders of patients coming to the outpatient department in the healthcare facilities.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The survey: We followed a protocol similar to the first round (Round 1) in September 2020[17] to estimate the fraction of the population with active infection and IgG antibodies at the time of the survey.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For IgG antibody testing, we collected 4 ml of venous blood, centrifuged it, transported the serum to the laboratory while maintaining a cold chain, and detected SARS-CoV-2-specific IgG antibodies using a commercial, ICMR-approved, ELISA-based test kit (Covid Kavach Anti SARS-Cov-2 IgG antibody detection ELISA, Zydus-Cadila, India) [25] following the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2-specific IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti SARS-Cov-2 IgG</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.10.21261842
  17. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.10.21261726
    1
    1. sciscore 19 Aug 2021

      SciScore for 10.1101/2021.08.10.21261726: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.10.21261726
  18. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.09.21261819
    1
    1. sciscore 19 Aug 2021

      SciScore for 10.1101/2021.08.09.21261819: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Python programming language was used for the analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Furthermore, one of the significant limitations of the model is that it does not include the natural death and birth rates assuming those are constant 4,20. In addition, during the COVID-19 pandemic, there are broad variations in estimations of Case Fatality Rate (CFR) that may be misleading. Countries may be more or less likely to detect and report all COVID-19 deaths. Furthermore, they may be using different case definitions and testing strategies or counting cases differently. Variations in CFR also may be explained in part by the way time lags are handled. Differing quality of care or interventions being introduced at different stages of the illness also may play a role. Finally, the profile of patients may vary between countries 15. The proposed model uses the predictors as given in the parameter table under the methodology section. The model was internally validated using the parameters available in the previous studies in the underpinning literature. As with any modelling approach, our findings relate to the assumptions and inputs of the model which lead to a major limitation. The assumptions with the greatest potential effect on our findings are the structural assumptions of a compartmental epidemiological model4. Furthermore, the predictive capability of the tool is highly dependent on several preliminary data for parameter estimation. This dependence may lead to data misinterpretation, especially considering the SIR model. Notably, an essential parameter in epidemic...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.09.21261819
  19. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.09.21261555
    1
    1. sciscore 19 Aug 2021

      SciScore for 10.1101/2021.08.09.21261555: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Study Design and patients: This case series is part of a project titled disease profile of COVID-l9 including their follow-up in patients at a tertiary institute in India, approved by the Institutional Ethical Committee, All India Institute of Medical Sciences (AIIMS), Rishikesh, India (CTRI/2020/08/027169).<br>Field Sample Permit: Scraping or exudate from the nasal cavity and/or paranasal sinuses, hard palatal lesions, sinus material, a biopsy from extracted tooth socket area, endoscopic collection of debrided tissue/biopsy, etc were sampled [6].</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This study has its own limitations with lack of serum GM test which could have helped identifying the cases as of proven invasive aspergillosis. In the study, despite an early diagnosis of fungal infection post-admission, most participants could not be started on antifungal immediately with an average gap of 4-5 days in diagnosis and start of antifungal due to limited supply of amphotericin-B (Figure 1). Similar observations were made in a multicentric study conducted in other parts of India [30]. A delay of a week in diagnosis may double the 30-day mortality from 35% to 66% [3]. Treating CAMA is more worrisome since one (aspergillosis is a metastatic invasive infection) focuses majorly on medical treatment while the other focuses equally on surgical and medical management (mucor is a locally invasive infection). Patient 1 was diagnosed about 10 days after admission and couldn’t be saved, reflecting on the need for timely diagnosis and treatment. In conclusion, mixed fungal infections i.e. CAMA as COVID sequelae may be an emerging disease. This outbreak was seen particularly in COVID (or post-) patients with uncontrolled diabetes, on steroids, or cocktail therapy, or living in unhygienic environments. So judicious and relevant use of various medicines (drug stewardship) along with strict maintenance of personal and environmental hygiene is the key to prevent CAMA in COVID era. Patients should be advised to keep a check on their glycaemic index and seek medical advice at the e...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.09.21261555
  20. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.09.21261809
    1
    1. sciscore 19 Aug 2021

      SciScore for 10.1101/2021.08.09.21261809: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      For COVID-19, this is an important limitation because variants have been shown to exhibit properties such as being more transmissible and/or more deadly. Additionally, viruses like the Delta variant of COVID-19 seems to be just as transmissible from vaccinated people [10], which could potentially impact the results of this study. The second main assumption that this study makes is that vaccinated people can never get infected with the disease, not transmit the disease, and are instantly protected after the shot. While vaccines like Moderna and Pfizer-BioNTech mRNA vaccines work remarkably well, with the BNT162b2 mRNA vaccine of Pfizer and BioNTech having a 95% protection [11], there are documented cases of breakthrough infections, which are only increasing with the new Delta variant [12]. However, because of breakthrough infections’ rarity, it is unlikely they would have impacted the ICU hospitalizations and deaths greatly, leading the results found in this study to continue to be valid. In future studies, it would be beneficial to account for extraneous variables, such as the impact of variants and vaccine efficacy.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.09.21261809
  21. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.16.456510
    1
    1. sciscore 19 Aug 2021

      SciScore for 10.1101/2021.08.16.456510: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animals housing and experimental design: All animals were handled in accordance with the Animal Welfare Act and the study procedures were reviewed and approved by the Institutional Animal Care and Use Committee at the Cornell University (IACUC approval number 2020-0064).<br>Euthanasia Agents: Ferrets were humanely euthanized on day 14 pi under deep inhalatory anesthesia using isoflurane followed by heart puncture.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Twenty young (6-month-old ferrets) and twenty aged ferrets (18 to 39-month-old [30.5±5.3 - average±SD]) were randomly allocated to experimental groups (n = 4).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Cell cultures with no CPE were frozen, thawed, and subjected to two additional blind passages/inoculations in Vero E6/TMPRSS2 cell cultures.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For this, the original sample was subjected to limiting dilutions and inoculated into Vero E6/TMPRSS2 cells cultures in 96-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6/TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following incubation of serum and virus, 50 µl of a cell suspension of Vero E6 cells was added to each well of a 96-well plate and incubated for 48 h at 37 °C with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The three-parameter logistic model was implemented in GraphPad Prism software (Version 9.0.1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 27. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.16.456510
  22. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.15.456333
    1
    1. sciscore 19 Aug 2021

      SciScore for 10.1101/2021.08.15.456333: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: The final models have been validated and deposited using the wwPDB OneDep System and the final refinement statistics, PDB codes are summarized in Table 3.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence alignment: The full spike proteins from the five different coronaviruses were aligned using the online alignment software Rhône-Alpes Bioinformatics Center (PRABI http://www.prabi.fr/) multiple sequence alignment CLUSTALW (29).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PRABI</div><div>suggested: (PRABI, RRID:SCR_010522)</div></div><div style="margin-bottom:8px"><div>CLUSTALW</div><div>suggested: (ClustalW, RRID:SCR_017277)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, CD8+ T cell lines were stimulated with cognate peptide pools or 10µM individual peptides (Genscript) and incubated for 5 hours in the presence of GolgiPlug (BD Biosciences), GolgiStop (BD Biosciences) and anti-CD107a-AF488 (BD Biosciences/eBioscience).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Biosciences</div><div>suggested: (BD Biosciences, RRID:SCR_013311)</div></div><div style="margin-bottom:8px"><div>BD Biosciences/eBioscience</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were acquired on a BD LSRFortessa with FACSDiva software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FACSDiva</div><div>suggested: (BD FACSDiva Software, RRID:SCR_001456)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis was performed using FlowJo software where cytokine levels identified in the R0 control condition were subtracted from corresponding test conditions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Manual model building was conducted using COOT (37) followed by refinement with BUSTER (38).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div><div style="margin-bottom:8px"><div>BUSTER</div><div>suggested: (BUSTER, RRID:SCR_015653)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All molecular graphics representations were created using PyMOL (Schrodinger, LLC, v1.7.6.3)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fluorescence intensity data was normalised and plotted using GraphPad Prism 9 (version 9.0.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Kinetics data was analysed using the T200 BiaE-valuation software, whilst steady state values were extracted using T200 BiaEvaluation software, plotted and fitted into a one-site specific binding non-linear regression using Graphpad Prism (version 9.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BiaEvaluation</div><div>suggested: (BIAevaluation Software, RRID:SCR_015936)</div></div><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 4. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.15.456333
  23. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.09.21261669
    1
    1. sciscore 19 Aug 2021

      SciScore for 10.1101/2021.08.09.21261669: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Additionally, one major caveat of pooled testing is sample dilution and the increase of false negatives. To eliminate the pooling dilution effect, we utilized a modified RNA extraction protocol which differs from current clinical diagnostic lab procedures by simply concentrating the RNA to a set volume regardless of the patient input number (Fig. 2A). This standardizes the dilution to an expected and reproducible ΔCt from the ground truth value that does not change if the number of patients within a pool increases (Fig. 2B). This protocol alone removes the risk of samples with low levels of virus being diluted in a pool and being read as a false negative. Our approach demonstrates an effective process to combat testing bottlenecks for future pandemics. Many clinical testing labs currently utilize automated RNA extraction systems in which parameters can be changed to fit our new protocols. Additionally, we have created a beta decoding software in which qPCR data can be entered and the program will decode the data, identify positive patients, and generate additional pools for further testing, if needed, all automatically (software code available upon request). Most importantly, the application of our testing method is broad and can be applied to many testing applications within medicine and beyond such as serum antibody testing, drug screening, avian influenza surveillance, water contamination testing, etc. Our application of compressed sensing is perfectly positioned for testi...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.09.21261669
  24. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.09.21261754
    1
    1. sciscore 19 Aug 2021

      SciScore for 10.1101/2021.08.09.21261754: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics clearance: Ethics approval (Ethics 2020-24) was provided by the Research Ethics Committee of the International Institute of Social Studies, Erasmus University Rotterdam.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">There are 91 health centers in Addis Ababa and 44 were randomly chosen for the survey.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.09.21261754
  25. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.09.21261798
    1
    1. sciscore 19 Aug 2021

      SciScore for 10.1101/2021.08.09.21261798: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: 2.1 Serum samples: The study was approved by the Ethics and Research Committee of Universidade Anhembi Morumbi, under protocol No. 26691419.6.0000.5492.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The materials from nasopharynx and oropharynx were subjected to analyses performed using a RT-PCR assay (Abbott Real-Time SARS-CoV-2 kit, Abbott Laboratories, São Paulo, SP, Brazil), which characterizes the individuals as “detectable” and “undetectable” for COVID-19 disease [29].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott Laboratories</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.09.21261798
  26. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.09.455609
    1
    1. sciscore 19 Aug 2021

      SciScore for 10.1101/2021.08.09.455609: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The LMM method builds a linear mixed-effects model and can therefore handle random effects in contrast to the limma method where a grouping variable can be included only as an additional fixed effect (Weber et al. (2019)).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>limma</div><div>suggested: (LIMMA, RRID:SCR_010943)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A limitation on the level of dataset evaluation is that we could not interpret the results obtained on the PBMC dataset biologically. We could therefore not describe which markers were falsely classified as differentially expressed and which markers were overlooked. Additionally, we did not include a dataset with batch effects but assumed that the data had already been corrected for it. Theoretically, it should be possible to include a batch effect as a random effect or additional term in a model. This can be done for all the approaches we evaluated but the statistical tests and CyEMD. Finally, the downsampling of the spiked and the CytoGLMM datasets was not repeated multiple times. If that would have been done, the results would be more reliable and robust. In this study, repeating the evaluations that many times was not feasible because of the high runtime requirement of BEZI and ZAGA. All in all, the diffcyt methods perform fast and yield good, trustworthy results when the median of the differentially expressed marker is unequal to zero. Nevertheless, they did not outperform a simple, Wilcoxon signed-rank test or t-test on the medians, meaning that a more complicated model is not certainly necessary to detect significant differences in CyTOF marker medians. The comparison with the Kruskal-Wallis test on marker medians shows that the clear advantage of the Wilcoxon/t-test is the ability to compute a paired test statistic. Regarding the cytoGLMM methods, we observe that smal...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.09.455609
  27. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.09.455606
    1
    1. sciscore 19 Aug 2021

      SciScore for 10.1101/2021.08.09.455606: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.09.455606
  28. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.15.456423
    1
    1. sciscore 19 Aug 2021

      SciScore for 10.1101/2021.08.15.456423: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.15.456423
  29. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.13.456326
    1
    1. sciscore 19 Aug 2021

      SciScore for 10.1101/2021.08.13.456326: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.13.456326
  30. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.13.456164
    1
    1. sciscore 19 Aug 2021

      SciScore for 10.1101/2021.08.13.456164: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animal experiment: Female, C57BL/6 mice (6-8 weeks of age) and Balb/c mice (6-8 weeks of age) were purchased from Beijing Vital Laboratory Animal Technology Co., Ltd. (Beijing, China) and Shanghai Jiesjie Laboratory Animal Co., Ltd. (Shanghai, China), which were kept in SPF condition.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">All animal studies were performed after randomization.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antigen-specific humoral immune responses: Enzyme-linked immunosorbent assay (ELISA) was used to measure the antigen-specific antibody production induced by the DNA vaccinations as previously described.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies were detected with HRP-conjugated goat anti-mouse IgG (Southern Biotech, Birmingham, AL) after the enzymatic reaction was developed, the OD values were read at 450/620 nm by an ELISA plate reader (Bio-Rad, Hercules, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 015-620-003, RRID:AB_2337231)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Goat anti-Rabbit IgG-HRP (Invitrogen, 32460) and Rabbit anti-hACE2 antibody (Sino Biological, 10108-RP01) were used to detect the concentration of hACE2 binding with the RBD.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Rabbit IgG-HRP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-hACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Seed SARS-CoV-2 (SARS-CoV-2/WH-09/human/2020) stocks and virus isolation studies were performed in Vero E6 cells, which are maintained in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen, USA) supplemented with 10% fetal bovine serum (FBS), 100 IU/mL penicillin, and 100 μg /mL streptomycin, and incubated at 36.5 °C, 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The diluted samples were mixed with a virus suspension of 100 TCID50 in 96-well plates at a ratio of 1:1, followed by 2 h incubation at 36.5 °C in a 5% CO2 incubator. 1× 104 Vero cells were then added to the serum-virus mixture, and the plates were incubated for 3–5 days at 36.5 °C in a 5% CO2 incubator.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animal experiment: Female, C57BL/6 mice (6-8 weeks of age) and Balb/c mice (6-8 weeks of age) were purchased from Beijing Vital Laboratory Animal Technology Co., Ltd. (Beijing, China) and Shanghai Jiesjie Laboratory Animal Co., Ltd. (Shanghai, China), which were kept in SPF condition.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Balb/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmid preparation: Plasmids of pGX9501, pVAX1-S-WT, and pVAX1 were transformed into DH5a E.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pGX9501</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pVAX1-S-WT</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Six hours later, the percentage of labeled cells was detected with LSRFortessa flow cytometry (BD) and analyzed by FlowJo (TreeStar).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics were performed using GraphPad Prism 7 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.13.456164
  31. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.13.456316
    1
    1. sciscore 19 Aug 2021

      SciScore for 10.1101/2021.08.13.456316: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: All animal studies were conducted in compliance with all relevant local, state, and federal regulations and were approved by the Bioqual Institutional Animal Care and Use Committee (IACUC).<br>IACUC: All animal studies were conducted in compliance with all relevant local, state, and federal regulations and were approved by the Bioqual Institutional Animal Care and Use Committee (IACUC).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animals and study design: 18 cynomolgus macaques were randomly assigned to three groups.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Immunologic and virologic assays were performed blinded.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">B cell immunophenotyping: Fresh PBMCs were stained with Aqua live/dead dye (Invitrogen) for 20 min, washed with 2% FBS/DPBS buffer, and suspended in 2% FBS/DPBS buffer with Fc Block (BD) for 10 min, followed by staining with monoclonal antibodies against CD45 (clone D058-1283, BUV805), CD3 (clone SP34.2, APC-Cy7), CD7 (clone M-T701, Alexa700), CD123 (clone 6H6, Alexa700), CD11c (clone 3.9, Alexa700), CD20 (clone 2H7, PE-Cy5), IgA (goat polyclonal antibodies, APC), IgG (clone G18-145, BUV737), IgM (clone G20-127, BUV396), IgD (goat polyclonal antibodies, PE), CD80 (clone L307.4, BV786), CD95 (clone DX2, BV711), CD27 (clone M-T271, BUV563), CD21 (clone B-ly4, BV605), CD14 (clone M5E2, BV570) and CD138 (clone DL-101, PE-CF594).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD45</div><div>suggested: (BD Biosciences Cat# 564914, RRID:AB_2744401)</div></div><div style="margin-bottom:8px"><div>CD3</div><div>suggested: (GenWay Biotech Inc. Cat# GWB-220B7B, RRID:AB_10511043)</div></div><div style="margin-bottom:8px"><div>CD7</div><div>suggested: (BD Biosciences Cat# 741824, RRID:AB_2871159)</div></div><div style="margin-bottom:8px"><div>CD123</div><div>suggested: (BD Biosciences Cat# 751837, RRID:AB_2875808)</div></div><div style="margin-bottom:8px"><div>CD11c</div><div>suggested: (BioLegend Cat# 117331, RRID:AB_10900261)</div></div><div style="margin-bottom:8px"><div>CD20</div><div>suggested: (BD Biosciences Cat# 743611, RRID:AB_2741622)</div></div><div style="margin-bottom:8px"><div>PE-Cy5), IgA</div><div>suggested: (Bioss Cat# bs-0645R-PE-Cy5, RRID:AB_11071475)</div></div><div style="margin-bottom:8px"><div>IgM</div><div>suggested: (Creative Diagnostics Cat# DCABY-1319, RRID:AB_2493413)</div></div><div style="margin-bottom:8px"><div>CD80</div><div>suggested: (Thermo Fisher Scientific Cat# EPX140-15803-901, RRID:AB_2576106)</div></div><div style="margin-bottom:8px"><div>CD95</div><div>suggested: (BD Biosciences Cat# 741292, RRID:AB_2870823)</div></div><div style="margin-bottom:8px"><div>CD27</div><div>suggested: (BD Biosciences Cat# 748705, RRID:AB_2873109)</div></div><div style="margin-bottom:8px"><div>CD21</div><div>suggested: (BD Biosciences Cat# 740395, RRID:AB_2740125)</div></div><div style="margin-bottom:8px"><div>CD14</div><div>suggested: (BioLegend Cat# 301831, RRID:AB_10897803)</div></div><div style="margin-bottom:8px"><div>CD138</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IFN-γ enzyme-linked immunospot (ELISPOT) assay: ELISPOT plates were coated with mouse anti-human IFN-γ monoclonal antibody from BD Pharmingen at a concentration of 5 μg/well overnight at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IFN-γ</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plates are washed a second time and incubated for 2 h with Streptavidin-alkaline phosphatase antibody from Southern Biotechnology (1 μg/mL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Streptavidin-alkaline phosphatase</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the packaging plasmid psPAX2 (AIDS Resource and Reagent Program), luciferase reporter plasmid pLenti-CMV Puro-Luc (Addgene), and Spike protein expressing pcDNA3.1-SARS CoV-2 SΔCT of variants were co-transfected into HEK293T cells by lipofectamine 2000 (ThermoFisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To determine the neutralization activity of the plasma or serum samples from participants, HEK293T-hACE2 cells were seeded in 96-well tissue culture plates at a density of 1.75 x 104 cells/well overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-hACE2</div><div>suggested: RRID:CVCL_A7UK)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the packaging plasmid psPAX2 (AIDS Resource and Reagent Program), luciferase reporter plasmid pLenti-CMV Puro-Luc (Addgene), and Spike protein expressing pcDNA3.1-SARS CoV-2 SΔCT of variants were co-transfected into HEK293T cells by lipofectamine 2000 (ThermoFisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>psPAX2</div><div>suggested: RRID:Addgene_12260)</div></div><div style="margin-bottom:8px"><div>pLenti-CMV</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pcDNA3.1-SARS</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The gene fragment was subsequently cloned into a pcDNA3.1+ expression plasmid using restriction site cloning (Integrated DNA Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1+</div><div>suggested: RRID:Addgene_117272)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequent analyses were performed using FlowJo software (Treestar, v.9.9.6).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses: Statistical analyses were performed using GraphPad Prism (version 9.0) software (GraphPad Software) and comparison between groups was performed using a two-tailed nonparametric Mann-Whitney U t test.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.13.456316
  32. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.13.456317
    1
    1. sciscore 19 Aug 2021

      SciScore for 10.1101/2021.08.13.456317: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 42. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.13.456317
  33. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.15.456422
    1
    1. sciscore 19 Aug 2021

      SciScore for 10.1101/2021.08.15.456422: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The coronavirus cleavage sites: At least one polyprotein (ORF1ab) sequence with the known cleavage sites of the 3CL protease were obtained for 14 coronavirus species in three genera including Alphacoronavirus, Betacoronavirus and Gammacoronavirus from the NCBI RefSeq and protein databases on April 15th,2021 (Table S1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RefSeq</div><div>suggested: (RefSeq, RRID:SCR_003496)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For each coronavirus species with the known cleavage sites on at least one polyprotein, the polyprotein sequences were obtained from the NCBI protein database and were aligned with MAFFT (version 7.427) (Katoh and Standley, 2013).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NCBI</div><div>suggested: (NCBI, RRID:SCR_006472)</div></div><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The AA indexes: A total of 566 AA indexes were obtained from the AAindex database (version 9.2) on November 18th, 2020 (Kawashima et al., 2008).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AAindex</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The location of human proteins were inferred based on the subcellular location provided by the UniProt database.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UniProt</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Logo of sequences centered the cleavage sites: The logo of sequences centered the cleavage sites was generated with WebLogo 3 using the default parameters on April 16th, 2021 (Crooks et al., 2004).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>WebLogo</div><div>suggested: (WEBLOGO, RRID:SCR_010236)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Principal Component Analysis (PCA): The PCA of the AA indexes were achieved using the module of sklearn.decomposition in Python (version 3.7) (Pedregosa et al., 2011).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Functional enrichment analysis of human genes: The KEGG pathway and GO enrichment analysis was conducted with functions of enrichKEGG and enrichGO in the package clusterProfiler (version 3.18.1) in R (version 4.0.5) (Yu et al., 2012).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div><div style="margin-bottom:8px"><div>clusterProfiler</div><div>suggested: (clusterProfiler, RRID:SCR_016884)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      There were some limitations in the study. Firstly, although the dataset was much larger than that used in previous studies, the dataset was still limited in size. The cleavage sites of the Deltacoronavirus were not included in the analysis. Nevertheless, the computational model developed here still showed high accuracy in both validations and testing, suggesting their potential usage in predicting the cleavage sites of the coronavirus 3CL protease. Secondly, the P1 position of the coronavirus 3C-like protease cleavage site was supposed to be highly conserved with Q, although there were a few cleavage sites with other residues in the P1 position. More experimental efforts are needed to determine the AA specificity of the coronavirus 3CL protease cleavage sites. Thirdly, only 12 experimentally-validated cleavage sites were used to test the model. More experimental validations are needed to evaluate the performance of the model.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.15.456422
  34. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.16.456470
    1
    1. sciscore 19 Aug 2021

      SciScore for 10.1101/2021.08.16.456470: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.16.456470
  35. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.15.456341
    1
    1. sciscore 19 Aug 2021

      SciScore for 10.1101/2021.08.15.456341: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethics statement: All animal studies and experiments were approved and performed under the Kansas State University (KSU) Institutional Biosafety Committee (IBC, Protocol #1460) and the Institutional Animal Care and Use Committee (IACUC, Protocol #4468) in compliance with the Animal Welfare Act.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Virus challenge of animals: Six female white-tailed deer (WTD), approximately 2 years of age, were acquired from a Kansas deer farm (Muddy Creek Whitetails, KS) and acclimated for ten days in BSL-3Ag biocontainment with feed and water ad libitum prior to experimental procedures.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Two independent veterinary pathologists (blinded to the treatment groups) examined the slides and morphological descriptions were provided.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following three washes with PBS-T, 100 μL of HRP-labelled Rabbit Anti-Deer IgG (H+L) secondary antibody (95058-328, VWR, Batavia, IL, USA) diluted 1:1000 (100ng/mL) was added to each well and incubated for 1 hour at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Deer IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Indirect ELISA was used to detect Bovine Coronavirus (BCoV) antibodies in sera with Spike (S) recombinant viral protein (LSBio, LS-G64076-20, Seattle, WA, USA) using the methods described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BCoV</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2-specific immunohistochemistry (IHC): IHC was performed as previously described (9) on four-micron sections of formalin-fixed paraffin-embedded tissue mounted on positively charged Superfrost® Plus slides and subjected to IHC using a SARS-CoV-2-specific anti-nucleocapsid rabbit polyclonal antibody (3A, developed by our laboratory) with the method previously described (35).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-nucleocapsid</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and virus isolation/titrations: Vero E6 cells (ATCC; Manassas, VA) and Vero E6 cells stably expressing transmembrane serine protease 2 (Vero-E6/TMPRSS2; 33) were obtained from Creative Biogene (Shirley, NY) via Kyeong-Ok Chang at KSU and used for virus propagation and titration.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To determine infectious virus titers of virus stocks and study samples, 10-fold serial dilutions were performed on Vero-E6/TMPRSS2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6/TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Selected swab and tissue homogenate samples were tested for viable virus by culture on Vero E6/TMPRRS2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6/TMPRRS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Susceptibility of cervid cells to SARS-CoV-2: The SARS-CoV-2 USA-WA1/2020 strain was passaged 3 times in Vero-E6 cells to establish a stock virus for infection experiments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Swabs were placed in 2mL of viral transport medium (DMEM, Corning; combined with 1% antibiotic-antimycotic, ThermoFisher), vortexed, and aliquoted directly into cryovials and RNA stabilization/lysis Buffer RLT (Qiagen, Germantown, MD, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher</div><div>suggested: (ThermoFisher; SL 8; Centrifuge, RRID:SCR_020809)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The two sequences for each of the locations listed above, corresponding to either lineage A (USA-WA1/2020) or alpha VOC B.1.1.7 (USA/CA_CDC_5574/2020), were subjected to BLAST mapping analysis against individual sample read databases to determine the relative amount of each strain in the samples.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Histopathology: Tissue samples from the respiratory tract (nasal cavity [rostral, middle and deep turbinates following decalcification with Immunocal™ Decalcifier (StatLab, McKinney, TX, for 4-7 days at room temperature), trachea, and lungs as well as various other extrapulmonary tissues (liver, spleen, kidneys, heart, pancreas, gastrointestinal tract [stomach, small intestine including Peyer’s patches and colon], cerebrum [including olfactory bulb], tonsils and numerous lymph nodes were routinely processed and embedded in paraffin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Peyer’s</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.15.456341
  36. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.04.455181
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.04.455181: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Collection of plasma and serum from donors and patients: All blood donors were screened following the FDA guidance instructions under an institutional review board approved protocol (IRB #202003554).<br>Field Sample Permit: At the time of plasma collection, serum samples were collected in serum separator tubes and allowed to clot for at least 30 minutes.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">The second study group is composed of convalescent plasma collected from women hospitalized for delivery, who had previously been infected by SARS-CoV-2, as confirmed by a SARS-CoV-2-positive PCR (n=7) or positive serology test (n=21).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Commercial immunoassays to measure antibodies that target SARS-CoV-2 proteins: The DiaSorin Liaison SARS-CoV-2 S1/S2 IgG chemiluminescence assay detects IgG against spike subunits S1 and S2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Ortho COVID-19 IgG antibody test was performed on Ortho’s VITROS® system.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COVID-19 IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells lines: Vero-E6 cells, human embryonic kidney (HEK) 293T cells and human osteosarcoma (HOS) cells were obtained from the American Type Culture Collection (ATCC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All proteins were produced by transient transfection of 293T cells using polyethyleneimine (PEI), as previously described (46).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To propagate virus, Vero-E6 cells cultured in DMEM/FCS 2% were infected at a multiplicity of infection (MOI) of 0.001.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HOS cells were seeded in white opaque 96-well plates (1.4 × 104 cells per well) and transfected the next day with 80 ng per well of pCG1-SARS-2-S plasmid expressing SARS-CoV-2 spike using JetPrime transfection reagent.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCG1-SARS-2-S</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These values, along with the log-transformed dilution values were fit to a non-linear regression model using GraphPad Prism 8 to calculate the IC50 value.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.04.455181
  37. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.05.455212
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.05.455212: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: In vivo mouse studies: All animal procedures were performed by adhering to the Institutional Animal Care and Use Committee (IACUC) guidelines.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The next day, cells were stained using a rabbit anti-N antibody (Invitrogen; PA5-81794) as primary and a goat anti-rabbit secondary conjugated to horseradish peroxidase (Invitrogen; 31460).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-N</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (Thermo Fisher Scientific Cat# 31460, RRID:AB_228341)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The spike trimer was expressed by transient transfection in 293F cells and purified by affinity chromatography as previously described (PMID: 33842901).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293F</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization assay: Twenty-thousand Vero.E6 cells were seeded per well in a 96-well cell culture plate (Corning; 3340) 1 day prior to performing the assay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero.E6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Six to eight weeks old female, BALB/c mice were vaccinated via the intramuscular route with 3 μg of each respective protein with 1:1 mixture of Addavax (Invivogen) in a total volume of 50 μL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The spike gene of each respective variant (EPI_ISL_703454, EPI_ISL_745160) was cloned into the pCAGGS vector and used to transfect cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_18926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">EPI_ISL_792680 was cloned into pcDNA3.4 for transient transfection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.4</div><div>suggested: RRID:Addgene_131198)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed in GraphPad Prism 7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Another caveat of our study is that we were not able to include B.1.617.2, B.1.617.1 and C.37 in our analysis even though these are currently important variants. In summary, we found that neutralizing titers are always highest against the homologous virus but that antigenic relationships are not necessarily symmetric and that some variant spike proteins induced more balanced responses (e.g. P.1) than others (B.1.351, B.1.1.7). In addition, the drop in binding antibody is much lower than the drop in neutralizing activity. Non-neutralizing binding antibodies have been shown to play an important role in protection for other diseases caused by virus infections including Ebola virus disease and influenza A and B virus [30–33]. The maintenance of binding antibody and T cell responses against variants could partially explain the maintenance of vaccine efficacy, despite the occasional steep drops in neutralizing antibody titers.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.05.455212
  38. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.06.455382
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.06.455382: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All experimental animal procedures were approved by the Institutional Animal Committee of the San Raffaele Scientific Institute and all infectious work was performed in designed BSL-3 workspaces.<br>Euthanasia Agents: Mice were euthanized by cervical dislocation.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Social scent-discrimination test: The social scent-discrimination test was used to assess hyposmia/anosmia in IN- infected or AR-infected male mice compared to PBS-treated control male mice, as previously described (Zheng et al., 2021).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In vivo treatment: In selected experiments, K18-hACE2 mice were injected intraperitoneally with 2 mg per mouse of α-IFNAR1 blocking antibody (BioXcell, #BE0241, clone MAR1-5A3) 1 day before infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>α-IFNAR1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>#BE0241</div><div>suggested: (Bio X Cell Cat# BE0241, RRID:AB_2687723)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 cells were seeded into 96 wells plates and infected at 95% of confluency with base 10 dilutions of virus stock.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice: B6.Cg-Tg(K18-ACE2)2Prlmn/J mice (referred to in the text as K18-hACE2) were purchased from The Jackson Laboratory.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B6.Cg-Tg(K18-ACE2)2Prlmn/J</div><div>suggested: RRID:IMSR_JAX:034860)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As control, K18-hACE2 mice received the same volume of aerosolized PBS (125 μL per mouse).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry analysis was performed on BD FACS Symphony A5 SORP and analyzed with FlowJo software (Treestar)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RNA-seq data processing and analysis: Raw reads were aligned to mouse genome build GRCm38 using STAR aligner (Dobin et al., 2013)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_004463)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene counts were generated using featureCounts (part of the Subread package (Liao et al., 2019)), based on GENCODE gene annotation version M22.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>featureCounts</div><div>suggested: (featureCounts, RRID:SCR_012919)</div></div><div style="margin-bottom:8px"><div>GENCODE</div><div>suggested: (GENCODE, RRID:SCR_014966)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differentially Expressed Genes (DEGs) between AR- and IN-infected mice were identified by generating a linear model using LIMMA R package (Ritchie et al., 2015) (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>LIMMA</div><div>suggested: (LIMMA, RRID:SCR_010943)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bright-field images were acquired with an Aperio Scanscope System CS2 microscope and the ImageScope program (Leica Biosystem) following the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageScope</div><div>suggested: (ImageScope, RRID:SCR_014311)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, anti-Iba1 (Synaptic system, #234006), anti-CD68 (Abcam #ab53444), and anti-iNOS (Abcam #ab3523).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Synaptic system</div><div>suggested: (Synaptic Systems, RRID:SCR_013612)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow and imaging data were collected using FlowJo Version 10.5.3 (Treestar) and Imaris (Bitplane), respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Imaris</div><div>suggested: (Imaris, RRID:SCR_007370)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed with GraphPad Prism software version 8 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.06.455382
  39. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.06.455406
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.06.455406: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.06.455406
  40. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.06.455405
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.06.455405: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mice: B6.Cg-Tg(K18-ACE2)2Prlmn/J (K18-hACE2) were purchased from Jackson Laboratories and bred in-house at the University Hospital of Bonn. 8-to-20-week-old mice of both sexes were used throughout the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Three scientists scored the sections in a blinded fashion as follows: 0 no staining; 1 weak staining, <5% brain area or <10% of lung area; 2 strong staining, 5-33% brain area or 10-50% of lung area; 3 strong staining >33% of brain area or >50% lung area.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IgG ELISA: The presence of SARS-CoV-2-specific IgG antibodies in the sera of mice was quantified using ELISA (QuantiVac, Euroimmun) according to the manufacturer’s recommendations, with the exception that the anti-human anti-IgG antibody in the kit was exchanged for a goat anti-mouse IgG-HRP conjugate (Jackson Immuno Research, 115-035-062), 1:5000 in 0.5% BSA in PBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2-specific IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human anti-IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For SARS-CoV-2 antigen immunohistochemistry, slides were incubated with blocking reagent (10% normal goat serum) followed by rabbit monoclonal antibody against SARS-CoV-2 nucleocapsid protein (Biozol, SIN-40143-R019, 1:20000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 nucleocapsid protein ( Biozol , SIN-40143-R019</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus was passaged in VeroE6 cells and the viral titers were determined using a plaque assay as described in37.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice: B6.Cg-Tg(K18-ACE2)2Prlmn/J (K18-hACE2) were purchased from Jackson Laboratories and bred in-house at the University Hospital of Bonn. 8-to-20-week-old mice of both sexes were used throughout the study.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B6.Cg-Tg(K18-ACE2)2Prlmn/J</div><div>suggested: RRID:IMSR_JAX:034860)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">K18-hACE2 transgenic mice were lightly anesthetized with ketamine/xylazine, before 5×104 PFU of SARS-CoV-2 virus was pipetted onto the nose and subsequently inhaled by the animal.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tissue sections were visualized using an Aperio SlideScanner CS2 and the Aperio Imagescope 12.4 software (Leica).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Imagescope</div><div>suggested: (ImageScope, RRID:SCR_014311)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: All statistical tests were calculated using Prism 9 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT03739138</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Intratumoral/Intralesional Administration of MK-4621/JetPEI™…</td></tr><tr style="background-color:#FF0000"><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT0306502</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Trial number did not resolve on clinicaltrials.gov. Is the number correct?</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.06.455405
  41. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.06.455384
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.06.455384: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To check the druggability of these pockets, all FDA approved drugs were downloaded from ZINC database46.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ZINC</div><div>suggested: (Zinc, RRID:SCR_008596)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.06.455384
  42. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.03.21260966
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.03.21260966: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SPSS software version 23 was used for the analysis (IBM).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The limitation of the in-house duplex test is that it can only identify one viral gene (E) and one internal control gene (Rp). However, the kappa index (0.92) shows that our protocol is comparable to commercial kits (LightMix E / RdRp) that screen two or more viral genes. Furthermore, because the E gene is unique to all Sarbecoviruses and because SARS-CoV-2 is the only member of the family now circulating in humans, the WHO has recommended that the E gene be prioritized as a target. In this approach, a single viral genetic target suffices for case confirmation in the lab.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.03.21260966
  43. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.03.21261298
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.03.21261298: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.03.21261298
  44. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.05.21261675
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.05.21261675: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: IRB approval was obtained through the NYU UCAIHS and the panelists were provided with a consent form at the beginning of the survey, which they acknowledged by clicking yes and proceeding to the survey.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">For the sociodemographic characteristics, age (18-29, 30-49, 50-64 and 65 and older), sex (female and male), race/ethnicity (non-Hispanic White, non-Hispanic Black, Hispanic and other), educational attainment (Less than or graduated High School, some college or graduated college, and post graduate or professional degree), annual household income (≤$25,000, $25,001-≤$50,000, $50,001-≤$75,000, $75,001-≤$100,000, ≥$100,001), religion (Protestant, Evangelical Catholic, other and Agnostic/Atheist), living in rural or metro, types of health insurance (private, Medicare, Medicaid, TRICARE/Indian HS/Veteran/Other and uninsured), being a parent (those living with children under age 18), and political party affiliation (Democrat, Republican, independent, and don’t know) were included.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">An online survey was conducted from a random sample of the Social Science Research Solution (SSRS) Opinion Panel web panelists, representative of U.S. adults age 18 and older who use the internet.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the sociodemographic characteristics, age (18-29, 30-49, 50-64 and 65 and older), sex (female and male), race/ethnicity (non-Hispanic White, non-Hispanic Black, Hispanic and other), educational attainment (Less than or graduated High School, some college or graduated college, and post graduate or professional degree), annual household income (≤$25,000, $25,001-≤$50,000, $50,001-≤$75,000, $75,001-≤$100,000, ≥$100,001), religion (Protestant, Evangelical Catholic, other and Agnostic/Atheist), living in rural or metro, types of health insurance (private, Medicare, Medicaid, TRICARE/Indian HS/Veteran/Other and uninsured), being a parent (those living with children under age 18), and political party affiliation (Democrat, Republican, independent, and don’t know) were included.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>non-Hispanic White</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Like all studies, this study has some limitations. Our sample differs from the adult population in several ways, as do most online survey panels. However, a number of high-quality studies have used similar approaches, whether by using the KnowledgePanel, Amazon M Turk, or other firms, and SSRS has a robust mechanism for quality checks that were embedded in our survey. Our study is cross-sectional, and thus cannot make claims about causality. Finally, our survey relies on self-report, and focuses on intentions, not behaviors, which may change. At the same time, it offers a snapshot of the US public’s intentions just as all adults became eligible for the vaccine, such that intentions could be quickly realized.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.05.21261675
  45. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.06.21261728
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.06.21261728: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the completion of data collection, the raw data were downloaded as a Microsoft Office Excel file and imported into SAS Enterprise Guide 8.4 for statistical analyses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Office Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">8.4 (SAS Institute Inc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our study has several limitations. The most serious limitation derives from the German hospital system: The indication for hospital and intensive care unit admission is at the discretion of the attending physician. This study is based on the assumption that no fundamental changes in admission practice occurred in German PICUs during the study period. Furthermore, the study is not population-based, even though many hospitals and most German University Hospitals participated. Therefore, our estimates rely on case numbers rather than incidence rates. Some of the hospitals in our study used F codes (behavioral disorders caused by psychotropic substances) for intoxications. This prevented several cases from being included, likely causing an underestimation of the number of intoxications during both study periods (reference and observation period). Even though we collected a considerable number of cases, in-depth analyses were limited due to small case numbers in subgroups. As a further consequence, the small case numbers are sensitive to random fluctuations, thus leaving uncertainty regarding the true strength of effect.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.06.21261728
  46. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.06.21261711
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.06.21261711: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics approval and data collection: This study was reviewed by the Prince Charles Hospital Human Research Ethics Committee and approval was granted as a low or negligible risk project (Project ID 70040; November 3, 2020).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study population: This study focused on pregnant women in two geographical locations in Australia.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our study has limitations, which should be considered when interpreting results. As this study was observational, it was not possible to account for unmeasured confounding variables. Although detailed data was collected on all births at SCUH, state-wide data for Queensland was limited to birth outcomes and gestational age, as per the predetermined perinatal data collection format. As our health service opened a new tertiary hospital in April 2017 (SCUH), retrospective analysis was only completed for two years prior from 2018–2019. We acknowledge that longer retrospective analysis would be preferable to further compare year-by-year variations in birth outcomes. Further research is required from ethnically, geographically, and socioeconomically diverse regions and high-risk groups for PTB such as Aboriginal and Torres Strait Islander women in Australia. Qualitative analysis of maternal behaviours during lockdown was beyond the scope of this study but would be highly informative.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.06.21261711
  47. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.05.21261633
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.05.21261633: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Population subgroups of interest included age groups (18-64 years; 65 years and above) and gender (men; women).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      There were also limitations. We did not examine all vaccine priority groups. There was insufficient data to examine occupational vaccine priority groups such as healthcare workers, though it would be valuable to gain insights into vaccination coverage and hesitancy in these groups who were also eligible to receive the vaccine. We only examined two broad age groups because there were too few younger people in the priority groups to disaggregate the age groups further. Given the notable difference in vaccine hesitancy between older and younger people in the priority groups in this analysis, further research is needed to understand trends in vaccine hesitancy across a greater number of age groups. Further, we did not examine differences by ethnicity, Aboriginal and Torres Strait Islander peoples, or cultural and linguistic diversity because the survey did not collect data on these characteristics. Given the evidence about differences in vaccine hesitancy by ethnicity in the United Kingdom and the Unites States (24), it is important to examine differences in vaccine hesitancy by these characteristics for people in priority groups in future research. The survey is unlikely to be representative of the Australian population, though the sample weights make the results more representative of the population. The vaccine coverage was estimated to be 8.2% overall, which is broadly consistent, though perhaps slightly lower, than population estimates of vaccination coverage at similar time...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.05.21261633
  48. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.06.21261734
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.06.21261734: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.06.21261734
  49. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.06.21261695
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.06.21261695: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: The results were analyzed using the SPSS version 22 software (SPSS Inc., Chicago, IL, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.06.21261695
  50. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.06.21261716
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.06.21261716: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical statement: The study was approved by the Institutional Ethics Committee of the ICMR-Regional Medical Research Centre (ICMR-RMRC), Gorakhpur (IHEC Number-RMRCGKP/EC/2021/2.1).<br>Consent: Written and informed consent was obtained from all the participants enrolled in the study before the collection of clinical data and samples.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, Nucleocapsid (N) protein, inactivated whole SARS-CoV-2 antigen, neutralizing antibody (NAb) response and phenotyping of lymphoid cells of lysed whole blood.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Nucleocapsid ( N ) protein , inactivated whole SARS-CoV-2 antigen ,</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-SARS-CoV-2 IgG antibody evaluation: We evaluated anti-SARS-CoV-2 IgG antibody response against S1-RBD, N-protein and the whole antigen.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S1-RBD , N-protein and the whole antigen .</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-SARS-CoV-2 antibody (NIBSC code 20/130) was also included in the assay as a reference standard.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Post incubation at 37°C for 1 hr, each virus-diluted serum sample (0.1 ml) was inoculated onto duplicate wells of a 24-well tissue culture plate of Vero CCL-81 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero CCL-81</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The ELISA titres against S1-RBD, N protein and inactivated SARS-CoV-2 (whole virus) was compared in sera of the three groups and analysed statistically using the Kruskal-Wallis test along with Dunns’ multiple comparisons in GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      There are a few limitations in our study. The sample size of 18 participants is small, the follow up period is only 60-70 days after immunisation with the first dose and baseline serological and immunological data of the participants is not available. However, there are several major strengths in this study. This is the first report of heterologous immunisation with an adenovirus vector based and an inactivated whole virion vaccine in humans demonstrating safety and significantly improved immunogenicity. Qian He et al., had earlier reported similar findings in a mouse model9. Comparable proportion of solicited AEFIs in the heterologous and homologous groups despite the elderly age group (mean age 62 years) demonstrates the safety of combination regimen. Immunogenicity profile studied against the VOCs; Alpha, Beta and Delta variants demonstrates significantly higher titers in the heterologous group. Overall, this study demonstrates that immunization with a heterologous combination of an adenovirus vector platform-based vaccine followed by an inactivated whole virus vaccine is safe and elicits better immunogenicity than two doses of homologous vaccination, using the same vaccines. These findings have an important implication for the COVID-19 vaccination program wherein heterologous immunisation will pave the way for induction of improved and better protection against the variant strains of SARS-CoV-2. Such mixed regimens will also help to overcome the challenges of shortfall of...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.06.21261716
  51. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.05.21261677
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.05.21261677: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the institutional review boards of the Medical University of Innsbruck (Austria) (approval number: 1257/2020) and the South Tyrol Province (Italy) (0150701).<br>Consent: Each participant gave a digital informed consent at the survey start.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our study bears limitations. As indicated by the prevalence of long COVID, fraction of females, middle-aged and over-representation of health care workers in the study collectives, the survey might have targeted primarily individuals more affected by the disease and health-aware people of the general convalescent populations. Additionally, the retrospective and cross sectional study character precluded detailed tracking of particular symptom kinetic and relapses. Furthermore, it may explain the significant effect of the observation time on the readouts of long COVID in the multi-parameter modeling. Even though our data are highly consistent for both study populations differing in multiple demographic, socioeconomic and clinical features and the confounding impact of sex, age and observation time was included in the risk modeling, our findings will require an independent prospective validation.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04661462</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Health After Covid-19 in Tyrol</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.05.21261677
  52. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.05.21261634
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.05.21261634: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics: This project was approved by the Ethical Committee of Pontevedra-Vigo-Ourense (reference 2021/184).<br>Consent: All the patients included in the study belong to the COHVID-GS, which signed an informed consent form at the time of inclusion in the cohort.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">COHVID-GS also includes data about comorbidities, smoke status, weight and height.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COHVID-GS</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed with IBM Statistical Product and Service Solutions (SPSS) program, version 22.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This study has few limitations. Firstly, some of the symptoms reported are subjective and based on the patient’s testimony (e.g. fatigue, headache, dyspnoea). Additionally, the lack of validated scales to measure most of the symptoms makes difficult to compare data between subjects or studies. Secondly, most of the symptoms may be affected by personal, psychological or environmental factors. We needed to use a non-validated custom questionnaire, as there is not a specific post-COVID-19 document established. Many symptoms could be higher reported in one group than another for unrelated reasons with coronavirus disease. This is the case for hair loss that may be more noticed in women and therefore more reported, leading to a possible increase of the prevalence in female subjects. In addition, previous comorbidities and age could increase the persisting symptoms in the hospitalized group. For COPD patients, we did not record symptoms that started before COVID-19 diagnosis. Therefore, it is possible that COPD patients reported more frequently chest or respiratory symptoms.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.05.21261634
  53. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.05.21261552
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.05.21261552: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 5. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.05.21261552
  54. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.05.21259465
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.05.21259465: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.05.21259465
  55. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.05.21261642
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.05.21261642: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics statement: The study was conducted according to the guidelines of the Declaration of Helsinki, and approved by the Institutional Review Board of the Sheba Medical Center institutional review board (7045-20-SMC).<br>Consent: For the Israel cohort, patient consent was waived as the study used remains of clinical samples and the analysis used anonymous clinical data.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Of these, twelve lineages were randomly chosen with an emphasis on lineages prevalent across different continents.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Construction of phylogenetic trees: Phylogenetic trees were constructed using NextStrain’s Augur pipeline [8].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Augur</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Dating of internal nodes are reported based on NextStrain, which in turns relies on IQ-Tree [25] ancestral sequence reconstruction, dating, and assignment of confidence intervals for these dates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IQ-Tree</div><div>suggested: (IQ-TREE, RRID:SCR_017254)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fastq files were subjected to quality control using FastQC (www.bioinformatics.babraham.ac.uk/projects/fastqc/) and MultiQC [33] and low-quality sequences were filtered using trimmomatic [34].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FastQC</div><div>suggested: (FastQC, RRID:SCR_014583)</div></div><div style="margin-bottom:8px"><div>MultiQC</div><div>suggested: (MultiQC, RRID:SCR_014982)</div></div><div style="margin-bottom:8px"><div>trimmomatic</div><div>suggested: (Trimmomatic, RRID:SCR_011848)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequences were mapped to the SARS-CoV-2 reference genome (NC_045512.2) with Burrows-Wheeler aligner (BWA) mem [35].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA</div><div>suggested: (BWA, RRID:SCR_010910)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Resulting BAM files were sorted and indexed using SAMtools suite [36].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAMtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Multiple alignment of sample sequences with the reference Wuhan sequence (NC_045512.2) was performed with MAFFT using default parameters [24].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The caveat in this hypothesis is that infections from all Delta clades are evident already in April across the globe. It is possible that these are a biased sample from incoming travelers who did not go on to create transmission chains. A second hypothesis is that Delta A may be under positive selection. In line with this, 82% of the lineage specific mutations of this clade are non-synonymous, similar to what characterizes VOs (Table S2, Fig. 2A). However, this clade lacks additional substitutions in its Spike gene (as opposed to clades A and E), and is characterized by seven amino-acid replacements in the ORF1a/b polyprotein. This is particularly perplexing as the lineage defining mutations of the main Delta lineage are depleted of mutations in ORF1a/b (Table S2). An additional non-synonymous substitution is evident in the ORF7b gene (T40I) and in the N gene (G215C) at position 215, quite proximal to the 203-205 region discussed above. Only two of the eleven substitutions unique to the Delta D clade are seen in other clades worldwide (Table S2), and thus the functional implications of Delta D substitutions remain to be further investigated. To summarize, we have used a comparative approach to detect a unique mode of evolution present in Delta. This step-wise mode of evolution characterized both the formation of the Delta D clade, and its subsequent spread, and is in stark contrast to the evolution observed in other VOCs. In particular, the global increase in Delta frequency ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/content/10.1101/2021.08.05.21261642v2
  56. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.05.21261660
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.05.21261660: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Participation was voluntary, and all participants were required to read and sign a consent form (supplementary file 1) before their first test.<br>IRB: The study was conducted with approval from the UCD Human Research Ethics Committee, approval number LS-21-20-Barry. c. The testing regime: The Panbio™ COVID-19 Ag rapid test device (Abbott, Ireland) was used for all tests.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The study was conducted with approval from the UCD Human Research Ethics Committee, approval number LS-21-20-Barry. c. The testing regime: The Panbio™ COVID-19 Ag rapid test device (Abbott, Ireland) was used for all tests.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The current study assessed the feasibility and limitations of an antigen testing programme conducted in a university environment which was considered at higher risk of SARS-CoV-2 transmission. The testing programme was conducted on a regular basis over a 6-week pilot with a relatively large group of workers and students. b. Feasibility, including lessons learned: The pilot study was implemented successfully, and a relatively large group of staff and students were tested on a regular basis in a safe and efficient manner over the 6-week period. Further, as a result of the trial, the participants reported a decrease in anxiety in the workplace and increased confidence among workers. The testing programme allowed participants to carry out their work aware that an extra layer of risk reduction was in place alongside other risk mitigations such as high-grade masks, physical distancing, hand cleanliness and increased ventilation. Importantly, the introduction of the antigen testing was not associated with a noticeable decrease in people following HSE guidelines around the other risk mitigations, so risk of a COVID-19 outbreak in the workplace was decreased overall. There was excellent feedback from staff and students in relation to the information they received beforehand as well as the training videos. Nonetheless, the initial swabbing technique among participants varied greatly, highlighting the importance of on-hand assistance for first-time participants. Correct nasal swabbing t...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.05.21261660
  57. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.05.21261565
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.05.21261565: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was performed in line with the principles of the declaration of Helsinki after approval from the local ethics committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      They have also, simultaneously, highlighted the potential limitations of this score like the ‘treatment paradox’. As the disease continues to evolve and our understanding of it continues to change, the impact assessment of these models will require rigorous and continued assessment in real time in order to retain validity. Keeping these relevant critiques in mind we decided to wait to prospectively evaluate our model before recommending it for general use.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.05.21261565
  58. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.05.21261663
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.05.21261663: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.05.21261663
  59. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.05.21261683
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.05.21261683: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      One limitation of our analyses is that the model was fit to date of case confirmation because the date of symptom onset, which is more closely related with the date of infection, was not available. The daily number of confirmed cases can abruptly change depending on the intensity of intervention measures, of which the dynamics may not be consistent with disease transmission process. This means using the data on case confirmation under dynamics intervention measures is challenging. We tried to mitigate this difficulty by incorporating the dynamics of intervention programs by assuming that the start date and duration of enhanced case detection vary while the case detection rate increases over time and let the data suggest the values for those parameters.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.05.21261683
  60. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.05.21261626
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.05.21261626: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations: In DETECT, all data is participant reported with no validation of the accuracy of self-reported symptoms, test dates or results. While we were able to collect continuous data, the amount of sensor data collected, or the accuracy of self-reported symptoms, depends entirely on the willingness of the participants to wear the sensor and accurately report how they feel. Despite the fact that the information collected may not be as accurate as in a controlled laboratory setting, previous work has demonstrated the value of participant-reported outcomes.28-30 In the data analysis, among the people who reported the COVID-19 test outcome (active participants), we separated participants who reported at least one symptom from those who did not report any symptoms. The app indeed did not have an explicit way to report the absence of symptoms, so potentially some symptomatic individual may have not reported their symptoms. Furthermore, this study is based on the aggregation of continuously monitored data into a finite number of daily features. A recent study has provided new insights about the analysis of intra-day changes for monitoring physiological variations,31 that may be used in future studies. Changes in more advanced metrics, like respiratory rate,17 peripheral temperature10 or HRV,12 may also prove to add to the prediction of a COVID-19 infection, even if they have been marginally considered in our work since only a small fraction of participants were providing this t...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.05.21261626
  61. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.04.21261600
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.04.21261600: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The University of Essex Ethics Committee approved all data collection (Supplement).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">We calculate the mean of the GHQ-12 score, for the whole sample and by sex (men and women) and ethnicity (ethnic minorities and White British), over time (2017-2019, April 2020, March 2021).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Study limitations include: relying on self-reported mental health measures, attrition, and small sample size of individuals from ethnic minorities.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.04.21261600
  62. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.04.21261604
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.04.21261604: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: The study was approved by the Office of Research Subjects Protection of Virginia Commonwealth University.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      One limitation of this survey is that it included deaths outside the immediate household (Deshmukh 2021). Seroprevalence data can also help to assess the extent of infection in a population. Based on application of international age-specific infection fatality rates to Indian demography and seroprevalence, Anand estimated the Covid-19 related mortality in India to be 4.0 million (Anand 2021). One limitation of this approach is that the infection fatality rates may differ from country to country, depending on the medical system and host factors. Guilmoto analyzed Covid-19 mortality in several well-defined Indian populations: deaths in Kerala, elected representatives, Indian Railways personnel, and teachers in Karnataka (Guilmoto 2021). Application of the age-specific mortality rates to the Indian population yielded a mortality estimate of 2.2 million persons by late May 2021 (Guilmoto 2021). Our analysis has a number of limitations. The data analyzed are still incomplete for many regions and times. There may be delays in registering deaths. In addition, available data obtained from regional government websites, central government compilations, and by reporters through RTI requests are not in complete agreement. Some of the data upon which the model is based may simply be wrong, because early reports may contain errors. All-cause mortality may be higher not only due to infection with the Sars Cov-2 virus, but also because of health system overload, delays in patients entering t...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.04.21261604
  63. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.04.21261576
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.04.21261576: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.04.21261576
  64. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.05.21261627
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.05.21261627: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: An initial scoping exercise, searching PROSPERO-registered studies and contacting study authors to avoid duplication in this rapidly expanding research field, revealed no existing reviews with a focus on general practitioner mental health and wellbeing during the COVID-19 pandemic.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Each reviewer will be blind to the other’s assessment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We will search the following databases; MEDLINE, Embase, PsychInfo and, owing to the large body of COVID-19 literature being published in this space, Medrxiv and Google Scholar will also be searched.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEDLINE</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div><div style="margin-bottom:8px"><div>Embase</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div><div style="margin-bottom:8px"><div>Google Scholar</div><div>suggested: (Google Scholar, RRID:SCR_008878)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.05.21261627
  65. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.04.21261609
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.04.21261609: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants provided written and informed consent.<br>IRB: The study was approved by Ethics Committee II (Mannheim) of the University of Heidelberg (reference number 2020-417MF) and the German Institute for Drugs and Medical Devices.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Differences in continuous variables between men and women were examined by two-sided t-tests; the chi-squared test was used for categorical variables (Table 1).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">We randomly assigned the study population to three sampling groups according to the time sequence of collecting the nasopharyngeal swabs (group 1: rRT-PCR, RDT-Roche, RDT-Abbott; group 2: RDT-Roche, RDT-Abbott, rRT-PCR; and group 3: RDT-Abbott, rRT-PCR, RDT-Roche).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">This ensured that the performers of the RDTs were unaware of the rRT-PCR-results.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In addition to collecting the nasopharyngeal swabs for rRT-PCR testing, we collected two completely independent swab specimens to run two commercially available and widely used Ag-RDTs from Abbott Diagnostics (Abbott Panbio TM COVID-19 Ag Rapid Test, Abbott Rapid Diagnostics Jena GmbH, Jena, Germany, www.abbott.com/poct) and Roche Diagnostics (Roche-SD Biosensor SARS-CoV-2 Rapid Antigen Test, identical to SD BIOSENSOR Standard Q COVID-19 Ag, www.sdbiosensor.com; Roche Diagnostics; Mannheim, Germany, www.roche.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples in which both N501Y and H69/V70 were absent may have contained variants other than Alpha, Beta, or Gamma or the wild-type.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gamma</div><div>suggested: (GAMMA, RRID:SCR_009484)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The analyses were carried out using R v4.0.2 (http://www.r-project.org).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>http://www.r-project.org</div><div>suggested: (R Project for Statistical Computing, RRID:SCR_001905)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations: We applied rRT-PCR as the reference method to detect SARS-CoV-2 infection. Despite being considered the gold standard, this technique has the limitation that the detection of SARS-CoV-2 RNA in patient samples does not indicate the presence or shedding of viable virus with replicative capacity or whether the tested individual is contagious at the time of the test 12,26. Although the presence of viral RNA proven by rRT-PCR does not automatically equate to infectiousness, a significant correlation between the Ct value (reflecting viral load) and subsequent virus cultivation has been observed. Samples with Ct values between 13 and 17 have a culture positivity rate of 100%, which declines gradually to 12% when Ct values of 33 are analysed. No viral growth occurs at Ct values ≥34, suggesting that patients with these values do not excrete infectious viral particles 17. Therefore, if infectivity rather than a positive rRT-PCR test were considered the reference for RDTs, our results would stand more in favour of RDT testing. However, a direct conversion of Ct values or a positive RDT to contagiousness has not yet been established. Ct values can hardly be compared across studies, and the correlation between viral load and the risk of transmission from a positive case is still not entirely clear 13,27, with a variety of circumstances, such as the individual’s behaviour, the type and duration of contact, the environment, and the implementation of transmission-reducing measur...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.04.21261609
  66. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.06.21261725
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.06.21261725: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      One limitation of our results is our simple metric for the cost-benefit ratio, defined as the number of days of self-isolation or quarantine per transmission averted, for an average traced contact. When either top-down or voluntary control measures keep R(t) near 1 (Weitz et al. 2020), this metric describes efficiency in achieving this outcome (Petrie and Masel 2020). Translating the number of days spent in quarantine/self-isolation into specific social/economic costs will vary according to settings. The costs are particularly large, making DCT especially beneficial, in settings where individuals are unable to work from home, have no effective place to self-isolate, or struggle to live independently (Smith et al. 2021), as well as in settings where many people are repeatedly affected, for example where entire school year groups are sent home or workplaces closed (Leng et al. 2021). On the other hand, if reduced transmission tips the balance from an uncontrolled to a controlled epidemic, then even strategies with much larger costs for only slightly larger benefits (both defined as above) are preferred. For the present comparison between quarantine and DCT for traced contacts, the benefits were similar but costs were very different, simplifying the recommendation in favor of DCT in scenarios where the aim is epidemic mitigation, rather than elimination. A further complication, given the low sensitivity of COVID-19 self-testing, is the need for clear communication. A negative re...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.06.21261725
  67. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.06.21261727
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.06.21261727: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was reviewed and approved by the Baylor Scott and White Research Institute Institutional Review board (IRB # 021-144) with a waiver of the requirement of informed consent for the use of residual specimens for sequencing and epidemiological studies.<br>Consent: This study was reviewed and approved by the Baylor Scott and White Research Institute Institutional Review board (IRB # 021-144) with a waiver of the requirement of informed consent for the use of residual specimens for sequencing and epidemiological studies.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">We randomly selected 1% of the positive specimens for sequencing when positivity rates were higher than 5% and all positive specimens when positivity rates were <5%, to identify the variants in circulation.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data was analyzed using the Illumina BaseSpace application/bioinformatics pipeline, DRAGEN COVID Lineage v3.5.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BaseSpace</div><div>suggested: (BaseSpace, RRID:SCR_011881)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A second limitation that must be kept in mind when interpreting the results reported here is that, while clinical manifestation data for the 28 vaccine breakthrough cases for which sequencing was possible are presented by vaccine brand they cannot support comparisons of effectiveness between the brands, as there was unequal distribution of vaccine brands in the Central Texas community. In conclusion, our results show that, in early 2021, Central Texas experienced a rapid growth of the alpha (B.1.1.7) variant, which then maintained dominance for several weeks, but towards the end of the study period (June/July 2021) was itself rapidly displaced by the delta (B.617.2) variant. Examination of vaccine breakthrough infections showed small numbers overall and with each of these variants, with the distribution of the variants among breakthrough cases following a similar pattern to the distribution in the overall COVID-19 cases in our study population. Continued monitoring is needed, both to assess the longer-term impact of the delta (B.1.617.2) variant’s dominance on risk for vaccine breakthrough infections, and to identify any new variants, or variants altering the distribution in circulating strains, that might impact risks for disease and/or effectiveness of vaccines and therapeutics. Lastly, the findings in this report are subject to at least two limitations. First, the number of reported COVID-19 vaccine breakthrough cases is likely a substantial undercount of all SARS-CoV-2 in...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.06.21261727
  68. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.02.21261459
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.02.21261459: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Some of the limitations of the two models considered in this study include not explicitly accounting for the impact of some control interventions, notably vaccination. Our justification for not including vaccination is that, during the beginning of the devastating wave in India (Spring 2021), the vaccination coverage in both India and Pakistan were quite low [68]. Furthermore, the models do not incorporate some heterogeneities, such as age and risk structure, that may also be relevant to the dynamics of the disease in the two nations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.02.21261459
  69. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.03.21261496
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.03.21261496: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study protocol was approved by the statutory clinical research committee of Leumit Health Services and the Shamir Medical Center Institutional Review Board (129-2-LEU).<br>Consent: Informed consent was waived because only deidentified routinely collected data were used.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.03.21261496
  70. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.02.21261509
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.02.21261509: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Isolate USA-WA1/2020 of SARS-CoV-2 (NR-52281 BEI Resources) and CA427 (B.1.427, received from CA DPH) were propagated in Vero CCL-81 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero CCL-81</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Isolate Amsterdam I of HCoV-NL-63 (NR-470, BEI Resources) was propagated in Huh7.5.1-ACE2 cells (all virus cultures were performed in a Biosafety Level 3 laboratory).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7.5.1-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We first performed binary classification of trajectories based on the Supported Vector Machine (SVM) in MATLAB.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MATLAB</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.02.21261509
  71. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.03.21261438
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.03.21261438: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The Strasbourg University Hospital Ethics Committee has approved this study (reference: CE-2021-14).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A limitation of using the PMSI national database is that a possible delay can occur between patient discharge and coding. However, the extent of this bias is limited, as the hospital is reimbursed by the state health insurance only if diagnoses made during hospitalization are sent to the national database no more than one month after discharge. To ensure that data is as complete as possible, the analysis period was ended on 30 June 2020, i.e., leaving more than three months for patient codes to be registered before the date of extraction from the database in October 2020. Homogeneity of the diagnostic coding, which must be as close as possible to those noted during the stay, is provided by strict, national rules with regular checks carried out by the payer, thus limiting misclassification bias. A final limitation of our study is restricted knowledge of other external local events which could influence the activity of the hospital facility. Such biases are nevertheless partially controlled by the study design, as analysis is carried out at a national level, and the annual time periods compared time periods compared are proximal. Within this study, we have not extended the analysis across a sufficient number of previous years to be able to determine whether there is a seasonal effect on stroke admissions. In previous unpublished analyses, carried out for internal purposes using data from Strasbourg University Hospital, we were able to identify a decrease in the trend of hospita...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.03.21261438
  72. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.04.455042
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.04.455042: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.04.455042
  73. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.05.455040
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.05.455040: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Preparation of Saliva: Stimulated saliva was collected at Unilever Research Port Sunlight, with ethical approval from the Unilever R&D Port Sunlight Independent Ethics Committee (GEN 022 13), collected during November 2019 from 11 donors over 2 days.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell Culture and Viruses: Vero E6 cells (C1008: African green monkey kidney cells) obtained from Public Health England, were maintained in Dulbecco’s minimal essential medium (DMEM) with 10% foetal bovine serum (FBS) and 0.05mg/ml gentamicin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.05.455040
  74. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.05.455082
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.05.455082: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.05.455082
  75. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.05.455262
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.05.455262: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Data reporting: The number of samples tested was completely unbiased and all compounds were formatted in a randomized manner using an acoustic dispenser for analysis in the primary HTS campaigns.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">All other downstream experiments were not randomized nor blinded as structures were known and hits were chosen using statistical parameters described below.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: For the ReFRAME library, all structural information was withheld until primary hits had been validated.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2 expression was confirmed by immunofluorescence staining using mouse monoclonal antibody against c-Myc antibody 9E10 (Thermo Fisher) and Goat-anti-mouse FITC (Jackson ImmunoResearch Laboratories, Inc).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>c-Myc</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Goat-anti-mouse FITC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 cells enriched in ACE2 were selected by FACS with antibody against human ACE2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 cells were stained with Goat anti-Human Phycoerythrin-conjugated ACE2 Polyclonal Antibody (R&D Systems) for 30 min at 4 °C in dark.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human Phycoerythrin-conjugated ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The HEK293T cell line expressing human ACE2 was created by transduction with VSV-G protein-pseudotyped MLV containing pQCXIP-myc-ACE2-c9, as previously described18.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T-ACE2-TMPRSS2 cells were kept under selection with 1.3 µg/mL of puromycin (Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 cells enriched in ACE2 were selected by FACS with antibody against human ACE2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The HEK293T-ACE2 cells were seeded at 2,000 cells/well, using an Aurora FRD (Aurora Discovery), at 2.5 µL/well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Time-of-drug addition assay: Time-of-drug addition assay was performed in Vero CCL81 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero CCL81</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The HEK293T cell line expressing human ACE2 was created by transduction with VSV-G protein-pseudotyped MLV containing pQCXIP-myc-ACE2-c9, as previously described18.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pQCXIP-myc-ACE2-c9</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293T cells were co-transfected with three plasmids, pMLV-gag-pol, pCAGGS-VSV-G and pQCXIP-myc-ACE2-c9 and the medium was replaced the next day.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMLV-gag-pol</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCAGGS-VSV-G</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293T cells were co-transfected with three plasmids, pMLV-gag-pol, pQC-Fluc and pCAGGS-SARS2-SFmut-cflag or pCAGGS-VSV-G using PEI 40K (Polysciences, Inc.), and the medium was refreshed 6 hours later.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pQC-Fluc</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCAGGS-SARS2-SFmut-cflag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The 3CLpro assay followed the exact same procedure albeit utilized the 3CLpro vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>3CLpro</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was performed using GraphPad Prism software (San Diego, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.05.455262
  76. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.04.21261595
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.04.21261595: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We estimated disparities in each county using the ratio between per capita case rates for age-matched White and non-White residents (naive relative risk) during each epidemic interval.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>White</div><div>suggested: RRID:MMRRC_037613-MU)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.04.21261595
  77. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.04.21261561
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.04.21261561: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Sources of serum specimens and data acquisition: The standard practice for serum collection and storage in the clinical laboratories involves collecting venous blood into a serum separator tube and centrifuging the specimen (1500g for 7 minutes) within 2 hours of collection to separate cells from serum.<br>IRB: Study approval: The retrospective (IRB#20-03021671) and prospective (IRB#20-11022929; IRB#20-04021831) studies in this manuscript were performed at NewYork–Presbyterian Hospital/Weill Cornell Medical Center (NYP/WCMC) with approval by the Institutional Review Board of Weill Cornell Medicine (WCM).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(Figure 1) SARS-CoV-2 total RBD antibody, surrogate neutralizing antibody assay and avidity assays: The SARS-CoV-2 total receptor-binding domain (RBD) antibody (TAb), surrogate neutralizing antibody (SNAb) and avidity were used to measure serum antibody levels on the TOP-Plus (Pylon 3D analyzer; ET HealthCare, Palo Alto, CA), and were previously described. (23) The TAb assay measures the overall interaction between SARS-CoV-2 antibodies and the RBD of the virus spike (S) protein, with a read out of sample relative fluorescence unit (RFU).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 total RBD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2 total receptor-binding domain (RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SNAb is a competitive binding assay, based on the anti-SARS-CoV-2 antibody-mediated inhibition of the interaction between the ACE2 receptor protein and the RBD.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A higher intrinsic binding strength of a paratope to RBD or addition of paratopes to the antibody structure results in a higher binding strength, which results in a lower dR of the antibody-RBD pair.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-RBD</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(Figure 1) SARS-CoV-2 total RBD antibody, surrogate neutralizing antibody assay and avidity assays: The SARS-CoV-2 total receptor-binding domain (RBD) antibody (TAb), surrogate neutralizing antibody (SNAb) and avidity were used to measure serum antibody levels on the TOP-Plus (Pylon 3D analyzer; ET HealthCare, Palo Alto, CA), and were previously described. (23) The TAb assay measures the overall interaction between SARS-CoV-2 antibodies and the RBD of the virus spike (S) protein, with a read out of sample relative fluorescence unit (RFU).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ET HealthCare</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were performed in statistical programming language R version 4.0.2 (2020-06-22) or in GraphPad Prism Version 9.1.2 (GraphPad Software, La Jolla, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations: Our study has several limitations. First, selection bias may exist in both the prospective and retrospective studies. As the HospNoVax and OutPtNoVax specimen in the study were retrospectively collected, the study was reliant on pre-existing data and remnant specimens. During this early time period of the pandemic in New York City, most hospitalized individuals were older, with more severe symptoms and predominately male,(41)which was reflected in our cohort (median age 67.5 years, IQR 54.0-77.0; 66% Male). The prospective study participants were younger, approaching or at middle age (overall median age 44.4 years, IQR 33.6-57.4) and predominantly female (74%). Indeed, the better population for comparison are OutPtNoVax, but there was insufficient data to perform a direct comparison at those similar timepoints Additional bias may exist with the prospective vaccination study volunteers, as study participants were healthcare workers (eligible for the vaccine in late December 2020 to January 2021), possibly reflecting a study population with fewer comorbidities. Together with the small sample size (n=60), these results may not represent those of the general population.(42, 43) Second, given the exploratory nature of the study and limited sample size, post-hoc adjustments were not performed. This small study size also prevented multivariate analysis to look for possible confounders between the cohorts. For example, a previous study found SNAb to be age associated in ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.04.21261561
  78. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.04.21261618
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.04.21261618: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Despite these strengths, our study has certain limitations. First, we could not estimate the rate of breakthrough infections among SARDs patients. Second, this was a retrospective study that identified patients who presented to care for SARS-CoV-2 PCR testing, so the proportion of asymptomatic breakthrough infections observed in our study may be an underestimate. Third, while the observed frequency of certain DMARD use (e.g., mycophenolate mofetil, rituximab) in our cohort suggests that the blunted antibody response associated with these DMARDs may put patients at risk for breakthrough infection, we did not have antibody testing available for all patients and cannot rule out the possibility that SARD manifestations (e.g., interstitial lung disease) commonly treated with these medications contributed to the severity of the presentation. Fourth, we were unable to determine whether DMARDs were held temporarily prior to or after vaccine doses as recommended by the American College of Rheumatology (17) since these changes were not consistently documented in the EHR. In conclusion, a small minority of COVID-19 cases among SARDs patients in a large healthcare system occurred in fully vaccinated patients. However, a large portion of these cases required hospitalization and occurred among patients using DMARDs that have been previously associated with a blunted antibody response following vaccination. Additional studies are urgently needed to estimate the risk of breakthrough infectio...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.04.21261618
  79. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.30.21261386
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.07.30.21261386: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Study selection: Duplicates were removed using EndNote® and Covidence®.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Covidence®</div><div>suggested: (Covidence, RRID:SCR_016484)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following characteristics of the included studies were extracted (see S1 Supporting information 2 for a complete description of each item extracted): The data extraction template was piloted with 10 studies by two authors, and the full data extraction process was conducted in Microsoft Excel ®.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Strengths and limitations of the review: This review has several strengths. Firstly, to our knowledge, this is the first study systematically mapping and characterising all empirical research produced in response to COVID-19 in LAC. Secondly, while most of the studies exploring COVID-19 research production have had a broad bibliometric focus (e.g. counting the total number of publications, not differentiating by their empirical nature), this review only includes empirical studies using at least some basic scientific method that have a higher likelihood of contributing with novel information to literature and decision making. Thirdly, most of the studies exploring countries’ involvement in COVID-19 research have looked for author’s affiliation, as opposed to the actual participation of country’s people or population, which is the main focus of this review. Finally, while evidence syntheses often consider certain type of study designs in their inclusion criteria, this review gathers all relevant empirical research, including all type of study designs and methods (e.g., modelling studies, basic science, etc.). Among the limitations of this review, we could only report the month of the studies at the time the searches were conducted, which might have missed some studies that became publicly available later but with earlier dates of publication. Another limitation relates to the possibility that some studies might have not explicitly described the scientific methods used to collec...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.30.21261386
  80. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.01.21261397
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.01.21261397: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Individuals direct Hugo to share their health records with the research team according to the terms in the informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">These power calculations are agnostic to the outcome of interest but based on the aim to examine relative differences in long-term outcomes between individuals with and without SARS-CoV-2 based on and between age strata.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Additional outcomes: assessed include post-infectious sequelae (e.g., dyspnea, cough) [34–36], post-traumatic stress disorder (PC-PTSD-5) [37], and exercise (exercise vital sign; 2 question survey to assess habitual physical activity) [38–40], using previously validated questionnaires.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PC-PTSD-5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, approved 1/21/2021), the University of Texas Southwestern Medical Center (STU 2020-1352, approved 2/3/2021), the University of Texas, Houston (HSC-MS-20-0981, approved 9/10/2020), the University of California, San Francisco (20-32222</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HSC-MS-20-0981</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Deidentified, individual-level data are sent from Hugo to the analytic team periodically for quality assurance and analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Hugo</div><div>suggested: (HUGO, RRID:SCR_012800)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Strengths and limitations: Our cohort study integrates detailed self-reports of participants with automated capture of their EHR information to provide more comprehensive data than traditional approaches. This innovative method enables capturing of baseline medical conditions, accounting for intermediate events between SARS-CoV-2 infection and sequelae, and objective assessments over time. Merging self-reported and digital data in this manner paves the way for similar research into long-term sequelae in other disease entities, including non-infectious illnesses such as trauma. Using the on-line digital platform to collect patient-oriented outcomes enables us to adapt the survey content in real time as new information emerges. Additionally, there is the potential for this cohort to be engaged in future research as new questions arise relating to long-term sequalae, therapies and other related issues. Recruitment design strengths include the inclusion of participants with a range of disease severity, including participants with and without a history of hospitalization. Additionally, we seek to recruit participants who are ethnically diverse and geographically dispersed. Further, our design includes concurrent controls with negative SARS-CoV-2 diagnostic results to overcome the variable exposure to healthcare access as well as to COVID-19 mitigation strategies implemented in the community (e.g., masking mandates, shut-downs) which could otherwise bias assessment of the risk of p...

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04610515</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Innovative Support for Patients With SARS-COV2 Infections (C…</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.01.21261397
  81. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.03.21261442
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.03.21261442: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The analytic approach described here is based on several assumptions and limitations that affect how our results should be interpreted. First, this approach is based on reported case counts and does not account for the population at-risk, susceptibility of persons previously infected, or duration of immunity following vaccination. Second, these calculations assume that vaccinated and unvaccinated people have the same risk of exposure to SARS-CoV-2, which may not be true at the population level. Third, we define vaccine breakthrough infections as those occurring more than two weeks after completion of vaccination; these figures do not include people who may become infected following partial vaccination or prior to 14 days following completion of vaccination. Fourth, reported COVID-19 case counts stratified by patient age are not available from all states (12). Our assumption that adults comprise 88.3% of reported cases reflects cumulative trends since the beginning of the pandemic; these data may not reflect the age distribution during the weeks included here and only approximate the number of COVID-19 cases occurring among adults. If the proportion of total cases occurring among adults decreased over time, our assumption would yield an overestimate of vaccine breakthrough cases. As younger age groups commence vaccination, calculations should be updated to reflect the entire population. Lastly, reporting delays among both COVID-19 case and vaccine administration data vary, and...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.03.21261442
  82. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.03.21260614
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.03.21260614: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The present study has some limitations. In the first place, since we do not have nominal data on people vaccinated at the national level, it cannot be determined whether all the health workers included were finally vaccinated during the study period. However, given the wide vaccination coverage in Peru for this population, it is estimated that the percentage of unvaccinated health workers would be low, and their exclusion would not significantly modify the results found. Additionally, in comparing survival between COVID-19 waves, the use of retrospective data does not allow an accurate assessment of the 60-day prognosis of patients infected in the last weeks of the year study period. However, this bias would act by attenuating the differences in survival found between the first and second waves, which could be even greater if patient mortality data were included in the following two months. Another aspect in this analysis is the difference in the availability of Peruvian health resources to face the COVID-19 pandemic in the first and second waves. Although this situation has been able to favor the reduction of mortality in the second wave, the change in survival seen during the start of the first and second doses and the period of protection strongly suggest the contribution of the vaccination process in the change in survival of health workers. The results found coincide with the evidence presented at the national level that suggests a potential influence of vaccination on t...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.03.21260614
  83. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.03.21261444
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.03.21261444: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The IU Human Subjects and Institutional Review boards approved the study protocol (Protocol #2008293852).<br>Consent: Participants provided informed consent through an online eConsent framework.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">We used a cut-off score of 7 for males and 5 for females when using AUDIT-C to identify at-risk drinkers (41).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">We acquired a random sample of IUB undergraduate students (n=7,499).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study size: We did not perform power analysis for the current cohort study as this study was leveraged from the RCT study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: AUDIT-C is an effective and brief three-question measurement tool for detecting high-risk alcohol consumption (40), validated for use among college students (41).</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The parent study was a randomized controlled trial evaluating the effect of receiving SARS-CoV-2 antibody test results on participants’ compliance with protective behavior against COVID-19 (33).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COVID-19</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Participants needed to be seronegative for SARS-CoV-2 antibodies at baseline (n=1027).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used SARS-CoV-2 IgM/IgG rapid assay kit (Colloidal Gold method) to test participants for SARS-CoV-2 IgM and IgG antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 IgM</div><div>suggested: (Bethyl Cat# E88-302, RRID:AB_2892019)</div></div><div style="margin-bottom:8px"><div>IgG antibodies</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibody test result was interpreted as positive if one or both of IgG and IgM antibody types were detected in the blood sample.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody testing results were entered into the REDCap (Research Electronic Data Capture (35, 36)) data capturing system (14).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data analysis was conducted using SAS software, Version 9.4 (Cary, NC, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS</div><div>suggested: (SASqPCR, RRID:SCR_003056)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used Python for data visualization (version 3.7.6, Python Software Foundation, Beaverton, OR, US).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Strengths and limitations: Study design: Some aspects of our study design influence the interpretation of our findings. Our study design was observational and therefore inferring a causal relationship between alcohol use and SARS-CoV-2 seroconversion is difficult because of the potential for unmeasured confounding. Moreover, the associations between high-risk alcohol consumption and secondary outcome of symptomatic COVID-19 were evaluated cross-sectionally and with a small sample size. Thus, our ability to evaluate the temporal ordering between high-risk alcohol consumption and symptomatic COVID-19 outcome is limited. Nonetheless, we used a robuster study design (prospective cohort) with larger sample sizes when evaluating the associations between high-risk alcohol consumption and seroconversion and self-reported SARS-CoV-2 new infection outcomes. Measures: We chose different measurement tools for assessing the exposure and outcome, each of which have some strengths and limitations. We used biological antibody testing to measure seroconversion outcome. Antibody testing kits can capture undetected previous SARS-CoV-2 infections. Yet, the antibody testing kits in this study had a low sensitivity. However, we used a secondary outcome (self-reported new SARS-CoV-2 infection) that does not depend on antibody positivity. Previously, we found a strong association between self-reported SARS-CoV-2 infection and antibody testing variables (14). Similarly, we used different measures to ...

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04620798</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Longitudinal COVID-19 Antibody Testing in Indiana University…</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.03.21261444
  84. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.04.21261360
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.04.21261360: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.04.21261360
  85. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.03.21261365
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.03.21261365: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.03.21261365
  86. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.04.21261332
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.04.21261332: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.04.21261332
  87. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.03.21260940
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.03.21260940: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Study procedures: Informed consent was obtained from all patients.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using SPSS Version 27.0 (IBM, Armonk, NY, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Of importance, cardiopulmonary limitations were not felt to be the main driver of exercise intolerance by 6 months as reduced peak oxygen consumption was only seen in symptom-limited submaximal tests. Other CPET studies of COVID-19 patients have also demonstrated a high proportion of submaximal tests.30 In one study, direct assessment of maximum muscle strength using dominant leg extension independently predicted peak oxygen consumption in patients following COVID-19.7 Taken together, these findings strongly suggest that muscular conditioning and fitness are important determinants of exercise tolerance and highlight the role of dedicated rehabilitation in augmenting recovery. Postural orthostatic tachycardia and other manifestations of dysautonomia have frequently been described among patients post-COVID-19.31,32 Here, we showed that at 2-3 months, heart rate recovery, an indirect measure of autonomic health, was impaired in patients compared to controls.33 By six months, heart rate recovery improved, implying that dysautonomia may be transient and does spontaneously recover in some patients. An interesting observation from serial CPET assessments was that O2 pulse, a marker of exertional stroke volume, was reduced in patients at 2-3 months and normalized by 6 months. Reduced O2 pulse has also been observed in a recent study by Baratto et al.,34 where impaired tissue oxygen extraction has been implicated. Increased pulmonary vascular resistance (PVR) can also explain the redu...

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04510025</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Capturing MultiORgan Effects of COVID-19</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.03.21260940
  88. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.04.21261471
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.04.21261471: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: ManARTS) Biobank (study no M2020-88) for MFT or the Northern Care Alliance Research Collection (NCARC) tissue biobank (study no. NCA-009) for SRFT and PAT.<br>IRB: Ethics approval was obtained from the North West-Haydock Research Ethics Committee for ManARTS (reference 15/NW/0409) and from the Wales Research Ethics Committee 4 for NCARC (reference 18/WA/0368).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">We developed a model using the 43 samples from 12 patients (chosen randomly) with severe disease, using Wilks’ Lambda with Rao’s F-approximation to assess the significance of correlations.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.04.21261471
  89. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.03.455003
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.03.455003: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-T7 tag HRP-conjugated secondary antibodies were diluted at 1:5000 and incubated at room temperature for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-T7 tag</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To obtain the T20 score of a given VH/VHH sequence, the query sequence will be searched against the reference database by blastp.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>blastp</div><div>suggested: (BLASTP, RRID:SCR_001010)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structural analysis of buried residues: The degree of burial for a residue is quantified by measuring the depth of the side chain below the protein surface using the ResidueDepth module in BioPython.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioPython</div><div>suggested: (Biopython, RRID:SCR_007173)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following criteria were used to predict the presence of a certain interaction: Salt bridge: The distance between two opposite charge atoms between two residues is less than 4 angstrom.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Salt</div><div>suggested: (SALT, RRID:SCR_003187)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The raw data were processed and fitted into the 4PL curve using the Prism Graphpad 9.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.03.455003
  90. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.04.455134
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.04.455134: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Minimization, equilibration and production: MDS were performed with GROMACS 2018.2, 2019.6 or 2020.2 engines (11)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GROMACS</div><div>suggested: (GROMACS, RRID:SCR_014565)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GlycoSHIELD: Methodology and user scripts: A library of conformers of 11 distinct glycans (up to 40 000 conformers per glycan) was generated and is publicly available on Zenodo (https://zenodo.org/record/5083355).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Zenodo</div><div>suggested: (ZENODO, RRID:SCR_004129)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Currently, only single chain PDBs are supported by GlycoSASA.py Dependencies: GlycoSHIELD requires the MDAnalysis-1.1.1 (17), numpy-1.21.1 (19) and Matplotlib-2.2.3 (20) Python packages.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structures corresponding to a range of angles were generated and linker region reconstructed using MODELLER (22).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MODELLER</div><div>suggested: (MODELLER, RRID:SCR_008395)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">3D structure rendering: Rendering of molecular structures were performed with PyMOL (23),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 10. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.04.455134
  91. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.04.21261596
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.04.21261596: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our study also has several limitations. First, most of our analyses are based on population-level data without variant-specific information, given limited variant testing during most of the study period. We circumvented this data deficiency by analyzing estimates of a key subpopulation (e.g., the WHts neighborhood where B.1.526 was initially detected) and leveraging prior knowledge (e.g., estimated IFR prior to B.1.526 emergence). Second, our study did not distinguish the two subclades within the B.1.526 lineage – one containing the E484K mutation and the other containing the S477N mutation. Both the E484K and S477N mutations have been shown to mediate immune escape;29,31-33 in addition, the percentages of these two subclades were similar during our study period, suggesting they likely have similar epidemiological characteristics. Lastly, there is a likely larger uncertainty in B.1.526-related and B.1.1.7-related IFR estimates for younger ages (those under 45), due to the smaller number of deaths and larger uncertainty in baseline IFR estimates. Future investigation addressing these issues is warranted should a large sample of variant-specific data become available. In summary, our study has reconstructed the early epidemic trajectory and subsequent rise of B.1.526 in NYC and estimated its key epidemiological properties. Findings highlight the importance of monitoring the viral diversity of SARS-CoV-2, epidemiological characteristics of new variants, and disease severity, as ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.04.21261596
  92. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.03.21261545
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.03.21261545: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data are not publicly available but are available to researchers by application to the Facebook Data for Good Partner Program (https://dataforgood.fb.com/, diseaseprevmaps(at)fb.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Good Partner Program</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This was calculated separately for travel in and out of the UK (Highest mean weekly movement out: UK - Ireland, week commencing 10th August 2020; Highest mean weekly movement in: Spain - UK, week commencing 10th March 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>August</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.03.21261545
  93. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.06.455424
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.06.455424: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bi-fluorescence frameshift measurements: A549 (CRL-185) cells were purchased from the American Type Culture Collection (Manassas, VA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For measuring −1 PRF efficiency in the panel of CoV frameshift signals used to test inhibitors, we used a dual-luciferase reporting system based on a plasmid containing the sequence for Renilla luciferase and the multiple cloning site (MCS) from the plasmid pMLuc-1 (Novagen) upstream of the firefly luciferase sequence in the plasmid pISO (addgene), as described previously (19,26).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMLuc-1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pISO</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To remove rNTPs and polymerase, mRNA was purified using weak anion exchange as described (34). (3) Construction of bi-fluorescent reporter for cell-based assays: The reporter plasmid pJD2261 was constructed by cloning a gBlock (IDT) encoding AcGFP, the HIV-1 −1 PRF signal, mCherry, and insulator A2 described previously(35) into PstI-digested pUC19 (Genbank accession L09137).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pJD2261</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pUC19</div><div>suggested: RRID:Addgene_50005)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, the CMV promoter from pJD2044 was inserted into KpnI/PstI-digested fluorescent reporter.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pJD2044</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV-2 frameshift reporter was made by digesting pJD2514 [19] using SalI and BamHI, gel-purifying the SARS-CoV-2 −1 PRF insert, and then ligating it into SalI/BamHI-digested pJD2261 vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pJD2514</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary structural predictions were performed on the pKiss (31) and Hotknots (32,33) web servers using default settings, with the proposed structures (Fig.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pKiss</div><div>suggested: (pKiss, RRID:SCR_017256)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All data analysis was carried out in Graphpad Prizm 8 and 9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.06.455424
  94. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.04.21260420
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.04.21260420: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Informed consent: Informed consent will be obtained from the potential trial participants or their surrogate decision makers.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Trial interventions: Helmet group: A helmet (Subsalve, USA or its equivalent), which is made of transparent latex-free polyvinyl chloride, will be applied to patients randomized to the intervention group as per the study protocol which considers the manufacturer instructions.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Blinding: Due to the nature of the study intervention, blinding is not be possible.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">22 Considering a mortality rate of 40% in patients with COVID-19 pneumonia and moderate to severe ARDS treated with usual care, we calculated that enrollment of 304 patients (152 in each group) would provide the study with 80% power to demonstrate an absolute difference of 15% in the primary outcome between the usual care group and helmet NIV group at a two-sided alpha level of 0.05.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SAS software, version 9.2 (SAS Institute) will be used for all the analyses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The main limitation to our study is inability to blind the given allocation due to the nature of the intervention.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04477668</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Helmet Non-Invasive Ventilation for COVID-19 Patients</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.04.21260420
  95. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.05.21258160
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.05.21258160: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies used in this study: HIF1α (Abcam ab51608, 1:200), MyBPC3 (ThermoFisher PA547925, 1:50),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MyBPC3</div><div>suggested: (Thermo Fisher Scientific Cat# PA5-47925, RRID:AB_2607814)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Image brightness, contrast, and size were adjusted using Adobe Photoshop CS4 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Adobe Photoshop</div><div>suggested: (Adobe Photoshop, RRID:SCR_014199)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: All data were quantified by ImageJ (analyze particle).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was performed using GraphPad Prism 9.0 with unpaired t test, nonparametric, Kolmogorov-Smirnov. p value < 0.05 was considered statistically significant.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 24. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.05.21258160
  96. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.05.21261610
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.05.21261610: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serological Assay and Vaccination Records: Antibody status was determined using the Roche Elecsys® Anti-SARS-CoV-2 (qualitative) assay detection of neutralizing antibodies against SARS-CoV-2 nucleocapsid (N) protein, hereafter referred to as “Roche N-test”.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2 nucleocapsid ( N</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations may occur in observational serological surveys; e.g., sample demographics may not be fully representative of the state, which is true for some variables in the current survey. Sampling variability or selection biases may operate within small time windows of a serological survey, and can result in inaccuracies in seroprevalence estimates. It will therefore generally be necessary to smooth estimates using a chosen time window dependent on factors such as the magnitude of the wave of infection and participant accrual rate. Fortunately, we observe that the application of an isotonic restriction to reflect the assumption that seroprevalence should not decrease in a reasonably small time window mostly overcomes the issue of daily or weekly sampling variability. Further, it is necessary to estimate the percentage of people who have both had natural COVID-19 infection and are fully vaccinated in a given time window in order to subtract that proportion from the overall sum. Finally, it is important to age-adjust estimated serological and vaccination rates to the state census so they are commensurate with population demographics. This is especially important since vaccination was rolled out by age group, with older adults first priority in January-March 2021. To our knowledge, this is the first fully data-driven estimation of total immunity to SARS-CoV-2 in the state of Texas, which is the second largest state in the US with a population of 29.2 million. The method proposed...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.05.21261610
  97. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.06.21261590
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.06.21261590: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the Ethics Committee of National Hospital Organization Utsunomiya National Hospital (No. 03-01, April 19, 2021).<br>Consent: Written informed consent was obtained from all study participants before enrolment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Finally, we enrolled 378 healthcare workers (255 women, 123 men), including the 6 from our preliminary study [18], and their medical histories and demographic characteristics were recorded using a structured self-reported questionnaire.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To calculate Spearman’s rank correlation coefficient and perform the Mann-Whitney U test, we used Statistical Package for the Social Sciences (SPSS version 25).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Statistical Package for the Social Sciences</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Some limitations and possible sources of bias in this study include the following. First, the participants were limited in number and were all healthcare workers vaccinated at a single national hospital in Tochigi prefecture, where the COVID-19 pandemic has been well-controlled since SARS-CoV-2 began spreading around the globe. Therefore, the results obtained in this study might not be generalisable on a wide scale, or even within Japan. Second, several data, including body height and weight, were obtained by means of a standardised structured self-reported questionnaire. We cannot deny the possibility that some data may have been affected by recall bias. Third, the cut-off level of the Ab against the SARS-CoV-2 spike antigen needs to be determined for the different variants of SARS-CoV-2, but this information is currently unavailable. Further studies are needed to confirm our observations. In conclusion, we have reported for the first time real-world Ab titres against the SARS-CoV-2 spike antigen at 3 months after the second dose of the BNT162b2 vaccine, which were much lower than those measured shortly after the second inoculation. We demonstrated that the most important factors associated with low Ab titres were age and smoking habit. In particular, current smoking status causes lower Ab titres, and smoking cessation before vaccination may improve the individual effectiveness of the BNT162b2 vaccine. To establish a more personalised approach to vaccination involving earlie...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.06.21261590
  98. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.05.21261671
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.05.21261671: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Survey Measures: After providing informed consent, participants underwent interviewer-administered surveys at baseline and approximately one week later to minimize participant burden.<br>IRB: Protocols were approved by institutional review boards at the University of California San Diego and Xochicalco University.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody Detection: Serology was conducted by Genalyte® (San Diego, CA), using their Maverick™ Multi-Antigen Serology Panel [9] that detects IgG and IgM antibodies to five SARS-CoV-2 antigens (Nucleocapsid, Spike S1-S2, Spike S1, Spike S1-RBD, Spike S2) within a multiplex format based on photonic ring resonance.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antigens ( Nucleocapsid , Spike S1-S2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HIV and HCV Serology: Rapid HIV and HCV tests were conducted using the Miriad® HIV/HCV Antibody InTec Rapid Anti-HCV Test (Avantor</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HIV</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-HCV</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.05.21261671
  99. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.02.21260667
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.02.21260667: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Study design: Participants of our ongoing SARS-CoV-2 seroprevalence study were recruited by informing employees of the University Medical Center Hamburg-Eppendorf and written informed consent was obtained by all study participants before recruitment.<br>IRB: The study protocol was reviewed and approved by the Ethics Committee of the Medical Council of Hamburg (PV 7298).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serology: To differentiate between past infection and vaccine-induced immune response, anti-SARS-CoV-2 antibodies against the viral nucleocapsid (NC) and the receptor-binding domain (RBD) domain of the viral spike protein (S) were determined using the qualitative anti-NC-SARS-CoV-2 Ig assay (Elecsys Anti-SARS-CoV-2, Roche, Mannheim Germany; cut off ≥ 1 COI/ml) and the quantitative anti-S1-RBD-SARS-CoV-2 assay (Elecsys Anti-SARS-CoV-2 Spike, Roche, Mannheim, Germany; cut off 0.8 U/ml).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-NC-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Since it has been previously demonstrated that after natural infection, an anti-S1-RBD-SARS-CoV-2 antibody concentration of more than 133 BAU/ml predicts the presence of neutralizing antibodies (Resman Rus et al., 2021) and may thus be a potential surrogate for high protection from COVID-19 after vaccination, we specifically calculated the percentage of different subgroups of our study cohort with antibody titers above this threshold.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S1-RBD-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using GraphPad Prism, version 9 for macOS (GraphPad Software, La Jolla, California, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our study has important limitations, most of which are inherent to the cross-sectional character of our study. First, we only provide vaccine-induced antibody titers for point in time and are not able to assess longitudinal data or serological kinetics. Also, since different COVID-19 vaccines were licensed and distributed to hospital workers at different points in time, we are not able to compare immune responses elicited by different vaccines at the same post-vaccination interval. Second, while our longitudinal study was initiated before COVID-19 vaccines could be anticipated, and study participants were recruited across all age groups and occupations, we did not recruit a strictly representative sample of hospital employees at our tertiary care center, which limits the overall generalizability of results. Study participants with a positive attitude towards COVID-19 vaccines in general and those who have been vaccinated in particular may be more likely to participate in our study which may represent an important selection bias. Third, not all individuals develop a long-lasting anti-NC-SARS-CoV-2 response follow infection with SARS-CoV-2 (Van Elslande et al., 2021), so we may underestimate the true overall infection rate in our cohort. Fourth, the number of study participants, especially those with anti-NC-SARS-CoV-2 antibodies, was relatively small in some subgroups, and our findings need to be confirmed by larger cohort studies. While the COVID-19 pandemic evolves and the o...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.02.21260667
  100. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.02.21261500
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.02.21261500: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our study suffered from a few limitations. First, we did not use longitudinal measures of PIDRs due to limited public health surveillance. Second, data for COVID-19 testing rates for each race are not available when examining the racial differences. Third, due to the limited data access, we used county-level data rather in this study whereas using zip code-level data would have offered a better granularity of data in the statistical models. At last, variables used in this study may not be complete because we primarily adopted the framework from Snyder and Parks to conceptualize the study where the framework was designed for studying COVID-19 infection. Future studies could also integrate other frameworks with a better coverage of Social Vulnerability Index (SVI), a varible for exploring the negative effects in communities towards hazardous events.52

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.02.21261500
  101. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.03.21261567
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.03.21261567: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.03.21261567
  102. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.05.455290
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.05.455290: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Human SARS-CoV-2: nasopharyngeal swab specimens were collected as part of the routine SARS-CoV-2 surveillance conducted by the Mount Sinai Pathogen Surveillance program (IRB approved, HS#13-00981).<br>Euthanasia Agents: Anesthetized hamsters were euthanized by intracardiac injection of sodium pentobarbital (Sleepaway - Zoetis) euthanasia solution.<br>IACUC: All animal studies were approved by the Institutional Animal Care and Use Committee (IACUC) of Icahn School of Medicine at Mount Sinai (ISMMS)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Hamster infections: Ten female golden Syrian hamster of approximately 4-weeks-old were placed in pairs in five different cages.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: , non-essential amino acids, penicillin (100 UI/mL), streptomycin (100 UI/mL) (Corning) and normocin (100 ug/mL) (InvivoGen) to prevent mycoplasma infection.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-mouse secondary IgG-HRP antibody (abcam, 6823) was used at a dilution 1:5000 to detect SARS-CoV-2 Spike protein and anti-rabbit secondary IgG-HRP antibody (Kindle Biosciences, R1006) at 1:2000 to detect SARS-CoV-2 nucleocapsid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>secondary IgG-HRP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit secondary IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 1-hour, anti-mouse SARS-CoV-2-NP antibody (1C7C7, kindly provided by Dr. Moran) was added at a dilution of 1:1000 in 1% milk-TBST and incubated for 1 hour at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse SARS-CoV-2-NP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, cells were washed two times in PBS and stained with goat anti-mouse secondary IgG-HRP antibody (abcam, 6823) at a dilution of 1:5000 in 1% milk-TBST and incubated for 1 hour at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse secondary IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 24 post-infection, cells were fixed with 10% methanol-free formaldehyde and incubated with primary antibodies against spike KL-S-3A7 (43) and nucleoprotein polyclonal anti-serum (44) diluted in 3% bovine serum albumin (BSA) for 1 hour at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-serum</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, cells were washed and stained with secondary antibodies anti-mouse Alexa Fluor-488 (ThermoFisher; A21202) and anti-Rabbit Alexa Fluor 568 (ThermoFisher; A11011) in 5% BSA for 1h at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Molecular Probes Cat# A-21202, RRID:AB_141607)</div></div><div style="margin-bottom:8px"><div>anti-Rabbit</div><div>suggested: (Molecular Probes Cat# A-11011, RRID:AB_143157)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: VeroE6 and Caco-2 cell lines were originally purchased from the American Type Culture Collection (ATCC)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: CLS Cat# 300137/p1665_CaCo-2, RRID:CVCL_0025)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Specimens were selected for viral culture on Vero-E6 cells based on the complete viral genome sequence information (31).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral transport media was incubated with VeroE6 cells until cytopathic effect was observed and supernatants from infected cells were used for plaque purification of clonal population as previously described (42).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, ten-fold serial dilutions were performed in infection media for SARS-CoV-2 and inoculated onto confluent VeroE6 or VeroE6-TMPRSS2 cell monolayer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies against SARS-CoV-2 Spike S2 protein (Abcam; ab6823) and nucleocapsid (Novus Biologicals; NB100-56576) were purchased from the indicated suppliers and used at a dilution of 1:3000 and 1:2000 respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Novus Biologicals</div><div>suggested: (Novus Biologicals, RRID:SCR_004286)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Oxford Nanopore sequencing: The frequency of variants at position S:655 in the hamster samples was further confirmed with Oxford Nanopore (ONT) sequencing in a MinION Mk1C instrument.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MinION</div><div>suggested: (MinION, RRID:SCR_017985)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequencing data acquisition was done with the ONT software MinKNOW v4.3.7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MinKNOW</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Genome assembly was done with the Artic pipeline (artic-network/artic-ncov2019) with default parameters, where reads were aligned to the reference genome Wuhan-Hu-1 (MN908947.3) using minimap2 (2.17-r941), consensus variants were called with Nanopolish (0.13.2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Nanopolish</div><div>suggested: (Nanopolish, RRID:SCR_016157)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.05.455290
  103. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.03.21261548
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.03.21261548: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The exposure notification (EN) relies on the Privacy-Preserving Contact Tracing Project developed by Apple and Google.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Google</div><div>suggested: (Google, RRID:SCR_017097)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Extended Data Table 4 summarizes the method comparison study completed to support the correlation between saliva samples processed with covidSHIELD and nasal samples processed with Abbott RealTime SARS-CoV-2 assay performed on the Abbott m2000 System.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Ct values were plotted as single replicate values on a scatter plot, using GraphPad Prism 8 (version 8.4.2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.03.21261548
  104. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.30.21261339
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.07.30.21261339: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: No testing was performed until patient consent was obtained.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Nine of the 25 subjects were females (36%).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT02735707</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomized, Embedded, Multifactorial Adaptive Platform Trial…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04381936</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomised Evaluation of COVID-19 Therapy</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04338360</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Approved for marketing</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Expanded Access to Convalescent Plasma for the Treatment of …</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.30.21261339
  105. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.04.21261613
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.04.21261613: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: All study protocols were reviewed and approved by the University of Texas Health Science Center Houston Institutional Review Board prior to any data collection.<br>Consent: Enrollment required contact information, demographic characteristics and informed consent for three blood draws over 6-12 months.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">These features provide an optimal combination of high specificity and sensitivity for the detection of immune exposure to SARS-CoV-2 in the general population, including in pregnant women and pediatric populations.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The larger study aims to enroll participants from four populations across the state of Texas; pediatric school children 5-17 years of age, FQHC or community clinic patients, kindergarten to -12th grade educators and allied staff and Texas workforce employees who will be tested for SARS-CoV-2 antibodies at three points over a 6-12 month period.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The full adjustment analysis was completed using SPSS version 27 and by hand.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The inclusion of COVID-19 positive and negative participants is important as it has been a limitation of other studies and allows us to more accurately determine the seroprevalence and human response over time in a diverse representative population. Therefore, ability to determine antibodies in individual with no previous history of COVID-19 over time is a unique aspect of our program approach that may inform understanding of the timing of neutralizing antibodies across a 6-month period; current estimate indicate antibodies may be stable for 5-7 months after SARS-CoV-2 infection13. Although self-reported the COVID-19 test positivity and self-report of symptoms allows us to better determine the cycle and decline of antibody levels in a large sample of Texans over a 6-month period. It is estimated that over one-third of patients that have recovered from COVID-19 have antibodies given mild or asymptomatic disease,11 it is important to note that in our sample, 68.7% of those with a previous positive COVID-19 test had a positive SARS-CoV-2 antibody test. The timing of the data collection from the start of the first reported cases in Texas was approximately 6 months from the start of our data collection. The positive cases will be monitored for decline of antibody levels and collection of additional COVID-19 testing, positive results and symptoms over a further six-month enrollment period. Although the highest neutralizing antibody titers are found in severe disease,19 the expected...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.04.21261613
  106. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.01.21261309
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.01.21261309: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The original and follow-up research designs were approved by the Ethics Committees of the Advanced Telecommunications Research Institute International (ATR) (approval No. 21-195 for the original study & 21-749 for the follow-up study).<br>Consent: All participants read a full explanation of the study and gave informed consent before each survey.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Demographic variables were collected as follows: gender (women and men), age, job status (Self-employed, employed, unemployed and other), education history, household income per year (<4 million yen,</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Given the complex nature of the link between the current pandemic and mental health, this study has some limitations. First, long-term effects of this pandemic cannot be assessed yet. Second, the psychiatric scores assessed here did not include some important dimensions, such as psychotic symptoms. Third, our analysis focused on the Japanese population. Our understanding of the effects of the COVID-19 pandemic on mental health would benefit from international comparisons, including race, culture, religion, and psychiatric states that were not assessed in this study. Finally, because our data were concatenated across time-points, the PCs reflected both temporal covariance and covariance between participants. Future work with more time points may help us clearly distinguish these two effects, to better understand the impact of the pandemic on mental health. In summary, time courses of nine psychiatric symptoms during the COVID-19 pandemic were aggregated into three exacerbated, orthogonal principal components with different peaks, as well as different modulating factors. Our findings underline the importance of flexible approaches for mental health protections. Long-term monitoring and real-time reporting are both necessary to determine the full consequences of COVID-19 on mental health.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.01.21261309
  107. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.31.21261423
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.07.31.21261423: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.31.21261423
  108. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.30.21261400
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.07.30.21261400: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics approval: This study was approved by the Ottawa Health Science Network Research Ethics Board (20200331-01H).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analysed using the Statistical Package for Social Sciences (SPSS) (IBM SPSS Statistics for Windows, version 25.0 (IBM Corp.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      An important limitation of the current study is that, while we were able to show significant differences between the post-slowdown and pre-slowdown cohorts, we cannot identify a specific cause. One possible explanation is that the lack of screening procedures during the slowdown period resulted in more cancers going undetected at an earlier stage and that this led to a disproportionate number of advanced cancers in the post-slowdown cohort. This explanation would apply to those patients who would have normally undergone a screening procedure but were delayed/cancelled due to the slowdown. Another possible explanation is that some people may have been reluctant to seek medical attention. This may have been out of personal fear of COVID-19 or out of respect for government messaging to stay at home. Thus, some people may have discounted early warning signs and only presented to hospital once they had developed “alarm” symptoms (e.g., persistent abdominal pain). Unfortunately, both explanations involve system failures at a population level. In summary, our findings demonstrate that health care policies put in place at the beginning of the COVID-19 pandemic in Ontario, Canada were ultimately associated with more advanced disease in patients diagnosed with CRC. Worsening cancer burden not only increases patient morbidity and mortality, but also has long-term social and economic effects on oncological care. Governments and health authorities should consider these results when creati...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.30.21261400
  109. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.07.30.454526
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.07.30.454526: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DS-affinity autoAg identification: Potential autoAgs were identified by DS-affinity from protein extracts from six human cell lines as previously described, including HFL1 fetal lung fibroblasts [1], A549 lung epithelial cells [2], HS-Sultan B-lymphoblasts [4], Wil2-NS B-lymphoblasts [7], Jurkat T-lymphoblasts [5], and HEp-2 fibroblasts [11].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Jurkat</div><div>suggested: TKG Cat# TKG 0209, RRID:CVCL_0065)</div></div><div style="margin-bottom:8px"><div>HEp-2</div><div>suggested: CLS Cat# 300397/p694_Hep-2, RRID:CVCL_1906)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Autoantigen literature text mining: Each DS-affinity protein was verified as to whether it is a target of autoantibodies by an extensive literature search on PubMed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Search keywords included the MeSH keyword “autoantibodies”, the protein name or its gene symbol, or alternative names and symbols.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MeSH</div><div>suggested: (MeSH, RRID:SCR_004750)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein network analysis: Protein-protein interactions were analyzed with STRING [14].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STRING</div><div>suggested: (STRING, RRID:SCR_005223)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Enrichment of pathways and processes were analyzed with Metascape [16], which utilize various ontological sources such as KEGG Pathway, GO Biological Process, Reactome Gene Sets, and Canonical Pathways.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Metascape</div><div>suggested: (Metascape, RRID:SCR_016620)</div></div><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div><div style="margin-bottom:8px"><div>GO Biological</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ShinyGO is based on a large annotation database derived from Ensembl and STRING-db.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ensembl</div><div>suggested: (Ensembl, RRID:SCR_002344)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.07.30.454526
  110. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.05.21259863
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.05.21259863: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">We made a small modification to the pregnancy flag, restricting this to females aged under 50, to avoid including any codes incorrectly recorded against males and post-menopausal women.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Priority groups for vaccination: We classified patients into priority groups (box 1) using SNOMED-CT codelists and logic defined in the national COVID-19 Vaccination Uptake Reporting Specification developed by PRIMIS v1.1 (“COVID-19 Vaccination Uptake Reporting Specification” n.d.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PRIMIS</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Software and Reproducibility: Data management and analysis was performed using the OpenSAFELY software libraries and Python, both implemented using Python 3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This analysis was delivered using federated analysis through the OpenSAFELY platform: codelists and code for data management and data analysis were specified once using the OpenSAFELY tools; then transmitted securely to the OpenSAFELY-TPP platform within TPP’s secure environment, and separately to the OpenSAFELY-EMIS platform within EMIS’s secure environment, where they were each executed separately against local patient data; summary results were then reviewed for disclosiveness, released, and combined for the final outputs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EMIS’s</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Strengths and weaknesses: The key strength of this study is its unprecedented scale: our source population includes 57.9 million people, over 95% of the population in England. This was achieved by developing and deploying data management and data analysis software inside the EHR vendors’ infrastructure, where the patient data already resides. Another key strength is that we identified patients in JCVI priority groups by directly implementing the full official SNOMED-CT codelists and logic for the national PRIMIS COVID-19 Vaccination Uptake Reporting Specification, thus ensuring that our cohorts are perfectly in line with national procedures and GP expectations. We recognise some limitations with our analysis. Our population, though extremely large, may not be fully representative of the full eligible population: it does not include individuals not registered with a general practice, or the 4% of patients registered at practices not using TPP or EMIS. We include only currently registered and living patients, and exclude those who have moved away or died during the vaccination campaign. Primary care records, whilst detailed and longitudinal, cannot be used to determine vaccine eligibility through reasons of employment, and as such our priority groups which include working-age people will have a subset who were offered the vaccination earlier than others. As there is no national guidance on the use of decline codes it is likely that there is variation in how these codes are bein...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.05.21259863
  111. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.05.455126
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.05.455126: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All donors provided explicit informed consent and the study was approved by the Medical Research Ethics Committee (Tc-BIO protocols 16-856 and 20/806).<br>IRB: All donors provided explicit informed consent and the study was approved by the Medical Research Ethics Committee (Tc-BIO protocols 16-856 and 20/806).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, samples were washed three times in 0.1% Triton X-100 in PBS (v/v) for 20 minutes before the addition of corresponding secondary antibodies Alexa Fluor 488-, Alexa Fluor 594, Atto 647N, or Abberior STAR635p-conjugated anti-rabbit and anti-mouse together with DAPI and Phalloidin-Atto-647N (1:200) for 2 hours at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Phalloidin-Atto-647N</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies: Primary antibodies used in this study were rabbit anti-ACE2 (Sino Biological, #80031-RP02), mouse beta-tubulin IV (BioGenex, #MU178-UC), rabbit anti-Calnexin (Abcam, ab22595), mouse anti-CC10 (Origene, AM26360PU-N), Mouse-anti-CD63 (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CC10</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Mouse-anti-CD63</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DSHB Hybridoma Product H5C6, deposited to the DSHB by August, J.T. / Hildreth, J.E.K.), Mouse anti-Centriolin antibody (C-9, Santa Cruz Biotechnology, sc-365521)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Centriolin</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-365521, RRID:AB_10851483)</div></div><div style="margin-bottom:8px"><div>C-9</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-365521, RRID:AB_10851483)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, mouse anti-SARS CoV/SARS-CoV-2 Nucleocapsid (Sino Biological, #40143-MM08), rabbit anti-SARS CoV Nsp3 (Rockland, #100-401-A52), rabbit anti-SARS-CoV-2 Spike S1 (Sino Biological, # 40150-R007) and rabbit anti-TMPRSS2 (Atlas Antibodies, Cat# HPA035787).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS CoV/SARS-CoV-2 Nucleocapsid (Sino Biological, #40143-MM08),</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-TMPRSS2</div><div>suggested: (Sigma-Aldrich Cat# HPA035787, RRID:AB_2674782)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies were highly cross-adsorbed Alexa Fluor -488 or -594-conjugated goat antibodies against rabbit IgG or mouse IgG, IgG1 or IgG2A (Thermo Fisher Scientific), goat-anti-mouse and goat anti-rabbit Abberior STAR 635P and goat anti-mouse Atto 647N (Sigma-Aldrich), together with Atto 647N Phalloidin (ATTO-TEC) and DAPI (Sigma-Aldrich).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>-594-conjugated goat antibodies against rabbit IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>mouse IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG2A</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>and goat anti-rabbit Abberior STAR</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Key resources table: Cells: Vero E6 cells and HEK293T cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen) supplemented with 10% fetal calf serum (FCS, PAA laboratories), 100 Units/ml penicillin, 100 µg/ml streptomycin and 2mM L-glutamine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The respective virus titer was determined by titration of infectious particles on Vero E6 cells (TCID50) and quantitative real-time reverse transcription-PCR (qRT-PCR) specific for the SARS-CoV-2 E gene [69].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids and cloning: pMD2.G (Addgene#12259) and psPAX2 (Addgene #12260) were gifts from Didier Trono. pFUGW-mCherry-KASH (Addgene #131505,[49]) and pFUGW-spCas9 (Addgene #131506, [49]), pCAGS-PSD95FinR-GFP-TC and pORANGE-empty-FLAG-Cas9 were gifts from Harold MacGillavry. pORANGE-hsACE-GFP KI, a plasmid for C-terminal endogenous tagging of ACE2 using the ORANGE method of CRISPR/Cas9-based genome editing [49], was generated by ligating a primer dimer encoding the target sequence TCTGAACATCATCAGTGTTT into the BbsI sites of pORANGE-empty-FLAG-Cas9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMD2 . G</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>psPAX2</div><div>suggested: RRID:Addgene_12260)</div></div><div style="margin-bottom:8px"><div>pFUGW-mCherry-KASH</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCAGS-PSD95FinR-GFP-TC</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pORANGE-empty-FLAG-Cas9</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pFUGW-hsACE2-GFP-KI_mCherry-KASH, a lentiviral vector for C-terminal endogenous tagging of ACE2 was generated by subcloning the target sequence, gRNA scaffold and EGFP donor sequence, surrounded by target sequences, from pORANGE-hsACE-GFP KI into the PacI site of pFUGW-mCherry-KASH, by Gibson assembly cloning.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pFUGW-hsACE2-GFP-KI_mCherry-KASH</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentiviral infection and gene editing: Lentivirus packaging was performed by using MaxPEI-based co-transfection of HEK293T cells with psPAX2, pMD2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMD2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate ACE2-GFP knock-ins in differentiated HNEC, cells were transduced with 20 µl of each concentrated lentivirus, the first produced from pFUGW-spCas9, carrying spCas9 and the second produced from pFUGW-hsACE2-GFP-KI_mCherry-KASH, carrying the sgRNA targeting ACE2 exon 18, the EGFP donor module and the marker mCherry-KASH, labeling infected cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pFUGW-spCas9</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies were highly cross-adsorbed Alexa Fluor -488 or -594-conjugated goat antibodies against rabbit IgG or mouse IgG, IgG1 or IgG2A (Thermo Fisher Scientific), goat-anti-mouse and goat anti-rabbit Abberior STAR 635P and goat anti-mouse Atto 647N (Sigma-Aldrich), together with Atto 647N Phalloidin (ATTO-TEC) and DAPI (Sigma-Aldrich).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_004463)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The z-stacks were subjected to mild deconvolution using Huygens Professional software version 17.04 (Scientific Volume Imaging, The Netherlands) with the classic maximum likelihood estimation (CMLE) algorithm and the signal-to-noise ratio (SNR) parameter equal to 7 over 10 iterations.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huygens Professional</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For segmentation in Figure 7G, the raw dataset was imported in ImageJ and was segmented for microvilli and cilia using the trainable Weka segmentation plugin [71] (https://zenodo.org/record/59290) in ImageJ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 44. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.05.455126
  112. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.04.455157
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.04.455157: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RIPPLES software is available under the MIT license as part of the UShER package at https://github.com/yatisht/usher.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UShER</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.04.455157
  113. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.03.21261560
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.03.21261560: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the Yale University Institutional Review Board and the requirement for an informed consent was waived for this retrospective review.<br>Consent: The study was approved by the Yale University Institutional Review Board and the requirement for an informed consent was waived for this retrospective review.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Continuous and categorical variables were summarized as medians or means, and percentages as appropriate, and bivariate analysis comparing hospitalized with nonhospitalized patients using SPSS Version 26.0 was performed to identify factors that differentiated between the two groups.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The study had several limitations. First, this was a retrospective review of PWH at a single urban institution, and this group may not be representative of the general global population of PWH. Second, hospitalized cases were identified through a health systems database with laboratory confirmation, leaving open the possibility that other PWH from the YNHH clinics were tested for SARS-CoV-2 or hospitalized elsewhere. Third, although reports show that COVID-19 disproportionately affects disadvantaged populations[22], the PWH cohort in the current study, consisting largely of minorities, and people over 50 years with multiple co-morbid conditions but with ready access to advanced treatments, achieved favorable outcomes overall. Finally, these data reflect the COVID-19 trends among PWH before the initiation of mass vaccination. As the pandemic continues to evolve and new variants emerge, these circumstances could alter the risk factors for hospitalization and severe disease.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.03.21261560
  114. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.04.21261333
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.04.21261333: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Several limitations exist for this study. First, our sample of international travellers was limited due to the rapid implementation of travel restrictions and border closures in multiple countries in response to the rapidly changing situation of COVID-19 pandemic. In addition, all participants of telephone interviews reported that they had essential business or reasonable needs to travel abroad, our findings therefore may not be generalisable to those travelling for leisure purposes. However, the study benefits from being an early evaluation of adherence behaviour and responses to public health guidance among international travellers in the pandemic. Most importantly, it provides an opportunity to learn from the opening stages of the pandemic about how people navigate between differing national rules and guidance across borders. It provides insights that can inform recommendations for improving information provision and hence individual adherence for public health benefit. Public health implication: While international travellers were conscious of the potential risks associated with travel and keen to mitigate those risks, it is important to ensure that international travellers get information and official guidance on the key restrictions and preventive measures for the country to which they are travelling. The provision of a centralised and regularly updated official information hub would help to minimise possible confusion between different sources of guidance. In addition,...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.04.21261333
  115. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.03.21258337
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.03.21258337: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: However, the patients were informed of the purpose of data collection and their written informed consent was requested.<br>IRB: The study was evaluated and approved by the Clinical Research Ethics Committee of the Jordi Gol Foundation (CEI: 21/169-PCV).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.03.21258337
  116. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.03.21261483
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.03.21261483: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-SARS-CoV-2 ELISA (EUROIMMUN US, New Jersey) with a recombinant S1 domain of the spike protein was used to measure IgG antibodies to SARS-CoV-2 spike protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 ELISA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>measure IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2 spike protein.</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.03.21261483
  117. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.02.21261480
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.02.21261480: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical approval: The ethics approval was received from the Institutional Ethics Review Board of the University of the Punjab, Lahore, Pakistan (Reference number:183/DFEMS).<br>Consent: Informed verbal consent to participate in the study was obtained from participants.<br>Field Sample Permit: Respondents sampling and inclusion criteria: The study was conducted in Punjab Province, which is the most developed, populated, and the second-largest province of Pakistan.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">All the interviews were audio-taped, and additional field notes were taken by the principal investigator SK (male)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Strengths and limitations: This study is novel as it is the first of its kind study. It has delivered a convenient and comprehensive understanding of the knowledge, perception, and preparedness of the international medical students residing in hostels of different Universities of Pakistan towards the COVID-19 pandemic. A significant strength of this study was the inclusion of international students of six countries who are pursuing medical courses in seven Universities in different places of Pakistan. This enabled an in-depth exploration of the range of knowledge, perceptions, and preparedness as well of such students towards the COVID-19 pandemic. This study informs about the status of international medical students in Pakistan that can help their management with a quality stay in such a global pandemic. In this context, this study can have an impact in filling the prevailing gap in the qualitative, academic, and administrative issues between the international medical students and the respective authority and the literature as well. All the participants were guaranteed the secrecy and confidentiality of their profile, and the interview was also taken by international students in Pakistan. Therefore, the participants liberally and decently communicated their feelings. Besides, the data analysis based on a thematic analysis method simplified the generation of typical findings. Moreover, there are some probable limitations linked to this qualitative study. This study was carrie...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.02.21261480
  118. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.03.21261377
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.03.21261377: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.03.21261377
  119. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.04.21261538
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.04.21261538: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: All data preprocessing and analyses were performed in R 3.5.0 statistical software9. 4. Ethics: The study was performed in accordance with the Decree 466/1210 of the National Health Council and Good Clinical Practice Guidelines, after approval by the Institutional Review Board (IRB n° 4.637.933).<br>Consent: All participants included in this study provided written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our study has limitations. Our analysis was based on a convenience sample. Moreover, our participants represent a single geographic region of a heterogeneous country, such as Brazil. However, worldwide prevalence of obesity is a public health concern and our findings are in line with previous reports14–17. As another point to address, the two centers included in this study represent different populations, public and private, which may characterize different clusters and limit the interpretation of our results for the sample as a whole. Also, most of our data represents self-report and may be subject to bias. Despite that, we believe that our results add to the literature as they represent an outpatient prospective cohort of young individuals with low risk for complications related to COVID-19 in a LMIC, identifying important risk predictors for this population. Moreover, a similar impact of obesity was consistently found despite adjusting for several possible confounders. In conclusion, our data identified that obesity, in addition to age, was the most important risk factor predicting hospital admission for COVID-19 in a young population in Southern Brazil. These results highlight the importance of health support strategies aimed at this population, in order to promote additional protection, such as vaccination, and to encourage lifestyle changes.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.04.21261538
  120. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.04.21261592
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.04.21261592: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Human specimens: All human specimens were obtained with oversight from the UAMS Institutional Review Board (IRB), and waiver of consent and HIPAA applied.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">An additional 5% of negative sera were randomly selected and tested in parallel.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Purified proteins were confirmed by Coomassie and western blot using antigen-specific antibodies and stored at -80°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein production and purification: HEK293T cells were cultured in Dulbecco’s minimum essential media (DMEM; Gibco) supplemented with 10% heat-inactivated calf serum (CS, VWR), 2 mM L-glutamine (Invitrogen), and 100 U/mL penicillin/100 µg/mL streptomycin (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 15 cm dishes seeded with 9×106 cells on the preceding day were transfected with 20 µg of pCAGGS-SARS-CoV-2 Wuhan-Hu-1 RBD-C-terminal 6-His tag (BEI Resources), pCAGGS SARS-CoV-2</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_18926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Wuhan-Hu-1 ectodomain Spike glycoprotein gene-C-terminal 6-His tag, or pCMV3 2019-nCoV</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV3</div><div>suggested: RRID:Addgene_161029)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Clinical and demographic variables were stored in a secure REDCap database16,17 and included age, sex, race/ethnicity, zip code, and county of residence.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were coated with 2 µg/mL RBD, spike, nucleoprotein, or bovine serum albumin (BSA; Sigma Aldrich) and FACT ELISA was performed as above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BSA; Sigma Aldrich</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We conducted all analyses using SAS version 9.4 (SAS Institute).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.04.21261592
  121. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.04.455140
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.04.455140: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Ethics Statement: All work was conducted in accordance with the Declaration of Helsinki in terms of informed consent and approval by an appropriate institutional board.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: The presence of the desired mutations was determined by automated DNA sequencing.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alexa Fluor-647-conjugated goat anti-human Abs (Invitrogen) were used as secondary antibodies to detect ACE2-Fc and plasma binding in flow cytometry experiments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human Abs ( Invitrogen )</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The 293T-ACE2 cell line was previously described (Prévost et al., 2020) and was maintained in medium supplemented with 2 µg/mL of puromycin (Millipore Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus neutralization assay: 293T cells were transfected with the lentiviral vector pNL4.3 R-E-Luc (NIH AIDS Reagent Program) and a plasmid encoding for the indicated Spike glycoprotein (D614G, B.1.1.7, P.1, B.1.351, B.1.429, B.1.526, B.1.617, B.1.617.1, B.1.617.2) at a ratio of 10:1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Two days post-transfection, 293T-Spike cells were stained with the CV3-25 Ab, ACE2-Fc or plasma from SARS-CoV-2-naïve or recovered donors.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-Spike</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids encoding B.1.617, B.1.617.1, B.1.617.2 Spikes were generated by overlapping PCR using a codon-optimized wild-type SARS-CoV-2 Spike gene (GeneArt, ThermoFisher) that was synthesized (Biobasic) and cloned in pCAGGS as a template.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_18926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids encoding B.1.429, D614G and other SARS-CoV-2 Spike single mutations were generated using the QuickChange II XL site-directed mutagenesis protocol (Stratagene) and the pCG1-SARS-CoV-2-S plasmid kindly provided by Stefan Pöhlmann.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCG1-SARS-CoV-2-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus neutralization assay: 293T cells were transfected with the lentiviral vector pNL4.3 R-E-Luc (NIH AIDS Reagent Program) and a plasmid encoding for the indicated Spike glycoprotein (D614G, B.1.1.7, P.1, B.1.351, B.1.429, B.1.526, B.1.617, B.1.617.1, B.1.617.2) at a ratio of 10:1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNL4.3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell surface staining and flow cytometry analysis: 293T were transfected with full length SARS-CoV-2 Spikes and a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) using the calcium-phosphate method.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pIRES2-eGFP</div><div>suggested: RRID:Addgene_14998)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were acquired on a LSRII cytometer (BD Biosciences), and data analysis was performed using FlowJo v10.7.1 (Tree Star).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Biosciences</div><div>suggested: (BD Biosciences, RRID:SCR_013311)</div></div><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.04.455140
  122. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.03.454782
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.03.454782: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All patients gave written informed consent and all samples were deidentified for this study under IRB #i20-00595 (SARS-CoV-2 infected), IRB #s18-02037 (healthy pre-SARS-CoV-2 controls), and IRB #S20-02069 (vaccinated lymphoma patients).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Specifically, the sample set was randomly split into a training set with 90% observations and a test set with 10% observations.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For reference standards, a commercially available anti-COVID-19 and SARS-CoV S glycoprotein antibody clone CR3022 in the IgG, IgA and IgM formats (Absolute Antibody, Human IgG1, Kappa, catalog number Ab01680-10.0, Human IgA, Kappa, catalog number Ab01680-16.0, Human IgM, Kappa, catalog number Ab01680-15.0) were included in triplicates in each measurement.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-COVID-19</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV S glycoprotein</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Human IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Human IgA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Human IgM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">d 1:800), anti-human IgA PE (Jackson 109-115-011 diluted 1:100) and anti-human IgM DyLight405 (Jackson 709-475-073 diluted 1:200) were used as secondary antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgA PE</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In order to standardize MBBA data across different measurements, they were referenced to the MFI values of the control antibodies, CR3022, as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For neutralization of cancer patient serum, 20,000 Vero E6 (ATCC CRL-1586) cells/well were seeded in 96 well plates the day before infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed using FlowJo (BD, version 10.7.1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.03.454782
  123. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.04.454929
    1
    1. sciscore 10 Aug 2021

      SciScore for 10.1101/2021.08.04.454929: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Custom code for revealing insertions, deletions, and SNPs was used alongside the pairwise2 local tool (https://biopython.org/docs/1.78/api/Bio.pairwise2.html) from the BioPython library (Python version 3.7, BioPython version 1.78; https://biopython.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div><div style="margin-bottom:8px"><div>BioPython</div><div>suggested: (Biopython, RRID:SCR_007173)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Genomic positions were retrieved from the UCSC genome browser (see Table 1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UCSC genome browser</div><div>suggested: (UCSC Genome Browser, RRID:SCR_005780)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used Pandas (version 1.2; https://pandas.pydata.org/), Matplotlib (version 3.3; https://matplotlib.org/), and Seaborn (version 0.11; https://seaborn.pydata.org/installing.html) to visualize the data.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Matplotlib</div><div>suggested: (MatPlotLib, RRID:SCR_008624)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.04.454929
  124. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.02.21261504
    1
    1. sciscore 06 Aug 2021

      SciScore for 10.1101/2021.08.02.21261504: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Study participants: Paired DBS and plasma specimens were collected from COVID-19 convalescent and SARS-CoV-2 vaccinated individuals enrolled as part of the Hospitalized or Ambulatory Adults with Respiratory Viral Infections (HAARVI) research study in Seattle, Washington.<br>Consent: All participants completed informed consent as approved by the University of Washington Institutional Review Board (protocol #STUDY00000959).<br>IRB: All participants completed informed consent as approved by the University of Washington Institutional Review Board (protocol #STUDY00000959).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibody was prepared by diluting goat anti-human IgG-horseradish peroxidase (Sigma #A0170) to 1:2,500 in blocking buffer (2.24 µg/mL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG-horseradish</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells were added to 6-well plates at 5 x 105 cells per well in DMEM supplemented with 10% fetal bovine serum, 2 mM L-glutamine, and penicillin/streptomycin/fungizone.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">4 HEK293T-ACE2 cells in 96-well black-walled plates and, after 16-24 hours, adding 100 µL of diluted viral supernatant per well in duplicate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Duplicate OD450 measurements were averaged and IgG concentrations in plasma and DBS eluates were interpolated from the standard curve using the five-parameter logistic equation function in GraphPad Prism 8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following point dilutions were assessed: 1:400 for participant plasma and negative control normal human serum (Gemini Biosciences #100-110, lot H87WOOK), 1:20 for VB DBS eluates, and 1:40 for FS DBS eluates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gemini Biosciences</div><div>suggested: (Penn Cell Center Stockroom, RRID:SCR_010003)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Figure 1 was created in BioRender.com.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioRender</div><div>suggested: (Biorender, RRID:SCR_018361)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The remaining figures were generated using RStudio.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RStudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.02.21261504
  125. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.02.21260750
    1
    1. sciscore 06 Aug 2021

      SciScore for 10.1101/2021.08.02.21260750: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The protocol was approved by the institutional ethics committee (#ECR/206/Inst/GJ/2013/RR-20).<br>Consent: All HCW irrespective of their HCQ consumption status, who were asymptomatic at baseline and were willing to give consent and take HCQ as recommended were included in the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were performed using STATA, version 11.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.02.21260750
  126. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.02.21261479
    1
    1. sciscore 06 Aug 2021

      SciScore for 10.1101/2021.08.02.21261479: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants provided written informed consent; the study was approved by the University of Melbourne human research and ethics committee (2056689 and 21198153983).<br>IRB: All participants provided written informed consent; the study was approved by the University of Melbourne human research and ethics committee (2056689 and 21198153983).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 specific IgG, IgA1 and IgA2 antibodies in plasma (1:200), saliva (1:5 and 1:50) and tears (1:5 and 1:50) from the respective cohorts (i and ii) were assessed by a customized multiplex bead array consisting of 5 SARS-CoV-2 proteins, including a whole Spike trimer (ST), the Spike 1 (S1), Spike 2 (S2), Receptor Binding Domain (RBD) of Spike and NP (Nucleoprotein) as previously described [11].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 specific IgG, IgA1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA2</div><div>suggested: (LSBio (LifeSpan Cat# LS-C141769-200, RRID:AB_10946697)</div></div><div style="margin-bottom:8px"><div>S2), Receptor Binding Domain (RBD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>NP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was performed with GraphPad Prism 9 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.02.21261479
  127. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.01.21261297
    1
    1. sciscore 06 Aug 2021

      SciScore for 10.1101/2021.08.01.21261297: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study Approvals: The Mount Sinai Hospital Research Ethics Board (REB) granted approval for recruiting staff in long-term care facilities located in the Greater Toronto Area for blood and saliva collection and for conducting serum ELISAs at the Lunenfeld-Tanenbaum Research Institute (study number: 20-0339-E).<br>Field Sample Permit: The University of Saskatchewan REB granted approval for saliva sample collection during the pre-COVID era (study number: BIO-USask-1579).<br>Consent: Consecutive out-patients diagnosed at the same 4 hospitals prior to March 15th and on a convenience sample of later days were approached for consent to collect serum and saliva at 4-12 weeks PSO.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Enzyme-linked immunosorbent assays for detecting antigen-specific IgG, IgA, and IgM in serum: We used a previously published method for detection of saliva and serum anti-SARS-CoV-2 antibodies4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antibodies4</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, an automated chemiluminescent ELISA assay was used to analyze the levels of IgG, IgA, and IgM antibodies to the Spike trimer, its RBD, and the nucleocapsid, as reported previously with the following modifications.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The secondary antibody for IgG was an IgG-HRP fusion (PRO1146, 1:6700 or 0.9 ng/well), donated by the NRC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PRO1146</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A standard curve of the VHH72 monoclonal antibody22fused to a human IgG1 Fc domain (PRO23, also from the NRC) was generated for calibrating the anti-Spike and anti-RBD IgG response.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human IgG1 Fc domain (PRO23</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Spike</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-RBD IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">50ul of Horse radish peroxidase (HRP)-conjugated goat anti human-IgG, IgA and IgM secondary antibodies (Southern Biotech, IgG: 2044-05, IgA: 2053-05, IgM: 2023-05) were added to the appropriate wells at dilutions of 1:1000, 1:2000 and 1:1000 in 2.5% BLOTTO, respectively, and incubated for 1 hour at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti human-IgG, IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA for detection of secretory component associated anti-Spike/RBD antibodies: Secretory chain associated antibodies were detected by modifying our saliva Spike/RBD ELISA by using an HRP-conjugated Goat anti-human secretory component detection reagent at a dilution of 1/750 from Nordic MUBio (Cat# GAHu/SC/PO).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Spike/RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Each plate was normalized either to the mean of the rVSV-eGFP-SARS-CoV-2-S supernatant controls or to the 0.05 μg/mL anti-RBD antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Supernatant was added to Human Embryonic Kidney (HEK) 293 cells were engineered to encode human angiotensin converting enzyme 2 (hACE2 in the pDEST-mCherry vector) as previously described24.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation, the mixture of sample and rVSV-eGFP-SARS-CoV-2-S was transferred to the plated HEK293-hACE2-mCherry cells at a 1:1 ratio of culture media to virus/sample suspension.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293-hACE2-mCherry</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Supernatant was added to Human Embryonic Kidney (HEK) 293 cells were engineered to encode human angiotensin converting enzyme 2 (hACE2 in the pDEST-mCherry vector) as previously described24.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pDEST-mCherry</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analysis was performed in SAS 9.4M6 (SAS Institute, Cary, NC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.01.21261297
  128. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.02.21261469
    1
    1. sciscore 06 Aug 2021

      SciScore for 10.1101/2021.08.02.21261469: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: UK Biobank was approved by the North West Multi-Centre Research Ethics Committee (11/NW/0382).<br>Consent: All participants provided informed consent.<br>Field Sample Permit: This work was conducted under application number 52553.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data was analysed using IBM SPSS (V26.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      There are limitations to this analysis. The cohort consists of volunteers, meaning results may not be entirely generalisable to the whole UK [18]. We used data, particularly CKD classification, from the baseline assessments recorded >10□years ago and, as such, the current health status of participants (e.g., changes in kidney function) cannot be determined. Our CKD group had mild disease staging and findings may differ as disease severity increases. We were only able to categorise ethnicity into three broad categories, rather than considering disaggregated groupings. Disaggregation into specific ethnicity groups has revealed differences in COVID-19 outcomes [5]. This study is the first to detail the association of ethnicity and socioeconomic deprivation with the risk of severe COVID-19 in relation to presence of CKD. These findings are of importance in informing interventions to reduce morbidity and mortality amongst these groups and policy and practice improvements are needed to address the broad disparity among CKD patients.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.02.21261469
  129. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.30.21261372
    1
    1. sciscore 06 Aug 2021

      SciScore for 10.1101/2021.07.30.21261372: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Literature Search: A search was conducted of national anesthesia organization webpages.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We originally searched MEDLINE, LitCovid, and Google for guidelines and recommendations surrounding the perioperative airway management of patients with COVID-19.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEDLINE</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our study has limitations. Firstly, our results provide an overview of the current literature rather than answer a single, predefined question. Secondly, the recommendations included in our scoping review were not comprehensively assessed for methodologic quality (since this is not usually conducted for scoping reviews), although we would expect that included recommendations would likely score poorly in both methodological rigour and transparency of development. Reflecting on our experiences with the COVID-19 pandemic, our study should inform future efforts to improve and streamline the pandemic response. A few central groups of critical care specialists were able to both create and organize emerging evidence and facilitate the creation of internationally applicable guidelines which could be locally modified as needed. For example, the REMAP-CAP and RECOVERY trials provided a global research platform to efficiently adapt to the COVID-19 pandemic, and rapidly evaluate various treatments in an expeditious manner.19–21 Similar international, multicentre initiatives within the perioperative research space were seldom observed, representing an important avenue of exploration to improve preparedness for future pandemics. Early synthesis and organization of evidence without redundancy in efforts will facilitate development of a judicious response to future pandemics. Our scoping review may be considered as one of the first needed steps to learn from experience. Just like individuals...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.30.21261372
  130. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.02.21261502
    1
    1. sciscore 06 Aug 2021

      SciScore for 10.1101/2021.08.02.21261502: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data Analysis: Data was analyzed using Microsoft Excel and GraphPad Prism Version 9.1.1</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      However, there are limitations of this study. First, this study did not include collection of matched NP swabs and compared the relative performance of nasal swabs and saliva. Second, the small cohort of community COVID-19 patients studied here is likely not representative of other patient populations, such as immunocompromised or hospitalized patients. Third, this study was performed in 2020 prior to the emergence of SARS-CoV-2 variants of concern in the U.S. and widespread COVID-19 vaccination. At that time the alpha variant predominated in the studied geographic region. The delta variant for example may display altered biology. Yet RT-qPCR remains foundational for SARS-CoV-2 testing. Simplified specimen collection using saliva and efficient laboratory testing using extraction-free methods offer an innovative approach that is attractive to resource-poor settings and high throughput laboratories alike. Viral load monitoring of individual patients by a single laboratory has the potential to predict outcomes in COVID-19, assess therapeutic response particularly in the setting of clinical trials, and personalize guidance for quarantine and repeat testing.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.02.21261502
  131. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.03.21261014
    1
    1. sciscore 06 Aug 2021

      SciScore for 10.1101/2021.08.03.21261014: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The Ethics Committee of the Nancy CHRU hospital made the statement that this research has been carried out in accordance to current French and European ethical standards as well as The Code of Ethics of the World Medical Association (Comité d’Ethique CHRU de Nancy, decision n° 326, August 3, 2021).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      However, it is important to define a vaccine strategy in order to obtain sufficient neutralizing antibodies level in order to guarantee a long term sufficient immunization One major limitation of our study is its cross-sectional character and therefore results have to be interpreted with a lot of precaution.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04964024</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Not yet recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">SaRS-Cov-2 Antibodies Following Exposure to Coronavirus Dise…</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.03.21261014
  132. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.02.21261516
    1
    1. sciscore 06 Aug 2021

      SciScore for 10.1101/2021.08.02.21261516: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.02.21261516
  133. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.23.21261029
    1
    1. sciscore 06 Aug 2021

      SciScore for 10.1101/2021.07.23.21261029: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: An explanation of this study was provided on the website, and answers to questions regarding consent to research were obtained one by one.<br>IRB: Ethics statement: This study were approved by the Nagasaki International University Ethics Committee (Approval number 50, July 2, 2021).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were performed using JMP Pro 16 (SAS Institute Inc., Cary, NC, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This is one of the limitations of the present study. Information on adverse events that did not require treatment was not available, except for voluntary reports. This is a general limitation in adverse event investigations. The COVID-19 Vaccine Moderna Intramuscular Injection efficacy after second doses was 94.1% in preventing symptomatic, laboratory-confirmed COVID-19 among persons without evidence of previous SARS-CoV-2 infection 3,5). This vaccine requires two times injections to be fully effective, with the second dose having a higher frequency of adverse events than the first time injection1–4). Although there are no detailed data on Japanese who received the COVID-19 Vaccine Moderna Intramuscular Injection, data on Japanese healthcare workers who received the COMIRNATY intramuscular injection show that female and young people are more likely to increase of adverse events at the time of the second dose 2). Similar adverse events are predicted with the COVID-19 Vaccine Moderna Intramuscular Injection. In addition, there is a high possibility that this vaccine will be administered in younger people. Age is often a risk factor for adverse events and should be pursued with caution. However, the adverse events caused by vaccination with this vaccine are rarely serious, and the benefits of vaccination should be emphasized 6). For peace of mind at the time of vaccination, those with many risk factors or those who had adverse events at the time of the first inoculation should p...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.23.21261029
  134. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.01.21261458
    1
    1. sciscore 06 Aug 2021

      SciScore for 10.1101/2021.08.01.21261458: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data bases used were Google scholar, Pakmedinet, PUBMED and MEDLINE.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Google scholar</div><div>suggested: (Google Scholar, RRID:SCR_008878)</div></div><div style="margin-bottom:8px"><div>MEDLINE</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data of outcome variables was entered in Microsoft Excel.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.01.21261458
  135. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.03.21261441
    1
    1. sciscore 06 Aug 2021

      SciScore for 10.1101/2021.08.03.21261441: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: The final protocol and informed consent were approved by the institutional review boards of each of the participating investigational sites.<br>IRB: The final protocol and informed consent were approved by the institutional review boards of each of the participating investigational sites.<br>Field Sample Permit: Plasma specimens from COVID-19 convalescent and vaccinated subjects: Plasma specimens from COVID-19 convalescent subjects and SARS-COV-2 vaccinated subjects used as comparators in the present paper were previously collected from a separate study conducted in collaboration with the National Institute for Infectious Diseases, IRCCS – Lazzaro Spallanzani Rome (IT) and Azienda Ospedaliera Universitaria Senese, Siena (IT).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">A total of 30 healthy men and nonpregnant women, 18 to 55 years of age, meeting all inclusion/exclusion criteria were enrolled in three sequential cohorts of 10 subjects each.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">This is a dose escalation study, open label across doses and randomized, double blind withing each dose level.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">This is a dose escalation study, open label across doses and randomized, double blind withing each dose level.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 1 hour incubation at 37°C, 5% CO2, virus-mAb mixture was added to the wells of a 96-well plate containing a sub-confluent Vero E6 cell monolayer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the analyses of sera or plasma neutralisation antibody titres against SARS-CoV-2 and VoCs, the 100% inhibitory dilution (ID100) was calculated as geometric mean of two technical duplicates and statistical significances of the differences among groups was determined by non-parametric Mann–Whitney T test using GraphPad Prism software (version 8.0.2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The limitation of our study is that our first in human study was conducted in healthy population of age 18-55 without much diversity, whereas the risk for severity of COVID-19 disease is more in population with comorbid conditions or older age groups. Our ongoing Phase 2-3 study will assess MAD0004J08 in mild/moderate diseased and stratified subjects groups to assess dose selection and efficacy. To conclude, MAD0004J08 administration is safe, confers broad-coverage against major SARS-CoV-2 variants of concern, and giving the low dosage needed and i.m. route of administration can be a globally available and affordable countermeasure to the COVID-19 pandemic.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04932850</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Study to Evaluate the Safety and Concentrations of Monoclona…</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.03.21261441
  136. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.03.21261518
    1
    1. sciscore 06 Aug 2021

      SciScore for 10.1101/2021.08.03.21261518: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: This prospective cohort study about COVID-19 among Japanese workers was conducted under the Collaborative Online Research on the Novel-coronavirus and Work (CORoNaWork) Project. Details of the study protocol are described elsewhere15.<br>IRB: This study was approved by the Ethics Committee of the University of Occupational and Environmental Health, Japan (reference nos.<br>Consent: Informed consent was obtained from all participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">For the baseline survey, we recruited 33,087 workers throughout Japan from 605,381 randomly selected panelists registered with an Internet survey company.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were conducted using Stata (Stata Statistical Software release SE16.1; StataCorp LLC, College Station, TX, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This study has several limitations. First, the reason for the participants’ unemployment was unclear. We do not know if it was due to the effects of COVID-19, if a company went bankrupt, or if participants tried to change jobs of their own accord. However, we analyzed unemployment using two different definitions, and the results with both were almost identical. Second, the generalizability of our results is unclear because the study was conducted using an Internet surveys. Individuals who were truly in need may not have had Internet access and thus could not have participated in the survey. We attempted to reduce as much bias in the target population as possible by sampling according to region, job type, and prefecture based on the infection incidence rate. Third, among the 27,036 participants in the baseline survey, 7095 did not respond to the follow-up survey (non-participation rate, 26%). It is possible that some respondents were unable to participate in the follow-up survey owing to poverty caused by unemployment. However, if such individuals had participated in the survey, the association between SES and unemployment would have been stronger. In conclusion, we identified a relationship between SES and subsequent unemployment during COVID-19. It is necessary to provide broad, ongoing support in the form of both short-term assistance and long-term job training and health care.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.03.21261518
  137. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.02.21261379
    1
    1. sciscore 06 Aug 2021

      SciScore for 10.1101/2021.08.02.21261379: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The trial protocol was approved by the London-Brighton & Sussex Research Ethics Committee and the Health Research Authority, sponsored by the University of Warwick, co-ordinated by Warwick Clinical Trials Unit, and funded and prioritized as an urgent public health COVID-19 study by the National Institute for Health Research.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Trial design: Recovery-Respiratory Support was a parallel group, open-label, three-arm, adaptive, randomized controlled trial designed to evaluate the clinical effectiveness of CPAP and HFNO, compared with conventional oxygen therapy, in hospitalized patients with acute respiratory failure due to COVID-19.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Due to the nature of the trial interventions and context, we were unable to blind patients, treating clinicians, or outcome assessors.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">The sample size calculation assumed 11 interim analyses (and the final one) would be conducted.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our trial has several limitations. Firstly, we did not achieve our planned sample size with the decision to stop recruitment driven by practical reasons linked to reducing numbers of COVID-19 in the UK, and an ethical obligation to share accumulated data with the international clinical community. Secondly, we observed crossover between allocated treatment arms, principally from the conventional oxygen therapy arm to one or both of the interventions. This is a common challenge in trials of non-invasive respiratory strategies, and reduces the observed effect size of a clinically effective treatment.23,24 Thirdly, we determined that it would be impractical to collect screening data, meaning we are unable to describe the number of non-randomized patients and reasons for non-randomization. Finally, the trial was rapidly set-up early in the pandemic, prior to the development of a core outcome set for COVID-19 trials.25 Whilst our outcome list aligns closely to most of the core outcomes subsequently identified, we did not capture information on patient recovery following hospital discharge. In conclusion, in this randomized trial of hospitalized adults with acute respiratory failure due to COVID-19, CPAP, compared with conventional oxygen therapy, reduced the composite outcome of tracheal intubation or death within 30 days of randomisation in hospitalized adults with acute respiratory failure due to COVID-19. There was no effect observed, compared with conventional oxygen therapy, w...

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">ISRCTN16912075</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.02.21261379
  138. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.03.21261414
    1
    1. sciscore 06 Aug 2021

      SciScore for 10.1101/2021.08.03.21261414: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All the publications indexed up to the 5th of July 2021, in the following six databases were reviewed: PubMed, Embase, The Web of Science, Scopus, The Cochrane Central Register of Controlled</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div><div style="margin-bottom:8px"><div>Embase</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was performed using the software STATA V.16.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This review has some limitations. Only one person extracted most of the data (LA). Even so, all data were checked for accuracy on repeated occasions and all analyses were conducted several times and checked by a senior statistician (SA). It is also possible that some publications may have been missed. The use of standard care, provided in addition to AZM in the intervention arm, and on its own in the comparison arm, was not described in detail in some studies. It is not clear how different this standard care was across the studies and how this may have affected the results. Some RCTs adjusted the treatment effect for confounders but not all did so. In those adjusted however, there was no considerable difference between the unadjusted and adjusted estimates, likely due to the balanced characteristics of the compared groups, achieved by randomization. The comprehensive search in six databases, and critical assessment of 16 studies, that added together a large number of patients, represent strengths of this review. The inclusion of both observational and interventional studies, based in different settings and looking at various outcomes, are also positive aspects of this research. Furthermore, the sensitivity analyses that was conducted adds consistency to the results. The use of a random effect model was a conservative choice. The overall estimate remained significant despite the increased width of the confidence intervals, providing support to the significance of the findings....

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.03.21261414
  139. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.02.21261486
    1
    1. sciscore 06 Aug 2021

      SciScore for 10.1101/2021.08.02.21261486: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The PDE was replaced by a series of ordinary differential equations (ODEs) by finite difference approximations, which were solved using the SciPy software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SciPy</div><div>suggested: (SciPy, RRID:SCR_008058)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transformation of a map of Japan based on the effective distance from Tokyo and local connectivity: We created a transformed map of Japan according to the Mercator projection (i.e., the longitude and latitude corresponding to the x and y coordinates in the Euclidean plane, respectively) depending on the effective dis-tance from Tokyo, which was estimated from the diffusion equation and local interactions between prefectures (Supplementary Figure 7).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Mercator</div><div>suggested: (Mercator, RRID:SCR_014493)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      However, the proposed method has some limitations. Importantly, the assumption of the diffusion process from Tokyo is qualitatively different between periods before and after peaks of infection and does not allow to quantitatively compare effective distances between these periods. Thus, improvements in methodology to the estimate effective distance based on the uniform assumption remain to be addressed in future studies.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.02.21261486
  140. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.02.21261465
    1
    1. sciscore 06 Aug 2021

      SciScore for 10.1101/2021.08.02.21261465: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the Hamad Medical Corporation and Weill Cornell Medicine-Qatar Institutional Review Boards with waiver of informed consent.<br>Consent: The study was approved by the Hamad Medical Corporation and Weill Cornell Medicine-Qatar Institutional Review Boards with waiver of informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">From January 18 until February 15, 2021, the Alpha variant wave expanded rapidly and weekly rounds of viral genome sequencing [1–4] of randomly collected samples confirmed the presence of this and other originally circulating “wild-type” variants, but documented only limited presence of the Beta variant and no other variants of concern [1–4].</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations include the smaller sample sizes of critical disease and COVID-19 deaths in the Alpha variant analysis (Supplementary Table 2) compared to the Beta variant analysis (Supplementary Table 3), as COVID-19 criticality and fatality have been low in Qatar’s predominantly young and working-age population [8, 13], leading to statistically non-significant results and wider 95% confidence intervals. Data on co-morbid conditions were not available to study investigators; hence, they could not be factored explicitly in our analysis. Nevertheless, matching and adjusting for age in analysis may have served as a proxy, given that co-morbidities are associated with old age. Furthermore, with the young population structure [8], we anticipate that only a small proportion of the study population may have had serious co-morbid conditions. However, our findings may not be entirely generalizable to other settings, where elderly people constitute a sizable proportion of the population. Imperfect assay sensitivity and specificity of PCR testing may have affected infection ascertainment. However, all PCR testing was performed with extensively used, investigated, and validated commercial platforms having essentially 100% sensitivity and specificity (Supplementary Text 1). Unlike blinded, randomized clinical trials, the investigated observational cohorts were neither blinded nor randomized. In conclusion, the Alpha variant is associated with 48% higher risk of severe disease than wild-type ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.02.21261465
  141. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.02.21261095
    1
    1. sciscore 06 Aug 2021

      SciScore for 10.1101/2021.08.02.21261095: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: 2.6 Ethics approval: All patients provided written consent.<br>IRB: The Institutional Review Board of the Faculty of Medicine, Ramathibodi Hospital, Mahidol University, Bangkok, Thailand, reviewed and approved the study protocol (approval number: MURA2021/242).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We included KT recipients from three hospitals; Ramathibodi Hospital, Praram 9 Hospital, and Samitivej Sukhumvit Hospital, all located in Bangkok, Thailand. HMI and CMI were measured before, 4 weeks after the first dose, and 2 weeks after the second dose, using a SARS-CoV-2 immunoglobulin G (IgG) assay that tests for antibodies against the receptor-binding domain (RBD) of the SARS-CoV-2 spike protein, SARS-CoV-2 surrogate virus neutralization test (sVNT), and an enzyme-linked immunospot (ELISpot) assay for interferon-γ (IFN-γ), respectively (Supplementary Figure 1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 immunoglobulin G (IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.2 SARS-CoV-2 humoral immune responses: SARS-CoV-2 anti-RBD IgG antibodies were measured using the Abbott SARS-CoV-2 IgG II Quantification assay (Abbott Diagnostics, U.S.A)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The function of the anti-SARS-CoV-2 spike protein S1 RBD antibody was determined by using a SARS-CoV-2 NeutraLISA surrogate neutralization test assay (Euroimmun, Germany).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 spike protein S1 RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The neutralizing antibodies in plasma were inhibit binding between RBD and angiotensin-converting enzyme 2 (ACE2) receptor.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.2 SARS-CoV-2 humoral immune responses: SARS-CoV-2 anti-RBD IgG antibodies were measured using the Abbott SARS-CoV-2 IgG II Quantification assay (Abbott Diagnostics, U.S.A)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Emerged spots were counted using an ImmunoSpot analyzer (Cellular Technology Limited, Shaker Heights, OH), and spot quality was checked using ImmunoSpot Software v5.0.9.15.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImmunoSpot</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed with Stata statistical software, version 15 (StataCorp, LLC, College Station, TX).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Stata</div><div>suggested: (Stata, RRID:SCR_012763)</div></div><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In addition, the distribution of anti-RBD IgG and SARS-CoV-2-specific IFN-γ-producing SFUs/106 PBMCs were expressed as the mean with 95% CI, presented as a dot plot generated with GraphPad Prism 6.0 (GraphPad Software, Inc, San Diego, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations of this study include the small sample size. Future large-scale studies are needed to confirm our findings and further explore predictors of inadequate immune responses in these specific populations. The strength of this study is it represents one of the first studies to investigate immunogenicity and safety in SOT recipients vaccinated with an inactivated SARS-CoV-2 vaccine. Although poor anti-RBD antibody and surrogate neutralization antibody responses were observed compared with immunocompetent individuals, the assumption of inadequate humoral responses cannot yet be completely elucidated, as further studies using standardized plaque reduction neutralization tests are necessary to define a better cut-off antibody titer that correlates well with neutralization. However, we instead attempted to assess CMI, which is believed to boost a prolonged protective memory response in our susceptible patients. However, the most important thing is adherence to strict basic infection prevention measures remains crucial after immunization. So far, research focused on the effectiveness of COVID-19 vaccines in SOT recipients has not been fully explored. Our study could not report the effectiveness of this vaccine in preventing natural infection because of the short follow-up period after vaccination. Furthermore, vaccine effectiveness varies depending on the study population, the dynamics of local virus transmission, the dominance of variants of concern, and healthcare resources...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.02.21261095
  142. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.08.02.21261505
    1
    1. sciscore 06 Aug 2021

      SciScore for 10.1101/2021.08.02.21261505: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Data Extraction: The following data were extracted from the qualified studies: first author, year/month of the publication, location (city-country), hospital name, definition of disease severity, subject number, number of COVID-19 patients in each health status, age, male to female ratio, vital sign, clinical feature (12 symptoms), comorbidity (any; 8 main diseases), and desired 14 lab data [Appendix I, Appendix II).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Literature Search Strategy: We used the search terms “COVID-19”, “2019-nCoV”, and “coronavirus” in the search field “Title/Abstract”, at the electronic databases: MEDLINE, and EMBASE.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEDLINE</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div><div style="margin-bottom:8px"><div>EMBASE</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      However, such data has its limitations. Routine lab data retains several advantages, which can indicate the whole body situation of a COVID-19 patient whose functions can be changed dramatically in few days.122 Additionally lab testing is easy to access, repeatable, self-explain, relatively cheap, and therefore can be a cost-effective tool under pandemic circumstances. Current criteria to judge the severity, to triage or referral COVID-19 patients, are based on imaging, demographics, comorbidities, vital signs, or symptoms.6, 123, 124 Based on our study results single lab data, lymphocyte count at administration plus age can be useful for the purposes. Early and continue monitoring lab data for a COVID-19 patient can help to understand the health state, triage the patient, predict the severity of disease, predict the health consequences, and workout treatment judgment appropriately. Our study has several limitations. Due to the lack of non-English articles, pediatric study and specific disease groups, interpretation of the results must be cautious. Ideally, all desired lab data should be collected and analyzed in all studies. However, it is not realistic in the real world because of wide-ranging medical resource deficiency that existed across countries. We suggest collecting essential data through a standardized list while clinical presentation, medical history, imaging information, comprehensive lab data, and other valuable factors, can be assembled and analyzed which will a...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.08.02.21261505
  143. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.03.454858
    1
    1. sciscore 06 Aug 2021

      SciScore for 10.1101/2021.08.03.454858: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by an external ethics committee authorized by the Government of Lower Franconia and performed under the project license AZ 55.2.2-2532-2-1179.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Eleven weeks old, female K18-hACE2 mice (Jackson Laboratory, Bar Harbor, USA) were immunized as described before and infected four weeks after the boost immunization intranasally with 9×103 focus-forming units (FFU) of the SARS-CoV-2 strain BavPat1 in a total volume of 50 µl under light anaesthesia with inhaled isoflurane.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HRP-coupled anti-mouse IgA (dilution 1:5,000, A90-103P, Bethyl Laboratories) detection antibodies were added for 1h at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgA</div><div>suggested: (Bethyl Cat# A90-103P, RRID:AB_67140)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To analyse quantities of antigen-specific antibodies, 5×105 HEK 293T cells producing SARS-CoV-2 spike or nucleocapsid were incubated for 20 minutes at 4°C with the respective biological sample diluted in 100 µl FACS-PBS (PBS with 0.5% BSA and 1 mM sodium azide) to bind to spike protein on the surface, or in 100 µl permeabilization buffer (0.5% saponin in FACS-PBS) to bind to intracellular nucleocapsid protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific</div><div>suggested: (Miltenyi Biotec Cat# 130-092-105, RRID:AB_615062)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing with 200 µl buffer, specific antibodies were bound with polyclonal anti-mouse Ig-FITC (1:300, 4°C, 20 min incubation; BD Biosciences),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse Ig-FITC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 infected cells were visualized using SARS-CoV-2 S-protein specific immunochemistry staining with anti-SARS-CoV-2 spike glycoprotein S1 antibody (Abcam) 90. Dennis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 spike glycoprotein S1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To analyse quantities of antigen-specific antibodies, 5×105 HEK 293T cells producing SARS-CoV-2 spike or nucleocapsid were incubated for 20 minutes at 4°C with the respective biological sample diluted in 100 µl FACS-PBS (PBS with 0.5% BSA and 1 mM sodium azide) to bind to spike protein on the surface, or in 100 µl permeabilization buffer (0.5% saponin in FACS-PBS) to bind to intracellular nucleocapsid protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T-ACE2 cells stably expressing the human Angiotensin-converting enzyme 2 (ACE2) were transduced with the dilutions of the pseudotypes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the detection of infectious virus in BAL and the lung, Vero E6 cells were seeded at 2×104 cells/well in a 96-well plate in 200 µl of D10 for confluent monolayer 24 h prior to infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mRNA vaccine Comirnaty® encodes the stabilized prefusion S protein and is described elsewhere 83. Immunizations: Six to eight weeks old female BALB/cJRj or C57BL/6 mice were purchased from Janvier (Le Genest-Saint-Isle, France) and housed in individually ventilated cages in accordance with German law and institutional guidelines.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/cJRj</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Eleven weeks old, female K18-hACE2 mice (Jackson Laboratory, Bar Harbor, USA) were immunized as described before and infected four weeks after the boost immunization intranasally with 9×103 focus-forming units (FFU) of the SARS-CoV-2 strain BavPat1 in a total volume of 50 µl under light anaesthesia with inhaled isoflurane.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vaccines: Codon-optimized sequences for the N or the spike S protein of SARS-CoV-2 were cloned into the pVAX1 expression plasmid (ThermoFisher) optimized for DNA vaccinations referred to as pVAX1-SARS2-N and pVAX1-SARS2-S 81.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pVAX1</div><div>suggested: RRID:Addgene_137910)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the production of pseudotyped reporter particles, HEK293T cells were transfected with the SIV-based self-inactivating vector encoding luciferase (pGAE-LucW), the SIV-based packaging plasmid (pAdSIV3), and the respective spike variant-encoding plasmid 86–88.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pGAE-LucW</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After further washing, samples were measured on an AttuneNxt (ThermoFisher) and analysed using FlowJo software (Tree Star Inc.)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.03.454858
  144. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.30.21261378
    1
    1. sciscore 05 Aug 2021

      SciScore for 10.1101/2021.07.30.21261378: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was conducted among the health professionals involving the post-graduates, teaching staffs, and teaching staffs cum consultants between 20 to 65 years of age from the six constituent colleges of a private University in Belagavi District of North Karnataka, India who were included by simple random sampling, following the ethical clearance from the Institutional Research and Ethics Committee (Ref No: 1445).<br>Consent: On clicking the link, this form informed the participants about the purpose, confidentiality, their voluntary involvement in the study, and also received the consent for participation (inclusion criteria) on selecting the mandatory “Yes” option to proceed with the submission.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The study was conducted among the health professionals involving the post-graduates, teaching staffs, and teaching staffs cum consultants between 20 to 65 years of age from the six constituent colleges of a private University in Belagavi District of North Karnataka, India who were included by simple random sampling, following the ethical clearance from the Institutional Research and Ethics Committee (Ref No: 1445).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">The sample size was estimated to be 376 using the formula where , and (derived from pilot study).</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A self-designed 18-item pre-validated questionnaire, based on the myths/misconceptions regarding COVID-19 vaccine known to prevail among the general public obtained from the various internet sources like the official sites of Centres for Disease Control and Prevention (Department of Health and Human Services, USA), University of Missouri Healthcare, IndiaToday etc., was used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Missouri Healthcare</div><div>suggested: ( Washington University Center for Diabetes Translation Research , RRID:SCR_015204)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: This study was conducted in a smaller sample size of the health professionals of a single University. Future studies could be done, involving a larger population of health professionals from multiple centers, with a uniform sample size among the fields.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.30.21261378
  145. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.02.454829
    1
    1. sciscore 05 Aug 2021

      SciScore for 10.1101/2021.08.02.454829: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">HCT-8 [HRT-18] cells (human male, ATCC CCL-244) were maintained in RPMI containing 10% horse serum, 2 mM L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed 4X in wash buffer and the secondary antibody Goat anti-Human Ig-HRP (Southern Biotech, Cat# 2010-05), was added and incubated at 37°C for 1 hr.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human Ig-HRP</div><div>suggested: (SouthernBiotech Cat# 2010-05, RRID:AB_2795564)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing one time with PBS-T (PBS, 0.05% Tween-20), plate was incubated with rabbit anti-nucleocapsid antibody (Sino Biological, Cat# 40643-T62) for 1h at room temperature on a plate shaker at 800 rpm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-nucleocapsid</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell Lines: All cell lines were incubated at 37°C in the presence of 5% CO2. 293-6E (human female, RRID:CVCL_HF20) and 293T cells (human female, RRID:CVCL_0063) cells were maintained in Freestyle 293 media with gentle shaking.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>the</div><div>detected: ( RRID:CVCL_HF20)</div></div><div style="margin-bottom:8px"><div>293T</div><div>detected: (CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HCT-8 [HRT-18] cells (human male, ATCC CCL-244) were maintained in RPMI containing 10% horse serum, 2 mM L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCT-8</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">LLC-MK2 cells (Macaca mulatta, ATCC CCL-7) were maintained in cDMEM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>LLC-MK2</div><div>suggested: ATCC Cat# CCL-7, RRID:CVCL_3009)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Huh7 cells (human male, a gift from Dr. Ram Savan, Department of Immunology University of Washington) were maintained in cDMEM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: CLS Cat# 300156/p7178_HuH7, RRID:CVCL_0336)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The proteins were expressed in 293E cells and purified using Ni-NTA affinity resin followed by size exclusion chromatography on a superose 6 column as described in(Esposito et al., 2020)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293E</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, HIV-1 Tat (pHDM-tat1b, BEI resources NR-52518), SARS-CoV-2 spike (pHDM-SARS-CoV-2 Spike Wuhan-Hu-1, pHDM-SARS-CoV-2 Spike-B.1.1.7, SARS-CoV-2 Spike-P.1, pHDM-SARS-CoV-2 Spike-B.1.351 (Stamatatos et al., 2021), pCMV3-SARS-CoV-2-Spike-B.1.617.2, pTWist-WIV1-CoV (a gift from Alejandro Balazs (Addgene plasmid # 164438; http://n2t.net/addgene:164438; RRID:Addgene_164438), or pHDM-MERS-CoV Spike and a luciferase/GFP reporter (pHAGE-CMV-Luc2-IRES542 ZsGreen-W, BEI Resources Cat# NR-52516) were co-transfected into 293T cells at a 1:1:1:1.6:4.6 ratio using 293 Free transfection reagent according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudoviron production was carried out at 32 °C for 72 hours after which the culture supernatant was harvested, clarified by centrifugation and frozen at −80°C. 293 cells stably expressing human HEK-293T-hACE2, for SARS-CoV-2 pseudoviruses, or Huh-7 cells for MERS-CoV pseudoviruses were seeded at a density of 4×103 cells/well in a 100 µL volume in 96-well flat bottom black-walled, clear bottom tissue culture plates (Greiner CELLSTAR Cat# 655090).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293</div><div>suggested: NIH-ARP Cat# 103-306, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Meanwhile 50 μL of cDMEM containing 6 µg/mL polybrene was added to each well of 293T-ACE2 or Huh-7 target cells and incubated for 30 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate a plasmid encoding the SARS-CoV-2 spike B.1.1. variant (pHDM-SARS-CoV-2-Spike-B.1.1.7) primers were designed that anneal 5’ of the H69 codon and just 3’ of the D1118 codon on the pHDM-SARS-CoV-2 Spike Wuhan-Hu-1 plasmid (BEI Resources Cat# NR-52514) and used to amplify cDNA corresponding to the N and C termini of the spike protein and the plasmid backbone using Platinum SuperFi II DNA Polymerase (Thermofisher Cat# 12368010) according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHDM-SARS-CoV-2-Spike-B.1.1.7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The synthesized DNA was cloned into the pHDM-SARS-CoV-2 Spike Wuhan-Hu-1 plasmid that was cut with EcoRI and HindIII and gel purified to remove the SARS-CoV-2 Spike cDNA using InFusion HD cloning Plus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Wuhan-Hu-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, plasmids expressing the HIV-1 Gag and pol (pHDM540 Hgpm2, BEI Resources Cat# NR-52517), HIV-1Rev (pRC-CMV-rev1b, BEI Resources Cat#</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pRC-CMV-rev1b</div><div>suggested: RRID:Addgene_164443)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, HIV-1 Tat (pHDM-tat1b, BEI resources NR-52518), SARS-CoV-2 spike (pHDM-SARS-CoV-2 Spike Wuhan-Hu-1, pHDM-SARS-CoV-2 Spike-B.1.1.7, SARS-CoV-2 Spike-P.1, pHDM-SARS-CoV-2 Spike-B.1.351 (Stamatatos et al., 2021), pCMV3-SARS-CoV-2-Spike-B.1.617.2, pTWist-WIV1-CoV (a gift from Alejandro Balazs (Addgene plasmid # 164438; http://n2t.net/addgene:164438; RRID:Addgene_164438), or pHDM-MERS-CoV Spike and a luciferase/GFP reporter (pHAGE-CMV-Luc2-IRES542 ZsGreen-W, BEI Resources Cat# NR-52516) were co-transfected into 293T cells at a 1:1:1:1.6:4.6 ratio using 293 Free transfection reagent according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV3-SARS-CoV-2-Spike-B.1.617.2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_164438)</div></div><div style="margin-bottom:8px"><div>pHAGE-CMV-Luc2-IRES542</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell surface SARS-CoV-2 S binding assay: cDNA corresponding to AA 15-1336 of HCoV-OC43 was PCR amplified from pCAGGS-Flag-HCoV-OC43 Spike (a kind gift from Dr. Marceline Côté, University of Ottawa) and cloned into the pTT3 vector using InFusion cloning (Clontech).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS-Flag-HCoV-OC43</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pTT3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">cDNA for the HKU1 spike was PCR amplified from pCMV-HCoV-HKU1 (SinoBiological Cat# VG40606-UT) and subcloned into pTT3. pTT3-SARS-CoV-2-S (Seydoux et al., 2020), pHDM-MERS-CoV-Spike, pTWist-WIV1-CoV, pHDM-MERS-CoV-1 Spike, pTT3-HKU1 or pTT3-OC43 Spike were transfected into suspension-adapted 293T cells using 293 Free transfection reagent (EMD Millipore Cat# 72181) or PEI transfection reagent (PolySciences Inc. Cat# 23966) according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV-HCoV-HKU1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pHDM-MERS-CoV-Spike</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pTT3-HKU1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pTT3-OC43</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibody concentration that neutralized 50% or 80% of infectivity (IC50 and IC80 for mAbs) was interpolated from the neutralization curves determined using the log(inhibitor) vs. response -- Variable slope (four parameters) fit using automatic outlier detection in GraphPad Prism Software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Model building was completed using COOT (Emsley and Cowtan, 2004) and refinement was performed in Phenix with the final refinement run through the PDB_REDO server (Joosten et al., 2014).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div><div style="margin-bottom:8px"><div>Phenix</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structural figures were made in Pymol (Schrodinger, LLC)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pymol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plates were then washed once with 200µl of FACS buffer and stained with of PE-conjugated AffiniPure Fab fragment goat anti-human IgG (Jackson Immunoresearch Cat# 109-117-008) at a 1:100 dilution and live/dead green fluorescent reactive dye (Thermo Fisher Cat# L34970) at a 1:1000 dilution in 50 µl/well of 1X PBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo Fisher Cat#</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.02.454829
  146. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.03.454861
    1
    1. sciscore 05 Aug 2021

      SciScore for 10.1101/2021.08.03.454861: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animal Procedures and Study Design: All animal procedures were performed under the approval of the Committee on the Ethics of Animal Experimentation of the IGTP and the authorisation of Generalitat de Catalunya (code: 11222).<br>Euthanasia Agents: Euthanasia was performed under deep isoflurane anaesthesia by whole blood extraction via cardiac puncture and was confirmed by cervical dislocation.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">B6.Cg-Tg(K18-ACE2)2Prlmn/J (or K18-hACE2) hemizygous transgenic mice (034860; Jackson Immunoresearch, West Grove, PA, USA) were bred at CMCiB by pairing hemizygous males for Tg(K18-ACE2)2Prlmn (or K18-hACE2) with non-carrier B6.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, viruses were propagated in VeroE6 cells (CRL-1586; ATCC, Virginia, VA, USA) for two passages and recovered by supernatant collection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">B6.Cg-Tg(K18-ACE2)2Prlmn/J (or K18-hACE2) hemizygous transgenic mice (034860; Jackson Immunoresearch, West Grove, PA, USA) were bred at CMCiB by pairing hemizygous males for Tg(K18-ACE2)2Prlmn (or K18-hACE2) with non-carrier B6.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B6.Cg-Tg(K18-ACE2)2Prlmn/J</div><div>suggested: RRID:IMSR_JAX:034860)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For absolute quantification, a standard curve was built using 1/5 serial dilutions of a SARS-CoV2 plasmid (2019-nCoV_N_Positive Control, catalog number 10006625, 200 copies/μL</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV2</div><div>suggested: RRID:Addgene_153201)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Biosafety Approval & Virus Isolation: The biologic biosafety committee of Germans Trias i Pujol Research Institute (IGTP) approved the execution of SARS-CoV-2 experiments at the BSL3 laboratory of the Centre for Bioimaging and Comparative Medicine (CMCiB, Badalona, Spain).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bioimaging</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In a second step, using the MODELLER models as input, we ran FoldX v5 (Schymkowitz et al., 2005; Delgado et al., 2019) to model the mutations associated with the B.1.351 variant of the virus, obtaining 10 additional models (named mACE2-B.1.351 RBD) (Supplementary Fig. 3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MODELLER</div><div>suggested: (MODELLER, RRID:SCR_008395)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We evaluated each model with FoldX and pyDock (Cheng et al., 2007) which have achieved good performance predicting the impact of mutations in protein-protein complexes (Amengual-Rigo et al., 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FoldX</div><div>suggested: (FoldX, RRID:SCR_008522)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.03.454861
  147. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.02.454546
    1
    1. sciscore 05 Aug 2021

      SciScore for 10.1101/2021.08.02.454546: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The conformational effects of 50 µg/ml CV3-1 and CV3-25 antibodies on SARS-CoV-2 spike were tested by pre-incubating fluorescently labeled viruses for 60 mins at 37°C before imaging in the continued presence of the antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CV3-25</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">At 48h post transfection, 293T cells were stained with anti-Spike monoclonal antibodies CV3-25, CV3-1 (5 µg/mL) or using the ACE2-Fc chimeric protein (20 µg/mL) for 45 min at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">; mouse anti-S1 antibody (Sino Biological) and rabbit anti-S2 antibody (Sino Biological) were used as controls.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-S2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Western blots were developed with horseradish peroxidase (HRP)-conjugated secondary antibodies (anti-human IgG, anti-mouse IgG or anti-rabbit IgG, correspondingly).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To evaluate antibody recognition of S glycoproteins lacking N-linked glycans, 293T-S cells expressing the wild-type SARS-CoV-2 S glycoprotein were lysed with lysis buffer, as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 S glycoprotein</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T-ACE2 cells stably expressing human ACE2 are derived from 293T cells and were maintained in medium supplemented with 2 µg/mL of puromycin (Millipore Sigma</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the 4 x 105 Vero-E6 cells were seeded on 12-well plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudoviruses decorated with SARS-CoV-2 Spike were prepared by transfecting HEK293T cells (70% confluent 10 cm dishes) with a plasmid mixture of 5 µg of psPAX2 (Gag-pol, Rev, and Tat expression vector; does not express Vpr), 5 µg of pCMV-d19 Spike (last 19 residues at C-terminal were deleted) from the B.1.1.7 variant or WH01 G614, and 2 µg of a pCAGGS-Cyclophilin A-HiBiT construct using polyetherimide (PEI).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T-ACE2 target cells were transfected in a 24 well plate using PEI with 500ng/well of pMX Puro PH-LgBiT (LgBiT-tagged to pleckstrin homology domain of human phospholipase C the N terminus).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T-S cells were seeded in 6-well plates at a density of 1×106 cells per well on day 0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-S</div><div>suggested: RRID:CVCL_LC70)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alternatively, for peptide epitope competition assay, CV3-25 (5µg/mL) was pre-incubated in presence of increasing concentrations of peptide #288 (1149-KEELDKYFKNHTSPD-1163), peptide #289 (1153-DKYFKNHTSPDVDLG-1167), a shorter version of peptide #289 (1153-DKYFKNHTSPD-1163) or a scramble version of the peptide #289 (DHDTKFLNYDPVGKS), which were synthesized by Genscript.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>1153-DKYFKNHTSPD-1163</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plasmids encoding the Spike from the B.1.617.1 (E154K, L452R, E484Q, D614G, P681R) and the B.1.617.2 (T19R, Δ156-158, L452R, T478K, D614G, P681R, D950N) lineages were generated by overlapping PCR using a codon-optimized wild-type SARS-CoV-2 Spike gene that was synthesized (Biobasic, Markham, ON, Canada) and cloned in pCAGGS as a template.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_18926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudoviruses decorated with SARS-CoV-2 Spike were prepared by transfecting HEK293T cells (70% confluent 10 cm dishes) with a plasmid mixture of 5 µg of psPAX2 (Gag-pol, Rev, and Tat expression vector; does not express Vpr), 5 µg of pCMV-d19 Spike (last 19 residues at C-terminal were deleted) from the B.1.1.7 variant or WH01 G614, and 2 µg of a pCAGGS-Cyclophilin A-HiBiT construct using polyetherimide (PEI).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>psPAX2</div><div>suggested: RRID:Addgene_12260)</div></div><div style="margin-bottom:8px"><div>pCMV-d19</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCAGGS-Cyclophilin A-HiBiT</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T-ACE2 target cells were transfected in a 24 well plate using PEI with 500ng/well of pMX Puro PH-LgBiT (LgBiT-tagged to pleckstrin homology domain of human phospholipase C the N terminus).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMX</div><div>suggested: RRID:Addgene_111810)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Two short peptides labeling tags (Q3: GQQQLG; A4: DSLDMLEM) were introduced into designed positions in the S1 subunit on the plasmid encoding SB.1.1.7, pCMV-SB.1.1.7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV-SB.1.1.7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids pCMV-SB.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV-SB</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, dual-tagged pCMV-SB.1.1.7 Q3-1 A4-1, and pCMV delta R8.2 were transfected into 293T cells at a ratio of 20:1:21.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV-SB.1.1.7 Q3-1 A4-1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCMV</div><div>suggested: RRID:Addgene_20783)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow Cytometry Analysis of Cell-Surface Staining: Using the standard calcium phosphate method, 10 μg of Spike expressor and 2 μg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pIRES2-eGFP</div><div>suggested: RRID:Addgene_14998)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells were transfected by the calcium phosphate method with the lentiviral vector pNL4.3 R-E-Luc (NIH AIDS Reagent Program) and a plasmid encoding for SARS-CoV-2 Spike at a ratio of 5:4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNL4.3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tomographic tilt series between −60° and +60° were collected by using SerialEM (Mastronarde, 2005)(Mastronarde, 2005) in a dose-symmetric scheme (Hagen et al., 2017; Mastronarde and Held, 2017)(Hagen et al., 2017) with increments of 3°.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SerialEM</div><div>suggested: (SerialEM, RRID:SCR_017293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tomograms were reconstructed by weighted back projection and tomographic slices were visualized with IMOD.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IMOD</div><div>suggested: (IMOD, RRID:SCR_003297)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All the density maps were segmented in the UCSF Chimera (Pettersen et al., 2004), and ChimeraX (Goddard et al., 2018; Pettersen et al., 2021) was used for surface rendering and visualization of cryo-ET maps and models. “Fit in map” tool in Chimera and ChimeraX was used for rigid fitting.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ChimeraX</div><div>suggested: (UCSF ChimeraX, RRID:SCR_015872)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">smFRET data analysis was performed using MATLAB (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MATLAB</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MathWorks)-based customized SPARTAN software package (Juette et al., 2016).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPARTAN</div><div>suggested: (SPARTAN, RRID:SCR_014901)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, Model building and Analysis: Motion correction, CTF estimation, particle picking, curation and extraction, 2D classification, ab initio model reconstruction, volume refinements and local resolution estimation were carried out in cryoSPARC (Punjani et al., 2017; Rubinstein and Brubaker, 2015).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Geometry validation and structure quality evaluation were performed by EM-Ringer (Barad et al., 2015) and Molprobity (Chen et al., 2010).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Molprobity</div><div>suggested: (MolProbity, RRID:SCR_014226)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Model-to-map fitting cross correlation and figures generation were carried out in USCF Chimera, Chimera X (Goddard et al., 2018; Pettersen et al., 2004; Pettersen et al., 2021) and PyMOL (The PyMOL Molecular Graphics System, Version 2.0 Schrödinger, LLC.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Iterative cycles of model building and refinement were done in Coot(Emsley and Cowtan, 2004) and Phenix.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phenix</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were acquired on a LSRII cytometer (BD Biosciences) and data analysis was performed using FlowJo v10.5.3 (Tree Star).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Hill coefficient analyses were done using GraphPad Prism version 9.1.0 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantification and Statistical Analysis: Data were analyzed and plotted using GraphPad Prism software (La Jolla, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">P values were indicated as *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001. Schematics: Schematics for showing experimental design in figures were created with BioRender.com.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioRender</div><div>suggested: (Biorender, RRID:SCR_018361)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 56 and 52. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.02.454546
  148. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.30.21261274
    1
    1. sciscore 05 Aug 2021

      SciScore for 10.1101/2021.07.30.21261274: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Human Subjects: The study was conducted under a public health surveillance program reviewed by UCSF Committee on Human Research.<br>Consent: Survey participants provided consent in their preferred language.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our study was subject to limitations. First, the survey was intentionally conducted among parents the vast majority of whom had themselves received a vaccine. Findings reported should thus not be extrapolated to the general population, but rather illustrate the potential to leverage community-based sites to effectively reach children in highly impacted areas for vaccination. Second, both scientific context and community attitudes can evolve rapidly. Rather than providing a single answer expected to remain static over time and place, the current study illustrates the potential to leverage community vaccination sites to rapidly generate actionable and locally and culturally relevant context-specific knowledge. Finally, we did not include surveys of the youth themselves, who have an important perspective that may influence vaccine uptake.19 In conclusion, Latinx parents disproportionately affected by COVID-19 and utilizing a neighborhood testing/vaccination site were highly motivated to vaccinate their children to protect their health and that of the community.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.30.21261274
  149. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.02.454730
    1
    1. sciscore 05 Aug 2021

      SciScore for 10.1101/2021.08.02.454730: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our model has limitations and should only be seen as a modest step of putting key elements of the innate immune system into a dynamic framework. In particular, we omit the anti-inflammatory cytokines secreted by the macrophages that reduce recruitment of macrophages in a previous model of innate immunity [55]. Extension of these next-level cells may reduce and extend the macrophage dynamics to the longer timescales where adaptive immunity also comes into play. The model could be extended further into the disease progression with more components in the immune systems including the role of CD8 T cells. A previous study about the motif comprised of the interactions between antigen and CD8 T cells also suggested that bistability would result from the interplay between antigen and the immune system [56]. It is also interesting to compare our model to the quite different and elaborate model of ref. [57] that follows a population of human cells by assuming that IFN-1 converts infected cells to resistant cells. In that model, the NK cells are the main cause of direct virus elimination, and the macrophages primarily act by inducing IFN-1 that in turn reduce virus proliferation. Despite the substantial differences, the model in ref. [57] contains the central motif of Fig. 2B, leading to similar predictions of increased macrophages activity associated with reduction of IFN-1 signaling. The heterogeneity of the viral kinetics has been discussed in other relevant models in contexts that i...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.02.454730
  150. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.30.21261234
    1
    1. sciscore 05 Aug 2021

      SciScore for 10.1101/2021.07.30.21261234: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The protocol was approved CALHN Human Research Ethics Committee, Adelaide,<br>Consent: Inclusion criteria were PCR-confirmed SARS-CoV-2 infection from nasopharyngeal swabs, the ability to attend study follow up visits, and voluntary informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">A total of 69 COVID-19 convalescent individuals (35 male, 36 female) representing a range of prior mild, moderate, severe, critical COVID-19 cases were recruited (Table S1).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies were diluted in 5% skim milk in PBST as follows: Goat anti-Human IgG (H+L) Secondary Antibody, HRP (1:30,000;</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sigma): anti-human IgA HRP antibody (1:5,000; Sigma) and incubated for 1 hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pearson correlation analysis was performed using the Hmisc v4.4-2 package in R to determine correlations between anti-Spike and anti-RBD antibody titres, flow cytometry data and BTM activity scores.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Spike</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 protein purification and ELISA: Prefusion SARS-CoV-2 ectodomain (isolate WHU1, residues1-1208) with HexaPro mutations (76) (kindly provided by Adam Wheatley) and SARS-Cov-2 receptor-binding domain (RBD) with C-terminal His-tag (77) (residues 319-541; kindly provided by Florian Krammer) were overexpressed in Expi293 cells and purified by Ni-NTA affinity and size- exclusion chromatography.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">AUC calculation was performed using Prism GraphPad, where the X-axis is half log10 of sera dilution against OD450 on Y-axis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Compensation was set with beads matched to each panel antibody combination using spectral compensation using FlowJo Software V10.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RNA-Seq analysis: Sequence read quality was assessed using FastQC version 0.11.4 (78) and summarised with MultiQC version 1.8 (79) prior to quality control with Trimmomatic version 0.38 (80) with a window size of 4 nucleotides and an average quality score of 25.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FastQC</div><div>suggested: (FastQC, RRID:SCR_014583)</div></div><div style="margin-bottom:8px"><div>MultiQC</div><div>suggested: (MultiQC, RRID:SCR_014982)</div></div><div style="margin-bottom:8px"><div>Trimmomatic</div><div>suggested: (Trimmomatic, RRID:SCR_011848)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reads that passed all quality control steps were then aligned to the mouse genome (GRCh38 assembly) using HISAT2 version 2.1.0 (81).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HISAT2</div><div>suggested: (HISAT2, RRID:SCR_015530)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The gene count matrix was generated with FeatureCounts version 1.5.0-p2 (82) using the union model with Ensembl version 101 annotation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FeatureCounts</div><div>suggested: (featureCounts, RRID:SCR_012919)</div></div><div style="margin-bottom:8px"><div>Ensembl</div><div>suggested: (Ensembl, RRID:SCR_002344)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The count matrix was then imported into R version 4.0.3 for further analysis and visualisation in ggplot2 v2.3.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To assess if differential gene expression was primarily driven by differences in the proportion of any major immune cell population (i.e. LD granulocytes, LD neutrophils, CXCR3+ neutrophils, monocytes, lymphocytes, CD56++ NK cells, CD19+ B cells, CD3+ T cells, NKT cells, CD4+ T cells or CD8+ T cells), we additionally fit the frequency of each population in each individual into the EdgeR model and reperformed the differential gene expression and pathway overrepresentation analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EdgeR</div><div>suggested: (edgeR, RRID:SCR_012802)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene Set Variation Analysis (GSVA) (44) was used to calculate a per sample activity score for each of the modules (excluding unannotated modules labelled as ‘TBA’). limma v3.46.0 was used to identify modules that were differentially active in at least one timepoint.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>limma</div><div>suggested: (LIMMA, RRID:SCR_010943)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Correlation networks were exported to Cytoscape v3.8.1 for visualisation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cytoscape</div><div>suggested: (Cytoscape, RRID:SCR_003032)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.30.21261234
  151. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.03.454910
    1
    1. sciscore 05 Aug 2021

      SciScore for 10.1101/2021.08.03.454910: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: All animal protocols were approved by the Institutional Animal Care and Utilization Committee of Academia Sinica and were conducted in strict accordance with the guidelines on animal use and care of the Taiwan National Research Council’s Guide.<br>IACUC: All animal protocols were approved by the Institutional Animal Care and Utilization Committee of Academia Sinica and were conducted in strict accordance with the guidelines on animal use and care of the Taiwan National Research Council’s Guide.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Eight-week-old female C57BL/6 mice (Charles River strain) were purchased from BioLASCO Taiwan Co. Ltd.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, the cells were washed with PBS and stained for the secondary antibody FITC- conjugated goat anti-Rabbit IgG Ab (F1262, 1:500 dilution) for 1 h at room temperature, followed by staining with DAPI (5 μg/ml, D21490, Molecular Probes) for 5 min and mounting with Vectashield mounting solution (H-1000, Vector Laboratories).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Rabbit IgG</div><div>suggested: (Sigma-Aldrich Cat# F1262, RRID:AB_259430)</div></div><div style="margin-bottom:8px"><div>F1262</div><div>suggested: (Sigma-Aldrich Cat# F1262, RRID:AB_259430)</div></div><div style="margin-bottom:8px"><div>Vectashield mounting solution (H-1000</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These blots were then washed three times with PBST, incubated at r.t. with HRP goat anti-mouse (31430, 1:20,000) or HRP goat anti-hamster (PA1-28823, 1:5,000) antibodies for 1 h at r.t. and then developed using a Western Lightning Enhanced Chemiluminescence kit (PerkinElmer) according to the manufacturer’s protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse (31430</div><div>suggested: (Thermo Fisher Scientific Cat# 31430, RRID:AB_228307)</div></div><div style="margin-bottom:8px"><div>anti-hamster (PA1-28823</div><div>suggested: (Thermo Fisher Scientific Cat# PA1-28823, RRID:AB_10986856)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were incubated with SARS-CoV-2 anti- RBD antibody (40592-T62, 1:500) at 4°C for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti- RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To detect anti-spike antibody in the sera of immunized mice and hamsters, SF9 insect cells were infected with either wild type baculovirus (WT-BAC) or a recombinant baculovirus (S-BAC) that expressed a chimeric SARS-CoV-2 S-gp64 protein in which the transmembrane and C-terminal regions of S protein were replaced by the transmembrane and C-terminal regions of baculovirus GP64 so that the S-gp64 fusion protein would be expressed on insect cell surfaces.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 neutralization assay: Serially diluted antibodies from immunized mice or hamsters were incubated at 37 °C for 1 h with 100 TCID50 SARS-CoV-2 TCDC#4 (hCoV-19/Taiwan/4/2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>hCoV-19/Taiwan/4/2020</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunoglobulin ELISA for SARS-CoV-2 S-specific antibodies: Immunoglobulin ELISA was performed as described previously (17) with some modifications.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S-specific</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Coated plates were incubated for 1 h at r.t. with sera that had been serially diluted in PBS containing 1% BSA, then washed with PBST, and incubated with HRP-conjugated IgG2C (PA1-29288, 1:15000) or HRP-conjugated IgG1 (PA1-74421, 1:6000) secondary antibodies at r.t. for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HRP-conjugated IgG2C</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HRP-conjugated IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>PA1-74421</div><div>suggested: (Thermo Fisher Scientific Cat# PA1-74421, RRID:AB_10988195)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were subsequently washed twice with FACS buffer, and then incubated with an antibody cocktail including anti-CD3-PE/Cyanine7, anti-CD4-FITC, anti-CD8-Pacific blue, anti-CD44- PE and anti-CD62L-APC for 15 min on ice.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD3-PE/Cyanine7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD4-FITC</div><div>suggested: (Sigma-Aldrich Cat# F1773, RRID:AB_476965)</div></div><div style="margin-bottom:8px"><div>anti-CD8-Pacific blue , anti-CD44- PE</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD62L-APC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunohistochemical staining was performed with a monoclonal rabbit anti-SARS-CoV/SARS-CoV-2 nucleocapsid (NP) antibody (1:1000, 40143-R001, Sino Biological), followed by incubation with Dako EnVision+ System HRP.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV/SARS-CoV-2 nucleocapsid (NP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HuTK-143 cells were cultured in MEM medium supplemented with 10% FBS and 1% PS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HuTK-143</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 TCDC#4 (hCoV-19/Taiwan/4/2020) is a local isolate and it was propagated on Vero-E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunofluorescence staining of cell surface S protein: BHK21 and BSC40 cells were infected respectively with MVA-S or v-NY-S at a multiplicity of infection (MOI) of 5 PFU/cell for 1 h, washed with PBS, and then incubated in growth media for a further 12 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BSC40</div><div>suggested: ATCC Cat# CRL-2761, RRID:CVCL_3656)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To test reactivity of immunized mouse and hamster sera to SARS-CoV-2 spike protein, the extracellular domain of spike protein from residue 14 to 1209, consisting of S1 and S2 but without the transmembrane domain, was expressed in HEK 293 cells and subsequently purified.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry analysis of cell-surface SARS-CoV-2 S protein expression: To detect spike protein expression on the surface of cells infected with MVA-S or v-NY-S, BSC40 and BHK21 cells (5×105) were infected with v-NY-S and MVA-S, respectively, at an MOI of 5 PFU/cell and incubated for 12 h, before being detached via treatment with 2 mM EDTA in PBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK21</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mixture was then added to HEK-293T cells expressing human ACE2 receptor (104 cells/well of a 96-well plate) and incubated for 24 h at 37 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mixtures were then added to pre-seeded Vero E6 cells for a 4-day incubation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Prime-boost immunization regimens in mice: Eight-week-old female C57BL/6 mice were housed in the Animal Facility of Academia Sinica (Taipei, Taiwan) for at least 3 days prior to vaccination experiments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Construction of recombinant vaccinia viruses: To generate recombinant vaccinia viruses expressing SARS-CoV-2 S protein (Isolate Wuhan-Hu-1, NC_045512), a human codon-optimized open reading frame (ORF) encoding full-length SARS-CoV-2 S protein was inserted into a pSC11 plasmid and under regulatory control by an early and late p7.5k promoter to obtain pSC11-S plasmid (117).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSC11</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The pSC11-S plasmid was transfected into HuTK-143 cells infected with the wild type v-NY virus strain.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSC11-S</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Eight-week-old female C57BL/6 mice (Charles River strain) were purchased from BioLASCO Taiwan Co. Ltd.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioLASCO</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were acquired using a BD LSR II (BD Biosciences) flow cytometer and data analyses were performed with FlowJo 8.7 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The oligonucleotides were synthesized by Genomics BioSci</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Genomics</div><div>suggested: (UTHSCSA Genomics Core, RRID:SCR_012239)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses: Statistical analyses were conducted using Student’s t test in Prism (version 9) software (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      On the other hand, several limitations of the hamster model exist. SARS-CoV-2 infection in humans affects multiple organ systems including the heart, kidneys, liver, spleen and large intestine (83, 84) whereas in hamsters live virus mainly replicates in respiratory tracts with little evidence of infectious virus in other organs, despite the detection of viral RNA in non-respiratory tissues (55, 85). Furthermore, a lack of hamster-specific biological reagents makes it difficult to characterize immune responses and the mechanisms of pathogenesis in hamsters. A successful vaccine against SARS-CoV-2 should stimulate both humoral and cellular immune responses to inhibit virus replication and prevent disease in the host (86). In both mouse and hamster model our prime-boost immunization with MVA-S and v-NY-S generated high titers of neutralizing antibodies. Evidence from preclinical studies in nonhuman primates and hamsters indicted that vaccine-induced SARS-CoV-2 neutralizing antibodies correlate with protection against lung infection and clinical disease (19, 55, 87). While it is difficult to study T-cell immune response in hamsters, our immunization regiments induced TH1-biased immune response and effector memory CD8+T cells in mice, consistent with other studies using MVA-based SARS-CoV-2 vaccines (41–43, 88). Interestingly, Tan, et al (2021) reported that early induction of interferon-γ secreting SARS-CoV-2 specific T cells correlates with mild disease and rapid virus clearance...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.03.454910
  152. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.01.454696
    1
    1. sciscore 05 Aug 2021

      SciScore for 10.1101/2021.08.01.454696: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Integrative Homology Modelling: Modeller version 9.21 (Sali and Blundell, 1993) was used to build two full length models of SARS-CoV-2 S protein: i) open state with one RBD in the up conformation and two RBDs in the down conformation; and ii) closed state with all three RBDs in the down conformation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Modeller</div><div>suggested: (MODELLER, RRID:SCR_008395)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.01.454696
  153. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.01.454662
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.08.01.454662: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">WT C57BL/6J, IL-6 KO and huACE-2 mice (Mccray et al., 2007) were purchased from Jax® and bred in house.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HuLang-DTA and Batf3-/- mice were bred to huACE-2 mice in house.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Batf3-/-</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The stained samples were run on LSRFortessa™ (BD Biosciences) and the resulting data analyzed with FlowJo 10.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses: All data were analyzed with GraphPad Prism version 9.0.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.01.454662
  154. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.02.454771
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.08.02.454771: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.02.454771
  155. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.01.454605
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.08.01.454605: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Purified human integrin α5β1 and anti-α5 (MAB1956Z) and anti-α5β1 (MAB1999) antibodies were from Merck (Kenilworth, NJ, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-α5β1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HUVEC monolayers were treated for 16 hours with TNFα, spike, the spike receptor-binding domain, and the RGD tripeptide alone or in combination with anti-α5β1 antibodies (5 μg mL−1), anti-α5 antibodies (5 μg mL−1), volociximab (5 μg mL−1), or ATN-161 (500 nM) in 20% FBS F12K without heparin or ECGS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-α5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Microplates were then incubated for 1 hour at RT, washed three times with PBST, incubated for 1 hour at RT with 1:1,000 of anti-spike antibody (Rabbit MAb, Sino Biological, Beijing, CN) diluted in blocking buffer, washed (three times in PBST), and incubated (1 hour at RT) with horseradish peroxidase-labeled goat anti-rabbit secondary antibodies (Thermo Fisher Scientific) diluted 1:2,500 in 50% blocking buffer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-spike</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The NF-κB activation inhibitor, BAY 11-7085 (5 μM), or anti-α5 antibodies (5 μg mL−1) were added 30 minutes prior to a 30-minutes incubation with spike (100 nM) or TNFα (1 nM).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TNFα</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed, fixed in 4% PFA for 30 minutes at RT, permeabilized for 30 minutes with 0.5% Tx-100-PBS, blocked with 0.05% Tx-100, 1% BSA, 5% normal goat serum-PBS at RT for 1 hour, and incubated overnight at 4°C in a humid chamber with 1:200 mouse monoclonal anti-NF-κB p65 antibody (Santa Cruz, CA, USA) in 0.1% Tx-100, 1% BSA-PBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-NF-κB p65</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nuclear DNA was counterstained with 5 μg mL−1 Hoechst 33342 (Sigma-Aldrich) and the coverslips washed and mounted with Vectashield mounting medium (Vector laboratories, Burlingame, CA) and observed under fluorescence microscopy (Olympus IX51). qPCR: HUVEC grown to 80% confluency on 6-well plates were incubated under starving conditions (0.5% FBS, F12K medium) for 30 minutes with the NF-κB activation inhibitor, BAY 11-7085 (5 μM) or anti-α5 antibodies (5 μg mL−1) followed by a 4-hour incubation with 100 nM spike.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vectashield mounting medium</div><div>suggested: (Vector Laboratories Cat# H-1000, RRID:AB_2336789)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed, fixed with 4% PFA for 30 minutes, permeabilized with 0.5% Tx-100-PBS for 30 minutes, blocked with 0.1% Tx-100, 1% BSA, 5% normal goat serum-PBS for 1 hour at RT, and incubated overnight at 4°C in a humid chamber with 1: 100 anti-CD31 antibody (Abcam) in 0.1% Tx-100, 1% BSA-PBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD31</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed and incubated in darkness with goat anti-mouse secondary antibodies (1:500, Alexa fluor 488, Abcam, Cambridge, UK) in 0.1% Tx-100, 1% BSA-PBS for 2 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Abcam Cat# ab19639, RRID:AB_2040847)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Both, Rhotekin and PAK1 binding domains are coupled to agarose beads, and the isolation and detection of the active forms of RhoA, Rac1, and Cdc42 were done under conventional bead-precipitation and western blot protocols using goat anti-mouse alkaline phosphatase secondary antibodies (Jackson ImmunoResearch, Philadelphia, PA, USA, 1:5000) and a colorimetric detection kit (BioRad, Hercules, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PAK1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Rac1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Cdc42</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Forty-five μg of protein were resolved in SDS-PAGE and blotted with anti-phospho-eNOS (Ser1177) antibodies (Cell Signaling, Danvers, MA, USA, 1:250), followed by incubation with goat anti-rabbit horseradish peroxidase secondary antibodies (Jackson ImmunoResearch, 1:5000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-phospho-eNOS</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Ser1177) antibodies (Cell Signaling, Danvers, MA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Membranes were reblotted using antibodies against total eNOS (Cell Signaling, 1:500), goat anti-rabbit alkaline phosphatase secondary antibodies (Jackson ImmunoResearch, 1:5000), and a colorimetric detection kit (BioRad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibodies against total eNOS (Cell Signaling, 1:500)</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fluorescence cytochemistry for CD31 and F-Actin: HUVEC were seeded on 18 mm coverslips coated with fibronectin (1 μg cm−1) and placed in a 12-well plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HUVEC</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HUVEC monolayers were washed three times with warm PBS, and images were obtained in an inverted fluorescent microscope (Olympus IX51, Japan) and quantified using the CellProfiler software47.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CellProfiler</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 17. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.01.454605
  156. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.08.02.454701
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.08.02.454701: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Embedding amino acid sequences using ProtVec: ProtVec regards amino acid 3-mers as ‘biological words’ and effectively embeds each of such words (over 9,048 words in total) into a 100-dimensional vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ProtVec</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Training binary classification models: In training the models, we utilized the SVM implementation from scikit learn library (version 0.22.2.post1) and XGB-Classifier from the XGBoost Python package (version 0.90).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We evaluated both models using 5-fold cross validation (StratifiedKFold implementation from scikit-learn) and ROC/AUC computation (scikit-learn).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>scikit-learn</div><div>suggested: (scikit-learn, RRID:SCR_002577)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.08.02.454701
  157. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.07.31.454592
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.31.454592: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A monoclonal antibody against the N protein was diluted in the incubation buffer (1:2000, v/v; Genetex HL344) and incubated with the cells for 1 h; after this time, cells were washed with PBS and subsequently incubated with a 1:500 (v/v) dilution of a goat anti-rabbit conjugated to Alexa 488 (Invitrogen-Carlsbad, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: Vero E6 (ATCC) and Calu3 (ATCC) cell lines were kindly provided by Dr. Enjuanes (CNB-CSIC)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu3</div><div>suggested: BCRJ Cat# 0264, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549 and Huh7 cells were transduced with a retroviral vector enabling expression of ACE2 in a di-cistronic expression cassette also conferring resistance to blasticidine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The hCoV-229E-GFP51 was kindly provided by Dr. Thiel (University of Basel) and propagated in Huh7 cells at 33°C in a controlled 5% CO2 environment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cypopathic effect protection assays in Vero E6 and Huh7-ACE2 cells: Vero E6 or Huh7-ACE2 cell monolayers were inoculated (MOI = 0.001) in the presence of a wide range of two-fold dilutions of the crude, or partially purified extracts, or pure compounds and incubated for 72 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Huh7-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Assessment of viral entry using retroviral pseudotypes: Retroviral particles pseudotyped with SARS-2-CoV spike envelope protein (Spp) were produced in HEK293T cells as previously described54 with materials kindly provided by Dr. F. L. Cosset (INSERM, Lyon) and J. M. Casasnovas and J. G. Arriaza (CNB-CSIC) for the S protein cDNA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VSV-GFP30 was kindly provided by Dr. Rodriguez (CNB-CSIC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VSV-GFP30</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statitistical Analysis: Descriptive statistics were calculated using Microsoft Excel.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">One-way ANOVA and post-hoc tests were calculated using IBM SPSS Software Package (version 26).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.07.31.454592
  158. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.30.21261392
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.30.21261392: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mechanistic model: We developed a stochastic discrete time SEIR metapopulation model for the 22 regions in Madagascar.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Madagascar</div><div>suggested: (Madagascar, RRID:SCR_003274)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      There are a number of caveats associated with this work. In particular, by focussing simply on region population size and connectivity patterns, the model simplifies a number of aspects that may be important to the pace of spread of SARS-CoV-2, such as within region dynamics (i.e., some regions may be more internally connected than others (Rice et al., 2021)), as well as interventions including travel bans and how these changed connectivity over the first months of spread. However, the better performance of the mobile phone model compared to the gravity-based model in both the mechanistic and statistical model suggests that the connectivity matrix used to link the regions is the core of the problem. Our analysis provides a first step for moving towards models that can capture the spread of an emergent pathogen. It also highlights the centrality of data availability and strengthening collaboration among different institutions with access to critical data - models are only as good as the data that they use - so building towards effective data-sharing pipelines is essential.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.30.21261392
  159. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.29.21261348
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.29.21261348: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">AURUM and GOLD are established primary care databases broadly representative of the UK population,13, 14 and previous research has demonstrated their validity for vaccine safety surveillance.15, 16 Both databases were mapped to the Observational Medical Outcomes Partnership (OMOP) Common Data Model (CDM) for analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GOLD</div><div>suggested: (GOLD, RRID:SCR_000188)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Study strengths and limitations: Our study has limitations. The time period studied covered the initial phases of vaccination in the UK, when vaccines were prioritized for older, more vulnerable populations and healthcare staff.24 We therefore saw a higher prevalence of conditions such as asthma and diabetes in those vaccinated than in the general population. Although we used indirect standardization to account for differences in the four cohorts’ age distributions, remaining residual confounding could explain some of our findings. Such bias could result in overestimated safety signals due to remaining imbalances in the baseline outcome risk when comparing vaccinated and background populations. Measurement error is unavoidable in observational studies. However, any errors are likely to have been non-differential across our vaccinated and unvaccinated cohorts and should therefore not have affected our relative rate estimates. As we only used primary care data, we may have underestimated absolute risks due to a lack of hospital linkage. However, previous studies have shown that CPRD captures rare events well, even without linkage to Hospital Episode Statistics.25 Although within-database comparisons are preferred,16 we had to use two slightly different primary care databases. However, one study found that these databases gave similar results.26 We also used the OMOP common data model to maximize the comparability of the two databases irrespective of differences in their coding ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.29.21261348
  160. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.31.21261425
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.31.21261425: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Another limitation of our study is that the only information we used to resolve uncertainty about true infection status was whether individuals were tested for surveillance purposes. Given that prevalence differed by an order of magnitude between these groups, this was quite beneficial. However, additional information—such as recent contacts or status as student, faculty or staff—could have potentially helped narrow this type of uncertainty further. Doing so would have required estimating more parameters and could have made the analysis more susceptible to bias if an increasingly complex model were not specified properly. In addition to limitations of our analysis, there were also limitations of our data set. First, a more balanced testing effort across different test types and groups of subjects could have helped reduce uncertainty about certain parameters, especially those relating to antigen tests. Second, for individuals who truly were positive, we have no information about how many days elapsed between their initial exposure and when they were tested. Given how variable test sensitivity is over the course of an infection (11, 17), this factor alone could be a major driver of the sensitivities we estimated. For example, individuals tested for surveillance screening had presumably not displayed any symptoms up to the time of testing, making it possible that many of our positive surveillance tests came from presymptomatic individuals with high viral loads (36). Even so, the...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 20. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.31.21261425
  161. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.07.30.454520
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.30.454520: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All animal studies were performed in accordance with the National Institute of Health guidelines and using protocols approved by the University Committee on Animal Resources.<br>Euthanasia Agents: Tissue Preparation for fluorescence imaging: After the duration of the experiment, mice were transcardially perfused using cold phosphate buffered saline (PBS) and paraformaldehyde (PFA) (4% in PBS, pH: 7.3).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mice: C57BL/6J (2-3 months old; Jackson Laboratory; Bar Harbor, ME, USA), male mice were used.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">A training image was created from the (ROIs) to train a three-way random trees pixel classifier to account for variation, and distinguish between positive fluorescence and negative background.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">The experimenter was blinded to the experiment design, and unaware of the tracers, T1 and T2 used in these studies.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-SARS-CoV-2 spike protein antibody (SARS-CoV-2 Spike Protein Monoclonal Antibody (cat# MA5-36087; immunogen SARS-CoV-2 spike protein that interact with HeLa cell expressed SARS-CoV-2) and anti ACE2 antibody (ACE2 Recombinant Rabbit Monoclonal Antibody (Cat# MA532307; interact with mouse ACE2) were obtained from Life Technologies Corporation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 spike protein</div><div>suggested: (Thermo Fisher Scientific Cat# MA5-36087, RRID:AB_2866698)</div></div><div style="margin-bottom:8px"><div>anti ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The groups of mice were as follows: young male mice (2-3 months old), T1 (anti-ACE2 antibody; young male mice (2-3 months old)) and T2 (anti-spike protein antibody; young male mice (2-3 months old)).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>T1</div><div>suggested: (US Biological Cat# C2256-23M, RRID:AB_2291331)</div></div><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: (Biotrend Cat# ACE23-M, RRID:AB_2223312)</div></div><div style="margin-bottom:8px"><div>T2 ( anti-spike protein</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Materials: SARS-CoV-2 Spike proteins (recombinant SARS-CoV-2 Spike Protein (S-RBD; cat# RP-87678, HEK293 cell expressed and binds ACE2) and ovalbumin Alexa Fluor-488 conjugate (Cat# 034781; molecular weight 45 kDa) were obtained from Life Technologies Corporation, Carlsbad CA, USA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-SARS-CoV-2 spike protein antibody (SARS-CoV-2 Spike Protein Monoclonal Antibody (cat# MA5-36087; immunogen SARS-CoV-2 spike protein that interact with HeLa cell expressed SARS-CoV-2) and anti ACE2 antibody (ACE2 Recombinant Rabbit Monoclonal Antibody (Cat# MA532307; interact with mouse ACE2) were obtained from Life Technologies Corporation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice: C57BL/6J (2-3 months old; Jackson Laboratory; Bar Harbor, ME, USA), male mice were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SP was labeled separately with Alexa Fluor 555 using a kit (Microscale protein labeling kit; ThermoFisher Scientific; Waltham, MA, USA) and by following the manufacturer instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher Scientific</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Imaging settings and recordings were accomplished through a custom-built LabVIEW program (National Instruments, Austin, TX, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>LabVIEW</div><div>suggested: (LabView , RRID:SCR_014325)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Using ImageJ software (National Institutes of Health, Bethesda, MD, USA), regions of interest (ROIs) were identified, and the ROI fluorescence intensity recorded at the same settings, as reported [39].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Peak intensity (Imax) was identified as the average of 10 seconds at the peak identified using GraphPad Prism software (Version 9.1.0 (216)).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations of the present study: We used the RBD of the SP as a surrogate of the virus (SARS-CoV-2) to study its biodistribution and elimination, since RBD plays a major role for viral entry into host cells. However, the distribution pattern might be different for the actual virus, and the molecular weight of SP would influence filtration at the kidneys and convective flow in peripheral organs, such as muscles. Thus, a lower molecular weight RBD (< albumin) likely represent a maximum biodistribution. The biodistribution of SP was not systematically evaluated in all organs/cells, such blood cells, pancreas and others. Therefore, it is possible that an organ not studied may also play a role in SP uptake. However, these other organs may not be as significant, since there was no significant SP- NIRF level in the rest of the mouse. Thus, we focused on organs with significant signal. The interaction of the whole virus with host cells may be different. Nevertheless, our studies and other that use the SP would provide critical data to better and safely model the virus behavior in a host before using the virus in studies. In the current study the efficacy of anti-SP and anti-ACE2 antibodies was assessed and thus, intravenous injection of SP was used. However, the main route of viral entry into the body in inhalation of droplets. In terrestrial animals, injection of fluid into the nose is not physiological. The SP would need to specially formulate into an aerosol for inhalation studie...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.07.30.454520
  162. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.29.21261325
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.29.21261325: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Evosep One system (Evosep, Odense, Denmark) was used to separate peptides on a Pepsep column, (150 µm internal diameter, 15 cm) packed with ReproSil C18 1.9 µm, 120A resin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ReproSil</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Files were debarcoded using the Matlab DebarcoderTool (58).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Matlab</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed using Maven (Princeton University, Princeton, NJ, USA) in conjunction with the KEGG database and an in-house standard library.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Biostatistics and bioinformatics analyses: Preprocessing, statistical analysis, and plot generation for all datasets was carried out using R (R 4.0.1 / Rstudio</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Biostatistics</div><div>suggested: (BWH Biostatistics Center, RRID:SCR_009680)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bioconductor v 3.11) (61-63), as detailed below.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bioconductor</div><div>suggested: (Bioconductor, RRID:SCR_006442)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reads were demultiplexed and converted to fastq format using bcl2fastq (bcl2fastq v2.20.0.422).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>bcl2fastq</div><div>suggested: (bcl2fastq , RRID:SCR_015058)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data quality was assessed using FASTQC (v0.11.5) (https://www.bioinformatics.babraham.ac.uk/projects/fastqc/) and FastQ Screen (v0.11.0, https://www.bioinformatics.babraham.ac.uk/projects/fastq_screen/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FASTQC</div><div>suggested: (FastQC, RRID:SCR_014583)</div></div><div style="margin-bottom:8px"><div>https://www.bioinformatics.babraham.ac.uk/projects/fastq_screen/</div><div>suggested: (FastQ Screen, RRID:SCR_000141)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Trimming and filtering of low-quality reads was performed using bbduk from BBTools (v37.99)(64) and fastq-mcf from ea-utils (v1.05, https://expressionanalysis.github.io/ea-utils/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ea-utils</div><div>suggested: (ea-utils, RRID:SCR_005553)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alignment to the human reference genome (GRCh38) was carried out using HISAT2 (v2.1.0)(65) in paired, spliced-alignment mode with a GRCh38 index with a Gencode v33 annotation GTF, and alignments were sorted and filtered for mapping quality (MAPQ > 10) using Samtools (v1.5)(66)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HISAT2</div><div>suggested: (HISAT2, RRID:SCR_015530)</div></div><div style="margin-bottom:8px"><div>Gencode</div><div>suggested: (GENCODE, RRID:SCR_014966)</div></div><div style="margin-bottom:8px"><div>Samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene-level count data were quantified using HTSeq-count (v0.6.1)(67) with the following options (--stranded=reverse –minaqual=10 –type=exon --mode=intersection-nonempty) using a Gencode v33 GTF annotation file.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HTSeq-count</div><div>suggested: (htseq-count, RRID:SCR_011867)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FCS() function from the flowCore package (v2.2.0) (71) and raw intensity values inverse hyperbolic sine transformed using the cytofAsinh() function with cofactor = 5 from the cytofkit package, and 1000 cells per FCS file sampled without replacement for downstream analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>flowCore</div><div>suggested: (flowCore, RRID:SCR_002205)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For visualization, dimensionality reduction was performed using the t-distributed stochastic neighbor embedding (t-SNE) method from the Rtsne package (v0.15) (72), using all markers.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Rtsne</div><div>suggested: (Rtsne, RRID:SCR_016342)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Unsupervised clustering, using all markers, was performed using the cytofkit implementation of the PhenoGraph algorithm (22)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PhenoGraph</div><div>suggested: (Phenograph, RRID:SCR_016919)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differential abundance analysis: For RNAseq, gene-level differential expression in COVID+ versus COVID- was evaluated using DESeq2 (version 1.28.1)(68) in R (version 4.0.1), with q < 0.1 (FDR < 10%) as the threshold for differentially expressed genes, and considering only genes with ≥ 0.5 counts- per-million in at least two samples.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Standardized fold-changes from each model were visualized by overlaying on t-SNE plots or as heatmaps using the ggplot2 (v3.3.1) (79) and ComplexHeatmap (v2.4.2) (78) packages.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div><div style="margin-bottom:8px"><div>ComplexHeatmap</div><div>suggested: (ComplexHeatmap, RRID:SCR_017270)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      One limitation of our study is that all measurements were performed from peripheral blood, which can only inform about a subset of the pathophysiological processes modulated by the various ligands. Our study would be highly complemented by studies of IFN ligands in various tissues (e.g. (53)). It is also possible that the specialized biosignatures observed are driven in part by SARS-CoV-2 itself. Like other members of the coronavirus family, SARS-CoV-2 has evolved diverse strategies to evade the antiviral effects of IFN signaling, and it is possible that these escape mechanisms do not affect all IFN ligands equally (54). Despite these limitations, key observations produced by our study include the differential relationship between IFN ligands and the antiviral transcriptional program in circulating immune cells, the specialized relationship between seroconversion, immune cell type abundance and IFN ligand levels, and the distinct metabolic signatures associated with the ligands. Throughout the study, the contrast between IFNA2 and IFNA6 exemplifies these points. Both IFNA2 and IFNA6 are specifically recognized by the reagents employed and significantly upregulated in the COVID19 positive cohort. However, whereas IFNA2 is strongly associated with the IFN transcriptional program in immune cells, IFNA6 is not. IFNA2 proteomic signatures are enriched for cytokines and chemokines previously linked to IFN signaling, whereas IFNA6 proteomic signatures, similarly to those of IFNB1, a...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.29.21261325
  163. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.07.30.454402
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.30.454402: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.07.30.454402
  164. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.07.30.454557
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.30.454557: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For each sequence, a pair-wise alignment with the reference (EPI_ISL_402124) was done using Biopython (Cock et al., 2009).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Biopython</div><div>suggested: (Biopython, RRID:SCR_007173)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Multiple sequence alignments, where required, were done using Clustal Omega (https://www.ebi.ac.uk/Tools/msa/clustalo/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Clustal Omega</div><div>suggested: (Clustal Omega, RRID:SCR_001591)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All sequence analysis and data handling, where specifically not mentioned, were performed in Python; and visualization/graphs were created in Microsoft Excel.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structural analyses: The positions of indels and N-glycosylation sites were visualized on the 3D-structure of SARS-CoV-2 spike glycoprotein (PDB ID: 6VXX or 6XR8) using the Visual Molecular Dynamics (VMD) program (https://www.ks.uiuc.edu/Research/vmd/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.ks.uiuc.edu/Research/vmd/</div><div>suggested: (Visual Molecular Dynamics, RRID:SCR_001820)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Finally, information on different functional domains of SARS-CoV-2 spike glycoprotein was obtained from the literature/UniProt (https://www.uniprot.org/) and residue overlap coefficient was enumerated (Table S2) (Vijaymeena and Kavitha, 2016).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.uniprot.org/</div><div>suggested: (Universal Protein Resource, RRID:SCR_002380)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.07.30.454557
  165. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.30.21261347
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.30.21261347: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Specific locations were used for sample collection that continued two times during the tenure from November 2020 to January 2021.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Result Validation: For RT-PCR result validation another RT-PCR kit was used randomly to verify the results of both positive and negative samples obtained by the regularly used kit (Supplementary Figure-2).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.30.21261347
  166. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.29.21261314
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.29.21261314: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">For qualitative evaluation of the visibility of the test bands (positive versus negative score), RGB pictures of AgPOCT results from randomly chosen replicates were evaluated independently by three individuals in a blinded manner.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">For qualitative evaluation of the visibility of the test bands (positive versus negative score), RGB pictures of AgPOCT results from randomly chosen replicates were evaluated independently by three individuals in a blinded manner.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Test results were quantified by measuring the background corrected signal intensities of the test (T) band versus control (C) band in ImageJ (v1.53c) using the “Gels” analysis function usually used for quantification of Western Blot bands.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.29.21261314
  167. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.29.21261006
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.29.21261006: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Ethical approval was waived and informed consent was not required.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This analysis has a number of limitations. 1) This study, which included only vaccinated persons, does not directly estimate vaccine effectiveness; that would require a comparison of the rate of infection between vaccinated and unvaccinated people. 2) The population of people infected with SARS-CoV-2 in this study may not be representative of the population of people infected with SARS-CoV-2 in Maryland during the same period. Only some laboratories either conduct sequencing or make specimens available to the Maryland Department of Health laboratory for sequencing; populations tested by other laboratories would not be represented in this analysis. Further, infections in vaccinated persons were preferentially selected for sequencing by Maryland’s public health lab. 3) This study examined two specific SARS-CoV-2 spike protein mutations. SARS-CoV-2 mutations are not randomly assorted; if there is some other spike protein mutation that commonly co-occurs with E484K or L452R in Maryland, that mutation could actually be responsible for the associations observed here. 4) Data on patients’ underlying health conditions were not available. 5) In analyses of hospitalization, the outcome was hospitalization within 28 days of infection. The cause of hospitalization was not available; some hospitalizations may not have been caused by SARS-CoV-2 infection. This analysis is the first to examine the association of the E484K and L452R substitutions with SARS-CoV-2 infection and subsequent hosp...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.29.21261006
  168. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.30.21261329
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.30.21261329: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the Human Investigation Review Board of Public Institutional Bioethics Committee designated by the South Korean Ministry of Health and Welfare, which waived the requirement of informed consent due to retrospective study design and anonymity of the HIRA database (IRB # P01-2020-1262-001).<br>Consent: This study was approved by the Human Investigation Review Board of Public Institutional Bioethics Committee designated by the South Korean Ministry of Health and Welfare, which waived the requirement of informed consent due to retrospective study design and anonymity of the HIRA database (IRB # P01-2020-1262-001).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      There are also several limitations of this study. First, there may have been outcome misclassification in cardiovascular outcome (MI, stroke, and TIA), because we defined our cardiovascular outcome variables by diagnostic codes in admirative claim data. HIRA reported that 82% of primary diagnosis codes in claims coincide with electronic medical records,29 so more than 18% of outcome misclassification can occur while trying to capture all the diagnostic codes other than primary diagnosis codes. However, we expect a greater validity for MI, stroke, and TIA since our study population focused on hospitalized patients under careful management. Other outcomes such as all-cause death seem to be well classified because the HIRA COVID-19 database was linked to the national death records and outcomes defined from procedure codes (ICU admission and mechanical ventilation use) are also expected to be valid since the codes are mandatory in the reimbursement review process. Second, statin exposure was defined based on inpatient and outpatient prescription. We are not aware of detailed information on the exposure, for example, adherence to the prescription. Last, although we performed IPTW and thorough sensitivity analyses, due to the inherent limitation of claims data, there might be still a residual confounding by potential unmeasured confounders typically used in clinical studies (e.g., body mass index, baseline blood pressures, laboratory test values). In conclusion, our analysis of a n...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.30.21261329
  169. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.29.21261308
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.29.21261308: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: In brief, the following outcomes were assessed: All the above projects, as well as the overall current study were approved by the SUMC Ethics Committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.29.21261308
  170. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.30.21261288
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.30.21261288: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Design and Setting: This pan-Canadian observational study enrolled consecutive eligible COVID-19 patients who presented to the EDs of 46 participating acute care hospitals between March 1 and December 31, 2020.(17) The research ethics boards of participating institutions reviewed and approved the study protocol with a waiver of informed consent for patient enrollment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">We conducted subgroup analyses on patients with severe COVID, pregnant patients, those reporting unstable housing, and those requiring invasive mechanical ventilation.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We conducted all analyses using Stata (Version 16.1, StataCorp, College Station, Texas).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04702945</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Canadian COVID-19 Emergency Department Registry</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.30.21261288
  171. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.07.30.454436
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.30.454436: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The membranes were incubated overnight at 4°C with anti-ACE2 mouse monoclonal antibody AC18Z (1:2000, Santa Cruz) or anti-β-actin mouse monoclonal antibody (1:5000, Sigma Aldrich)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-β-actin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-mouse IgG peroxidase conjugated (1:5000, Sigma Aldrich) was used as secondary antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-mouse IgG</div><div>suggested: (LSBio (LifeSpan Cat# LS-C69682-5000, RRID:AB_1653096)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FLAG-tagged ACE2 (AdipoGen) was captured on the chip by a previously immobilized anti-FLAG antibody (Merck Life Science S.r.l).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-FLAG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">S protein (Euprotein), its S1 domain and its RBD (SinoBiological), all Fc-tagged, were captured on the same chip by a previously immobilized anti-Fc antibody (Merck Life Science S.r.l).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Fc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FlagACE-2, FcS, FcRBD or FcS1 were then flowed on the corresponding anti-tag antibodies at 30 µg/mL in 10 mM phosphate buffer containing 150 mM NaCl and 0.005% Tween 20 (PBST, pH 7.4), also used as running buffer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-tag</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293-T cells were seeded into 10 cm plates with DMEM containing 0.5 mg/mL geneticin G418 (Thermofisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293-T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell viability: Cells were seeded on 96-well plates (7.5 × 103 Vero cells/well and 2 × 104 HEK293-ACE2 cells/well) in complete DMEM medium with 10% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: RRID:CVCL_ZW93)</div></div><div style="margin-bottom:8px"><div>HEK293-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus: We successfully isolated SARS-CoV-2 in Vero E6 cells from the nasopharyngeal swab of a COVID-19 patient (31).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">: 5′-GCT GGA TCC CCT AAT ATT ACA AAC TTG TGCC-3′; RBD-R: 5′-TGC CTC GAG CTC AAG TGT CTG TGGATC AC-3′) into pGEM T-easy vector (Promega, Madison, WI, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pGEM T-easy</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The ZOE™ images were analyzed with Fiji software (see S1 Appendix).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Surface plasmon resonance: All analyses were done with a ProteOn XPR36 Protein Interaction Array system (Bio-Rad Laboratories, Hercules, CA) surface plasmon resonance (SPR) apparatus with six parallel flow channels that can immobilize up to six ligands on the same sensor chip.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bio-Rad Laboratories</div><div>suggested: (Bio-Rad Laboratories, RRID:SCR_008426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: For statistical analyses were used with software version 7.03/8.0 (GraphPad) including all the data points, with the exception of experiments in which negative and/or positive controls did not give the expected outcome.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.07.30.454436
  172. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.07.30.454437
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.30.454437: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Bright-field microscopy images were taken at 10x magnification from randomly chosen areas of each culture dish.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies and reagents for immunocytochemistry included: ACTC1 (Actin α-sarcomeric mouse mAb clone 5C5 (Sigma)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACTC1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Actin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nucleocapsid clone 1C7 (Bioss Antibodies), ACE2 goat polyclonal Ab (R&D Systems) and ATP2A2/SERCA2 rabbit polyclonal Ab (Cell Signaling).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ATP2A2/SERCA2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The S-proteins were visualized on an immunoblot using the anti-S specific monoclonal antibody 1A9 (GeneTex, GTX632604; 1:2000 dilution) which binds the S2 subunit of SARS CoV and SARS-CoV-2 S-proteins.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GTX632604</div><div>suggested: (GeneTex Cat# GTX632604, RRID:AB_2864418)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An anti-mouse horseradish peroxidase (HRP)-conjugated secondary antibody was used to reveal the bands.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MERS S-protein was detected using a monoclonal anti-FLAG M2-HRP conjugated antibody (SIGMA, A8592 @ 1:2000) which bound to a C-terminal FLAG-tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-FLAG M2-HRP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>FLAG-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The expression of the mEmerald tag was verified using a polyclonal anti-GFP antibody (Abcam, ab290 @ 1:5000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-GFP</div><div>suggested: (Abcam Cat# ab290, RRID:AB_303395)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 infection of hiPSC-CM: SARS-CoV-2/UW-001/Human/2020/Wisconsin (UW-001) was isolated from a mild case in February 2020 and passaged in VeroE6 cells expressing TMPRSS2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus titration: SARS-CoV-2 infectious virus produced by hiPSC-CM was titered by plaque-forming assay done in confluent Vero E6/TMPRSS2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6/TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After initial exposure, the Vero/TMPRSS2 cells were washed three times to remove unbound virus and the media was replaced with 1.0% methylcellulose-media.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero/TMPRSS2</div><div>suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell-cell fusion was followed for 72-hours (for Vero cells) and 5 days for hiPSC-CMS with media and inhibitor refreshed on day-3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fluorescence-activated cell sorting: To determine S-protein cell surface expression levels, HeLa cells (8 × 105 in a 6-well plate) were transfected with the indicated S-protein expression plasmids (2 µg using GeneJuice transfection reagent).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids and mutagenesis: The codon-optimized SARS-CoV2 S-protein gene (YP_009724390) was synthesized by Genewiz in a pUC57-Amp plasmid (kindly provided by M. Barry).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pUC57-Amp</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The S-protein coding sequence was cloned into a pCG mammalian expression plasmid [52] using unique restriction sites BamHI and SpeI.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCG</div><div>suggested: RRID:Addgene_51476)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bioinformatics and data analysis: The quality of the raw RNA-seq data was assessed by fastqp v0.20.1 [44], and quality reads were filtered and aligned against human genome (hg19) using STAR alignment (v2.7.8a) [45] in galaxy platform (https://usegalaxy.org).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_004463)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The aligned reads were counted using htseq-count v0.9.1 [46] and 0.5 read counts per million (CPM) in at least two samples was used as an expression threshold.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>htseq-count</div><div>suggested: (htseq-count, RRID:SCR_011867)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Trimmed mean of M values normalized (TMM) [47] and log2 transformed data was used for plotting heatmaps and differential analysis in limma [48].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>limma</div><div>suggested: (LIMMA, RRID:SCR_010943)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the detection of viral transcripts, quality filtered reads were aligned against SARS-CoV-2 genome (MT039887.1) using BWA-MEM v0.7.17.1 (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA-MEM</div><div>suggested: (Sniffles, RRID:SCR_017619)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alignment summary statistics was computed using samtools idxstats v2.0.3 [49].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The raw RNA-seq data from this study are available at Gene Expression Omnibus with accession number xxxx [to be added].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene Expression Omnibus</div><div>suggested: (Gene Expression Omnibus (GEO, RRID:SCR_005012)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids and mutagenesis: The codon-optimized SARS-CoV2 S-protein gene (YP_009724390) was synthesized by Genewiz in a pUC57-Amp plasmid (kindly provided by M. Barry).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Genewiz</div><div>suggested: (GENEWIZ, RRID:SCR_003177)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ANOVA statistical analysis was carried out using GraphPad Prism software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After three washes with FACS wash buffer, cells were fixed in 4% paraformaldehyde and analyzed with a FACSCalibur (BD Biosciences, San Jose, CA) cytometer and FlowJo software (Tree Star Inc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FACSCalibur</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 34 and 37. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.07.30.454437
  173. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.28.21260814
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.28.21260814: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.28.21260814
  174. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.28.21261219
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.28.21261219: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The model was developed using Vensim (ver 6.4, Ventana Systems Inc.; Harvard, MA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vensim</div><div>suggested: (Vensim, RRID:SCR_016394)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.28.21261219
  175. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.30.21261265
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.30.21261265: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Euthanasia Agents: Alcohol” refers to the twelfth step of the protocol (CONTROLLED AIR), with 5 ml of alcohol added to the chamber at the step 8 (INJECTION) instead of CO2.<br>IRB: This study was approved by the Ethics Committee on Experiments on Human Subjects (approval number of 21005), The University of Electro-communications, located at Chofugaoka 1-5-1, Chofu, Tokyo, Japan.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data availability The raw data of the graphs are available on FigShare.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FigShare</div><div>suggested: (FigShare, RRID:SCR_004328)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.30.21261265
  176. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.07.30.454529
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.30.454529: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differential expression analysis, meta-analysis and visualization of multiple gene expression data sets from microarray and bulk RNAseq: Read counts were transformed (log2 count per million or CPM) and differentially expressed genes (DEGs) between groups were identified through the webtool NetworkAnalyst 3.0114 using limma-voom pipeline115.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NetworkAnalyst</div><div>suggested: (NetworkAnalyst, RRID:SCR_016909)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Shared DEGs among all datasets were displayed using Venn diagram116 and Circos Plot117 online tools.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Circos</div><div>suggested: (Circos, RRID:SCR_011798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We followed the Seurat pipeline118 as previously described by Stuart et al.119 to perform differential expression analysis and data visualization, i.e., UMAP, dotplot, and heatmap construction.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Seurat</div><div>suggested: (SEURAT, RRID:SCR_007322)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, the resultant network was annotated, analysed, and visualized using NAViGaTOR 3.0.14120</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NAViGaTOR</div><div>suggested: (TMA Navigator, RRID:SCR_005599)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Enrichment analysis and data visualization: We used ClusterProfiler122 R package to obtain dot plots of enriched signaling pathways.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ClusterProfiler122</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Elsevier Pathway Collection analysis for selected gene lists (7 genes underlying fHLH/IEI and 11 genes associated with severe COVID-19) was carried out using Enrichr webtool123–125.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Enrichr</div><div>suggested: (Enrichr, RRID:SCR_001575)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Circular heatmaps were generated using R version 4.0.5 (The R Project for Statistical Computing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>R Project for Statistical</div><div>suggested: (R Project for Statistical Computing, RRID:SCR_001905)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RStudio. https://www.rstudio.com/) using the circlize R package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.rstudio.com/</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div><div style="margin-bottom:8px"><div>circlize</div><div>suggested: (circlize, RRID:SCR_002141)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We trained a Random Forest model using the functionalities of the R package randomForest (version 4.6.14)79.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>randomForest</div><div>suggested: (RandomForest Package in R, RRID:SCR_015718)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differences in protein expression between COVID-19_ICU and COVID-19_nonICU was calculated using the nonparametric MANOVA (multivariate analysis of variance) test129 followed by analysis of nonparametric Inference for Multivariate Data130 using the R packages npmv, nparcomp, and ggplot2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.07.30.454529
  177. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.30.21260912
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.30.21260912: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      There are limitations to our analysis, notably uncertainties over parameter estimates. There is limited evidence on both serology and PCR test sensitivities for asymptomatic infections, and how these change over time since infection. As we show, differences in test sensitivity by symptom status can lead to overestimation of VEin, so further studies are needed to clarify the potential role of this bias. We also did not consider the vaccines’ effects on viral load and how this alters virological and serological test sensitivity. Multiple COVID-19 vaccines have been shown to reduce SARS-CoV-2 viral load (33,34), and lower load infections are less likely to lead to seroconversion (35). Therefore serology-based efficacy estimates may be more representative of high viral load infections than all infections. They may be comparable to estimates based on DNA sequenced swabs, as these samples must exceed a threshold viral load to be sequenced. Finally, we do not consider the use of point prevalence estimates from single time point PCR swabs, however this has been explored elsewhere (11,12). In conclusion, multiple biases have the potential to influence the COVID-19 vaccine efficacy estimates, with their direction and magnitude dependent on the vaccine properties and testing strategies. These biases may explain differences between the ChAdOx1 and Ad26.COV2.S trial reported estimates despite similar vaccine platform technologies, and should be considered when interpreting both efficacy a...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.30.21260912
  178. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.30.21261220
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.30.21261220: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The study was approved by the Institutional Evaluation Committee of the Austral Hospital registered in the Office of Human Research Protections IORG0006075, IRB00007319 – Universidad Austral IRB and in the Buenos Aires Province Central Ethic Committee.<br>Consent: Informed consent was obtained verbally owing to the contagiousness of the disease and for cases in which it could not be obtained it was waived as it is a low risk study and all data were analyzed anonymously.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">No sample size calculation was performed; the sample size was established by the time window of the study.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were performed with the use of R software (R Project for Statistical Computing; R Foundation).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>R Project for Statistical</div><div>suggested: (R Project for Statistical Computing, RRID:SCR_001905)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.30.21261220
  179. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.28.21261252
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.28.21261252: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical approval for the study was granted by Swansea University’s School of Management and College for Human and Health Sciences research ethics committees and all participants gave informed consent and had their data anonymized.<br>Consent: Ethical approval for the study was granted by Swansea University’s School of Management and College for Human and Health Sciences research ethics committees and all participants gave informed consent and had their data anonymized.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">14 Coding was performed using NVivo (version 11.4.3, QRS).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NVivo</div><div>suggested: (NVivo, RRID:SCR_014802)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations of this study: Strengths and limitations of the overall study have been discussed in previous publications.11,12 As with all qualitative studies, the generalizability of the findings is limited. As such, the strength of the study lies in its ability to reveal the complexity of the reasoning behind the extent to which people are supportive of COVID-19 vaccines in children, rather than in deriving proportions or gauging public sentiment overall. Additionally, due to the rapid nature of the call for participation from the participant pool, the sample size was slightly smaller than in previous rounds of data collection – although the total sample was deemed sufficient for the purposes of the analysis.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.28.21261252
  180. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.29.21261260
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.29.21261260: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the institutional review board of MGB with waiver of informed consent from study participants for secondary use of EHR data.<br>Consent: This study was approved by the institutional review board of MGB with waiver of informed consent from study participants for secondary use of EHR data.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">With each lexicon revision, we evaluated the performance of NLP for its ability to identify symptoms from a random set of clinical notes in the development dataset.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations: The symptom lexicon was developed using data from a multi-institution, U.S.-based health care system using a single EHR. Documentation patterns, preferred terminology, and local dialect may differ by geographic location, health system, and EHR vendor. This might impact symptom prevalence or lead to missed symptoms common in other populations. However, the large cohort sample size, and similarities of our findings to those from meta-analyses of prospective and retrospective studies in clinically and geographically distinct populations, supports the external validity and generalizability of this work. Future studies might be needed to replicate the symptom lexicon development pipeline in other EHR systems. Lexicon development was further enriched by manual review to minimize false positive and false negative symptom terminology in the EHR context and to enhance clinical relevance by term consolidation. Several limitations are inherent in use of EHR data to study post-acute COVID-19 symptoms. First, our study is limited to patients with clinical follow-up in the healthcare system. Patients may have sought out-of-system care post-COVID-19 infection; these patients’ symptoms would not be captured in our lexicon. However, travel advisories during COVID-19 may have limited the ability of patients to seek out of system (or out of state) care, improving our ability to capture encounters in the post-COVID-19 period. Second, the EHR reflects routine care, and therefore, sym...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.29.21261260
  181. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.29.21261321
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.29.21261321: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by Western Sydney Local Health District Human Research Ethics Committee (Project number 2020/ETH03085).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis plan: Descriptive statistics were used to summarise demographic characteristics and information sources in SPSS Version 25.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.29.21261321
  182. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.29.21261312
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.29.21261312: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-His (Millipore), anti-GST (Sigma), and anti-BSA (Sangon Biotech) antibodies were used for quality control of the SARS-CoV-2 proteome microarray.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-His</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-GST</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-BSA ( Sangon Biotech )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The arrays were washed with 1× PBST, and the bound antibodies were monitored by incubating with Cy3-conjugated goat anti-human IgG and Alexa Fluor 647-conjugated donkey anti-human IgM (Jackson ImmunoResearch, PA) diluted 1:1,000 in 1× PBST at room temperature for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Bio-Rad Cat# MCA647F, RRID:AB_808612)</div></div><div style="margin-bottom:8px"><div>anti-human IgM</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The optimized genes were synthesized and cloned into pET32a or pGEX-4T-1 by Sangon Biotech (Shanghai)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET32a</div><div>suggested: RRID:Addgene_62310)</div></div><div style="margin-bottom:8px"><div>pGEX-4T-1</div><div>suggested: RRID:Addgene_113505)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pheatmap (1.0.12) and ggplot2 (3.3.2) carry out plotting.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pheatmap</div><div>suggested: (pheatmap, RRID:SCR_016418)</div></div><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Nonetheless, there are some limitations for COVID-ONE humoral immunity. For example, it lacks data for convalescent patients, peptide-level humoral responses to proteins other than S protein, and multicentre samples. In the future, we will assay the dynamic responses of SARS-CoV-2-specific antibodies using ∼500 serum samples from ∼100 COVID-19 convalescent patients. We will also integrate published peptide microarray/phage display-related data[15-17, 30] and attempt to update the database covering the whole SARS-CoV-2 proteome at the peptide or amino acid level. In addition, the SARS-CoV-2 protein microarray has already been promoted by CDI Labs (www.cdi.bio) and ArrayJet (www.arrayjet.co.uk), and we anticipate more diverse data for SARS-CoV-2-specific antibody responses from multicentre samples. We strongly believe that by sharing a large dataset and facilitating data analysis, COVID-19 humoral immune is a valuable resource for COVID-19 research.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.29.21261312
  183. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.30.21261351
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.30.21261351: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical approval was gotten from the health research ethics committee of the Federal Medical Centre Gusau, Zamfara State.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data was analyzed using SPSS version 21.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations: Findings may be influenced by selection bias because respondents needed access to a smartphone or computer. This may have excluded the poor, elderly who are most vulnerable to COVID-19 this may limit external validity and may have distorted estimation of those willing to take the vaccine.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.30.21261351
  184. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.29.21261306
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.29.21261306: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: 14 The protocol for the CORoNa Work Project was approved by the Ethics Committee of the University of Occupational and Environmental Health, Japan.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were conducted using Stata/IC 14.0 (StataCorp, College Station, TX, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This study has several limitations. First, this study used a data set obtained from an online survey. Considering that the survey respondents were individuals who had access to the Internet and were interested in the survey, the results cannot be generalized. 23 Second, this study did not examine changes in the actual amount of time spent on housework and childcare because the questionnaire did not request that information. Third, the data did not contain detailed information about the respondents’ home situations. For example, it may be useful to examine the impact availability of close relatives, other family background information, and school status on changes in housework and childcare. Fourth, the survey did not obtain information about the employment status of a partner, which may impact housework and childcare. In conclusion, regardless of occupation, job type, and the number of employees in the workplace, the time spent by women on housework and childcare increased significantly compared to men, suggesting that the burden on women may be increasing during the COVID-19 pandemic.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.29.21261306
  185. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.29.21261324
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.29.21261324: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Therefore, we randomly selected one of the seropositive persons in the household as the first infected; then we repeated this 1000 times to obtain the relative risk, its confidence interval, and its p-value.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This study has several limitations. For practical reasons, we were not able to do a population-based sampling to estimate seroprevalence; instead, we targeted the families of TBAs and CHWs as well as patients and caretakers at health centres. This population is potentially different from the camp population, both in terms of exposure to the virus and access to care. However, this population originates from all geographical areas of the camp and includes all ages. The refusal rate was low among patients and caretakers, decreasing the potential risk of selection bias. Among family members of CHW and TBA, none who came to the study site declined to participate, but only 55% participated, which could potentially introduce bias. As the assessment of symptoms was based on participant recall over a one-year period, recall bias may have occurred; however, participants reported symptoms before they knew their test result and a significant difference was detected between seropositive and seronegative individuals. Due to logistical and time constraints, only rapid tests were used. Rapid tests have less accuracy than laboratory tests such as ELISA. Nevertheless, the BIOSYNEX test showed good performance in studies conducted on subjects infected a few weeks before (4). Certain types of antibodies decay over time (11), hence the sensitivity of the test may be affected. Cross-reactivity of the test that was used is possible; however, in a study conducted on a pre-pandemic sample from the Ce...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.29.21261324
  186. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.29.21261196
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.29.21261196: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Recruitment: Ethical approval was received from the University of Nottingham Faculty of Health Sciences Research Ethics Committee (FMHS 96-0920).<br>Consent: Procedures: Participants provided informed consent online before completing the online survey (JISC Online Surveys).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using STATA (Version 16) and GraphPad Prism (Version 7).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      (Barton & Pretty, 2010; Dubad et al., 2018; Grajfoner et al., 2017; Habak et al., 2020) Limitations: Despite the several strengths of this study such as longitudinal design and relatively large cohort, we acknowledge several limitations. First, the observational nature of the study means we cannot assume causal relationships between mental health outcomes and the impact of the COVID-19 pandemic. Second, nearly half (47%) of the original cohort were lost to follow-up. Although those who were lost to follow-up and completed all three surveys did not differ on most of the sociodemographic and baseline mental health measures, with the exception of anxiety. Although unlikely, it is possible that by excluding right censored data, our results overrepresented those with higher baseline anxiety. Third, our participants were self-selected and from a single institution in England with predominant proportion of undergraduate students and higher proportion of women than reported by Higher Education Policy Institute, (Higher Education Policy Institute) which also limits the generalisability of our findings. Nevertheless, our study showed the profound mental health difficulties university students experienced during the COVID-19 pandemic and point to potential avenues for psychological intervention (i.e., interventions addressing loneliness and positive mood).

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.29.21261196
  187. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.29.21261317
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.29.21261317: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.29.21261317
  188. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.29.21261190
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.29.21261190: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics approval was obtained from Scotland A Research Ethics Committee (responsible for studies requiring approval under the Adults with Incapacity [Scotland] Act, 2000 - 20/SS/0059).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Abnormal values were defined for NT-proBNP (>300ng/ml) and Troponin (TnT ≥15 ng/L or TnI ≥34 ng/L for males; ≥16 ng/L for females).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Power: Sample size selection was, by necessity, a pragmatic balance of maximising available information versus the prompt delivery of the study.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data: Study data were collected and managed using REDCap electronic data capture tools hosted by the University of Glasgow.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04764032</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Right Ventricular Dysfunction in Ventilated Patients With CO…</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.29.21261190
  189. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.28.21261304
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.28.21261304: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study protocol was approved by the MGB Institutional Review Board.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      In designing follow-up work, several limitations of this study should be considered. The non-randomized design of this study, although necessary given the high level of need of the sample, limits the inferences that can be made from these findings. Also, enrollment was likely affected by the fact that these healthcare employees were being flooded daily with lengthy emails regarding COVID-19-related information and supports, some of which included information about this study. This “information overload”, and the other multiple new demands associated with the crisis, may have also interfered with the capacity of participants to both view the videos and complete all three assessments. In summary, this study provides preliminary evidence for the efficacy of a brief online intervention for improving resilience and decreasing emotional distress in healthcare workers during the COVID-19 pandemic. Because some healthcare workers will likely need ongoing, additional support after the pandemic has subsided, resilience-enhancing interventions that are tailored to meet the needs of this population at subsequent points in time should also be developed and implemented.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.28.21261304
  190. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.28.21261200
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.28.21261200: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Their results agree with ours but it has the limitation of not guaranteeing that the mean period with single-dose protection is preserved in a varying vaccination rate, which is only possible using a more complex formulation, such as delay differential equations as used here. They also argue that, while the “release” strategy enables better allocation of vaccines, in a real-world situation the implementation of such strategy is too complicated to manage. While we agree that this strategy adds a complication factor, we also believe that stock optimization models such as the one developed in this study could be linked to vaccination databases and, as the vaccination roll-outs to tackle the SARS-CoV-2 pandemic were centralized by the national health systems, thus allowing more efficient allocation of vaccines. Throughout this study, we assumed that post second-dose efficacies do not depend on the time-window between doses, although evidence suggests that this is not the case for AZD1222 vaccine [36]. This simplifying assumption probably leads to a slight underestimation of the benefits of increasing the lag between doses for this vaccine. We have also assumed that first dose efficacy is constant over time, when in reality it builds up over approximately 2 weeks and wanes later on [27, 33]. This can be addressed using agent-based models [22], or age-of-infection models in a differential equations formulation, but that would greatly increase the complexity of the algorithm. This d...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.28.21261200
  191. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.28.21261276
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.28.21261276: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was deemed exempt from review by Mass General Brigham’s institutional review board.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Given the gravity of the opioid crisis in the United States, these limitations affect all analyses which utilize fatal opioid overdose data and highlight the need to collectively improve data collection and reporting infrastructure.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.28.21261276
  192. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.28.21261295
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.28.21261295: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Ethical approval: Written informed consent was obtained from study participants of the multi-centre study approved by National Healthcare Group Domain Specific Review Board (NHG-DSRB) (Study Reference 2012/00917).<br>IRB: Ethical approval: Written informed consent was obtained from study participants of the multi-centre study approved by National Healthcare Group Domain Specific Review Board (NHG-DSRB) (Study Reference 2012/00917).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">For serial Ct values, we fitted a generalized additive mixed model (GAMM) with a random intercept by patient.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">cPass™ detects total neutralizing antibodies targeting the viral spike protein receptor-binding domain [18].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>viral spike protein receptor-binding domain [ 18</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As part of active genomic surveillance, whole genome sequencing (WGS) by National Public Health Laboratory is performed for all patients in Singapore with SARS-CoV-2 detected by RT-PCR with a Ct value less than 30.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>WGS</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analyses were performed using Stata Release 15 (StataCorp, College Station, TX) and R version 3.6.2 (R Foundation for Statistical Computing, Vienna, Austria).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Ethical approval: Written informed consent was obtained from study participants of the multi-centre study approved by National Healthcare Group Domain Specific Review Board (NHG-DSRB) (Study Reference 2012/00917).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>National Healthcare</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      There are several limitations to our study. Firstly, we only compared vaccine-breakthrough infections with unvaccinated COVID-19 patients. We did not study vaccinated individuals who had similar exposure risk but did not develop COVID-19 infection. We thus could not evaluate vaccine efficacy against asymptomatic infection. We also did not have detailed epidemiologic data to study the effect of vaccination on preventing secondary transmission. Secondly, we could only obtain serologic tests after infection since patients were recruited after confirmation of infection. While active contact tracing and case finding in Singapore resulted in early identification of most COVID-19 cases, the first available serologic result was at a median of 2 (IQR:1-3) days of illness and antibody levels are likely to already have been boosted by natural infection. We thus could not evaluate the underlying immunologic mechanisms behind vaccine-breakthrough infection, e.g., diminished neutralizing antibody level or impaired cellular immunity. Further study should compare similarly exposed vaccinated individuals who develop breakthrough infection with those who do not, to elucidate the underlying drivers of susceptibility, which may enlighten us on how to optimize protection (e.g., through enhanced/boosted dosing schedules). Thirdly, PCR testing was not standardized in a centralized laboratory, and instead conducted at each centre using different validated commercial assays. Ct values are only a surr...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/content/10.1101/2021.07.28.21261295v1
  193. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.28.21261286
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.28.21261286: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.28.21261286
  194. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.28.21261283
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.28.21261283: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: (15) This study was approved by the research ethics boards of all participating institutions with a waiver of informed consent for enrolment.<br>Consent: (15) This study was approved by the research ethics boards of all participating institutions with a waiver of informed consent for enrolment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Model development and validation: We randomly assigned participating sites to derivation or validation, with the goal of assigning 75% of eligible patients and outcome events to derivation, and the remaining to validation.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">We evaluated the inter-rater agreement of key predictor variables by comparing data collected retrospectively with prospective data.(15) The clinical prediction score was developed after all chart abstractions were complete; research assistants were thus unaware of which clinical variables would be candidate predictor variables.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Model development and validation: We randomly assigned participating sites to derivation or validation, with the goal of assigning 75% of eligible patients and outcome events to derivation, and the remaining to validation.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data collection: Trained research assistants abstracted data from electronic and paper-based medical records into a central, web-based REDCap database (Vanderbilt University; Nashville, TN, USA), and captured demographics, vital signs, symptoms, and comorbidities, COVID-19 exposure risk, diagnostic test results, and patient outcomes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04702945</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Canadian COVID-19 Emergency Department Registry</td></tr></table>

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.28.21261283
  195. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.31.21261387
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.31.21261387: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.31.21261387
  196. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.23.21260984
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.23.21260984: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The DES model and simulation experiments were programmed using Matlab version R2020a.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Matlab</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This study was not free of limitations. First, the process model aligned with field observations for several sites and was validated by focus groups with those same sites. Hospitals may choose to implement mAb infusions in a different setting. Second, simulations relied on several assumptions for service times, nurse-to-patient ratio in infusion area, and arrival patterns under different scheduling protocols. Differences in these assumptions could impact simulation results. Third, despite considering the majority of the practical scenarios, the web-based decision-support tool is not exhaustive of all possible cases. Accordingly, users will not always be able to select the exact model input values corresponding to the scenario(s) they desire to investigate. Finally, in addition to IV infusions, mAb treatments have also now been approved as subcutaneous injections, which were not the focus of our study.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.23.21260984
  197. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.07.29.454404
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.29.454404: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.07.29.454404
  198. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.27.21261226
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.27.21261226: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Some limitations of this study should be kept in mind. Our empirical analysis takes the reported number of cases across European countries at face value. While we accounted for reporting delays, we disregarded any issues related to changes in reporting or testing that may affect the estimation of Rt. While the flexible method proposed by Abbott et al. (2020) renders any bias induced by a change of testing transient, any bias may have indeed changed the true value at which Rt crosses one. A more extensive analysis would look at all countries that experienced a second wave. However, we chose to limit ourselves to European countries because of the comparatively good reporting standards and the fact that there is sufficiently large heterogeneity in epidemic trajectories across European countries for the purposes of this study. On a similar note, because the time period between the end of the first and the beginning of the second wave was shorter than the time period it takes the system to settle at its new stable equilibrium after the first wave recedes in virtually all countries, we expect our findings to generalize well to non-European countries. We used an admittedly conservative criterion for date stamping the end of the first wave and the start of the second one to reduce the extent of the transient period we incorporate for indicator estimation. In particular, we chose the day at which Rt reaches its lowest value as starting point for the computation of early warning indica...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.27.21261226
  199. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.29.21261282
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.29.21261282: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.29.21261282
  200. www.medrxiv.org www.medrxiv.org
    https://medrxiv.org/cgi/content/10.1101/2021.07.24.21260660
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.24.21260660: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      In spite of supply constraints during the early days of the pandemic, Hi-Fi masks are now available without supply limitations such as N95 respirators and elastomeric N95 respirators (eN95) [31] [32] [35] [36] [37]. Beyond COVID-19 and Wildfires: COVID-19 will not be the last nor worst-case respiratory virus with pandemic potential. Global pandemics from novel viruses may be accelerating. We saw Ebola in 2014, Zika in 2016, and Coronavirus in 2019. There are over 180 human viruses besides Covid-19, and on average two new species are added every year [16]. Some 94% of these are RNA viruses. RNA viruses are prone to rapid mutations because they lack a proofreading mechanism, and have rapid replication [17]. For example, could a lab turn measles-like dog virus (∼50% fatal) into a human virus? Consider a dog virus called Canine Distemper Virus (CDV) [18] which acts by first attacking the immune system (via SLAMF1=CD150) then attacks the nervous system (via PVRL4). In vitro, gain of function studies suggest this canine virus may be just 2-3 mutations away from infecting humans [19]. Mutations in viruses are routinely synthesized artificially as part of COVID-19 vaccine research in laboratories across the world [20]. Aerosolized threats from bacteria dispersal [21] motivated the development of a national sensor network called Biowatch [22]. The idea of a lightweight respirator to secure against biological attacks that requires low inhalation pressures, is comfortable to wear for pr...

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    medrxiv.org/cgi/content/10.1101/2021.07.24.21260660
  201. www.biorxiv.org www.biorxiv.org
    https://biorxiv.org/cgi/content/10.1101/2021.07.30.454406
    1
    1. sciscore 04 Aug 2021

      SciScore for 10.1101/2021.07.30.454406: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Prediction of PROVEAN Score: To understand the effect of amino acid variations on the function of Nsp13, PROVEAN (Protein Variation effect Analyzer) tool was used [25].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PROVEAN</div><div>suggested: (PROVEAN, RRID:SCR_002182)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Moreover, the Discontinuous Bcell epitopes were also predicted using Disco tope 2.0 webserver tool [30] at a threshold value of −6.6 followed by representing the identified epitopes in the three-dimensional structure of Nsp13 protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Disco</div><div>suggested: (DISCO, RRID:SCR_004586)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.

      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    Visit annotations in context

    Annotators

    URL

    biorxiv.org/cgi/content/10.1101/2021.07.30.454406